Investigating the function and expression profile of Snail2 in vascular development

and maturation

Benjamin Maas 21/02/2015

Applied Science AS3 VKL VWO

Investigating the function and expression profile of Snail2 in vascular development and maturation

Forming a loss of function through creation of a CRISPR mutant zebrafish Benjamin Maas, Anne Lagendijk, Sungmin Baek, Ben Hogan University of Queensland, Institute for molecular Bioscience, Genomics of Development and Disease Division, Australia, Brisbane St. Lucia, QLD 4072

08/09/2014 – 02/03/2015

i

Summary The development of the vascular system plays an important role in the body starting during embryogenesis and continuing on through life. The development of the vascular system relies on a complex network of signalling pathways combined with the fine-tuned activity of transcriptional factors. The precise function and expression profile of many transcription factors remain largely unknown. In this research the function and expression profile of the transcription factor snail2 during vascular development are investigated. A loss-of-function model of the Danio Rerio (zebrafish) is developed using the CRISPR/Cas9 genome-editing tool. Three different single guide RNAs (sgRNAs) were designed for the CRISPR/Cas9 technology. sgRNA1, sgRNA2, and sgRNA3 were designed, synthesized and co-injected with the Cas9 endonuclease in three separate batches, creating the F0 generation of three families. Co-injection of these two components into the single-cell stage of zebrafish resulted in site-specific cleavage by Cas9, and non-homologous end joining (NHEJ) DNA repair, leading to mutations. The efficiency of cleavage by the sgRNA guided Cas9 on the target sites were tested on all three batches by a high resolution melting assay (HRMA). Transgenic (Tg) lines of zebrafish, in which cells specific to the blood vasculature were tagged with a fluorescent marker, were used to display the vascular development during embryogenesis. These Tg zebrafish lines were created using a technique called bacterial artificial chromosome (BAC) recombineering. The transgenic lines were used for the injections. The injected embryos from the notch:GFP Tg line (F0) were grown to adulthood were tested and outcrossed with wild type zebrafish to investigate the germline transmission. Genotyping showed a frameshift caused by a 7 bp deletion which led to a premature stopcodon early in the second exon of the snai2 gene. The premature stopcodon resulted in the loss of the Zinc-finger DNA binding domain of Snail2. Genotyping of embryos of the outcrosses showed that different mutations can occur in embryos of one outcross between a CRISPR mutant and a wild type zebrafish. This leads to the implication that a mutation created in the single-cell stage of an embryo does not mean that the complete germline carries the same mutation, implying that DNA cleavage and repair do not occur in the same single-cell stage of the embryo, leading to different mutations in different cells. Cleavage by both sgRNA1 and sgRNA2 have been demonstrated by an agarose gel analysis, impliying the loss of a large DNA fragment. This would mean that large DNA fragments could be deleted when different CRISPR complexes cleave at the same time. In conclusion this research shows that a premature stopcodon can be introduced early in the second exon of the snai2 gene, before the DNA binding domain encoding sequence. This gives rise to the conclusion that the loss of function of snai2 can be induced by the generation of a CRISPR mutant. Also is proven that a stabile transgenic line can be constructed for the targeting of a specific gene using BAC recombineering.

ii

Samenvatting De ontwikkeling van het vaatstelsel speelt een belangrijke rol in het lichaam tijdens embryogenese en gedurende het leven. De ontwikkeling van het vaatstelsel is gebaseerd op een ingewikkeld netwerk van signaling pathways in combinatie met een nauwkeurig afgestelde activiteit van transcriptie factoren. De exacte functie en het expressie patroon voor vele transcriptie factoren zijn nog steeds grotendeels onbekend. In dit onderzoek worden het expressie patroon en de functie van Snail2 onderzocht. Een loss-of-function model gebaseerd op Snail2 van de Danio Rerio (zebravis) is ontwikkeld aan de hand van de CRISPR/Cas9 genome-editing tool. Drie verschillende single guide RNAs (sgRNAs) werden ontworpen voor de CRISPR/Cas9 technologie. sgRNA1, sgRNA2, en sgRNA3 werden ontworpen, gemaakt en geïnjecteerd met Cas9 endonuclease in drie verschillende injectieronden, hiermee werd de F0 generatie van drie verschillende families opgegroeid. Co-injectie van deze twee componenten in het eencellig stadium van de zebravis resulteerde in een sequentie-specifieke dubbelstrengs breuk, en non-homologous end joining (NHEJ) DNA reparatie, wat leidde tot mutaties in het genomisch DNA. De efficiëntie van het sequentie-specifieke knippen van de drie verschillende CRISPR complexen werd getest aan de hand van een high resolution melting assay (HRMA). Transgene (Tg) lijnen van zebravissen, waarin cellen die specifiek zijn voor het bloedvatenstelsel werden gelabeld met een fluorescent marker, werden gebruikt om de vasculaire ontwikkeling visueel te weergeven tijdens de embryogenese van een zebravis. Deze Tg zebravis lijnen werden gecreëerd aan de hand van een techniek genaamd bacterial artificial chromosome (BAC) recombineering. Deze transgene lijnen werden gebruikt voor de injecties. De geïnjecteerde embryo’s van de notch:GFP Tg lijn (F0) werden opgegroeid en gekruist met wild type zebravissen om te achterhalen welke zebravissen de mutatie droegen in hun geslachtscellen. Analyse van het genotype van embryo’s van deze kruising (F1) lieten een 7 bp deletie zien die leidde tot een premature stopcodon vroeg in het tweede exon van het snai2 gen. Dit premature stopcodon resulteerde in het verlies van het Zinc-finger DNA bindings domein van Snail2. Analyse van het genotype van mutanten laat zien dat het mogelijk is dat F1 generatie embryo’s, van een kruising tussen een F0 geïnjecteerde CRISPR mutant en een wild type zebravis, verschillende mutaties dragen. Dit leidt tot de implicatie dat een mutatie gecreëerd in het eencellige stadium van een embryo niet betekend dat alle geslachtscellen dezelfde mutatie zullen dragen. Dit zou kunnen betekenen dat het knippen van het DNA en de reparatie ervan niet in hetzelfde eencellige stadium plaatsvinden, wat kan leiden tot verschillende mutaties in verschillende cellen. Aan de hand van een agarose gel analyse is gedemonstreerd dat het knippen van zowel sgRNA1 en sgRNA2 kan leiden tot de deletie van het DNA fragment tussen de twee dubbelstrengs breuken gecreëerd door de CRISPR complexen. Dit betekend dat grote DNA fragmenten uit genomisch DNA kunnen worden geknipt aan de hand van verschillende sequentie-specifieke CRISPR complexen. In conclusie laat dit onderzoek zien dat er een premature stopcodon kan worden geïntroduceerd vroeg in het tweede exon van het snai2 gen, voor de coderende sequentie voor het DNA bindings domein van Snail2. Op basis hiervan wordt geconcludeerd dat er een loss-of-function van snai2 kan worden geïnduceerd aan de hand van de generatie van een CRISPR mutant. Ook is er bewezen dat er een stabiele transgene lijn voor een specifiek gen kan worden ontwikkeld aan de hand van BAC recombineering.

iii

Acknowledgements First of all I would like to thank Ben Hogan for giving me the opportunity to work in his lab and working on a very interesting project. I would also like to thank Anne Lagendijk, my supervisor during my period at the IMB, for the great supervision on my project. Giving me responsibility and at the same time helping me in the right direction gave me the chance to work on many competences and improve on several skills. I would like to thank Sungmin Baek for helping me with the synthesis of poper single-guide RNAs for my injections, and Scott Patterson for his help on BAC recombineering. Finally I would like to thank all the people that contributed to a pleasant, and fun working environment, that made my stay at the IMB an unforgettable experience.

iv

Table of Contents

Summary.............................................................................................................................................. ii Samenvatting .................................................................................................................................... iii Acknowledgements ........................................................................................................................ iv 1. Introduction ............................................................................................................................... 1

1.1 General introduction .............................................................................................................................. 1 1.2 Plan ................................................................................................................................................................. 2 1.3 Theoretical background ....................................................................................................................... 3

1.3.1 Genome editing ........................................................................................................................ 3 1.3.2 The role of the Snail2 protein ............................................................................................ 4 1.3.3 Angiogenesis ............................................................................................................................. 7 1.3.4 Perivascular cells .................................................................................................................... 8

2 Materials and Methods ............................................................................................................ 9 2.1 Transgenic lines by BAC recombineering ..................................................................................... 9

2.1.1 Use of transgenic lines .............................................................................................................. 9 2.1.2 Plasmids and Strains ............................................................................................................... 10 2.1.3 Clone conformation ................................................................................................................. 11 2.1.4 pRedET transformation ......................................................................................................... 11 2.1.5 iTol2 insert .................................................................................................................................. 12 2.1.6 second targeting insert .......................................................................................................... 12

2.2 CRISPR/Cas9 technology .................................................................................................................... 13 2.2.1 Approach ................................................................................................................................. 13 2.2.2 Target site selection ............................................................................................................ 14 2.2.3 sgRNA generation and transcription ........................................................................... 15 2.2.4 Tg Zebrafisch lines and microinjection ....................................................................... 16 2.2.5 Control efficiency CRISPR complexes .......................................................................... 16 2.2.6 Identification founder fish ............................................................................................... 18 2.2.7 Generation F1 family ........................................................................................................... 19

3 Results.............................................................................................................................................20 3.1 BAC recombineering ................................................................................................................................. 20

3.1.1 Insert confirmation ................................................................................................................. 20 3.2 CRISPR/Cas9 technology ........................................................................................................................ 20

3.2.1 syntheses sgRNA1, 2 and 3 .................................................................................................. 20 3.2.2 Efficiency assays ....................................................................................................................... 22 3.2.3 Identification founder fish .................................................................................................... 25

4 Discussion ..................................................................................................................................33 4.1 BAC recombineering ............................................................................................................................. 33 4.2 CRISPR mutants ...................................................................................................................................... 33

5 Conclusions ...............................................................................................................................34 6 Recommendations ..................................................................................................................34 7 Self reflection ............................................................................................................................35 8 References .................................................................................................................................36 Attachement I: Transgenesis by BAC selection ...................................................................... A Attachement II: CRISPR/Cas9 technology ................................................................................ I Attachement III: High Resolution Melting Assay................................................................... L

v

1. Introduction

1.1 General introduction The investigation of how blood and lymphatic vessels form from pre-existing vessels, called angiogenesis, describes the research being done at the Department of Genomics of Development and Disease within the Institute for Molecular Bioscience (IMB). Development of the lymphatic and vascular system during embryonic development is very important for proper functioning of the human body. An enclosed circulatory system of blood vessels is formed as the vascular system develops. This way blood can bring oxygen and to the individual organs while waste products as CO2 and catabolites can be drained. Alongside the blood vasculature, lymphatic vessels are formed in which lymph transports fluids and immune competent cells that have left the blood vessels. Unlike the vascular system, the lymphatic system transports lymph only in one direction, towards the heart. Both vascular systems comprise of endothelial cells, which form the interior.

Snail2, a protein encoded by the snai2 gene, is expressed in cells associated to the endothelial cells, potentially perivascular cells (Hogan lab, unpublished data). Perivascular cells will be explained in section 1.3.4. To investigate the function of Snail2, a knockout of the snai2 gene will be created resulting in the Snail2 protein not being expressed. This way a clear biological model of the loss of function of Snail2 will be created to investigate the role of Snail2 during angiogenesis.

The zebrafish (Danio Rerio) model system offers a unique combination of imaging techniques, embryonic and genetic tools to study developmental processes and will therefore be used in this study. A knockout of the snai2 gene will be generated using the CRISPR/Cas9 technology. CRISPR stands for Clustered Regulated Interspaced Short Palindromic Repeat and Cas9 is an endonuclease. The general aim of this project is to create a loss of function allele of the snai2 gene. By using the CRISPR/Cas9 genome editing tool the aim is to ‘switch off’ the gene of interest by causing a frame shift in the coding sequence for Snail2, preferably resulting in a premature stop codon. A snai2 knockout model will be generated which will allow us to study the vascular development in the absence of functional Snail2 protein.

1

1.2 Plan

Using the CRISPR/Cas9 technology, the design and syntheses of a specific single stranded guide RNA (sgRNA) is required. This sgRNA will, in combination with the Cas9 endonuclease enzyme, cause double stranded breaks in the genomic region of interest. To increase the efficiency of the CRISPR/Cas9 technology 3 different gene specific sgRNAs, targeted to the same gene of interest, will be designed and synthesized increasing chances of causing a frameshift within the snai2 gene. The CRISPR/Cas9 technique will be further explained in attachement II.

To validate the occurrence of InDel mutations (explained in attachement III) a High Resolution Melting Assay (HRMA) will be performed. This biological assay is used to confirm that there is an InDel mutation generated in the snai2 gene. The InDel variants prove that the designed single-guide RNAs attach to the targeted sequence in the snai2 gene and efficient cleavage by Cas9 takes place at that site. The procedure of this assay will be explained in attachement III.

Once the CRISPR/Cas9 technique is validated, a large number of zebrafish embryos will be injected with the mixture of Cas9 protein and sgRNAs and a minimum of 100 embryos will be raised to adulthood.

When the embryos are grown until adulthood, which takes up to two to three months, the fish will be screened for germline transmission of snai2 mutations. These fish are referred to as mutant founders. This identification will be done by crossing the adult zebrafish of the injected embryos with wild type zebrafish. The mutation can only be inherited by the offspring if the mutation of a specific injected embryo was transmitted to the germ cells (germline transmission). To determine if the offspring carries snai2 mutations in its genome, another HRMA will be performed. Using this method the offspring can be characterised as positive (when having a mutation), or negative (when having the same sequence as the wild type zebrafish). The genomic DNA of positive embryos will be sequenced to determine the exact mutation. Positive tested zebrafish with the same mutation will be incrossed to create an F1 generation with a homozygous mutation. Those embryos will be used to display the vascular development using confocal microscopy.

During the time the injected zebrafish are being raised, the perivascular cells (explained in section 1.3.4.) in which Snail2 is expected to be expressed, will be further investigated. For this study, a technique called Bacterial Artificial Chromosome (BAC) recombineering, is used to image the different populations of these perivascular cells. BAC recombineering is used to create different kinds of transgenic zebrafish lines of the Danio Rerio that enable us to mark certain proteins, that are expressed in specific cells, with a fluorescent tag that can be visualised using confocal microscopy. The technique of BAC recombineering will be further explained in attachement I. Tagging certain proteins that are specific to a cell gives us the opportunity to image and study specific cell populations. Because Snail2 is a protein that is expected to be involved in pathways that regulate migration of perivascular cells, the imaging of these cells with and without a successful knockout of snai2 gives us knowledge about the role of Snail2 in this migration process.

2

1.3 Theoretical background

1.3.1 Genome editing Genome editing, a type of genetic engineering, is a cluster of techniques in which the genomic DNA of an organism is modified by inserting, replacing or removing DNA fragments. Genome editing technology is mostly practiced in genetic analysis, by creating biological models for the understanding of a gene or the function of a protein.

There are several genome editing methods in which genomic DNA can be modified. These techniques have been developed to create targeted mutations in the genomic DNA of an organism. This means creating a modification in a genomic sequence of interest. To create these target specific mutations, the double stranded DNA of that gene has to be cleaved first, generating a double stranded break (DSB). DSBs can be caused by several nucleases, depending on which genome editing technique is being used. Once a DSB is introduced in the genomic DNA by a specific nuclease, there are two different ways in which the DNA can be repaired. One of these mechanisms is called Homologous Recombination (HR), which is an accurate way of DNA repair using the undamaged sister chromatid or homologous chromosome as a template [1]. Another way of repairing damaged DNA is Non-Homologous End Joining (NHEJ), a mechanism for which no template is needed. NHEJ is a repairing pathway where a frameshift is most likely tooccur. The frameshift, possibly generating a premature stop codon, can cause a gene knockout. Therefore the NHEJ repairing pathway is used in this project, knocking out the snai2 gene. The process of NHEJ will be further explained in attachement II. Combining HR along with a genome editing tool within a specific gene allows the introduction of a wide range of mutations. By supplying specific designed engineered homologous repair templates instead of using the undamaged sister chromatid, new and different DNA fragments, can be inserted into the genomic DNA of an organism in a specific gene of interest [2]. These insertions are called knock-ins and will create a change in the gene, causing a mutation or an insertion of sequences encoding fluorescent tags (explained in attachement II).

The main three methods used in genome editing all share that they are using programmable site-specific nucleases [3]. This means that nucleases are used to cleave at an exact pre-determined position in the genomic DNA of an organism. Zinc-finger Nucleases (ZNFs), Transcription Activator-Like Effector Nucleases (TALENs) and Clustered Regulatory Interspaced Short Palindromic Repeat (CRISPR) are currently the three most used methods to introduce DSBs at pre-determined locations in the genomic DNA.

All three of these cleavage methods can show errors. These errors occur when the programmed site-specific nucleases bind to the wrong target site in the genomic DNA, resulting in off target cleavage. These sites where the nucleases bind and cleave are called off-target-cleavage sites. Because off-target-cleavage sites decrease the specificity of gene engineering, they should be prevented where possible.

Which method should be used in combination with specific genomic DNA, to achieve the most efficient site-specific cleavage, is in many cases yet to be determined. Thus far studies in zebrafish have shown that using the CRISPR/Cas9 system, site-specific cleavage can be achieved efficiently [4]. The process of the CRISPR/Cas9 system will be explained in attachement II.

3

1.3.2 The role of the Snail2 protein Snail2 is a transcriptional repressor encoded by the snai2 gene in the zebrafish, or Danio Rerio. The gene is located in chromosome 24 and has a size of 6017 basepairs and consists of 3 exons and 2 introns [5]. The role of the Snail2 protein in vascular development is largely unknown. To understand the function of Snail transcription factors, epithelial to mesenchymal transition (EMT) and endothelial to mesenchymal transition (EndMT) must be introduced, as Snail transcription factors are known to activate these processes [6].

Endothelial cells are the cells that form the endothelium as a single cell layer. This is the inner cellular layer of blood vessels, and therefore in direct contact with blood. Epithelial cells, forming the epithelium, line the covering of internal and external body surfaces. Epithelial cells form the epithelium by one or more layers. Both epithelium and endothelium are based on a basement membrane (BM) [7]. This BM, a composite of several large glycoproteins, supports the epithelium and the endothelium. An important property of endothelial cells in vascular development is being able to migrate directed in response to a variety of growth factors. Cell-cell adhesion and cell polarity are important properties for migration as they are involved in allowing endothelial cells to leave the tissue [8]. Endothelial cells within the endothelium have strong intercellular interactions generated by cellular adhesion protein complexes such as integrins and Vascular Endothelial cadherin (VE-cadherin) (Fig. 1). VE-cadherin is also a protein involved in the regulation of the polarity of the endothelial cells. The cell polarity of individual cells is important as they contribute to the shape of the cell and cell-cell adhesion. The polarity of the cell strongly collaborates with the function of the cell.

Figure 1 inter cellular adhesion complexes [8].

Mesenchymal cells are progenitor cells that, by a complex pathway of gene activation, have the ability to differentiate into multiple celltypes. The processes EMT and EndMT are based on the capacity of epithelial and endothelial cells to switch phenotypes to mesenchymal cells [9]. This phenotype switch gives the tissue the ability to remodel. A complex network of gene activation and repression regulates the

4

initiation, execution and maintenance of EMT and EndMT. To switch from an epithelial or endothelial phenotype to a mesenchymal phenotype, the cell has to change in some aspects. Gross changes in polarity, morphology, functionality and cell-cell interactions are the essential steps for the cells to undergo the phenotype switch. This phenotype switch is called the transition. During this transition, endothelial and epithelial cells lose their cell adhesion with other cells within the tissue. Therefore important intercellular adhesion protein complexes, such as E-cadherin and integrins, must be degraded. Downregulation of the genes encoding for these adhesion complexes prevents new expression. Because epithelial and endothelial cells are arranged on a BM, consisting of a thin sheet of fibres, this must also be degraded by the transitioning cells before being able to separate from the tissue. This degradation is caused by the production and secretion of metalloproteinase by the transitioning cells. Because during this process, the cells also progressively lose their polarity, they can successfully be separated from the tissue. To complete the transition, the cells have to activate the expression of additional mesenchymal genes and proteins, such as vimentin. (Fig. 2). Vimentin is a protein inducing change in cell shape, motility and polarity [10].

Figure 2 schematic overview of the molecular and cellular changes that occur during EMT [9]. BM indicates basement membrane; MMPs, matrix metalloproteinases; EMT, epithelial to mesenchymal transition; αSMA, DDR2 and FSP1 are mesenchymal proteins being expressed in the final state of transition.

During EMT, epithelial cells gain mesenchymal properties and loose contact

with neighbouring cells, enabling them to break through the basement membrane that separates the different kinds of tissue. One of the hallmarks of EMT is the functional loss of E-cadhering, a protein encoded by the Cadherin1 gene (CDH1 gene). E-cadherin is one of the proteins that is strongly involved in cell adhesion between epithelial cells. Snail2 is known to be a predominant inducer of EMT and thereby strongly represses the expression of E-cadherin. Expression of Snail2 positively correlated with tumour grade.

5

There are three Snail proteins that have been identified so far: Snail1 (Snail), Snail2 (Slug) and Snail3 (Smuc). All the family members encode transcriptional repressors. They all share a similar organisation with a highly conserved C-terminal domain, containing four to six zinc finger domains, which are responsible for binding the DNA when repressing the transcription of E-cadherin. The SNAG (Snail/Gfi) domain, located at the N-terminal of the protein, is able to bind several co-repressor complexes. The central region of the protein contains a Serine-Rich Domain (SRD), important in the regulation of the stability of the protein. The Nuclear Export Box (NEB) is responsible for the subcellular localization of Snail (Fig. 3).

Figure 3 structure of the Snail protein. The C-terminal contains zinc finger domains, responsible for binding to the DNA. the N-terminal contains the SNAG domain, which interacts with several co-repressors and epigenetic remodelling complexes [12].

The zinc finger domains of the Snail protein binds to a specific region on the DNA called the E-box motif. This motif consists of the sequence: 5’ – CANNTG – 3’. The ‘N’ in the sequence can be any base. This sequence lies within the promoter region of the CDH1 gene. The binding site of Snail is identical to the binding site of basic Helix-Loop-Helix (bHLH) transcription factors [13]. This indicates that Snail proteins might compete with the bHLH transcription factors involved in the regulation of the CDH1 gene.

EndMT is a specialised form of EMT. During EndMT, endothelial cells separate from an organised cell layer and invade the underlying tissue [10]. The stages in which this transition is made are comparable to the stages of EMT. They differ in the up- and downregulation of different genes, to loose contact with neighbouring cells and leaving their tissue. Like EMT, EndMT allows endothelial cells to delaminate from an organised cell layer and transition to a mesenchymal phenotype by loss of cell-cell junctions, loss of endothelial markers, gain of mesenchymal markers and acquisition of invasive and migratory properties. Therefore EndMT is suggested to have an important role in tissue remodelling like angiogenesis [11]. Angiogenesis will be explained in section 1.3.3. Snail has also proven to be a regulator of the induction of EndMT, as Snail transcription factors during EndMT also serve as repressors of the expression of important junction complexes like Vascular Endothelial cadherin (VE-cadherin) between endothelial cells.

6

The suggestion of EndMT being involved in angiogenesis, with Snail being an important regulatory protein of that process, raises the question whether Snail is expressed in endothelial cells or in cells located near endothelial cells. The question also includes the exact role of Snail in inducing EndMT.

1.3.3 Angiogenesis Angiogenesis is the growth of blood vessels forming from existing vasculature. It is a process that occurs in life in both health and in disease that begins during embryonic development and continues on through life [15]. Blood capillaries are needed in every tissue for the exchange of nutrients and metabolites. Angiogenesis is a process that reacts to changes in metabolic activity. Exercise for example stimulates angiogenesis in skeletal muscle and heart, as a lack of exercise can lead to capillary regression.

Angiogenesis is a process that can be split into two types. Sprouting angiogenesis is the type in which Vascular Endothelial Growth Factor A (VEGF-A) coordinates the vascular growth in a hypoxic environment. A hypoxic environment is an environment where there is a lack of oxygen. When functional cells in a tissue, called parenchymal cells, suffer from a deficiency of oxygen they respond by secreting VEGF-A. Under the influence of VEGF-A, leading cells at the tips of vascular sprouts, guide a developing capillary sprout through the extra cellular matrix (ECM). These leading cells are called tip cells. Tip cells can digest a pathway through the ECM by secretion of proteolytic enzymes called Matrix Metalloproteinases (MMPs). Long, thin cellular projections on the tip cells, called filopodia, secrete these MMPs (Fig. 4). Filopodia are heavily enriched with VEGFR2, which is a receptor for VEGF-A. This allows the tip cells to sense differences in the VEGF-A concentration. High concentrations of VEGF-A secreted by parenchymal cells indicate a hypoxic environment, which stimulates tip cells to guide the developing capillary sprout to the area with the oxygen deficiency in a certain tissue.

Figure 4 tip cell leading to a hypoxic environment by detection of VEGF-A [16]. The MMPs are secreted by the sprout tips to digest the pathway through the ECM.

Intussusceptive angiogenesis, or splitting angiogenesis, the second type of angiogenesis, is a process where an existing blood vessel splits in two, creating a new blood vessel. Because this type of angiogenesis only requires the reorganization of existing endothelial cells and it does not rely on immediate endothelial proliferation or differentiation, splitting angiogenesis is considered to be faster and more efficient than sprouting angiogenesis. This type of angiogenesis plays an important role in the

7

vascular development of embryos where growth is fast and resources are limited. Compared to sprouting angiogenesis, the control of splitting angiogenesis is poorly understood. However, it is known that splitting angiogenesis can also be stimulated by VEGF-A.

1.3.4 Perivascular cells Vascular walls are composed of two different cell types, endothelial cells and mural cells. Mural cells can again be referred to as two different cell types. Vascular smooth muscle cells are mural cells when associated with large arteries and veins [17]. However when they are associated with capillaries, mural cells are referred to as pericytes. Pericytes are located in the BM. During development, pericytes expand in number and migrate to cover endothelial tubes (Fig. 5). A lot of the signalling pathways in which the migration of pericytes are mediated remain unknown. A signalling pathway known to be implicated in pericyte development and maintenance is the Notch3 signalling pathway. Notch3 is a receptor protein located on the membrane of pericytes and vascular smooth muscle cells. When specific molecules attach to the Notch receptor on the membrane of one of the mural cells, the receptors send signals to the nuclei of these cells. The signals cause the cells to activate particular genes. This property of mural cells can lead to EMT or EndMT properties. Studies suggest that the Notch pathway is also used for the up-regulation of Snail transcriptional factors, and therefore plays an important role in EMT [18]. This suggestion brings us back to the question in which cells Snail2 is expressed.

Figure 5 pericyte covering endothelial tube [19].

8

2 Materials and Methods

2.1 Transgenic lines by BAC recombineering

2.1.1 Use of transgenic lines The sgRNAs forming the CRISPR complexes 1,2 and 3 will be injected in different transgenic zebrafish lines. The aim of using different transgenic lines (Tg) is to investigate the function of Snail2 as well as where it is expressed (explained in attachement I: BAC recombineering). To investigate the location of Snail2 expression an already present BAC plasmid was used. The transgenic line created with this BAC, called Tg BAC snail2T2A:GFP, overexpressed Snail2 and expressed GFP in a tissue-specific manner. Overexpression of Snail2 is caused by the complete Snail2 encoding sequence in the BAC construct. T2A is a peptide that links the GFP reporter gene to the native open reading frame (ORF) of Snail2. Once both proteins are expressed T2A self-cleaves thereby disconnecting the proteins from each other. Without the self-cleaving property of the T2A peptide, GFP would be directly connected to Snail2 and possibly inhibiting it’s function as a transcription factor. The Snail2 and GFP being expressed at the same moment at the same place gives information about the location of expression of Snail2. Though conclusions about whether Snail2 migrates after disconnecting from GFP cannot be made, as this cannot be imaged using the Tg BAC snail2T2A:GFP. As discussed in section 1.3.4, Snail2 might be upregulated by the Notch3 signalling pathway. An already present transgenic line carrying the notch:GFP transgene is used to get information about tissue that is involved in this Notch3 signalling pathway. In this transgenic line a specific upstream activating sequence is used that is stimulated by the signals caused by Notch3 signalling. This construct causes expression of GFP in tissue involved in the Notch3 signalling pathway. A hypothesis is that Snail2 might be upregulated by the Notch3 signalling pathway. It might also be possible that expression of Snail2 forms a sort of positive feedback for Notch signalling. This can be investigated by comparing CRISPR mutant- of this transgenic line, with wild type embryos of the same transgenic line.

9

To investigate the role of Snail2 in EMT or EndMT processes, two other transgenic lines are used. The Tg BAC acta2:YFP carries the DNA in its genome that is constructed to contain the ACTA2 promoter region controlling expression of the Yellow Fluorescent Protein (YFP) reporter gene. This means that YFP will be expressed in the specific tissue. ACTA2 stands for Smooth Muscle α-Actin, which is a protein, expressed in perivascular cells. Because a hypothesis is that Snail2 plays a role in the signalling pathway in which pericytes migrate during vascular development, the knockout of Snail2 may influence this process as explained in section 1.3.4. Imaging the YFP protein in time displays the location of pericytes during vascular development. Comparing CRISPR mutants of the Tg BAC acta2:YFP with uninjected embryos of the same transgenic line, displays the difference in phenotypes. The Tg acta2:YFP was already present. The other transgenic line, Tg BAC pdgf-β:TagRFP-T, was created to also tag perivascular cells. pdgf-β stands for Platelet Derived Growth Factor– β and is also specifically expressed in perivascular cells. TagRFP-T is a red fluorescent protein that is expressed under the control of the PDGF-β promoter in the PDGF-β TagRFP-T transgenic line. Because the expression of ACTA2 and PDGF-β in perivascular cells might differ in expression in time and conditions in the vascular developmen, the influence of Snail2 on perivascular cells can be investigated using two different angles.

2.1.2 Plasmids and Strains For the construction of the Tg BAC pdgf-β:TagRFP-T BAC, a BAC containing the PDGF gene had to be ordered. This was the CH73-289D6 BAC (BACPAC). As explained in draft I the construction require several plasmids. The pRedET plasmids (GeneBridges) and the plasmids containing the targeting templates were ordered. When bacteria contain the pRedET plasmid, they can only be incubated at 30°C overnight because the pRedET plasmids contain the SC101 temperature sensitive origins. Incubating them at higher temperatures will kill the pRedET plasmid. The plasmids used to generate the targeting templates were a kind gift from collaborators.

The primers used to create the templates for the first targeting step, iTol2_Amp(R), contained a complementary sequence for the amplification of the referred region, but also contained the 50 bp long homology arms that were needed for the incorporation into the pdgf-β BAC plasmid. iTol2_ Amp(R) forward primer: gcgtaagcgggcacatttcattacctctttctccgcacccgacatagatCCCTGCTCGAGCCGGGCCCAAGTG iTol2_Amp(R) reverse primer: gcggggcatgactattggcgcgccggatcgatccttaattccgtctactaATTATGATCCTCTAGATCAGATC The red sequences in the primers are the overhangs that will serve as homology arms when inserted into the BAC backbone.

10

The primers used for the second targeting step, TagRFP-T_Kan(R), contained different homology arms as this, the reporter cassette, was to be inserted at a different location then the iTol2_Amp(R) insert. TagRFP-T_Kan(R) forward primer: Upstream 50 bp homology arm – ACCATGGTGAGCAAGGGCGAGGAG TagRFP-T_Kan(R) reverse primer: Downstream 50 bp homology arm - TCAGAAGAACTCGTCAAGAAGGCG

2.1.3 Clone conformation Pdgf-β BAC cultures were streaked out on plates of LB with Chloramphenicol (Cm) [11.3 μg/ml]. The plates were grown overnight at 37°C. the next day grown colonies were taking up and resuspended in 50 μl MQ. A colony PCR was performed. Every reaction contained 4 μl 5x HF Buffer (New England Biolabs), 0.4 μl dNTPs [10 mM], 1 μl forward and reverse primer mix [10 μM], 0.2 μl phusion Taq [2 U/μl] (Thermo scientific), 13.4 μl mQ and 1 μl of the resuspended colony. The remaining mQ/colony mixture containing the pdgf-β BAC plasmid checked by the colony PCR was inoculated in 1 ml of LB-Cm, and grown overnight (O/N) at 37°C. 500 μl of the O/N culture is used to make a glycerol stock. This stock is stored at -80°C, and is used to grow new cultures of the pdgf-β O/N at 37°C. The stock is prepared by adding 500 μl of 30% glycerol to 500 μl of the O/N grown culture. The glycerol stock is stored at -80°C. Pdgf-β control primerset:

• Forward control primer: GTTTCCTTTGGCTTTGAGGCGA • Reverse control primer: AGCACAGAGCAGAAATCAGGAC

2.1.4 pRedET transformation A pipette tip was used to scratch some culture of the -80°C glycerol stock of the pdgf-β. This was added to 1 ml LB-Cm and grown overnight (O/N) at 3°C. 40 μl of this O/N culture was transferred to 2 ml fresh LB-Cm and incubated at 37°C for 2.5 hours. After the incubation the grown culture was transferred to a 2 ml tube. In a cold room (4°C) the culture was centrifuged at 5000 g for 1 minute. The supernatant was discarded and the pellet is resuspended in 1 ml of ice-cold mQ water. The culture is centrifuged at 5000 g for 1 minute once more. The supernatant was also taking off again, and the pellet was resuspended in 1 ml of ice-cold mQ water. For the last time the culture was centrifuged at 5000 g for 1 minute and the supernatant was discarded very careful. Approximately 50 μl were still to be left in the tube when the supernatant was discarded. Next, 2 μl of pRedET plasmid (Gene Bridges) [10 ng/μl] was added. The mixture of bacteria in 50 μl mQ water and 2 μl of pRedET plasmid were transferred to a 1 mm electroporation cuvette (Biorad) and electroporated with standard E. coli settings (1.35 kV, 10 μF and 600 Ω) (Biorad). The electroporation rate should be around 5 milliseconds. Directly after electroporation 950 μl of fresh LB was added. The mixture of LB with the electroporated culture was incubated for 3 hours at 30°C. after the incubation 100 μl was plated out on LB plates containing Chloramphenicol [11.3 μg/ml] and Tetracyclin (Tet) [3.3 μg/ml]. Single colonies of the plates were used for a colony PCR. The same protocol as the clone conformation

11

of the pdgf-β BAC culture was performed only this time it was performed on the pdgf-β BAC and pRedET culture, so positive colonies were selected by using a forward and reverse primer set for RedET. Again the remaining mQ/colony mixture of a RedET positive colony was inoculated. Only this time it was inoculated in 1 ml LB-Cm-Tet and incubated O/N at 30°C. Again 500 μl of the O/N culture was used to make a glycerol stock. pRedET control primerset: pRedET Forward CTCTTGCGGGATATCGTC pRedET Reverse GTGATGTCGGCGATATAGG

2.1.5 iTol2 insert A pipette tip scratched with the pdgf-β BAC/RedET glycerol stock was added to 1 ml of LB-C-Tet and grown O/N at 30°C. 40 μl of the O/N culture was inoculated in 2 ml fresh LB-Cm-Tet and incubated at 30°C for 4 hours. 67 μl of L-arabinose [10%] was added and the mixture was again incubated at 37°C for 1 hour. The culture was transferred to a 2 ml tube. The same washing steps were performed as explained in section 2.1.4. 2 μl of the prepared iTol2_Amp(R) PCR product was added to the mixture. To insert the iTol2_amp(R) PCR template into the pdgf-β BAC plasmid, the same electroporation protocol as explained in section 2.1.4 was used. After electroporation the cultures were incubated for 1 hour at 37°C. After the incubation the culture was centrifuged for 1 minute at 5000 G. The supernatant was discarded accept for 100 μl. The pellet was resuspended in this 100 μl medium and plated on LB plates containing Chloramphenicol [11.3 μg/ml] and Ampicilin [16.7 μg/ml]. These were incubated overnight at 37°C. Again single colonies on the plate were picked and checked on a colony PCR in the same way as explained in section 2.1.4, using a forward and reverse primer set for iTol2_Amp(R). The remaining mQ/colony mixture of a positive colony was inoculated in 1 ml LB-Cm-Amp and grown overnight at 37°C. Again 500 μl of the grown pdgf-β/iTol2 culture was used to make a glycerol stock.

2.1.6 second targeting insert The last step was performed with 1 ml of an O/N grown pdgf- β/RedET/iTol2 culture. The culture was grown O/N in 1 ml of LB-Cm-Amp at 37°C. 40 μl of this O/N culture grown stock was added to 2 ml fresh LB-Cm-Amp and incubated for 2.5 hours at 37°C. The grown culture was transferred to a 2 ml tube, for the exhibition of the washing steps. The washing steps were performed as explained in section 2.1.4 in the cold room. 1 μl of the insert Tag-RFP-T_Kan(R) was added to the mixture for electroporation. The electroporation was performed as explained in section 2.1.4. The electroporated cultures were incubated at 37°C for 1 hour. For selection of the proper BAC, the cultures were plated on LB plates containing Chloramphenicol [11.3 μg/ml], Ampicilin [16.7 μg/ml] and Kanamycin [16.7 μg/ml]. Plating of the cultures was performed as described in section 2.1.5. The plates were incubated overnight at 37°C. For selection of the target BAC, a colony PCR was performed on the grown single colonies on the LB-Cm-Amp-Kan plates using the forward primer of TagRFP-T_Kan(R) and the reverse primer of pdgf-β. The protocol of the colony PCR was the same as described in section 2.1.4. The remaining mQ/colony mixture of a positive

12

colony sample was inoculated in 1 ml LB-Cm-Amp-Kan medium and grown O/N at 37°C. And glycerol stocks were made as described in section 2.1.5.

2.2 CRISPR/Cas9 technology

2.2.1 Approach Three different sgRNAs are designed to cleave the genomic DNA in the snai2 gene at three different locations when co-injected with Cas9. The sgRNAs are referred to as sgRNA1, sgRNA2 and sgRNA3. The aim of designing these three sgRNAs is to reach a complete knockout of the snai2 gene. Because the knockout of the gene depends on the introduction of a premature stop codon, different approaches are used. Because Snail2 is a transcription factor, the DNA binding domain of the protein is important for its function. Introducing a premature stop codon upstream of the coding region for the DNA binding domain will therefore have a high probability of causing a non-functional truncated protein. The DNA binding domain of Snail2 is encoded in the second and third exon of the three exons of the gene. ATGCCTCGTTCATTCCTAGTAAAGAAGCATTTCAATGCAGCTAAGAAACCGAATTATAGTGAACTGGAGAGTCCGACAGTGTTTATTTCTCCATATGTCTTAAAAGCCCTCCCGGTGCCTGTTATACCTCAG.CCTGAAGTGTTAAGCCCGGTGGCGTACAATCCCATAACAGTATGGACTACCAGCAACCTGCCACTGTCGCCCCTT.CCCCACGACCTGTCCCCCATATCCGGATACCCCTCATCTCTCTCTGACACATCCTCTAATAAGGACCACAGCGGTTCGGAGAGCCCCAGAAGTGACGAAGACGAGCGGATACAATCCACCAAGCTGTCGGACGCTGAGAAGTTTCAGTGCGGTTTGTGTAACAAGTCCTACAGCACGTATTCGGGACTCATGAAGCACAAACAGCTGCACTGCGACGCACAGAGTCGGAAATCGTTCAGCTGCAAGTACTGCGAGAAGGAATACGTGAGTCTAGGAGCCCTAAAGATGCACATAAGGACACACACGCTGCCGTGCGTTTGTAAAATGTGTGGAAAAGCTTTCTCCAGGCCTTGGCTGCTGCAGGGACACATTAGAACACACACGGGTGAGAAACCGTTTTCCTGCCCCCACTGCAGTCGTGCATTCGCAGATCGATCGAACCTCCGAGCCCACCTGCAAACCCACTC.AGACGTGAAGAAATACCAGTGCAAGAACTGCTCTAAAACATTCTCTCGCATGTCGCTGCTGCACAAACATGAGGAATCTGGCTGTTGCATCGCACACTGA

All three exons are displayed in the sequence above. The first exon is displayed in yellow, the second in blue and the third in yellow again. The bold and italic region in the second and third exon displays the coding region for the DNA binding domain of the Snail2 protein. The purple regions display the selected target sites for respectively sgRNA1, sgRNA2 and sgRNA3. The exact location and sequence of these target sites will be further explained in section 2.2.1.2. The dots in the purple sequences display the cleave sites of the CRISPR (sgRNA/Cas9) complexes.

13

sgRNA1 and sgRNA2, were selected to target regions in the second exon, upstream of the encoding sequence for the DNA binding domain of the protein. Injecting embryos with one of the two sgRNAs hypothetically leads to InDels, aiming to introduce a premature stop codon. This is one approach to knock out snai2. Alternatively, injecting both sgRNA1 and sgRNA2 along with Cas9 in the same embryo, could lead to a major loss of sequence in the DNA. When the Cas9 endonucleases of the CRISPR complexes 1 and 2 cleave at the same time, NHEJ will not be able to prevent the DNA region between the cleave sites to be separated from the genomic DNA. The NHEJ repair pathway will only help reconnecting the loose ends of the DNA strand after cleavage. This would mean that the sequence between the cleave sites is basically cleaved out of the genomic DNA. The introduction of the InDel will again lead to the introduction of a premature stop codon upstream of the encoding sequence for the DNA binding domain. SgRNA3 is targeted to a region within the encoding sequence for the DNA binding domain, in the third exon. This way a premature stop codon will be introduced somewhere within the encoding region for the DNA binding domain, resulting in a non-functional domain. The precise target site selection on which the approaches were based, are explained in section 2.2.2.

2.2.2 Target site selection Target sites in de snai2 gene were selected using the database of CHOPCHOP [20]. The three target sites in the snai2 gene were selected based on their uniqueness in the genome of the Danio Rerio and their location in the exons. In selection of the target sites in the genomic DNA, the Protospacer Adjacent Motif (PAM) sequence had to be directly attached to the 20 base pair target site (explained in attachement II: CRISPR/Cas9 Technology). This PAM sequence was chosen to match the 5’ – NGG – 3’. The 5’ requirement of the target site was selected to end with ‘GG’. This selection was made to increase the stability of the sgRNA binding to the genomic DNA. These requirements lead to DNA target sites matching the sequence 5’ GG – N19 – GG 3’, with ‘N’ as any possible nucleotide. The last requirement to be satisfied was a GC content which had to be 50% or higher. Three matches given by CHOPCHOP were selected. The exact position and sequence of the target site are displayed in section 2.2.1.

14

2.2.3 sgRNA generation and transcription To generate a sgRNA, DNA is needed as a template as explained in attachement II. This DNA template has to contain a promoter for in vitro transcription, the spacer region that is specific to the target site in the genomic DNA and an overlap region that anneals to a constant oligonucleotide. This constant oligonucleotide encodes for the reversed complement sequence of the sgRNAs tracrRNA. The sequence of the tracrRNA tail of the sgRNA is always the same, regardless of the target site in the genomic DNA. The following oligonucleotides for the generation of the DNA templates were designed and ordered (Integrated DNA Technology). sgRNA1 gene-specific oligonucleotide sequence: 5’ – ATTTAGGTGACACTATAGGGCTTAACACTTCAGGCTGGTTTTAGAGCTAGAAATAGCAAG – 3’ sgRNA2 gene-specific oligonucleotide sequence: 5’ – ATTTAGGTGACACTATAGGGGACAGGTCGTGGGGAAGGTTTTAGAGCTAGAAATAGCAAG – 3’ sgRNA3 gene-specific oligonucleotide sequence: 5’ – ATTTAGGTGACACTATAGGTATTTCTTCACGTCTGAGGTTTTAGAGCTAGAAATAGCAAG – 3’

The red sequences of the oligonucleotides display the SP6 promoter sequence. The blue sequences are encoding the spacer region of the sgRNA, the crRNA, which is complementary to the target site within the genomic DNA. The green sequences display the overhang regions that are complementary with the constant oligonucleotide encoding the reverse-complement of the tracrRNA tail of the sgRNA. Constant oligonucleotide: 5’ – AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC – 3’

The green displayed sequence of the constant oligonucleotide is the sequence that anneals with the overhang regions of the gene-specific oligonucleotides, which are also displayed in green.

To generate the DNA templates 1 μl of a gene-specific oligonucleotide [100 μM], 1 μl of the constant oligonucleotide [100 μM] and 8 μl water were added to a 200 μl PCR tube (Eppendorf). This procedure was performed with the three designed gene-specific oligonucleotides in three separate PCR tubes. The PCR tube with a total volume of 10 μl was subjected to an incubation program. The program consisted of 5 minutes at 95°C followed by a decrease in temperature from 95°C to 85°C with 2°C per second. Then from 85°C to 25°C with a temperature decrease of 0.1°C per second, and finally it was held at 4°C. This step was performed to anneal the oligonucleotides. To obtain double stranded DNA the oligonucleotides were filled in in the 5’ 3’ direction by adding 2.5 μl dNTPs [10 mM (Invitrogen)], buffer 2 [10x (New England Biolabs)], 2 μl BSA [10x, 1 mg/ml (New England Biolabs)], 0.5 μl T4 DNA polymerase [3 U/ml (New England Biolabs)] and 2.8 μl of water. The total reaction volume of 19.8 μl of the three PCR tubes were incubated at 12°C for 20 minutes. After the incubation, the double stranded DNA had to be purified to increase the transcription efficiency. This was done by using a Axyprep PCR clean up kit (Axygen Biosciences). To test the DNA product they were run on a 2% agarose DNA gel. The product should show a dominant band at 120 bp. When the proper products

15

were confirmed, the sgRNAs were transcribed using the SP6 MEGAscript kit (Ambion). The reactions of the three PCR tubes were treated with 1 μl of TURBO DNase [1 U/μl (Ambion)] to digest DNA remaining’s, and incubated for 15 minutes at 37°C. The transcribed sgRNAs had to be purified using the Direct-Zol™ RNA miniprep kit (Zymo Research). The concentrations of the sgRNAs were measured using the Nanodrop and diluted to a concentration of 300 ng/μl and stored at -80°C.

2.2.4 Tg Zebrafisch lines and microinjection As explained in section 2.1.1, the transgenic lines chosen to be injected were the ACTA2 YFP, NOTCH GFP, PDGF-β TagRFP-T and the Snail2T2A:GFP. For the co-injection of Cas9 endonuclease and one of the sgRNAs, mixtures were prepared. 1 μl sgRNA [300 ng/μl] was added to 1 μl of Cas9 [1 μg/μl]. This reaction was incubated at 37°C for 15 minutes. After the incubation 0.5 μl phenol red dye was added, and the reaction was put on ice until injection.

The embryos of the transgenic lines had to be injected in the stage of one-cell zygotes. This way a possible mutation in the injected cell will be transmitted to all cells during the development of the embryo, increasing chances of transmitting the mutation to the germ cells of the embryo. Females were crossed with males from the same transgenic line (incross). The embryos of this incross were selected to be co-injected with Cas9 and one or two of the specific sgRNAs.

2.2.5 Control efficiency CRISPR complexes Injecting the embryos with the intention of growing them until adulthood to create the F0 generation, required an efficiency assay that displays mutations that have taken place in the genomic DNA of the injected embryos. HRMA was chosen for the screening of the mutations (explained in attachment III: High Resolution Melting Assay). This assay was used to test the mutation rates of embryos injected with one or two specific sgRNAs. This was a way to investigate the efficiency of the CRISPR complexes. As explained in attachment III, an HRMA is only reliable when performed on a small double stranded DNA region. Therefore, to perform HRMA, three different primer sets were designed for an HRMA for each sgRNA. The primer sets, consisting of a forward and a reverse primer, were designed to flank an area with a maximum of 110 bp. This area contained the predicted cleave site of each sgRNA, and would therefore also contain the site in which the insertion or deletion of nucleotides had taken place. The primer-BLAST tool of NCBI [21] was used to design the following primers specific to the intended PCR target. HRMA primers CRISPR sgRNA1:

• Forward ATGTCTTAAAAGCCCTCCCGGT

• Reverse AGGTTGCTGGTAGTCCATACTGTT HRMA primers CRISPR sgRNA2:

• Forward GGTGGCGTACAATCCCATAACAG • Reverse TGTGTCAGAGAGAGATGAGGGGT

HRMA primers CRISPR sgRNA3:

• Forward GCAGATCGATCGAACCTCCG Reverse GCGACATGCGAGAGAATGTT

16

20 embryos were used for each of the three sgRNAs to be injected along with Cas9 endonuclease. 24 hours post fertilization (hpf), genomic DNA of the embryos was extracted for analysis. The DNA was extracted by adding 50 μl of a mixture of 1ml DNA extraction buffer A [10 mM Tris-HCL, pH 8.0, 0.3% NP4O, 1 mM EDTA, 50 mM ICCI, 0.3% Tween20] and 50 μl of proteinase K [10 mg/ml] to a PCR tube containing one single embryo. This reaction was incubated for 2 hours at 55°C and then 5 minutes at 99°C. For the HRMA the genomic DNA of 8 uninjected embryos of the ACTA2 YFP transgenic line was extracted to be used as a control. For the HRMA, a 384-wells plate was used (Applied Biosystems). Every reaction contained 1μl of prepared genomic DNA, 5 μl Meltdoctor™ HRM Mastermix (Applied Biosystems), 1 μl of primermix [5 mM forward primer, 5 mM reverse primer] and 3 μl of water.

17

2.2.6 Identification founder fish The identification of the founder fish includes investigating the germline transmission of the mutation of the injected zebrafish embryos. This means that a possible mutation generated by the CRISPR/Cas9 method is transmitted to the germcells of the injected embryo. If the germcells carry the mutation, they can transmit the mutation to the next generation (F1). This was done by performing an HRMA on extracted DNA of embryos of zebrafish raised from an outcross between specific injected embryos, with wild type zebrafish. These embryos were embryos of the F1 generation.

Two families of zebrafish were obtained as explained in section 2.2.1. One family (number 107829) contained zebrafish raised from embryos injected with sgRNA1. The other family (number 107896) contained zebrafish raised from embryos injected with sgRNA1/sgRNA2. From both these families fish were used to cross with wild type fish in order to investigate whether a possible mutation has occurred in the germline of the fish or not. Positive samples, meaning that the HRMA showed heterozygous mutations, of a specific tested fish were used for genotyping to determine the mutation in the genome. Positive tested individual zebrafish from CRISPR families 107896 or 107829 were kept in separate tanks labelled with: family number, sex, date and a specific letter (107829, male, 01 Jan, A). This system was used to determine the genomic mutation of each specific zebrafish by sequencing. The tested embryos coming from the labelled CRISPR family fish were given the same code along with a sample number (107829, male, 01 Jan, A1) in order to determine different mutations in different embryos. For the sequencing special primers were designed to amplify a region of 412 bp. The amplified region flanked most of the second exon of snai2 (Fig. 6).

Figure 6 schematic overview of the primer selection for sequencing to amplify a region in the snai2 gene containing the target sites for zebrafish injected with sgRNA1, sgRNA2 or both (SnapGene Viewer).

Sequencing primerset:

• Forward primer: GTGACCTGTCAAAGTAGGC • Reverse primer: CCCGAATACGTGCTGTAGG

18

2.2.7 Generation F1 family The F1 generation was made by incrossing confirmed CRISPR mutants of the 107829 and 107896 families. This was done to generate a new family of fish carrying a homozygous mutation. The embryos coming from the incrosses were labelled with the codes given to the CRISPR parents (F0). For example: 107829, male, 22 Dec, C. x 107829, female, 01 Jan, A. Positive tested embryos were used for confocal microscopy further to identify possible defects during vascular development. This procedure was performed further in the process.

19

3 Results

3.1 BAC recombineering

3.1.1 Insert confirmation To confirm if all inserts were successfully incorporated into the pdgf-β BAC plasmid, a PCR was performed on single colonies that were grown overnight at 37 °C on LB-Cm-Amp-Kan plates. This is explained in section 2.1.6. The PCR products of the colony PCR were run on a 1.5% agarose gel (Fig. 7). This was done to check if the BAC construct contained the iTol2 insert and the TagRFP-T insert.

Figure 7 Control of the product size of the iTol2 inserts on 8 single colonies of the BAC (lane 2-9). Control of the product size of the pdgf-β/TagRFP-T insert on the same 8 single colonies of the BAC constructs (lane 10-17).

To see in Figure 6 is that the BAC constructs contains both inserts. The iTol2 insert detected by the use of iTol2 forward and reverse primers amplified a PCR product with a size of 300 bp as it should. The TagRFP-T insert was detected by the use of a TagRFP-T_Kan(R) forward primer and a pdgf-β reversed primer (primers are displayed in section 2.1). These primers amplified a PCR product with a size of 200 bp. This showed that also the last targeting insert, containing the reporter cassette, was successfully incorporated into the BAC construct. The pdgf-β BAC construct contained will be injected into wild type embryos to create the Tg pdgf-β:TagRFP-T zebrafish line.

3.2 CRISPR/Cas9 technology

3.2.1 syntheses sgRNA1, 2 and 3 The CRISPR technology is used to create the snai2 knockout. For these CRISPR complexes sgRNAs had to be designed to target specific sites in the genomic DNA as explained in section 2.2.

The synthesised DNA templates needed for the in vitro transcription to generate the sgRNAs were analysed on a 2% agarose gel for product size. The product sizes were validated at 120 bp (Fig. 8).

20

The generated DNA templates with the size of 120 bp were measured using

the Nanodrop to determine the DNA concentration (Table 1).

Table 1 Concentration of generated DNA templates.

DNA template sgRNA1 66.9 ng/μl DNA template sgRNA2 77.4 ng/μl DNA template sgRNA3 114.8 ng/μl

The templates were used to generate the sgRNAs. The sgRNAs were also run on a 2% agarose gel to validate the products (Fig. 9).

The analysis of the gel shows that the products have the proper sizes which means that the sgRNAs were correctly generated. The concentration of the sgRNAs was determined using the Nanodrop (Table 2).

Figure 8A control product size DNA templates for sgRNA1 (left band) and sgRNA2 (right band). Product size at 120 bp length. The marked lane contains collaborators product.

Figure 8B control product size DNA template for sgRNA3. The marked lane contains collaborators product.

Figure 9A sgRNA1 (left) and 2 (right) product validation. Product size 120 bp.

Figure 9B sgRNA3 product validation. Product size 120 bp.

21

Table 2 Concentration of validated sgRNAs.

sgRNA1 3359.4 ng/μl sgRNA2 2081.9 ng/μl sgRNA3 717.8 ng/μl

3.2.2 Efficiency assays As explained in section 2.2.5 the sgRNAs were checked on the efficiency of their site-specific cleavage before they were grown up to form the F0 generation. An HRMA was performed on sgRNA1/Cas9 co-injected embryos of the of the Tg BAC notch:GFP (Fig. 10).

The derivative melting curve of the uninjected embryos displayed in Figure 10A, shows that only one PCR product that has been amplified during the PCR of the HRMA. This can be concluded because the derivative melting curves shows single peaks at the same temperature. Figure 10B, displaying the aligned melting curves, shows that the uninjected embryos do not have any InDel mutations in the amplified region in their genomic DNA. This means that they can be used as a reliable control. Comparing the injected embryos with these controls shows several InDel mutations in the amplified region of the genomic DNA. 18 out of 20 embryos show a variant aligned melting curve compared to the controls. This mutation rate give rise to an efficiency of 90% by the CRISPR complex on the target site of sgRNA1. A second HRMA was performed on co-injected sgRNA2/Cas9 embryos of the Tg BAC notch:GFP (Fig. 11).

Figure 10B Display of the mutation rate of the DNA of the embryos co-injected with sgRNA1/Cas9 by comparison of the aigned melt curves.

Figure 10A Display of the derivative melt curve of the DNA of the uninjected embryos of the Tg BAC notch:GFP, serving as a control for the reliability of the HRMA.

22

The derivative melting curve displayed in Figure 11A shows multiple peaks meaning that multiple different PCR products were amplified. This means that the controls are not reliable and cannot be used as a reference for mutation recognitions of the samples carrying DNA of injected embryos. The validation of the site-specific cleavage of the CRISPR complex formed by Cas9 and sgRNA2 cannot be determined using this HRMA. As displayed in Figure 11B, possible mutations are not recognizable because the aligned melting curves do not simulate the melting process of the proper product. The aligned melting curves should be similar to the aligned melting curves displayed in Figure 10B. Another HRMA was perfomed on co-injected sgRNA2/sgRNA3/Cas9 embryos of the Tg BAC acta2:YFP (Fig. 12). Double site-specific cleavage of sgRNA2 and 3 can be identified by unamplified product in the concerning well. This is because the sgRNA3 forward primer in this case is not able to bind the DNA as this is cleaved out of the genomic DNA. The PCR will therefore fail to amplify this DNA region.

Figure 11A Displays the derivative melting curve of the DNA of the uninjected embryos of the Tg BAC notch:GFP, serving as a control for the reliability of the HRMA.

Figure 11B Display of the aligned melt curve of the embryos co-injected with sgRNA2/Cas9 and the aligned melt curves of the controls.

Figure 12A Display of the derivative melt curve of the DNA of the uninjected embryos of the Tg BAC acta2:YFP, serving as a control for the reliability of the HRMA.

Figure 12B Display of the mutation rate of the DNA of the embryos co-injected with sgRNA2/sgRNA3/Cas9 by comparison of the aligned melt curves.

23

The derivative melting curves of the uninjected Tg BAC acta2:YFP embryos

displayed in Figure 12A show that only one PCR product has been amplified during the PCR of the HRMA. Figure 12B, displaying the aligned melt curves of the uninjected embryos and the sample’s containing the DNA of the embryos co-injected with sgRNA2/sgRNA3/Cas9, shows that the uninjected embryos do not contain any InDel mutations in the amplified region, which means that they can be used as a reliable control. Comparing the controls with the sample’s containing the DNA of the injected embryos again shows several InDel mutations. 8 out of 10 injected embryos show an aligned melting curve that is different from the aligned melting curve of the control embryos, meaning that the tested injected embryos give a mutation rate of 80%. In this case this gives rise to the efficiency of site-specific cleavage of the CRISPR complex on the target site of sgRNA3, but not about the efficiency on the target site of sgRNA2. The efficiency of the CRISPR complex on the target site of sgRNA3 is 80%.

Amplified DNA of double injected embryos were also checked on a 1.5% agarose gel to see if double site-specific cleavage had taken place, using the forward primer of sgRNA2 and the reverse primer of sgRNA3. These assays were performed on embryos co-injected with sgRNA1/sgRNA2/Cas9 or sgRNA2/sgRNA3/Cas9. Embryos of the Tg BAC acta2:YFP were co-injected with sgRNA1/sgRNA2/Cas9. For the PCR to amplify the region of interest, the forward primer of sgRNA1 was used in combination with the reverse primer of sgRNA3. The region of interest has a length of 164 bp. If both CRISPR complexes cleave at the same time, a DNA fragment of 75 bp is deleted. During NHEJ repair, the size of the InDel will determine the new length of the DNA. The repaired strand without inserted or deleted basepairs will have a length of 89 bp. The PCR was performed on DNA extracted from 24 sgRNA1/sgRNA2/Cas9 co-injected embryos and 8 uninjected embryos. The products were run on a 1.5% agarose gel (Fig. 13).

Figure 13 Picture of the gel on which the amplified DNA regions of the uninjected Tg BAC acta2:YFP (lane 1-4 and 25-28) and the sgRNA1/sgRNA2/Cas9 injected TgBAC acta2:YFP (lane 5-24 and lane 29-32) are run.

Small InDel mutations are hard to perceive on a gel, as they often are just a few basepairs. In lane 6 a band is visible at approximately 100 bp. Because all the other bands are the same size as the uninjected embryos, the detected band in lane 6 is

24

most likely the cause of a double cleavage mutation, meaning that the DNA fragment between the target sites of sgRNA1 and sgRNA2 is cleaved out. The ladder, which is not well defined, shows that the gel did not run long enough.

Amplified DNA of the embryos of the co-injected sgRNA2/sgRNA3/Cas9 Tg BAC acta2:YFP were also run on a 1.5% agarose gel. The region of interest was amplified by using the control forward primer of sgRNA2 and the control reverse primer of sgRNA3. The amplified region should have a size of 967 bp. This was a lot bigger because the region also contained the complete intron between the second and third exon of the snai2 gene. The region in-between the cleavage sites had a size of 853 bp, meaning that the eventually repaired DNA would have a size of 114 bp. Running the products on the gel and analysing them did not show any big basepair deletions (data not shown).

3.2.3 Identification founder fish The zebrafish co-injected with sgRNA1 (family number 107829), and sgRNA1/sgRNA2 (family number 107896) of the F0 generation that carry a mutation in their genome, meaning that they also carry this mutation in their germline, have to be identified to create an F1 generation of zebrafish carrying the same mutation. Many zebrafish of both the families 107829 (sgRNA1) and 107896 (sgRNA1, 2) will be crossed with wild type zebrafish to confirm that the mutation is also transmitted to the germline of the injected zebrafish. The genomic mutation in the embryos of these outcrosses will be displayed in an overview in attachement IV. In this section an example of the analysis of HRMA and sequencing results is given. Sample ‘107829, male, 12 Jan, B14’ (F1) was tested positive by an HRMA (Fig. 14).

Figure 14 Display of the HRMA of sample ‘107829, male, 12 Jan, B14’. The red lines display the aligned melting curve of the wil type embryos. The purple line displays the aligned melting curve of sample ‘107829, male, 12 Jan, B14’, showing a heterozygous mutation.

This sample was used for sequencing. This way the exact sequence mutation in the sequence can be determined using the genomic DNA of a wild type zebrafish as reference DNA (Fig. 15). For the sequencing the primers discussed in section 2.2.6 were used. The upper chromatogram displays the upper strand and the chromatogram beneath shows the bottom strand of the ‘107829, male, 12 Jan, B14’ sample DNA.

25

Figure 15 Display of the sequence of the upper and lower strand of the amplified region in the genomic DNA of sample ‘107829, male, 12 Jan, B14’ by a chromatogram. Wild type zebrafish DNA is used as a reference.

The upper chromatogram of the upper strand starts showing double peaks after 5’ - CCTCAG’ - 3’ (red arrow). The chromatogram beneath starts showing double peaks after 3’ – AACACT – 5’ (red arrow). The upper strand is used to manually determine the mutation in the DNA of the sample. The manual determination was compared to the results of software [22] made for data analysis of sequence results, which came down to a deletion of 7 bp (Fig. 16).

Figure 16 Overview of the 7 bp deletion in the ‘107829, male, 12 Jan, B14’ sample using the software program Poly Peak Parser [22].

A 7 bp deletion in the snai2 gene at this location in the genome of the zebrafish leads to a change in the composition of amino acids and subsequently to a premature stopcodon (Fig. 17). The amino acid composition of wild type zebrafish is displayed in an overview in attachement IV along with the mutant founders (F1 generation).

Figure 17 overview of the mutated genome of the ‘107829, male, 12 Jan, B14’ sample. Stopcodons are displayed as the red squares.

Figure 17 shows that at position 133 there is a codon coding for cysteine followed by a stopcodon. In the wild type genome there is a codon coding for proline at position 133. the stopcodon after cysteine displayed of the ‘107829, male, 12 Jan, B14’ sample

26

can be considered a premature stopcodon. The fish labelled ‘107829, male, 12 Jan, B14’, is a CRISPR mutant and carries this mutation in his germcells. Another important observation to be noticed, is that sample ‘107829, male, 12 Jan, D3’ shows an exact similar genomic mutation even though the tested embryos are derived from two different zebrafish of the F0 generation (Fig. 18).

Samples 107829, male, 07 Jan, B2/B3/B5 (F1) were also positive tested by an HRMA (Fig. 19).

Figure 19 Display of the HRMA of samples ‘107829, male, 07 Jan, B2/B3/B5’. The red lines display the aligned melting curve of the wil type embryos. The green lines display the aligned melting curves of samples ‘107829, male, 07 Jan, B2/B3/B5’, showing heterozygous mutations.

Figure 18A Display of the HRMA of sample ‘107829, male, 12 Jan, D3’.

Figure 18B overview of the 7 bp deletion in the ‘107829, male, 12 Jan, D3’ sample by Poly Peak Parser [22].

27

Figure 19 shows that the curves of samples B2, B3 and B5 all look like each other, leading to the suggestion that the DNA of these embryos contain the same mutation. All samples were sequenced xusing the same primerset as discussed in section 2.2.6. Because the chromatograms of the upper and lower strand of all three samples was similar, only the chromatograms of sample ‘107829, male, 07 Jan, B2’ will be displayed (Fig. 20). The fact that the chromatograms of B2, B3 and B5 look similar, approve the suggestion that they contain the same genomic mutation.

Figure 20 Display of the sequence of the upper and lower strand of the amplified region in the genomic DNA of sample ‘107829, male, 7 Jan, B2/B3/B5’ by a chromatogram. Wild type zebrafish DNA is used as a reference.

The upper chromatogram of the upper strand starts showing double peaks after 5’ – ATACCT – 3’ (red arrow). The chromatogram beneath starts showing double peaks after 3’ – AAGTCC – 5’ (red arrow). Again a manual method was used to determine the mutation in the genomic DNA of the mutant zebrafish that came down to a deletion of 6 bp near the target site of sgRNA1. Again this was compared to the results given by the software program Poly Peak Parser [22] (Fig. 21).

Figure 21 Overview of the 6 bp deletion in the ‘107829, male, 7 Jan, B2/B3/B5’ sample by Poly Peak Parser [22].

A 6 bp deletion in the snai2 gene at this location leads to the change of a single codon at position 130 and the deletion of two amino acids. The only change in amino acids is the codon at position 130 encoding glutamic acid instead of glutamine (Fig. 22).

28

Figure 22 Overview of the mutated genome of the ‘107829, male, 7 Jan, B2/B3/B5’ sample. A glutamic acid instead of a glutamine is encoded at position 130 bp.

Again a sample from another fish with label ‘107829, male, 12 Jan, B17’ (F1), contains the exact same mutation (Fig 23).

Sample ‘107896, male, 22 Jan, C1’ (F1) was also positive tested by an HRMA (Fig. 24).

Figure 24 Display of the HRMA of samples ‘107896, male, 22 Jan, C1’. The red lines display the aligned melting curve of the wil type embryos. The blue line displays the aligned melting curve of sample ‘107896, male, 22 Jan, C1’, showing a heterozygous mutation.

Figure 23A Display of the HRMA of sample ‘107829, male, 12 Jan, B17’.

Figure 23B overview of the 6 bp deletion in the ‘107829, male, 7 Jan, B17’ sample by Poly Peak Parser [22].

29

In this case, embryo C1 (F1) was the only sample from Fish C of the F0 generation that carried this mutation. Other mutations of fish C and other fish from the 107896 family are displayed in attachement IV. Based on the HRMA, the sample was sequenced using the same primerset as discussed in section 2.2.6. The result of the sequencing is displayed in Figure 25.

Figure 25 Display of the sequence of the upper and lower strand of the amplified region in the genomic DNA of sample ‘107896, male, 22 Jan, C1’ by a chromatogram. Wild type zebrafish DNA is used as a reference.

The upper chromatogram in Figure 32 starts showing double peaks after 5’ – CACCCC – 3’, where the chromatogram beneath starts showing double peaks after 3’ – CCCCAC – 5’. To determine the exact mutation, again a manual method is executed on the data to determine the exact mutation in the genomic DNA. This resulted in a 5 bp deletion near the target site of sgRNA2. The manual outcome was compared to the results given by the software program Poly Peak Parser [22] (Fig. 26).

Figure 26 overview of the 5 bp deletion in the ‘107896, male, 22 Jan, C1’ sample by Poly Peak Parser [22].

The 5 bp deletion led to a frameshift and premature stopcodon downstream near the region in which the mutation has occurred in the genomic DNA (Fig. 27). The change in amino acids upstream of the premature stopcodon are displayed in attachement IV.

Figure 27 Overview of the mutated genome of the ‘107896, male, 22 Jan, C1’ sample. Again the stopcodons are displayed as red squares.

32

4 Discussion

4.1 BAC recombineering To display a successful insert of a targeting insert into the BAC construct, a colony PCR was performed. This PCR failed to work when using the same protocol for each insert. Adjusting the PCR protocol for each insert made it possible to prove successful incorporation of a specific targeting insert. Due to a shortage of time, the BAC construct was not injected into zebrafish embryos and imaged. This procedure is yet to be performed.

4.2 CRISPR mutants CRISPR mutants were confirmed by HRMA and sequencing as explained in section 2.2. For the determination of the mutation rate of a batch with a specific sgRNA a HRMA was performed as explained in section 2.2.5. The primerset for the control of the mutationrate on the second target site (sgRNA2) by an HRMA showed a divergent amplification plot (see figure 11A). This means that the primerset amplifying the DNA region containing the second target site on the genomic DNA were not properly designed and did not give an accurate PCR product. However, after injections of sgRNA1/sgRNA2 in the Tg BAC acta2:YFP batch, an agarose gel showed a sample that was significantly shorter than the other products (see figure 13, lane 6). This implicates cleavage of the sgRNAs at the same time and loss of the 75 bp long DNA fragment in-between the cleavage sites. Because the DNA ladder is not accurate, a close estimation of the length of the highlighted sample (Fig. 18, lane 6) could not be made. Yet, if double cleavage occurred, the proper functioning of the CRISPR complex with sgRNA2 on the second target site has been demonstrated. Another demonstration of the functioning of sgRNA2 is the sequencing data showing a 5 bp deletion near the second target site in the DNA of sample ‘107896, male, 22 Jan, C1’ in section 3.2.3 (see figure 25 & 26). Another important issue is the creation of a homozygous F1 generation with a stabile CRISPR mutation. Injecting a CRISPR/Cas9 complex into the single cell stage of a zebrafish embryo should theoretically result in a mutation that is then passed on through every cell. Therefore the germline, so every germcell, should contain the same genomic mutation. However, HRMA and genotyping (attachement IV) shows us that crossing CRISPR mutant F0 generations 107829 and 107896 with wild type zebrafish results in embryos that contain different mutations. This might be possible because the cutting of the CRISPR/Cas9 complex and the NHEJ DNA repair do not all occur in the same stage of the embryo. The implication of DNA repair happening in, for example, the two-cell stage of the embryo, gives rise to the possibility of different mutations in the germline of one injected embryo. The creation of a clean homozygous CRISPR mutant generation requires an equal mutation. Therefore, it is better to create a heterozygous F1 generation and a homozygous F2 generation for imaging. This way, zebrafish of the F1 generation can be genotyped and selected based on their mutation for the creation of the F2 generation. This will result in a clean homozygous F2 generation.

33

5 Conclusions This research shows that a stabile Bacterial Artificial Chromosome construct can be created for the targeting of the pdgf-β gene with a TagRFP-T fluorescent protein by BAC recombineering. Creation and imaging of the Tg pdgf-β:TagRFP-T is still in progress. Genotyping has proven that a snai2 knockout mutant of the Danio Rerio can be generated by the CRISPR/Cas9 technology. Design and co-injection of several site-specific single guide RNAs gives rise to accurate cleavage by a Cas9 endonuclease on a targeted site in the second and third exon of the snai2. A premature stopcodon can be introduced in the beginning of the Zinc-finger DNA binding domain of Snail2 leading to a non-functional protein. This gives rise to the conclusion that the loss of function of snai2 can be induced by the generation of a CRISPR mutant.

6 Recommendations For more effective BAC recombineering, the colony PCR protocol should be optimized for it to work on every targeting insert. This way it will be more accurate, and all primers of earlier performed inserts can be used in the role of a positive control during the same colony PCR.

As discussed in section 4.2, the most important next step would be the creation of a clean homozygous F2 generation that can be used for imaging. This way a specific phenotype can be connected to the knockout of Snail2 and the function of Snail2 can possibly be more accurately determined. For the determination of a more accurate model for the expression profile of Snail2, a transgenic line specific for smooth muscle cells can be generated. If a Snail2 knockout is created in this Tg line, confocal microscopy could possibly reveal more about the expression profile of Snail2 and also its function.

Because an implication of Snail2 is to be controlled by Notch signalling, a knockout model of Notch3 could possibly reveal more about the involvement of Notch signalling in the control of Snail2 if injected in a transgenic line that expresses a fluorescent protein under the control of the snai2 promotor, for example snail2T2A:GFP. Also because the mCherry and GFP expression in the transgenic lines controlled by the snai2 promotor are not really strong, it would be better to create a transgenic line that shows stronger expression of the reporter cassette. For example by the use of Upstream Activating Sequence (UAS) cassettes in front of the reporter cassette, or by the use of a different reporter cassette.

Another interesting process to investigate would be the cleavage by different CRISPR complexes at the same time, enabling a large DNA fragment to be deleted out of the genome. Because CRISPRs are relative cheap and it is a quick method. Optimizing this method would allow the deletion of large fragments relatively easy.

34

7 Self reflection In my time at the Institute for Molecular Bioscience I have gained a lot of experience and knowledge. A hard thing about an internship in general I think is the start. When you are in the lab on your own and you have to start organising your projects and own experiments. When I started I made many mistakes because of the fact that I didn’t organise my experiments properly. This made it very chaotic. I think I learned quite quickly that organising and planning your day enables me to keep a better focus on my experiments without being distracted about other thoughts of things I have to do. Another aspect is lab skills. On Fontys University you learn many skills but don’t use those skills to often. When you work in a lab and have to use specific skills every day, you learn how to work more effective. After a while, when you get better at some things, you start saving a lot of time and experiments seem to succeed more often. In the beginning I found it hard that I had to repeat experiments because they didn’t work. Speaking with colleagues in the lab taught me that that is also a part of working in the lab and that it is just a matter of trouble shooting to make an experiment succeed. My overall experience at the IMB has been insanely good. I had a very nice working environment and nice people around me to work with. A new and cool experience I thought was the fact that I really lead my own project, even though my supervisor informed me about the plan of the project, helped me gaining some important skills and helped me make decisions during my project. The project I have been working on is not completely finished yet, and if I had the chance I would stay another year to finish it properly!

35

8 References [1]: Qiagen, ‘DSB repair by homologous recombination’, consulted on 25/09/14,

http://www.qiagen.com/products/genes%20and%20pathways/pathway%20details.aspx?pwid=143

[2]: Dickinson DJ, Ward JD, Reiner DJ, Goldstein B, ‘Engineering the

Caenorhabditis elegans genome using Cas9-triggered homologous recombination’, consulted on 25/09/14, http://www.ncbi.nlm.nih.gov/pubmed/23995389

[3]: Thomas Gaj, Charles Gersbach, Carlos F Barbas, ‘ZFN, Talen, and

CRISPR/Cas-based methods for genome engineering’. Trends in Biotechnology, Vol. 31, No. 7, pp. 397 – 398.

[4]: Ryan M. Walsch, Konrad Hochedlinger, ‘A variant CRISPR-Cas9 system

adds versatility to genome engineering’. PNAS, Vol. 110, No. 39, pp. 15514 – 15515.

[5]: Kent WJ, ‘BLAT – the BLAST-like allignment tool’, last consulted on

20/10/2014, https://genome.ucsc.edu/cgi-bin/hgc?hgsid=389893389_R6ZGinWT5pAJdMtTmECGiDvdIA7c&c=chr24&o=36882657&t=36888674&g=refGene&i=NM_001008581

[6]: Jason C. Kovacic, Nadia Mercader, Miguel Torres, Manfred Boehm, Valentin

Fuster, ‘Epithelial-to-Mesenchymal and Endothelial-to-Mesenchymal Transistion’, consulted on 29/09/2014, http://circ.ahajournals.org/content/125/14/1795.long#sec-5

[7]: LeBlue VS, Macdonald B, Kalluri R, ‘Structure and function of basement

membranes’, Exp Biol Med (Maywood), October 2009, Vol. 239, No. 9, pp. 1121 [8]: Carlos O. Lizama, Ann C. Zovein, ‘Polarizing pathways: Balancing

endothelial polarity, permeability, and lumen formation’, Elsevier, March 2013, Vol. 319, pp. 1247 – 1254.

[9]: Samy Lamouille, Jian Xu, Rik Derynck, ‘Molecular mechanisms of epithelial-

mesenchymal transitions’. Molecular Cell Biology, Vol. 15, March 2014, pp. 178-196.

[10]: Melissa G. Mendez, Shin-Ichiro Kojima, Robert D. Goldman, ‘Vimentin

induces changes in cell shape, motility, and adhesion during epithelial to mesenchymal transistion’, The FASEB Journal, june 2010, Vol. 24, No. 6, pp. 1838 – 1851.

[11]: Yifan Wang, Jian Shi, Kequn Chai, Xuhua Ying, Binhua P. Zhou, ‘The role

of Snail in EMT and Tumorigenesis’, Current cancer drug targets, Vol. 13, April 2014, pp. 963 – 972.

36

[12]: M. Angela Nieto, ‘The Snail superfamily of zinc-finger transcription factors’. Nature reviews, Molecular Cell Biology, Vol. 3, March 2002, pp. 155 – 160.

[13]: S. Potenta, E. Zeisberg, R. Kalluri, ‘The role of endothelial-to-mesenchymal

transition in cancer progression’. British journal of cancer, Vol. 99, September 2008, pp. 1375 – 1379.

[14]: Laurens A. Van Meeteren, Peter ten Dijke, ‘Regulation of endothelial Cell

plasticity by TGF-β’. Cell Tissue Res, Vol. 347, 2012, pp. 177 – 186. [15]: Thomas H. Adair, Jean-Pierre Montani, ‘Angiogenesis’. Morgan & Claypool

Life sciences, 2010. [16]: Florian Milde, Michael Bergdorf, Petros Koumoutsakos, ‘A Hybrid Model

for Three-Dimensional Simulations of Sprouting Angiogenesis’. Biophysical Journal, October 2008, Vol. 95, No. 7, pp. 3146 – 3160.

[17]: Yuying Wang, Luyuan Pan, Cecelilia B. Moens Bruce Appel, ‘Notch3

establishes brain vascular integrity by regulating pericty number’. The company of development, Vol. 141, 2014, pp. 307 – 317.

[18]: Jorg Reichrath, Sandra Reichrath, ‘Notch Signaling in Embryology and

Cancer’. Landes Bioscience, New York, 2012, pp. 250 – 251. [19]: Stuart J. Mills, Allison J. Cowin, Pritinder Kaur, ‘Pericytes, mesenchymal

stem cells and the wound healing process’, Cells, 2013, Vol. 2, pp. 622. [20]: Tessa G. Montague, Jose M. Cruz, James A. Gagnon, George M. Church,

Eivind Valen, ‘CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome editing’. Nucleic Acids Research, 2014, Vol. 42. https://chopchop.rc.fas.harvard.edu/about.php

[21]: J. Ye, G. Coulouris, I. Zaretskaya, I. Cutcutache , S. Rozen, T.L. Madden,

‘Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction’, BMC Bioinformatics, June 2012, Vol. 18, No. 134, http://www.ncbi.nlm.nih.gov/pubmed/?term=22708584

[22]: Hill JT, Demarest BL, Bisgrove BW, Su YC, Smith M, Yost HJ (2014),

‘Poly Peak Parser: method and software for identification of unknown using sanger sequencing of PCR products’. Consulted on 22/01/2015, http://spark.rstudio.com/yostlab/PolyPeakParser/.

[23]: Nandor Nagy, Olive Mwizerwa, Karina Yaniv, Liran Carmel, Rafael

Pieretti-Vanmarcke, Brant M. Weinstein, Allan M. Goldstein, ‘Endothelial cells promote migration and proliferation of enteric neural crest cells via β1 integrin signaling’. Developmental Biology, June 2009, Vol. 330, No. 2, pp. 263 – 272.

37

[24]: John J. Armstrong, Karen K. Hirschi, ‘Recombineering of BAC DNA for the Generation of Transgenic Mice’, consulted on 15/10/2014, http://cdn.intechopen.com/pdfs-wm/24401.pdf

[25]: Kevinsche, ‘ The big bad bac: Bacterial Artificial Chromosomes’, consulted

on 16/10/2014, http://www.scq.ubc.ca/the-big-bad-bac-bacterial-artificial-chromosomes/

[26]: Louise van der Weyden, David J. Adams, Allan Bradley, ‘Tools for targeted

manipulation of the mouse genome’, Physiological Genomics, January 2002, Vol. 11, No. 3, pp. 133 – 164.

[27]: Jeroen Bussmann, Stefan Schulte-Merker, ‘Rapid BAC selection tol2-

mediated transgenesis in zebrafish’. ‘TECHNICAL PAPER’, accepted: 22 june 2011.

[28]: Muyers, J.P.P.P et al, ‘Rapid modification of bacterial artificial

chromosomes by ET-recombination, Nucleic Acids Research, 1999, Vol. 27, pp. 1555 – 1557.

[29]: Roger Y. Tsien, ‘The Green Fluorescent Protein’, Annual Review of

Biochemistry, July 1998, Vol. 67, pp. 509 – 544. [30]: Kazuhide Asawaka, Koichi Kawakami, ‘Targeted gene expression by the

Gal4-UAS system in zebrafish’. Japanse society of developmental biologists, accepted: 22 march 2008.

[31]: Katja Prubing, Aaron Voigt, Jorg Schulz, ‘Drosophila melanogaster as a

model organism for Alzheimer’s disease’, Molecular Neurodegradation, 2013, Vol. 8, No. 35.

[32]: Ryan M. Walsch, Konrad Hochedlinger, ‘A variant CRISPR-Cas9 system

adds versatility to genome engineering’. PNAS, Vol. 110, No. 39, September 2013, pp. 15514 – 15515.

[33]: P. Perez-Pinera, ‘RNA-guided gene activation by CRISPR-Cas9-based

transcription methods’, consulted on 07/10/2014, http://2013.igem.org/Team:Duke/Project/Basics.

[34]: James A. Gagnon, Eivind Valen, Summer B. Thyme, Peng Huang, Laila

Ahkmetova, Andrea Pauli, Tessa G. Montague, Steven Zimmerman, Constance Richter, Alexander F. Schier, ‘Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of Single-Guide RNAs’. PLOS one, Vol. 9, No. 5, May 2014, e98186.

[35]: F. Ann Ran, Patrick D. Hsu, Jason Wright, Vineeta Agarwala, David A.

Scott, Feng Zhang, ‘Genome engineering using the CRISPR-Cas9 system’. Nature Protocols, Vol. 8, October 2013, pp. 2281 – 2308.

38

[36]: Maria Eali, Carl T. Wittwer, ‘High Resolution Analasys for Gene Scanning’, PMC, Vol. 50, No. 4, April 2010, pp. 250 – 261.

39

Attachement I: Transgenesis by BAC selection A BAC (Bacterial Artificial Chromosome) is an artificial DNA construct, based on a fertility plasmid found in Escherichia Coli called the F-plasmid [24]. This F-plasmid is a DNA molecule that is separate from chromosomal DNA. An important property of this plasmid is a process called conjugation. Conjugation allows to be transferred from one bacterial cell to another bacterial cell by direct cell-to-cell contact. BACs are transferred into a bacterial cell by a process called transformation. Transformation is another way for exogenous DNA to be directly transported through the membrane of a bacterial cell. BACs are constructed to contain the F-plasmid with a complete locus of one or more genes. BACs can maintain genomic DNA sequences up to 350 Kbp in length. This means that a BAC may also contain all upstream regulatory elements necessary for gene expression such as the promoter region. The gene in a BAC can therefore be expressed in a cell where all necessary transcriptional factors are also expressed. For the study of the transcription and expression of genes in specific cells BACs are an efficient tool. To study a gene of interest, a gene-specific BAC has to be constructed.

To design a proper BAC plasmid, gene loci have to be incorporated into the BAC. Development and optimization methods for harnessing these BAC carrying gene loci are required. These methods are referred to as BAC recombineering. BAC recombineering relies on the presence of unique restriction enzyme sites in the F-plasmid via a series of digestions. Ligation processes then incorporate the desired DNA sequence into the plasmid (Fig. 28).

Figure 28 BAC construct containing a certain gene of interest ligated in the F-plasmid [25].

An important system to insert specific DNA regions into the BAC plasmid is

Homologous Recombination. This system requires linear DNA as a template, as explained in section 1.3.1. Homologous Recombination is a way to repair double stranded DNA breaks. If the used DNA template contains the desired DNA sequence along with a 50 basepair 3’ and a 5’ homology arm, it can be incorporated into the BAC plasmid (Fig. 29). The 3’ homology arm has to be homologous at the 5’ site of the DSB in the BAC plasmid, where the 5’ homology is required to be homologous at the 3’ site of the DSB in the BAC.

A

Figure 29 Insert incorporation in BAC by homologous recombination. The insert DNA contains two homology arms [26]. The 5' homology arm is homologous to the left of the DSB in the BAC plasmid, while the 3' homology arm is homologous to the right side.

The lineair template DNA necessary for homologous recombination can be

generated by PCR. Designing proper primers, specific regions of linear DNA can be amplified for the use of BAC recombineering [27]. Homologous recombination is a process that has to take place inside bacteria, as it relies on many enzymes. This is why the BAC plasmid is grown in an E. coli strain. A pRedET plasmid is co-transferred into this E. coli strain along with the BAC plasmid, as it expresses restriction- and ligation enzymes necessary for the incorporation of the PCR amplified linear DNA template. Electroporation is used to create Double Stranded Breaks in the BAC plasmid. The enzymes expressed by the pRedET plasmid can induce homologous recombination if the DSB is generated on a position where the homology arms of the linear template are homologous to the 5’ and 3’ site relative to the DSB in the BAC plasmid (Fig. 30). DSB positions in the BAC where the homology arms are not complementary, homologous recombination will not be possible. Those DSBs will be repaired using Non Homologous End Joining. Because these sites will contain random insertions or deletions of a variable number of nucleotides after repair, they will not be specific BACs containing the gene of interest. The specific generated BACs have to be separated from non-specific BACs. Incorporating a resistance gene against a specific antibiotic into the backbone of the BAC plasmid creates this selection. This resistance gene, also amplified by PCR, is co-incorporated in the linear DNA template along with the gene of interest. The template containing the gene of interest, the resistance gene and the necessary 50 basepair homology arms are generated by connecting the PCR products of the specific amplified linear DNA regions using a region of non-coding DNA. The non-coding sequence between the resistance gene and the gene of interest does not influence the expression of the genes. As homologous recombination uses this linear DNA template as an insert, only DSBs in BACs repaired by homologous recombination will now contain the gene of interest along with the resistance gene. The resistance gene protects the bacteria against a

B

specific antibiotic. Bacteria containing BAC plasmids that have not incorporated the insert by homologous recombination will therefore not be protected against the chemical, and will die when exposed to it. Selection takes place by plating the bacteria on a plate containing the specific antibiotic. This way only bacteria containing the BAC plasmids with the resistance gene in their backbone, the ones where homologous recombination repaired DSBs will survive and form colonies.

pRedET is a plasmid that is very sensitive for changes in temperature and is best kept with 30 °C. For the BAC constructs it is best to grow at 37°C when the DNA template is successfully incorporated in the plasmid. Changing the temperature from 30 to 37 °C will destroy the pRedET plasmid. When only one insert has to be incorporated in the BAC plasmid, the pRedET plasmid is no longer necessary in the bacteria after successful incorporation. Though, if a second insert is to be incorporated into the BAC construct, the pRedET plasmid has to be re-transformed into the bacteria to again provide the enzymes required for homologous recombination.

Figure 30 inserting linear DNA template containing the gene of interest along with the resistance gene into the backbone of the BAC plasmid [28]. pRedET as an external plasmid providing the necessary enzymes for restriction and ligation activity.

When a BAC construct is present in a mammalian cell it can provide information about the tissue in which cells transcribe certain genes, and the tissue of which the cells express certain proteins. BAC plasmids are constructed to contain a complete gene of interest, meaning that it also contains the upstream regulatory sequences including the promoter. The promoter region of the DNA, when bound with gene specific transcription factors, regulates transcription of a gene. If this promoter region has a downstream start codon and protein coding sequence, a protein is expressed.

Green Fluorescent Protein (GFP) is a protein that is able to generate a highly visible emitting internal fluorophore when exposed to light in the blue ultraviolet range [29]. This makes it a protein that can easily be detected when it is expressed in cells, giving information about the location of its expression.

C

BAC plasmids can be constructed to contain the coding sequence of the GFP protein. For studying the location of transcription of the snai2 gene, a BAC particular plasmid is constructed. It is constructed to express GFP under the control of the snai2 promoter region. Connecting the upstream regulatory sequence of snai2, carrying the promoter region, to the protein-coding sequence for GFP induces the expression of GFP. The only extra requirement is a start codon upstream of the protein-coding region. The constructed BAC plasmid is then injected into a zebrafish embryo. Besides that every cell of the zebrafish will contain its genomic DNA it will now also contain the DNA of the BAC plasmid.

To find out in which cells the Snail2 protein is expressed, a BAC plasmid is constructed containing the protein sequences of both Snail2 and GFP downstream of the snai2 promoter region and start codon. This will result in a GFP protein and a Snail2 protein. Because Snail2 is not fused to GFP, Snail2 is still able to migrate independently of GFP. This means that the detection of GFP in a particular cell does not mean that Snail2 is also still present in that same cell.

To construct a BAC carrying more then one inserted DNA regions, several incorporation processes need to be performed (Fig. 31). If the BAC is constructed to carry a promoter region and a protein-encoding region, two different incorporation steps have to be performed. A requirement for expression is that the promoter region has to be attached to the protein-encoding region. This requirement has to be satisfied in preparing the DNA templates for the inserts. The insert of the promoter region will be the first insert, as this lies upstream of the protein-encoding region. The protein-encoding region has to be inserted directly downstream of the promoter region. This means that the upstream 50 basepair homology arm of the second insert will have to be homologous with the last 50 basepairs of the promoter region. It also means that, for the insert to be properly performed, the DSB for the second insert has to be directly downstream of the promoter region (Fig. 32).

D

Figure 31 promoter region and protein-encoded region displayed as two separate DNA templates. the DNA template carrying the Smooth Muscle α-Actin (ACTA2) promoter region will be inserted first. The template carrying the GFP encoding region will be inserted second. This template can only be incorporated into the BAC plasmid when the DSB is generated directly downstream of the promoter region. The required restriction site is indicated with the green cross.

Figure 32 the result when both templates are successfully incorporated in the BAC plasmid. A recombineered BAC plasmid carrying a Smooth Muscle α-Actin (ACTA2) promoter and a GFP encoding sequence.

A last requirement is needed to use BAC plasmids for recombineering. In order for the DNA of the BAC plasmids to be expressed they need to be incorporated in the genome of the Danio Rerio, because only genetic information in the genomic DNA is transferred to daughter cells. For this incorporation a last incorporation of a DNA template into the BAC plasmid is needed.

E

This template carries Long Terminal Repeats (LTRs) [27]. These LTRs contain a sequence that is recognised by an enzyme called Tol2 transposase. Tol2 transposase is an enzyme able to cleave the BAC plasmid, making it linear DNA, and integrate it into the genome. The DNA template is constructed to carry two inverted LTRs enclosing a resistance gene. This template is incorporated into the BAC plasmid in the same way as earlier templates were incorporated. In the presence of Tol2 transposase in the cell, DSBs are generated inbetween the LTRs and the resistance gene (Fig. 33). The resistance gene is cleaved in this progress, and the BAC is able to stretch to linear DNA. Another function of Tol2 transposase is to integrate the linear BAC DNA into the genome. Tol2 recognises many sequences in the DNA and is able to cleave at many positions. Tol2 mediates the integration of the linear BAC DNA into the genome at a random position in the DNA. To enable this integration into the genome of the Danio Rerio, Tol2 transposase has to be present in the cell. Therefore, the generated BAC plasmid is co-injected with mRNA encoding Tol2 transposase into one-cell zygotes. Because Tol2 transposase is only required for the incorporation of the BAC DNA into the genome, mRNA encoding Tol2 transposase enables Tol2 transposase only to be present in the injected cell of the one-cell zygote. The integrated BAC DNA in the genomic DNA is called a transgene.

Figure 33 (A) a modified BAC clone carrying only the gene of interest [27]. (B) Incorporation of the Tol2 insert carrying two inverted LTRs enclosing a Ampicillin resistance gene (ampR). (C) In the second recombineering step, the reporter gene 'citrine' (yellow) and a kanamycin resistance gene (kanR) are incorporated at the start codon of the gene of interest. Tol2-mediated transgenesis cleaves ampR, linearizes the BAC DNA, and incorporates it into the Danio Rerio genome.

The expression pattern of the reporter gene of a BAC construct integrated in

the genome depends on a lot of factors. For example, the transgene could be integrated in a less active site in the genome, meaning that expression of the transgene would be low. This makes the expression pattern hard to control. Yet there is a way to increase expression of a transgene integrated in the genome. The solution lies in a different design of the BAC construct where expression of a reporter gene under the control of the promoter of a specific gene of interest is induced. An extra sequence called the Upstream Activating Sequence (UAS) is introduced [30]. A UAS is a sequence that is able to activate the transcription of downstream target genes when bound to Gal4. The advantage of this Gal4-UAS system is that it is an enhancer of

F

overexpression of genes downstream of the sequence. To study the expression profile of a certain gene, the Gal4-UAS system has to be designed to be specific for that gene. Instead of designing a BAC construct where the promoter of a gene of interest is attached to a reporter gene, the promoter sequence is attached to a region encoding Gal4. When this construct would be integrated in the genome, Gal4 would be expressed in specific cells under the control of the promoter region. Gal4 binding to UAS activates transcription of downstream genes. Therefore, if a UAS and a downstream reporter gene are designed to be constructed in the same transgene, the expression of Gal4 induces the expression of the reporter gene (Fig. 34). Single transcription factors can induce the activation of the gene for a period of time where Gal4 is expressed. The Gal4, now present in the cell, can on it’s turn induce activate the gene carrying the reporter cassette. The reporter gene can therefore be expressed for as long as Gal4 keeps binding the UAS. With this mechanism, expression of the reporter gene is amplified.

Figure 34 Gal4-UAS system [30]. The expression of Gal4 under the control of the promoter of a gene of interest (endogenous promoter). UAS when bound to the expressed Gal4 inducing transcription of a reporter gene (transgene).

The application of transgenic lines allows the investigation of the expression profile of a large range of genes. An example for the use of transgenic zebrafish lines is to display the vascular system using two different double transgenic lines. These transgenic lines are used to compare the expression profile of cells specific to the blood vasculature to the expression profile of Snail2. One of the double transgenic lines is kdrl:mCherry snail2T2A:GFP. kdrl is a gene encoding kinase insert domain receptor. Kdrl is a vascular endothelial growth factor and is specific to the blood vasculature. A second double transgenic line also uses the promotor of kdrl to control express a fluorescent protein. This double transgenic zebrafish line, kdrl:GFP snai2:mCherry, uses the same promotors to control the expression of fluorescent proteins. Both double transgenic lines can be used to investigate the expression profile of Snail2 relative to the blood vasculature. A wild type zebrafish of both transgenic lines has been imaged (Hogan lab unpublished data. A. Lagendijk) to investigate the expression profile of Snail2 (Figure 35). The part of the zebrafish that is imaged is called the trunk of the zebrafish.

G

Figure 35 Display of the position of the trunk in the zebrafish [23]. (B) Displaying the trunk of the WT zebrafish by kdrl:mCherry, and the cells near the blood vasculature expressing the fusion protein Snail2-T2A-GFP (Hogan lab unpublished data. A. Lagendijk). (C) Displaying the trunk of the WT zebrafish by kdrl:GFP, and the cells near the blood vasculature where mCherry is expressed under the influence of the promotor of snai2.

The trunk, displaying the blood vasculature in Figure 35B shows the axial vasculature of the zebrafish. The figure shows that the expression of mCherry (red) under the influence of the blood vascular tissue specific promotor kdrl is surrounded by Snail2-T2A-GFP (green). The blood vasculature shows a bright vessel that represents the dorsal aorta. Under that vessel with a much weaker expression of mCherry the posterior cardinal vein is being formed.

Another image of a wild type double transgenic zebrafish Tg kdrl:GFP snail2:mCherry (Fig. 35C) also displays the blood vasculature in the trunk of the zebrafish 23 hours post fertilization. This figure shows the expression of GFP (green) under the influence of the kdrl promotor and the expression of mCherry (red) under the influence of the snai2 promotor. Here the dorsal aorta is expressed brighter than it is in figure 36. Also the intersomitic vessels are forming starting from the dorsal aorta (vertical green vessels in between mCherry expression). Again the posterior cardinal vein is lightly recognizable just beneath the dorsal aorta. The expression of mCherry is ubiquitous, meaning that it is largely expressed in the area. However, the brightest expression is neat the dorsal aorta.

Based on these images an accurate conclusion about the cells in which Snail2 would be expressed cannot be made. However the use of these double transgenic lines displayed shows that the expression of Snail2 is close to the blood vasculature. This information in combination with the function of Snail 2 being involved in EMT-like processes (explained in section 1.3.2), leads to an implication that Snail2 is expressed in cells that are associated with vascular endothelial cells, potentially endothelial cells.

H

Attachement II: CRISPR/Cas9 technology The Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) associated Cas9 system originated from the adaptive immunity in bacteria [31]. The method has recently been applied to genome editing in many model organisms. CRISPR is a microbial nuclease system for the defence against phages and plasmids. CRISPR regions in DNA of microbial hosts contain a CRISPR-associated gene, encoding nuclease, as well as non-coding RNA elements capable of programming the specificity of the cleavage by the nuclease encoded by the CRISPR-associate gene. The CRISPR-associated gene encodes for the Cas9 enzyme, which is a nuclease able to cleave site-specific. The CRISPR/Cas9 system can be used as a genome editing tool in order to create biological models of certain genes. But in order to target a specific gene where cleavage by Cas9 should occur, design and syntheses of a proper artificial ‘non-coding RNA element’ has to be performed, in order to cleave site-specific by Cas9 endonuclease.

A short CRISPR RNA component (crRNA) should be designed that contains 20 basepairs that are complementary to the gene of interest in the genomic DNA of the organism [32]. The complementary region in the genomic DNA is called the protospacer. The crRNA, complementary to the protospacer, is used by Cas9 to be directed to the cleavage site. Another CRISPR RNA, called the transactivating RNA (tracrRNA), is fused to the crRNA. This tracrRNA is required to form ribonucleoprotein complexes with the Cas9 nuclease. The product of crRNA with the tracrRNA is called the single guide RNA (sgRNA). The sgRNA is required for Cas9 endonuclease to clave site-specific.

A Protospacer Adjacent Motif (PAM) sequence is required for the site-specific cleavage. This sequence has to be directly attached to the photospacer in the genomic DNA to which the sgRNA binds (Fig. 36). The PAM sequence is needed for Cas9 endonuclease to bind to the DNA. It comes in different sizes and can contain different nucleotides. 5’ – NGG – 3’ is a common used PAM sequence because it is found quite frequently in the genome. Because the PAM sequence is already located in the genome it does not have to be presented in the designed sgRNA.

Figure 36 CRISPR - associated Cas9 site-specific cleavage [33]. Designed sgRNA binds genomic DNA, and attracts Cas9 nuclease for the generation of a DSB in the genomic DNA. 5’ – NGG – 3’ PAM sequence attached to genomic target.

I

The sgRNA required for the CRISPR/Cas9 technology has to be generated using DNA templates [34]. To generate templates for the sgRNA transcription, gene-specific oligonucleotides containing the SP6 promotor sequence (5’ – ATTTAGGTGACACTATA – 3’) and the 20 base target site are fitted in one strand. This strand is then annealed to a constant oligo encoding the reverse-complement of the tracrRNA. To anneal both strands, the strand containing the SP6 promotor region and the 20 base target site, is designed with a small region called the overhang. When both strands are annealed they can be extended, meaning that the single stranded DNA gets ‘filled-in’ to create double stranded DNA (Fig. 37). Using in vitro transcription, the designed sgRNA, containing all necessary regions, is created.

Figure 37 creation of a template for the sgRNA transcription [34]. The template is containing the SP6 promotor, the 20 base target site and a overhang region that is complementary with the constant oligo. This DNA is transcribed in vitro to create the sgRNA.

When the sgRNA is synthesised, it can be injected into a zebrafish embryo. The injection is a mixture of the sgRNA and Cas9 endonuclease. The sgRNA/Cas9 complex within the cell of the one cell stage of the embryo, will guide the Cas9 to the targeted position in the genomic DNA of the embryo. This way the site-specific DSB can be generated. Non-Homologous End Joining is a way of DNA repair often resulting in insertions or deletions of a variable number of nucleotides (InDels) at the site of the DSB [35]. These InDels can disrupt the Open Reading Frame (ORF) of the targeted gene by creating a frameshift downstream of the DSB and/or a premature stop codon (Fig. 38). This way of DNA repair occurs in the absence of a suitable template. The introduction of a premature stop codon as a result of the frameshift will lead to the end of translation, and an incomplete protein. A gene knockout is generated when the expression of the target gene is altered or supressed resulting in a non-functional protein or no protein at all. Because the size and composition of the InDel occur randomly, the type and composition of the mutation in the genomic DNA of the embryo will need to be determined by sequencing, a method that reveals the DNA sequence of the mutated target gene.

J

Figure 38 NHEJ DNA repair. DSB fixed by the Non-Homologous End Joining pathway by an insertion or deletion (InDel) at the DSB site [35]. The InDel causing a frameshift and a premature stop codon, resulting in a gene knockout and a mutation.

K

Attachement III: High Resolution Melting Assay A High Resolution Melting Analysis (HRMA) is a quick way to compare the length of DNA products. It only includes three steps: DNA preparation, PCR and scanning by high resolution melting [36]. This biological assay is based on the denaturing of double stranded DNA when heated. The temperature when 50% of the DNA strands separate is called the melting temperature (Tm). It depends on the number of basepairs of the DNA product and the GC-content. Fluorescent markers in between basepairs of double stranded DNA can easily be measured, showing if DNA is double stranded or has become single stranded. HRMA is usually performed on relatively small DNA regions. If the regions are too long, chances are that the melting of the double stranded DNA occurs in more stages, making the Tm hard to define. For the CRISPR/Cas9 method, HRMA is a quick and cheap way to determine if injection of the CRISPR complex has caused any mutations in the genomic DNA of an embryo.

At the location of the DSB in the genomic DNA, an insertion or deletion of a variable number of nucleotides changed the size of the DNA. The change in size can be displayed by HRMA. Comparing the melting curve of these injected embryos with the melting curve of the genomic DNA of embryos that have not been injected with the CRISPR complex, a change in the length of the DNA can be determined. The number of basepairs added to, or deleted in the genomic DNA, can also be determined. Because of the site-specific cleavage of the CRISPR complex in just one gene of interest, only that region in the genomic DNA of the embryo has to be analysed. To limit the HRMA to this region in the DNA, a specific forward- and a reversed primer must be designed to define only the region within the gene of interest where the mutation should have taken place. Using the right primers, this region is amplified by the PCR included in the HRMA.

For the HRMA, 384 well plates are used to load the samples. This way the wells can be loaded with DNA from different embryos and analysed separately. The results are to be compared. Based on the comparison between injected and uninjected embryos, mutations and their size can be determined. HRMA cannot be used to determine the precise DNA sequence of the mutation. Therefore HRMA can only be used to determine whether the CRISPR technology is suitable for the genomic DNA that is used. For a precise comparison of DNA sequences between injected and uninjected embryos, next generation sequencing is a suitable biological method.

L