Antimicrobial Activity of Community-associated Methicillin-resistant Staphylococcus aureus Is Caused by Phenol-solubleModulin Derivatives*

Received for publication, January 13, 2011, and in revised form, January 24, 2011 Published, JBC Papers in Press, January 28, 2011, DOI 10.1074/jbc.M111.221382

Hwang-Soo Joo, Gordon Y. C. Cheung, and Michael Otto1

From the Laboratory of Human Bacterial Pathogenesis, NIAID, The National Institutes of Health, Bethesda, Maryland 20892

Community-associated methicillin-resistant Staphylococcusaureus (CA-MRSA) are causing an ongoing pandemic of mostlyskin and soft tissue infections. The success of CA-MRSA aspathogens is due to a combination of antibiotic resistance withhigh virulence. In addition, it has been speculated thatCA-MRSA strains such as the epidemic U.S. clone USA300 haveincreased capacity to colonize human epithelia, owing to bacte-riocin-based bacterial interference. We here analyzed themolecular basis of antimicrobial activity detected in S. aureusstrains, including those of the USA300 lineage. In contrast to aprevious hypothesis, we found that this activity is not due toexpression of a lantibiotic-type bacteriocin, but proteolyticallyprocessedderivatives of thephenol-solublemodulin (PSM)pep-tides PSM�1 and PSM�2. Notably, processed PSM�1 andPSM�2 exhibited considerable activity against Streptococcuspyogenes, indicating a role of PSMs in the interference ofS. aureus strains with the competing colonizing pathogen. Fur-thermore, by offering a competitive advantage during coloniza-tion of the human body, the characteristically high productionof PSMs in USA300 and other CA-MRSA strains may thus con-tribute not only to virulence but also the exceptional capacity ofthose strains to sustainably spread in the population, which sofar has remained poorly understood.

Community-associated methicillin-resistant Staphylococcusaureus (CA-MRSA)2 are the source of a pandemic of mainlyskin and soft tissue infections (1). However, CA-MRSA strainsalso cause severe and sometimes fatal infections such as necro-tizing fasciitis and pneumonia (2, 3). The danger associatedwith CA-MRSA stems from the combination of high virulencewith antibiotic resistance. Although the basis of hypervirulenceinCA-MRSA is currently unfoldingmore clearly (4), themolec-ular underpinnings of the fast and sustainable spread of CA-MRSA strains in the population are less well understood.Recent genome sequencing of a multitude of S. aureus

genomes has revealed that many S. aureus strains, about half ofthose that have been sequenced, contain the complete genetic

information required for the synthesis of an epidermin-likelantibiotic type bacteriocin (5). Lantibiotics are post-transla-tionally modified bacteriocins that comprise lanthionines,thioether-containing amino acids originating from the reactionof cystein sulfhydryl groups with dehydro amino acids formedby the dehydration of serine or threonine (6). Epidermin is alantibiotic produced by a specific strain of Staphylococcus epi-dermidis (7, 8). Gallidermin is produced by Staphylococcus gal-linarum and differs from epidermin in one amino acid position(9). Epidermin, gallidermin, and other lantibiotics often haveconsiderable antimicrobial activity against Gram-positive bac-teria, whereas the producers are commonly protected byimmunity systems such as specific lantibiotic exporters (10–12). The presence of genetic information in many S. aureusgenomes that is highly similar to that responsible for the bio-synthesis of epidermin and gallidermin suggests that a similarlantibiotic is produced by those S. aureus strains. Earlier, wetermed this hypothetical lantibiotic “aureodermin” (Adm), inanalogy to the naming of S. epidermidis epidermin and S. galli-narum gallidermin (5), but it has since frequently been called“Bsa” (for bacteriocin of S. aureus) or simply epidermin orgallidermin.Since their discovery in S. aureus genomes, it remained

unclear whether the adm (bsa) genes code for a functional bac-teriocin. By overexpressing the adm operon in an S. aureus lab-oratory strain, Daly et al. (13) demonstrated that a functionallantibiotic is produced by the adm genes. The adm operon con-tains two structural genes, adm1 and adm2. However, only pro-duction of Adm2 (Bsa2) was observed. These authors alsodescribed that strains of the ST8 sequence type, which containclinical strains such as S. aureus Newman, the MRSA strainUSA500 and the epidemic U. S. CA-MRSA clone USA300,show antimicrobial activities. In HPLC/MS analyses, theseactivities correlated with the presence of peaks that indi-cated production of Adm2. On that basis, the authors sug-gested that bacterial interference by Adm2 contributes toincreased colonization capacities of ST8 strains, in particu-lar, the widespread CA-MRSA clone USA300, by a compet-itive ecological advantage.Phenol-soluble modulins (PSMs) are a family of amphi-

pathic,�-helical peptides found in S. aureus, S. epidermidis, andother staphylococci (14–19). Several PSMshave cytolytic activ-ities, for example toward human neutrophils and other humancells, and significantly impact S. aureus pathogenesis in skininfection and bacteremia (17). Based on their surfactant-likeproperties, PSMs have also been proposed to impact biofilm

* This work was supported, in whole or in part, by the Intramural Research Pro-gram of the NIAID, National Institutes of Health (Grant ZIA AI000904-08).

1 To whom correspondence should be addressed: 9000 Rockville Pike, Bldg.33 1W10, Bethesda, MD 20892. Fax: 301-480-3633; E-mail: motto@niaid.nih.gov.

2 The abbreviations used are: CA-MRSA, community-associated methicillin-resistant Staphylococcus aureus; ESI, electrospray ionization; PSM, phenol-soluble modulin; RP, reversed-phase; THY, Todd-Hewitt broth; MBC, mini-mal bactericidal concentration; TSB, tryptic soy broth.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 286, NO. 11, pp. 8933–8940, March 18, 2011Printed in the U.S.A.

MARCH 18, 2011 • VOLUME 286 • NUMBER 11 JOURNAL OF BIOLOGICAL CHEMISTRY 8933

by guest on March 7, 2020

http://ww

w.jbc.org/

Dow

nloaded from

maturation and detachment (20), which has been demon-strated for the �-type PSMs of S. epidermidis (21). In addition,it has recently been shown that specific S. epidermidis PSMs,S. epidermidis PSM� and �-toxin (PSM�), have antimicrobialactivities against Streptococcus pyogenes owing to their capacityto form pores in the bacterial cell membrane (22). Finally, anti-microbial activities have been detected sporadically for otherstaphylococcal PSM-like peptides (23). Whether S. aureusPSMs are antimicrobial and responsible for antimicrobial activ-ities exhibited by some S. aureus strains is unknown. Impor-tantly, PSMs are produced in high amounts in the USA300/USA500 lineage of the S. aureus clonal complex 8 (17, 24). Thisis believed to be due to high activity of the agr quorum-sensingsystem, which strictly regulates PSM production (17, 25).Here, we present a comprehensive analysis of antimicrobial

activities of all known S. aureus PSM peptides. By constructionand use of psm and adm deletion strains and purification of theantimicrobial activity of the USA300 strain, we demonstratethat PSM-derived peptides rather than theAdm2 lantibiotic arethe source of that activity, suggesting a potential contributionof PSMs to the proposed competitive ecological advantage ofCA-MRSA.

EXPERIMENTAL PROCEDURES

Bacterial Strains and Growth Conditions—Bacterial strainsused in this study are shown in Table 1. All cultures were grownin tryptic soy broth (TSB) at 37 °C with shaking at 180 rpm,unless otherwise noted.Peptide Synthesis—Peptides were ordered through the Pep-

tide Synthesis Unit of the NIAID and synthesized by commer-cial vendors. All PSM peptides used wereN-formylated, unlessotherwise noted.

Production of Multiple psm Deletion Mutants—To producemultiple psm deletion mutants in S. aureus LAC, plasmidpKOR1psm� was constructed to delete the psm� operon with-out introduction of an antibiotic resistance cassette. To thatend, two PCR products were amplified from chromosomalDNAof strain LACusing primers psm�att1 and psm�rev1, andpsm�att2 and psm�rev2, respectively (Table 2). The two PCRproducts were cleaved using EcoRI and ligated, and the ligatedproduct was cloned into plasmid pKOR1 (26) using the Invit-rogen Clonase kit. Then, the resulting plasmid pKOR1psm�was transformed first into S. aureus RN4220 and finallyS. aureus LAC hld and S. aureus LAC psm� mutants (17).Afterward, allelic replacement and screening procedures wereperformed as described (26). The resulting S. aureus LACpsm�/psm� double mutant was transformed with plasmidpKOR1hld (17), and allelic replacement was performed asdescribed (26), resulting in thepsm triplemutant S. aureusLACpsm�/psm�/hld, in which all known psm loci are deleted, or, inthe case of the �-toxin gene hld, the start codon is mutated toabolish translation ofhld (17)without interferingwith the func-tion of the regulatory RNA, RNAIII, in which hld is embedded(27).Production of adm Deletion Mutant—To abolish Adm pro-

duction in strain USA300, the entire adm cluster (from theadmA2 to the admG gene, comprising all genes involved inposttranslational modification, processing, and producerimmunity in addition to the admA2 structural gene) wasdeleted using a procedure based on the temperature-sensitiveplasmid pBT2 (28). To that end, two PCR products flanking theadm operon were amplified from genomic DNA of strainUSA300 (LAC) using primers admKOdownFor and adm-

TABLE 1Bacterial strains used in this study

Strain Characteristics Source/Ref.

S. aureusUSA300 (LAC) Epidemic U.S. CA-MRSA clone, strain LAC, ST8, CC8 Ref. 36USA300 (LAC) psm� LAC psm� deletion mutant; specR Ref. 17USA300 (LAC) psm� LAC psm� deletion mutant; specR Ref. 17USA300 (LAC) hld LAC hld deletion mutant; hld start codon changed from ATG to ATT Ref. 17USA300 (LAC) psm�/psm� LAC psm�/psm� deletion mutant; specR This studyUSA300 (LAC) psm�/hld LAC psm�/hld deletion mutant; specR This studyUSA300 (LAC) psm�/psm�/hld LAC psm�/psm�/hld deletion mutant; specR This studyUSA300 (LAC) agr LAC agr deletion mutant; tetR Ref. 17USA300 (LAC) adm LAC adm deletion mutant; specR This studyUSA300 (SF8300) Epidemic U.S. CA-MRSA clone, strain SF8300 Ref. 24USA500 (BD02-25) Endemic HA-MRSA clone, progenitor of USA300, ST8, CC8 Ref. 24Archaic strain (COL) HA-MRSA, ST250, CC8 Ref. 24Iberian strain (BAA44) HA-MRSA, ST247, CC8 Ref. 24Portuguese/Brazilian strain (BAA43) HA-MRSA, ST239, CC8 Ref. 24Chinese strain (HS-522) HA-MRSA, ST239, CC8 Ref. 24USA400 (MW2) CA-MRSA, ST1 Ref. 37Newman MSSA isolate, ST8, Ref. 38MSSA 476 MSSA isolate, ST1 Ref. 398325 MSSA, ST8 Ref. 40RF122 Bovine isolate Ref. 41RN4220 Prophage/plasmid-cured, restriction-deficient derivative of 8325 Ref. 40

S. epidermidis1457 Biofilm-forming clinical isolate Ref. 42ATCC12228 Non-biofilm forming skin isolate ATCC

Other microorganismsStreptococcus pyogenes Serotype M3 F. DeLeoMicrococcus luteus ATCC9341 ATCCBurkholderia cepacia 4A Ref. 43Escherichia coli DH5� Cloning strain InvitrogenCandida albicans NIH 3172 Ref. 43

PSM Antimicrobial Activities

8934 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 286 • NUMBER 11 • MARCH 18, 2011

by guest on March 7, 2020

http://ww

w.jbc.org/

Dow

nloaded from

KOdownRev, and admKOupFor and admKOupRev, respec-tively (Table 2). The obtained PCR products were cloned up-and downstream of a spectinomycin resistance cassette thathad previously been cloned in plasmid pBT2 via BamHI andSalI sites (29), using the restriction sites KpnI and BamHI, andSalI and HindIII, respectively. To facilitate plasmid excisionafter recombination, the secY antisense cassette from plasmidpKOR1 (26) was amplified using primers secYtetFor andsecYtetRev (Table 2), introducing EcoRV sites, and cloned intothe EcoRV site of the pBT construct. The final construct wastransformed into strain USA300 (LAC) via strain RN4220 andthe allelic replacement procedure was performed as described(26).Purification of Antimicrobial Activity—Bacteria were grown

in 50 ml TSB at 37 °C for 16 h, after which cultures were cen-trifuged and 30-ml aliquots of supernatants were collected andmixed with 10 ml of 1-butanol. Extraction was performed byshaking solutions in 37 °C for 2 h. After brief centrifugation,upper (butanol) phaseswere collected and concentrated by vac-uum centrifugation. Dried samples were dissolved in 500�l 8 M

urea and used for further procedures. 100 �l of those sampleswere applied onto a �RPC C2/C18 ST 4.6/100 column (GEHealthcare) and run on an HPLC/MS system (1100 HPLC sys-tem connected to anMSD Trap SLmass spectrometer, AgilentTechnologies, Palo Alto, CA). An acetonitrile gradient fromeluent A (0.1% TFA in water) to eluent B (0.1% TFA in acetoni-trile) was applied as follows; 0% eluent B from 0 to 4 min, 0 to50% eluent B linear gradient from 4 to 72 min, 50 to 100%eluent B linear gradient from 72 to 82 min, 100% eluent Bfrom 82 to 90 min, 0% eluent B from 90 to 100 min. The flowrate was 0.5 ml/min and MS parameters were as publishedpreviously (17).For the purification of antimicrobial peptides, strain

SF8300 (USA300) was grown in 1 liter of TSB at 37 °C over-night. The supernatant was collected, acidified to pH 6 withHCl, and applied onto an HR16/20 column packed with cat-ion exchange SOURCE 30S material (GE Healthcare) usingan AKTA Purifier system (GE Healthcare). Eluent A (20 mM

H2PO4 in water:acetonitrile (7:3, v/v)) and eluent B (1 M

NaCl, 20 mM H2PO4 in water:acetonitrile (7:3, v/v)) wereused to elute samples with a flow rate of 5 ml/min and alinear gradient (eluent B, 0 to 100% in 80 min). After agardiffusion assays on Micrococcus luteus, fractions with anti-microbial activity were collected and concentrated by lyoph-

ilization. The concentrated fractions were injected onto aZORBAX SB-C18 9.4 � 25 cm column (Agilent) and elutedwith a flow rate of 4 ml/min and a linear gradient of 0.1%TFA in acetonitrile:water (0 to 100% in 80 min) with frac-tionation. Fractions were concentrated by lyophilization andapplied to the agar diffusion assay. Active fractions werecollected and applied to a SOURCE 5RPC ST 4.6/150 column(GE Healthcare). Samples were eluted using a 0.1% TFA ace-tonitrile:water gradient (0 to 20% in 2.5 min, 20 to 80% in 2.5to 52.5 min, and 80 to 100% in 52.5 to 55min) with a flow rateof 1 ml/min. Fractions were assayed for antimicrobial activ-ity by the agar diffusion assay and analyzed by reversed phase(RP)-HPLC/electrospray ionization (ESI)-MS.Agar Diffusion Assay—To determine antimicrobial activities

of LC fractions or culture filtrates,M. luteus was used as a teststrain. 100 �l of an overnight culture ofM. luteus was added to500 ml of autoclaved agar solution (5 g of casein hydrolysatepeptone; 2.5 g of yeast extract; 2.5 g of NaCl; 1.31 g of K2HPO4;and 7.5 g of agar). 20–60 �l of culture filtrate or LC sampleswere applied on paper disks and placed onto the agar platesafter drying. Plates were incubated at 37 °C overnight andexamined for halo production around paper disks representingantimicrobial activity. To determine antimicrobial activitiesagainst S. pyogenes, the same procedure was used, but bacteriawere added toTodd-Hewitt broth containing 0.2% yeast extract(THY).Determination of Minimal Bactericidal Concentration

(MBC)—Overnight cultures of each strain grown in propermedia (Staphylococcal strains inTSB, Streptococcus pyogenes inTHY,M. luteus in Luria-Bertani (LB)medium)were inoculatedinto appropriatemedia (20%TSB, 10% fetal bovine serum, 1mM

NaH2PO4, 150 mM NaCl, 50 mM NaHCO3 for S. aureus LAC,RN4220 and S. epidermidis 1457 strains; TSB for S. epidermidis12228; THY for S. pyogenes; LB forM. luteus) to achieve 2� 107

cfu/ml and 90-�l aliquots were dispensed in microtiter platewells. PSM stock solutions (640, 320, 160, 80, 40, 20, and 10�M)were prepared by serial dilutions with PBS. 10 �l of PSM serialstock dilutions were added into eachwell, and plates were incu-bated at 37 °C overnight. Cultures from thewells with no visiblegrowth were spread on agar plates, and cfus were counted afterovernight incubation at 37 °C.MBCwas determined as the low-est concentration of PSM, at which �99% of inoculated cellswere killed.

TABLE 2Oligonucleotides used in this study

Oligonucleotide Sequence

Deletion of psm� operonpsm�att1 GGGGACAAGTTTGTACAAAAAAGCAGGCTGTTGAGGCACGCGCCACTCGCCAGpsm�rev1 GATGCCAGCGATGATACCCATTAAGAATTCCTCCpsm�att2 GGGGACCACTTTGTACAAGAAAGCTGGGTGATGGTGGGGGACTATCGCGCACAGpsm�rev2 GCGAATTGAATTCTTAAAATTCTCAGGCCACTATACC

Deletion of adm clusteradmKOdownFor ATGCGGATCCGATTGGGGCTCTAACGGTAAAAGadmKOdownRev ATGCGGTACCATGAATACAAAATTTTTAGGTAAAACATTAGTAGadmKOupFor TGCGCTAGCGCGCGATATCGCGCGAAATAGAGGAAGTTAAACCCGAAATadmKOupRev ATGCGTCGACATTGTCATATTATCCCTTTTCAC

Cloning of secY cassettesecYtetFor GATCCCGGGTATTGAAAAGAGATAAGAATTGsecYtetRev GATCCCGGGTCTGCTTTCTTCATTAGAAT

PSM Antimicrobial Activities

MARCH 18, 2011 • VOLUME 286 • NUMBER 11 JOURNAL OF BIOLOGICAL CHEMISTRY 8935

by guest on March 7, 2020

http://ww

w.jbc.org/

Dow

nloaded from

FIGURE 1. Analysis of antimicrobial activity in S. aureus strains. A, dried 1-butanol extracts (corresponding to 1.2 ml of culture) of various S. aureusstrains were dissolved in 8 M urea, applied on filter disks, and placed on M. luteus test plates. Test plates were grown for 24 h. B, peak areas correspondingto the m/z 1046.1 peak at 66 min, obtained by integration of extracted ion chromatograms of m/z 1046.1. 100-�l samples of 1-butanol extracts(corresponding to 6 ml of extracted culture) were applied to a �RPC C2/C18 ST 4.6 � 100 mm column and a gradient from 0.1% TFA/water to 0.1%TFA/acetonitrile was run at 0.5 ml/min. Example chromatograms are shown in C. The largest peak found in the USA300 strain is marked by an arrow.D, mass chromatogram of the peak at �66 min in strain USA300.

PSM Antimicrobial Activities

8936 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 286 • NUMBER 11 • MARCH 18, 2011

by guest on March 7, 2020

http://ww

w.jbc.org/

Dow

nloaded from

RESULTS

S. aureus Culture Filtrates Contain Peptides Producingm/z Peaks during HPLC/MS Analysis Indicative of Adm2Production—To examine whether S. aureus strains producethe S. aureus lantibiotics Adm1 or Adm2, we investigated sixstrains representative of the major MRSA CC8 subclones (24),all of which contain the adm system, and all S. aureus strains,whose genomes have been sequenced and contain the geneticinformation to produce theAdm lantibiotics.We extracted sta-tionary growth phase culture filtrates with 1-butanol, a proce-dure known to enrich lantibiotics of the epidermin/galliderminfamily (30), determined antimicrobial activities on M. luteusagar plates (Fig. 1A) and applied the dried and redissolved buta-nol extracts to a �RPC C2/C18 ST 4.6/100 (GE Healthcare)reversed phase HPLC column. The column was run on anHPLC system coupled to an Ion Trap mass spectrometer withESI. We analyzed the entire elution range (0–100% acetoni-trile) form/z values corresponding to those expected for Adm1andAdm2. In the elution ion chromatograms of several strains,we detected peaks with m/z 1046.1 ((Adm2 � 2H�)/2) at elu-tion times of �66 min (Fig. 1, B and C). The m/z 1046.1 peakwas accompanied by the corresponding triple charged ion ofm/z 698.2 ((Adm2 � 3H�)/3), indicative of a peptide with acalculatedmass of 2090.1Da (Fig. 1D). Thismass is in very goodagreement with the theoretical mass of Adm2 of 2091 Da andthe experimental 2089.5Da value determinedbyDaly et al. (13).Of note, production of an antimicrobial substance as deter-mined by the agar diffusion assay (Fig. 1A) correlatedwith pres-ence of an m/z 1046.1 peak at � 66 min. Additional, minorpeaks of m/z 1046.1 found in some strains at other retentiontimes were not accompanied by the corresponding triple-charged ion and are thus not related to a peptide with a mass of2090 Da. Furthermore, we did not find ions related to the the-oretical Adm1 peptide, in agreement with the observations byDaly et al. (13). These results indicated that the antimicrobialactivity corresponding to a peptide of� 2090Da eluting at� 66min represents themajor antimicrobial activity in the S. aureusextracts and, at first, suggested that it is the Adm2 lantibiotic.Antimicrobial Activity in S. aureus Culture Filtrates Is Due to

PSMs—As an alternative hypothesis, we examined whether theantimicrobial activity may be due to production of PSMs. Totestwhether PSMsmay be involved in the antimicrobial activityof S. aureus strains, we tested 1-butanol extracts of S. aureusUSA300 (LAC) wild-type and isogenic psm mutants onM. luteus and S. pyogenes test plates (Fig. 2A) and by RP-HPLC/ESI-MS (Fig. 2B). All PSM peptides could be extracted using1-butanol. In addition to the psm�, psm�, and hld mutantsfrom a previous study (17), we constructed psm doublemutants(psm�/psm�, psm�/hld) and a triplemutant (psm�/psm�/hld).In the latter, all known S. aureus psm genes are deleted or, in thecase of hld, expression is inactivated by mutation of the startcodon. Moreover, we tested an agr mutant, in which no PSMpeptides are produced owing to strict regulation of PSMs by theagr quorum-sensing system (17, 25). Finally, we constructed adeletion mutant of the adm locus in USA300 to analyzewhether the antimicrobial activity of that strain is due to theproduction of the Adm lantibiotic.

The results clearly demonstrated that the antimicrobialactivity of strain USA300 is due to PSMs rather than the Adm2bacteriocin. First, antimicrobial activities were significantlyreduced in several psm deletionmutants and completely absentin the psm�/psm�/hld deletion strain, whereas there was nosignificant difference compared with the wild-type for the admdeletion mutant. Second, RP-HPLC/ESI-MS analysis showedthat presence of the peak indicating production of the 2090-Dapeptide was abolished in the psm�/psm�/hld deletion but notaffected in the adm deletion strain. Furthermore, this peak wasfound predominantly in strains known to produce highamounts of PSMs, such as USA300, USA400, and USA500 (17,24) (Fig. 1, B and C), in further support of the idea that thecorresponding peptide is PSM-derived.

FIGURE 2. Antimicrobial activity and presence of the 2090 Da peptide inUSA300 wild-type, adm, agr, and psm deletion mutants. A, dried 1-buta-nol extracts of USA300 (LAC) wild-type and isogenic adm, psm, and agr dele-tion strains (corresponding to 1.2 ml of culture) were dissolved in 8 M urea,applied on filter disks, and placed on M. luteus or S. pyogenes test plates. Testplates were grown for 24 h, and inhibition zones were measured. B, peak areascorresponding to the m/z 1046.1 peak at 66 min (2090-Da peptide) after anal-ysis of the extracts by RP-HPLC/MS (A and B). ***, p � 0.001; **, p � 0.01; *, p �0.05; N.S., not significant (one-way analysis of variance with Dunnett post testversus wild-type samples). Error bars depict � S.E.

PSM Antimicrobial Activities

MARCH 18, 2011 • VOLUME 286 • NUMBER 11 JOURNAL OF BIOLOGICAL CHEMISTRY 8937

by guest on March 7, 2020

http://ww

w.jbc.org/

Dow

nloaded from

The results obtained in the agar diffusion assay with the dif-ferent psm mutant strains indicated that primarily the PSM�peptides and the �-toxin (Hld) may be the source(s) of the anti-microbial activity (Fig. 2A). RP-HPLC/ESI-MS analysis showedthat the m/z 1046.1 peak at �66 min corresponding to the2090-Da peptidewas only observed in extracts from strains thatcontained the psm� genes, but not those in which these geneswere deleted (Fig. 2B). These results indicated that the antimi-crobial activity in strain USA300 is linked predominantly toPSM� peptides.S. aureus Antimicrobial Activity Is Due to Proteolytically Pro-

cessed PSM�1 and PSM�2 Peptides—To further confirm thishypothesis, we purified the antimicrobial activity using 1-buta-nol extraction followed by a series of preparative chromato-graphic steps, including cation exchange and reversed-phasechromatography. During purification, fractions were analyzedfor antimicrobial activity on M. luteus plates. In the last chro-matographic step, antimicrobial activity correlated with twopeptides with calculated masses of 2090 and 2072 Da (Fig. 3).N-terminal sequencing of the peptides demonstrated that thesepeptides were N-terminally processed products of the PSMpeptides PSM�1 and PSM�2, in which the two N-terminalamino acids were missing (Fig. 4).Taken together, our results demonstrated that the antimi-

crobial activity of USA300 is due to proteolytically processed

PSM�1 and PSM�2 peptides rather than the Adm2 lantibiotic.Culture filtrates of all strains that showed antimicrobial activityproduced ions corresponding to the peptides with masses of

FIGURE 3. Purification of the antimicrobial activity produced by S. aureus strain USA300. The antimicrobial activity produced by strain USA300 waspurified using 1-butanol extraction, cation exchange, and two steps of reversed phase chromatography. In each step, aliquots of fractions were tested forantimicrobial activity on M. luteus test plates. A, M. luteus agar diffusion test for antimicrobial activity of fractions within the elution range of the antimicrobialactivity in the last RP-HPLC step. B, RP-HPLC/ESI-MS analysis of selected fractions. At the end of the purification procedure, fractions with antimicrobial activity(1G5–1G10) contained mainly two peptides with masses of 2090.1 and 2072.2 Da.

FIGURE 4. Amino acid sequences, masses, and antimicrobial activities ofthe processed PSM�1 and PSM�2 derivatives corresponding to the2090- and 2072-Da peptides. A, amino acid sequences, theoretical andobserved masses of the PSM�1 and PSM�2 peptides, and the PSM�1�1-2and PSM�2 �1-2 processed peptides with antimicrobial activity found inS. aureus culture filtrates. Note that the mass differences correlate well withthe theoretical mass loss corresponding to the absence of the N-formyl-me-thionyl-glycyl residue. B, antimicrobial activity of synthetic peptides onM. luteus test plates.

PSM Antimicrobial Activities

8938 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 286 • NUMBER 11 • MARCH 18, 2011

by guest on March 7, 2020

http://ww

w.jbc.org/

Dow

nloaded from

2090 and 2072 Da during HPLC with similar retention times,indicating that the processed PSM�1 and PSM�2 peptides areresponsible for antimicrobial activity in all those testedS. aureus strains. Remarkably, the mass of the processedPSM�1 peptide corresponds exactly to the mass of Adm2. Thiscoincidence explains the previousmisinterpretation of the anti-microbial activity of USA300 and other S. aureus strains asbeing Adm2-derived (13).Antimicrobial Activity among S. aureus PSMs Is Limited to

Processed PSM�1 and PSM�2—To further investigate antimi-crobial activities of S. aureus PSM peptides, including the twoprocessed PSM� peptides, we analyzed antimicrobial activitiesof pure, synthetic peptides corresponding to all known PSMpeptides of S. aureus. To that end, we first applied 15 �l of 10mg/ml solutions on filters and placed them on test plates con-taining different bacteria. This concentration exceeds themax-imal concentrations of PSMs detected in bacterial culture fil-trates by at least one log (16–18). On S. pyogenes andM. luteustest plates, the two processed S. aureus PSM� peptides(PSM�1�1-2, PSM�2�1-2) showed considerable antimicrobialactivity, in contrast to the integral PSM�1 and PSM�2 peptidesand all other tested PSMs (data not shown). No activities ofPSMs were detected on Burkholderia cepacia, Escherichia coli,Candida albicans, S. aureus, and S. epidermidis plates (data notshown). Furthermore, we determined MBCs of all S. aureusPSM peptides (Table 3). Provided that strains exhibited growthin thatmedium,we used a special carbonate-containing growthmedium (killing assay medium), in which antimicrobial pep-tides were previously shown to develop more pronouncedactivity (31). In addition to activities against M. luteus, wedetermined those against several S. aureus and S. epidermidisstrains, and S. pyogenes. Unprocessed PSM peptides ofS. aureus did not elicit antimicrobial activities against any of thetested bacteria, except for very low activities of PSM�1 andPSM�2 against S. pyogenes.MBCs of S. aureusPSM�1�1-2 andPSM�2�1-2 were strongly increased compared with PSM�1and PSM�2, in particular when tested against S. pyogenes. Insummary, our experiments demonstrated significant antimi-crobial activities of the PSM�1�1-2 and PSM�2�1-2 peptides,particularly against S. pyogenes. In contrast, unprocessed PSMsexhibited no, or in rare cases, weak antimicrobial activities.

DISCUSSION

Exceptional capacity to colonize humans is a frequently dis-cussed possible reason for the epidemiological success of CA-MRSA strains, such asUSA300, as pathogens (32, 33). Althoughthere is no evidence to support this hypothesis, which is mainly

due to the lack of appropriate colonization models, two molec-ular factors have been suggested to potentially promote coloni-zation of USA300. First, most USA300 strains contain the argi-nine catabolic mobile element, whose arginine deiminaseoperon has been implied in promoting colonization mainly viaan impact on pH homeostasis (32, 34). This element is absentfrom most other S. aureus. Second, the Adm2 lantibiotic hasbeen reported to be expressed strongly in strains of the ST8 andST80 sequence types, which contain the epidemic U. S. andEuropean CA-MRSA clones, respectively. On those grounds,Adm2 was speculated to contribute to the spread of thosestrains by a competitive advantage over other bacteria, includ-ing staphylococci (13).In the present study, we investigated the molecular basis of

the antimicrobial activity found in USA300 and other S. aureusstrains to evaluate whether it is due to the Adm2 lantibiotic, asproposed previously (13). Our results indicate that antimicro-bial activities of S. aureus strains are based on PSM peptidesrather than lantibiotic-type bacteriocin production. Althoughit has been unequivocally shown that the adm operon codes fora functional lantibiotic (13), previous conclusions based onmass spectrometric analysis suggesting presence of the Adm2lantibiotic in S. aureus culture filtrates may have been incor-rect, owing to the coincidentally equal masses of the antimicro-bially active, processed PSM�1 peptide, PSM�1�1-2, andAdm2. Thus, the biological function of the adm operons pres-ent in many S. aureus strains remains unresolved. It is possiblethat the Adm lantibiotic(s) are only produced under specific invivo conditions that have not been or cannot be reproduced inthe laboratory.Among S. aureus PSMs, significant antimicrobial activity

was detected mostly in proteolytically processed PSMs, sug-gesting that PSM-based bacterial interferencemay play a role inmicroenvironments with proteolytic activity or under condi-tions with strong production of S. aureus exoproteases. Exceptfor weak activity of PSM�2�1-2 against S. aureus RN4220 andS. epidermidisATCC12228, we did not find considerable activ-ity of any PSM or PSM derivative against S. aureus or S. epider-midis strains, indicating that the antimicrobial properties ofS. aureus PSMs are likely not involved in a significant compet-itive ecological advantage within the species or genus. Con-trastingly, the pathogen and epithelial colonizer S. pyogeneswashighly sensitive to PSM antimicrobial activity, suggesting thatPSMsmay have a biological function in bacterial interference ofS. aureuswith that competing bacterium. This finding is of par-ticular interest, as staphylococci and streptococci are niche

TABLE 3Minimal bactericidal concentrations of S. aureus PSMsMBCs are defined as the concentration at which 99% of bacteria were killed.

PSMS. aureus LAC

(KAMa)S. aureus

RN4220 (KAMa)S. epidermidis1457 (KAMa)

S. epidermidis12228 (TSBa)

S. pyogenes(THYa)

M. luteus(LBa)

�1 �64 �64 �64 �64 64 �64�2 �64 �64 �64 �64 64 �64�3, �4, �1, �2, �-toxin, mecb �64 �64 �64 �64 �64 �64�1�1-2 �64 �64 �64 �64 8 �64�2�1-2 �64 64 �64 16 8 �64

a Medium used in MBC assays.b PSM-mec is present in some MRSA and methicillin-resistant S. epidermidis.

PSM Antimicrobial Activities

MARCH 18, 2011 • VOLUME 286 • NUMBER 11 JOURNAL OF BIOLOGICAL CHEMISTRY 8939

by guest on March 7, 2020

http://ww

w.jbc.org/

Dow

nloaded from

competitors in the humanbody and are not commonly found toco-colonize. Althoughmechanisms related to hydrogen perox-ide resistance have been proposed to cause an advantage forstreptococci in the nasopharynx (35),mechanisms contributingto predominantly staphylococcal colonization of the nose arenot understood. Our findings suggest that PSM-based bacterialinterference may represent such a mechanism; strong produc-tion of PSMs in CA-MRSA may thus contribute to the excep-tional capacity of those strains to colonize and spread in thepopulation.

REFERENCES1. DeLeo, F. R., Otto, M., Kreiswirth, B. N., and Chambers, H. F. (2010)

Lancet 375, 1557–15682. Francis, J. S., Doherty, M. C., Lopatin, U., Johnston, C. P., Sinha, G., Ross,

T., Cai, M., Hansel, N. N., Perl, T., Ticehurst, J. R., Carroll, K., Thomas,D. L., Nuermberger, E., and Bartlett, J. G. (2005) Clin. Infect Dis. 40,100–107

3. Miller, L. G., Perdreau-Remington, F., Rieg, G., Mehdi, S., Perlroth, J.,Bayer, A. S., Tang, A. W., Phung, T. O., and Spellberg, B. (2005) N. Engl.J. Med. 352, 1445–1453

4. Otto, M. (2010) Annu. Rev. Microbiol. 64, 143–1625. Otto, M., and Gotz, F. (2001) Res. Microbiol. 152, 351–3566. Bierbaum, G., and Sahl, H. G. (2009) Curr. Pharm. Biotechnol. 10, 2–187. Schnell, N., Engelke, G., Augustin, J., Rosenstein, R., Ungermann, V., Gotz,

F., and Entian, K. D. (1992) Eur. J. Biochem. 204, 57–688. Schnell, N., Entian, K. D., Schneider, U., Gotz, F., Zahner, H., Kellner, R.,

and Jung, G. (1988) Nature 333, 276–2789. Schnell, N., Entian, K. D., Gotz, F., Horner, T., Kellner, R., and Jung, G.

(1989) FEMS Microbiol. Lett. 49, 263–26710. Otto, M., Peschel, A., and Gotz, F. (1998) FEMS Microbiol. Lett. 166,

203–21111. Peschel, A., and Gotz, F. (1996) J. Bacteriol. 178, 531–53612. Saris, P. E., Immonen, T., Reis, M., and Sahl, H. G. (1996) Antonie Van

Leeuwenhoek 69, 151–15913. Daly, K. M., Upton, M., Sandiford, S. K., Draper, L. A., Wescombe, P. A.,

Jack, R. W., O’Connor, P. M., Rossney, A., Gotz, F., Hill, C., Cotter, P. D.,Ross, R. P., and Tagg, J. R. (2010) J. Bacteriol. 192, 1131–1142

14. Donvito, B., Etienne, J., Denoroy, L., Greenland, T., Benito, Y., and Van-denesch, F. (1997) Infect Immun. 65, 95–100

15. Mehlin, C., Headley, C. M., and Klebanoff, S. J. (1999) J. Exp. Med. 189,907–918

16. Vuong, C., Durr,M., Carmody, A. B., Peschel, A., Klebanoff, S. J., andOtto,M. (2004) Cell Microbiol. 6, 753–759

17. Wang, R., Braughton, K. R., Kretschmer, D., Bach, T. H., Queck, S. Y., Li,M., Kennedy, A. D., Dorward, D. W., Klebanoff, S. J., Peschel, A., DeLeo,F. R., and Otto, M. (2007) Nat. Med. 13, 1510–1514

18. Yao, Y., Sturdevant, D. E., and Otto, M. (2005) J. Infect Dis. 191, 289–29819. Watson, D. C., Yaguchi, M., Bisaillon, J. G., Beaudet, R., and Morosoli, R.

(1988) Biochem. J. 252, 87–9320. Kong, K. F., Vuong, C., and Otto, M. (2006) Int. J. Med. Microbiol. 296,

133–13921. Wang, R., Khan, B. A., Cheung, G. Y., Bach, T. H., Jameson-Lee,M., Kong,

K. F., Queck, S. Y., and Otto, M. (2011) J. Clin. Invest. 121, 238–248

22. Cogen, A. L., Yamasaki, K., Sanchez, K. M., Dorschner, R. A., Lai, Y.,MacLeod, D. T., Torpey, J. W., Otto, M., Nizet, V., Kim, J. E., and Gallo,R. L. (2010) J. Invest. Dermatol. 130, 192–200

23. Beaudet, R., Bisaillon, J. G., Saheb, S. A., and Sylvestre, M. (1982) Antimi-crob. Agents Chemother. 22, 277–283

24. Li, M., Diep, B. A., Villaruz, A. E., Braughton, K. R., Jiang, X., DeLeo, F. R.,Chambers, H. F., Lu, Y., and Otto, M. (2009) Proc. Natl. Acad. Sci. U.S.A.106, 5883–5888

25. Queck, S. Y., Jameson-Lee, M., Villaruz, A. E., Bach, T. H., Khan, B. A.,Sturdevant, D. E., Ricklefs, S. M., Li, M., and Otto, M. (2008)Mol. Cell 32,150–158

26. Bae, T., and Schneewind, O. (2006) Plasmid 55, 58–6327. Novick, R. P., Ross, H. F., Projan, S. J., Kornblum, J., Kreiswirth, B., and

Moghazeh, S. (1993) EMBO J. 12, 3967–397528. Bruckner, R. (1997) FEMS Microbiol. Lett. 151, 1–829. Kocianova, S., Vuong, C., Yao, Y., Voyich, J.M., Fischer, E. R., DeLeo, F. R.,

and Otto, M. (2005) J. Clin. Invest. 115, 688–69430. Ottenwalder, B., Kupke, T., Brecht, S., Gnau, V., Metzger, J., Jung, G., and

Gotz, F. (1995) Appl. Environ. Microbiol. 61, 3894–390331. Dorschner, R. A., Lopez-Garcia, B., Peschel, A., Kraus, D., Morikawa, K.,

Nizet, V., and Gallo, R. L. (2006) FASEB J. 20, 35–4232. Diep, B. A., Gill, S. R., Chang, R. F., Phan, T. H., Chen, J. H., Davidson,

M. G., Lin, F., Lin, J., Carleton, H. A., Mongodin, E. F., Sensabaugh, G. F.,and Perdreau-Remington, F. (2006) Lancet 367, 731–739

33. Diep, B. A., and Otto, M. (2008) Trends Microbiol. 16, 361–36934. Diep, B. A., Stone, G. G., Basuino, L., Graber, C. J., Miller, A., des Etages,

S. A., Jones, A., Palazzolo-Ballance, A. M., Perdreau-Remington, F., Sen-sabaugh, G. F., DeLeo, F. R., and Chambers, H. F. (2008) J. Infect. Dis. 197,1523–1530

35. Selva, L., Viana, D., Regev-Yochay, G., Trzcinski, K., Corpa, J. M., Lasa, I.,Novick, R. P., and Penades, J. R. (2009) Proc. Natl. Acad. Sci. U.S.A. 106,1234–1238

36. CDC (2003)MMWRMorb. Mortal Wkly. Rep. 52, 88–8937. CDC. (1999) Jama 282, 1123–112538. Baba, T., Bae, T., Schneewind, O., Takeuchi, F., and Hiramatsu, K. (2008)

J. Bacteriol. 190, 300–31039. Holden, M. T., Feil, E. J., Lindsay, J. A., Peacock, S. J., Day, N. P., Enright,

M. C., Foster, T. J., Moore, C. E., Hurst, L., Atkin, R., Barron, A., Bason, N.,Bentley, S. D., Chillingworth, C., Chillingworth, T., Churcher, C., Clark, L.,Corton, C., Cronin, A., Doggett, J., Dowd, L., Feltwell, T., Hance, Z., Har-ris, B., Hauser, H., Holroyd, S., Jagels, K., James, K. D., Lennard, N., Line,A., Mayes, R., Moule, S., Mungall, K., Ormond, D., Quail, M. A., Rabbin-owitsch, E., Rutherford, K., Sanders,M., Sharp, S., Simmonds,M., Stevens,K., Whitehead, S., Barrell, B. G., Spratt, B. G., and Parkhill, J. (2004) Proc.Natl. Acad. Sci. U.S.A. 101, 9786–9791

40. Peng, H. L., Novick, R. P., Kreiswirth, B., Kornblum, J., and Schlievert, P.(1988) J. Bacteriol. 170, 4365–4372

41. Fitzgerald, J. R., Hartigan, P. J., Meaney, W. J., and Smyth, C. J. (2000)J. Appl. Microbiol. 88, 1028–1037

42. Mack, D., Nedelmann,M., Krokotsch, A., Schwarzkopf, A., Heesemann, J.,and Laufs, R. (1994) Infect Immun. 62, 3244–3253

43. Kobayashi, S. D., Braughton, K. R., Whitney, A. R., Voyich, J. M., Schwan,T. G., Musser, J. M., and DeLeo, F. R. (2003) Proc. Natl. Acad. Sci. U.S.A.100, 10948–10953

PSM Antimicrobial Activities

8940 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 286 • NUMBER 11 • MARCH 18, 2011

by guest on March 7, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Hwang-Soo Joo, Gordon Y. C. Cheung and Michael Otto Is Caused by Phenol-soluble Modulin DerivativesStaphylococcus aureus

Antimicrobial Activity of Community-associated Methicillin-resistant

doi: 10.1074/jbc.M111.221382 originally published online January 28, 20112011, 286:8933-8940.J. Biol. Chem. 

  10.1074/jbc.M111.221382Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/286/11/8933.full.html#ref-list-1

This article cites 43 references, 14 of which can be accessed free at

by guest on March 7, 2020

http://ww

w.jbc.org/

Dow

nloaded from