Analysis of mRNAsthat Accumulate in Response - Plant Physiology

Plant Physiol. (1988) 87, 431-4360032-0889/88/87/0431/06/$Ol .00/0

Analysis of mRNAs that Accumulate in Response to LowTemperature Identifies a Thiol Protease Gene in Tomato'

Received for publication December 2, 1987 and in revised form February 5, 1988

MARK A. SCHAFFER AND ROBERT L. FISCHER*Division of Molecular Plant Biology, University of California, Berkeley, California 94720

ABSTRACT

We have studied the induction of gene expression at low temperatureby cloning mRNAs that accumulate when unripe tomato (Lycopersiconesculentum) fruit are incubated at 4°C. Two cloned mRNAs, C14 andC17, accumulate relatively rapidly in response to cold treatment, while athird, C19, displays a delayed response. Significant levels of these mRNAswere not detected during fruit ripening at normal temperature. We haveanalyzed gene expression at different temperatures and detect half-max-imal accumulation of the C14 and C17 mRNAs at 16°C and 11PC, re-spectively, and have observed that sustained gene expression requirescontinuous cold treatment. Furthermore, the level of C14 and C17 geneexpression in cold-tolerant (hybrid L. escukntumlLycopersicon pimpinel-lifolium) fruit is different from that in cold-sensitive (L. esculentum) fruit.DNA sequence analysis indicates that the C14 mRNA encodes a polypep-tide with a region that is homologous to the plant thiol proteases actinidinand papain and to the animal thiol protease cathepsin H. We concludefrom these experiments that low temperature selectively induces theexpression of specific genes and that one such gene encodes a thiol protease.

Many plants of tropical and subtropical origin sustain damagewhen exposed to low, nonfreezing temperature. This chillinginjury usually occurs below a critical threshold temperature of10 to 12°C and evokes multiple and complex symptoms (13, 26).For example, reproductive ability and photosynthetic functioncan be impaired. Furthermore, exposing fruit from these plantsto low temperature for a sufficient period of time often resultsin damage that persists even when the fruit is returned to normaltemperature. Incubation of tomato fruit below 12°C leads toabnormal ripening, with uneven and incomplete color develop-ment, loss of firmness, surface pitting, and increased suscepti-bility to decay by microorganisms (18, 29).

High-temperature stress induces dramatic changes in geneexpression in plants (31) and animals (24). Recently, exposureof plants to low temperature has been shown to elicit alterationsin protein profiles from in vitro translated mRNA (15, 27). Intomato fruit, chilling increases the activity of two enzymes in-volved in phenylpropanoid metabolism (phenylalanine ammo-nia-lyase and hydroxycinnamyl CoA:quinate hydroxycinnamyl-transferase), although it is not known whether this reflects increasedgene expression (29).

In order to understand better the effects of low, nonfreezingtemperature on the physiology of plant cells, we have investi-gated the role for altered gene expression. The tomato fruit isparticularly suitable for analysis. First, chill-induced modifica-

I Supported by United States Department of Agriculture (Grant No.8400383). M. S. was supported by a National Science Foundation Grad-uate Fellowship.

tions in tomato fruit physiology and biochemistry have beenwidely studied (2, 18, 21, 29). Second, tomato fruit developmentunder normal conditions has received considerable attention,including at the level of gene expression (14, 23). Third, highaltitude wild tomato species are available that are relatively coldtolerant (21). We report here the cloning of three mRNAs thatincrease in concentration when tomato fruit are exposed to 4°C.DNA sequence analysis indicates that one clone encodes a thiolprotease.

MATERIALS AND METHODS

Plant Material. A chill-sensitive tomato line (Lycopersiconesculentum cv VFNT Cherry) and a chill-tolerant hybrid tomatoline, NY280 (L. esculentumlLycopersicon pimpinellifolium, 21),were utilized in this study. Plants were grown under standardgreenhouse conditions.

Chilling Conditions. Mature green fruit were incubated in adarkened growth chamber for the indicated time and tempera-ture at 85 to 95% relative humidity. Following treatments, eachfruit was sliced in half to determine the precise stage of fruitdevelopment. Pericarp tissue from mature green stage one fruit(full size, green fruit with firm locular tissue; 23) was rapidlyfrozen in liquid nitrogen and stored at - 80°C.Messenger RNA Isolation. Polysomal, poly(A) + RNA was iso-

lated as described previously (23).Constructing and Screening a cDNA Library. Messenger RNA

isolated from mature green stage one chill-sensitive tomato fruitincubated 21 d at 4°C was used to construct a cDNA library (25).From this library, 500 colonies were differentially screened withlabeled mRNA probes isolated from mature green chill-sensitivefruit treated 21 d at 4°C and from untreated control fruit. Cloneshybridizing strongly with the cold-induced probe and not withto the untreated control probe were chosen for further study.Dot Blot Analysis of RNA. Dot blot hybridizations were per-

formed as described previously (23).Nucleotide and Amino Acid Sequence Analysis. Cloned genes

were inserted into pUC118 or pUC119 to enable single-strandtemplate preparation. Deletions were generated using the pro-cedures of Henikoff (17). Nucleotide sequences were determinedwith the dideoxy chain-termination method (Sequenase DNASequencing Kit, United States Biochemical Corp., Cleveland,OH). DNA and amino acid sequence analysis was performedusing the GEL, GENED, PEP, and SEQ programs of the BIO-NET National Computer Resource for Molecular Biology.Searches of the National Institutes of Health (NIH) GenBankand National Biomedical Research Foundation (NBRF) ProteinIdentification Resource employed IFIND, XFASTN, andXFASTP, and retrieved sequences were aligned with GEN-ALIGN.

431

Dow

nloaded from https://academ

ic.oup.com/plphys/article/87/2/431/6083166 by guest on 14 January 2022

SCHAFFER AND FISCHER

RESULTS

Low Temperature Induces Changes in the mRNA Populationin Chill-Sensitive and Chill-Tolerant Fruit. Messenger RNA wasisolated from chill-sensitive fruit exposed to 4°C, translated invitro, and the labeled proteins were analyzed by SDS-PAGE.Figure 1A shows that in response to low temperature at leasttwo mRNAs became more abundant, while at least two othermRNAs became less abundant. Similar changes in gene expres-sion were detected when chill-tolerant fruit were exposed to lowtemperature. These results demonstrate that the mRNA popu-lation in chill-sensitive and chill-tolerant fruit undergoes specificalterations in response to low temperature.

Isolation of cDNA Clones. To study the regulation of geneexpression by low temperature in greater detail, we cloned mRNAsthat accumulate in response to chilling. Messenger RNA isolatedfrom chill-sensitive fruit incubated at 4°C was used to constructa cDNA library. Clones hybridizing with labeled mRNA isolatedfrom chilled fruit, and not with labeled mRNA from untreatedfruit, were analyzed further. This strategy yielded three classesof cDNA clones represented by C14, C17, and C19. (Note thatthe names of clones have no relation to the mol wt in Fig. 1A.)As shown in Figure 1B, each clone hybridized with a distinctsize mRNA.Cloned mRNAs Accumulate in Chilled Fruit. To verify that the

cloned mRNAs accumulate in response to cold treatment, wehybridized each cDNA clone with mRNA isolated from chilledmature green tomato fruit. As shown in Figure 2, cold treatmentfor 1 d resulted in increased levels of C14 and C17 mRNA, while10 d was required to increase the level of C19 mRNA. Theseresults indicate that the response to low temperature at the levelof mRNA accumulation involved both an early, represented by

A. B.

S T S T_ - + + kD C14 Cl7 C19 kb

41

p6 -1.9

-1.2

-0.8

.j....t.<.

z ... .. ....i_. _ _.nr.. ^'sw *' *.' '#X ;....w .; .... .i.i§...

_. k ks_ sjE_ _'_ _ _E * Z.-__ _

FIG. 1. In vitro translation of mRNA from chilled sensitive and tol-erant fruit and size of mRNAs encoded by chill-inducible genes. A,Messenger RNA was isolated from chill-sensitive (S) and chill-tolerant(T) mature green tomato fruit exposed to 4°C for 0 (-) or 21 (+) d.The mRNA was translated in vitro using a wheat germ extract in thepresence of [35S]methionine, and the labeled proteins were subjected toSDS-polyacrylamide gradient (12-16%) gel electrophoresis and auto-radiography (23). Mol wt of proteins representing mRNAs that changein concentration during chilling are indicated and expressed in kilodaltons(kD). B, Messenger RNA (0.5 ug) from chill-sensitive tomato fruit ex-

posed to 4°C for 21 d was denatured with glyoxyl, subjected to electro-phoresis on a 1.4% agarose gel, transferred to nitrocellulose, and hy-bridized with the indicated 32P-labeled plasmid DNA, followed byautoradiography. Messenger RNA sizes are expressed in kilobases (kb)and were calculated relative to RNA standards.

PROBEC14

C17 * *

C19 O 0

PG

(

0 1 2 5 10 21 B /2 R Rt_ DAYS AT 40C -- - FRUIT STAGEJ

FIG. 2. Accumulation of specific mRNAs in fruit exposed to low tem-perature. Messenger RNA was isolated from chill-sensitive mature green(stage one) tomato fruit exposed to 40C for the indicated length of time.In addition, mRNA was isolated from untreated fruit at different stagesof development: breaker stage (B, less than 10% red), 50% red stage(1/2 R), or red stage (R); 0.5 jug of each mRNA was dotted onto nitro-celulose and hybridized with the indicated 32P-labeled DNA probes. PGrepresents a control cDNA clone encoding polygalacturonase that isdevelopmentally regulated during fruit ripening (23). Following auto-radiography, each dot was excised and analyzed by liquid scintillationcounting. cpm hybridized for each 32P-labeled DNA probe are as follows:C14, 720 cpm in 21 d chilled fruit, 60 cpm in 50% red fruit, ratio = 12;C17, 970 cpm in 21 d chilled fruit, 190 cpm in red fruit, ratio = 5; C19,4000 cpm in 21 d chilled fruit, 240 cpm in 50% red fruit, ratio = 17.

C14 and C17, and a delayed, C19, component. To determinewhether the cloned genes were expressed during ripening at nor-mal temperatures, mRNA from different stages of fruit devel-opment was isolated and hybridized with the labeled cDNA clones.As shown in Figure 2, the concentration of C14, C17, and C19mRNA was approximately 12-, 5-, and 17-fold lower in fruitallowed to ripen at normal temperature than in fruit chilled for21 d.

Analysis of mRNA Accumulation and Decay. To analyze fur-ther the regulation of gene expression by cold, we monitoredthe kinetics of C14 and C17 accumulation at time points earlierthan 1 d, and also after the apparent inducer, cold, is removed.As shown in Figure 3, we detected significant levels of C14 andC17 mRNA after 8 and 24 h of cold treatment, respectively.Furthermore, C14 mRNA concentration rapidly declined whenthe temperature was increased from 4 to 22°C. In contrast, in-creasing the temperature from 4 to 22°C induced a transient burstof C17 gene expression, although prolonged incubation at 22°Cresulted in the decay of the C17 mRNA.To learn how temperatures other than 4°C affect cloned gene

expression, we performed a temperature dose-response experi-ment. Messenger RNA was isolated from chill-sensitive fruitincubated 4 d at 4 to 22°C and hybridized with 32P-labeled C14and C17 plasmid DNA. As shown in Figure 4, C14mRNA achievedmaximal and half-maximal concentrations at 12 and 16°C, re-spectively. In contrast, C17 mRNA achieved maximal concen-tration at 4°C and half-maximal concentration at 11°C, approx-imately the threshold temperature for chilling-induced damageof tomato fruit. We conclude that the level of C14 and C17 geneexpression increases as the temperature decreases, but that eachgene displays a distinctive temperature dose-response curve.To determine the effect of genetically determined chilling tol-

erance on gene expression, we performed a similar dose-responseexperiment using chill-tolerant (L. esculentumlL. pimpinellifol-ium hybrid) fruit. As shown in Figure 4, C14 mRNA achievedmaximal and half-maximal concentrations at 4 and 7°C, respec-tively, in chill-tolerant fruit. These data suggest that lower tem-perature is required to induce significant levels of C14 gene

432 Plant Physiol. Vol. 87, 1988

Dow



LOW-TEMPERATURE-INDUCED mRNAs: ONE ENCODES A THIOL PROTEASE

1.0C14

a0.8

E 0.4 C

0.2

D 1.0 C'--~~ 0170.8 I

z0 0.6

<04LL

0.2 iI

20 40 60 80 100 190HOURS

FIG. 3. Rapid accumulation and decay of cloned mRNAs. Chill-sen-sitive mature green fruit were incubated at 4°C (0) and then transferredto 22°C (0) for the indicated period of time. One jig of mRNA wasdotted onto nitrocellulose and hybridized with the indicated 32P-labeledplasmid DNA. Following autoradiography, each dot was excised andanalyzed by liquid scintillation counting. Maximum cpm hybridized was4320 cpm for C14 and 1140 cpm for C17.

14

I 100

60

2

40 80 120

S.....S O *

T- * 0

160 220 40 80 120

co)* * 0

* 0 O

expression in chill-tolerant fruit than is required in chill-sensitivefruit. In contrast, C17 mRNA achieved maximal and half-max-imal concentrations at 4 and 11°C, respectively, in both chill-sensitive and chill-tolerant fruit. However, the level of Cl7 geneexpression was higher in the chill-sensitive fruit than in chill-tolerant fruit. These data suggest that genetically determinedchilling-tolerance influences cold-inducible gene expression.DNA Sequence Analysis. To investigate the structure and func-

tion of the C14 and C17 genes, we determined the DNA se-quences of their respective cDNA clones and compared them tosequences compiled in the NIH GenBank. We also comparedtheir predicted amino acid sequences to the sequences stored inthe NBRF Protein Identification Resource. No homology couldbe detected to the C17 DNA sequence or predicted amino acidsequence (data not shown). Thus, the biological function of theC17 gene remains to be elucidated.The homology search with the C14 sequence indicated a re-

lationship with both plant and animal thiol protease genes. Thestructure of the C14 cDNA clone and its complete DNA se-quence are shown in Figures 5 and 6, respectively. The cDNAsequence (1378 nucleotides) is shorter than the C14 mRNA (1900nucleotides; Fig. 1B) and does not include either 5' untranslatedsequences or the methionine codon that initiates translation.Nevertheless, the first 1038 nucleotides of the C14 cDNA se-quence represent an open reading frame encoding 346 aminoacids (Fig. 6). Within this open reading frame is a 660 nucleotideregion (nucleotides 52-711) that exhibits approximately 60%sequence identity with the DNA sequence of a plant thiol pro-tease, papain (data not shown). Furthermore, the predicted aminoacid sequence of this region has 58, 48, and 45% identity withthe thiol proteases actinidin, papain, and cathepsin H, respec-tively.As shown in Figure 6, amino acids critical to the structure and

function of thiol proteases are conserved in the C14, actinidin,papain, and cathepsin H polypeptides. Specifically, amino acidsare conserved that constitute the reactive nucleophile (Cys25,Hisl6l), that form the active center (Glnl9, Aspl60, Asnl81,Ser182, Trpl83), and that form disulfide bridges (Cys22-Cys64,Cys56-Cys97, Cysl55-Cys206) (3). Furthermore, eight of ninetype II glycine residues are conserved in C14 and actinidin. Thisis important because a significant alteration of protein confor-mation, due to the introduction of a C3 atom, would result fromreplacements of type II glycine residues (20). Finally, 27 of 29hydrophobic amino acids that comprise the core of actinidin arelikewise hydrophobic in C14 (20). These results suggest that theregion encodes a thiol protease domain. The remainder of thecDNA sequence encodes an additional 109 amino acids followedby a 315 nucleotide untranslated region terminating in a poly(A)tail.

160 220

FIG. 4. Temperature dose-response curve for C14 and C17 geneexpression in chill-sensitive and chill-tolerant fruit. Messenger RNA wasisolated from chill-sensitive (0, S) or chill-tolerant (, T) mature greenfruit exposed to the indicated temperatures for 4 d. One ,ug of eachmRNA was dotted onto nitrocellulose and hybridized with the indicated32P-labeled plasmid DNA. Following autoradiography, each dot was ex-cised, and the extent of hybridization was determined by liquid scintil-lation counting.

200I0 200 400 600 800 1000 1200 1400

FIG. 5. Restriction map and sequencing strategy for C14 cDNA. (U),DNA sequence encoding amino acids homologous to actinidin (5); (0),DNA sequence encoding amino acids not homologous to actinidin;

), untranslated DNA sequence. Horizontal arrows indicate theextent and direction of sequence determinations. B, BclI; C, ClaI; E,EcoRI; N, NcoI; P, PstI; S, SspI.

N p C 5' -> 3'. . T

I I

433

Dow



434 SCHAFFER AND FISCHER Plant Physiol. Vol. 87. 1988

1 AAGTTATCGAAGAACAAAAGTGATCGG'FATCTTCCTAAAGTTGGGGATAGCTTGCCGGAATCAATTGACTGGAGAGAAAAAGGT GTGCTTGTTGGTGTCAAGGATC LysLeuSerLysAsnLysSerAspArgTyrLeuProLysValGlyAspSerLeuProGluSerIleAspTrpArgGluLysGly ValLeuValGlyValLysAspA erTyrVal erAl AlaVal sp 1 erP ThrThrThrGluLeuSerTyrGluGluVal snAspGiyAspValAsnIle yrVai AiaValThrProinsnH Tyr er et ys sn i alSerPr sn

-17 -10 I 10

106 CAAGGAAGCTGTGGGAGTTGTTGGGCATTCTCTGCTGTTGCTGCCATGGAATCAATAAACGCGATAGTCACTGGGAATTTGATATCACTATCAGAGCAAGAGTTGGTGC GlnGlySerCysGlySerCysTrpAlaPheSerAlaValAlaAlaMetGluSerIleAsnAlaIleValThrGlyAsnLeulleSerLeuSerGluGlnGluLeuValA in| | 1lu in 1lllGlylllZlllt1lllllllllWle w hrVai ly ys rSer S eleP alThrIle eLs rgu snGluTH rlahrinhrThrGly We laVal laSer ysMetMetThila1

@ + 21 = * 29 It1 40 # 50 #

214 GATTGTGATAGGTCGTACAAT GAAGGTTGCGATGGTGGTCTTATGGACTACGCCTTTGAATTCGTCATTAAGAATGGAGGAATCGACACTGAAGAAGACTACCCTC AspCysAspArgSerTyrAsn GluGlyCysAspGlyGlyLeuMetAspTyrAlaPheGluPheValIleLysAsnGlyGlyIleAspThrGluGluAspTyrProA ly hrGlnf hrArg yrIleThrAspGly in 1 snAs_ s l sp ArgSer Tyr sn yrProTrpSer euGinLe AlaGlnTy isTyrArgAsnThH AsnPheM snHis in roSerGln yrIleLeuTyr W y etGly i spSe

= 60 += + + 70 It it it 80 +1

319 TACAAAGAACGCAATGGCGTATGTGATCAATATAGGAAAAATGCCAAGGTTGTTAAAATAGATAGCTATGAAGATGTTCCTGTTAATAACGAAAAGGCGTTGCAAAAGC TyrLysGluArgAsnGlyValCysAspGlnTyrArgLysAsnAlaLysValValLysIleAspSerTyrGluAspValProValAsnAsnGluLysAlaLeuGlnLysA hrAlaGlnAspi sp alAlaLeuGlnAspGln yr hr hr snyrr h rP luGlyValGlnArgTyr rgSerArgGlu W lyProTyrAlaAla lhriyValArgGln inProTy lyeuTyrH leGlyLys ln ysPheAsnProGluLys W i1aPheVa1LysAsnVa1ValAsnIl eThrLe sluetValGlu

90 = 100 #1 110 120 #

427 GCTGTTGCA CATCAACCTGTGAGCATTGCACTTGAAGCTGGTGGCAGAGACTTCCAGCACTACAAATCTGGT ATCTTCACTGGAAAATGT GGTACTC AlaValAla HisGlnProValSerIleAlaLeuGluAlaGlyGlyArgAspPheGlnHisTyrLysSerGly IlePheThrGlyLysCys GlyThrA hr Tyr al sp Wla spAla ysGln rP Serl Asn aial la ys e rg r

H euTyrAsn he he= ValThrGlu etMet alTyrSerSerAsnSer is ro

# 130 # ##130140 #+ 150 = +

523 GCAGTGGATCATGGTGTAGTTATTGCTGGATATGGTACTGAGAATGGCATGGATTATTGGATCGTTAGGAACTCATGGGGAGCTAMACTGCCGAGAGAACGGCTACC AlaValAspHisGlyValValIleAlaGlyTyrGlyThrGluAsnGlyMetAspTyrTrpIleValArgAsnSerTrpGlyAlaAsnCysArgGluAsnGlyTyrA laIle ly ------spThrThrTrpGlP Lys la ilaAiaVal Pro G lllSleLeulieLysl llav y rGlyTrpGlyH AspLys sn la euAlaVal luGln euLe ys er rpGlyA_

159 @ it* 170 # 180@ @ @ 1# + 190

628 CTCAGAGTCCAGCGTAACGTTTCCAGCTCTAGTGGCTTGTGTGGTTTAGCCATAGAGCCTTCATATCCAGTAAAAACAGGACCAAATCCTCCTAAACCCGCTCCATCTC LeuArgValGlnArgAsnValSerSerSerSerGlyLeuCysGlyLeuAlaIleGluProSerTyrProValLysThrGlyProAsnProProLysProAlaProSerA Metxwfflcl -

eLeulyllAM GlyGlyAlal hr le hrMet yrAsnAsnP Ile leLysArgGlyThrGlyAsn yr al yrThrSerSerPh sn

H PheLeuIleGlu GlyLysAsnMet laCysAla ieProGlnVal# # ~~~ ~~~~~200+ = ##210 #220

736 CCTCCATCTCCGGTCAAGCCACCTACAGAGTGTGATGAMATATTCTCAATGCGCTGTCGGCACCACTTGCTGCTGTATCCTTCAGTTCCGTAGGTCTTGCTTCTCTTGGC ProProSerProValLysProProThrGluCysAspGluTyrSerGlnCysAlaValGlyThrThrCysCysCysIleLeuGlnPheArgArgSerCysPheSerTrp

230 240 250 260

844 GGATGCTGCCCACTTGAAGGAGCCACTTGCTGTGAAGACCACTACAGTTGCTGCCCACACGACTATCCTATCTGCAATGTTCGTCAAGGAACATGCTCAATGAGCAAGC GlyCysCysProLeuCluGlyAlaThrCysCysGluAspHisTyrSerCysCysProHisAspTyrProIleCysAsnValArgGlnGlyThrCysSerMetSerLys

270 280 290 300

952 GGCAACCCACTGGGAGTGAAGGCAATGAAGCGCATTCTTGCACAACCTATTGGGGCCTTCGGAAATGGAGGAAAGMGAGCAGTTCTTGMTTCTACAAGCACCMTAC GlyAsnProLeuGlyValLysAlaMetLysArgI leLeuAlaGlnProI leGlyAlaPheGlyAsnGlyGlyLysLysSerSerSer

310 320 329

1060CTGCGGAATGGGGTGAAAAAGCAGGGACAACAGAGGACGTGAATCGATACATTGATT60CAAAACCTCATTTTTCCAGCAGAAAGGTGTAGAAACAGATGATGCAT1168 ATCAGATTACAGATGTTGATTATGATTTGTATATATTGGATTATTGTTCACTTTGTCTATTATTCAGTACATATTCCTTGTTTCTTA1TATGAGACTCCAG1276 TAATGCTTTTTAGTCTTCCATCTGTACTTGGTTTCAACATTAATTAAAAAAAAGGACTATCTTCTGTACCTTTCATTTA25

FIG. 6. C14 cDNA sequence and comparison of the predicted C14 amino acid sequence to thiol proteases. Optimal alignment of amino acidsequences was achieved using the GENALIGN program. C. The predicted C14 amino acid sequencc: A, actinidin (5); P. papain (8): H. cathepsinH (32). Residues that are identical to amino acids in the C14 sequence are indicated by stippled boxes. (8), Residues in the active sitc directlyinvolved in catalysis; ((a ), additional residues in the active site; ( ), cysteines involved in a disulfide bond in actinidin and papain; ( + ). type 11glycyl residues in actinidin; (#), residues in the actinidin hydrophobic core (3, 20).

Dow



LOW-TEMPERATURE-INDUCED mRNAs: ONE ENCODES A THIOL PROTEASE

DISCUSSION

Low Temperature Activates the Expression of Specific Genes.We have sought to understand the effect of chilling on the phys-iology of plant cells by studying the regulation of gene expressionby low temperature. Preliminary experiments (Fig. 1A; 15, 27)detected differences in the mRNA population of chilled andcontrol plant tissue. To further these studies, we have clonedand analyzed mRNAs that accumulate in response to low tem-perature.

Several lines of evidence indicate that low temperature inducesthe accumulation of C14 and C17 mRNA. First, their respectivemRNAs accumulated relatively rapidly when tomato fruit wereexposed to low temperature (Fig. 3). Second, the level of clonedgene expression was inversely proportional to the incubationtemperature (Fig. 4). Third, the mRNAs eventually decayedwhen the low temperature stress was removed (Fig. 3). Fourth,the mRNAs did not significantly accumulate during fruit ripeningat normal temperatures (Fig. 2). We conclude from these resultsthat in tomato fruit low temperature stress induces the expressionof genes that encode the C14 and C17 mRNAs. In addition, wellafter the induction of C14 and C17 gene expression is complete,the activation of C19 gene expression begins (Fig. 2). Thus, wefind both a rapid and a delayed genetic response to low tem-perature.Low temperature reduces the rate of cellular metabolism. Yet,

in spite of the reduction, the concentration of C14 and C17mRNA increases. At present, the mechanisms that regulate chill-inducible gene expression are not known. The accumulation ofspecific mRNAs at low temperature could reflect increased genetranscription and/or selective mRNA stabilization. Measuringthe in vivo relative rates of cloned gene transcription at differenttemperatures using established procedures should allow us todetermine whether transcriptional processes play an importantrole in regulating low temperature-inducible gene expression.We detected C14 and C17 mRNA in both chill-tolerant and

chill-sensitive fruit exposed to low temperature (Fig. 4). Thisresult indicates that the induction of C14 andCl 7 gene expressionby low temperature is probably not solely responsible for thedifferential chilling tolerance displayed by the two lines. Geneticbackground does seem to influence chill-inducible gene expres-sion, as suggested by the quantitative differences in C14 and C17mRNA levels observed in the sensitive and tolerant lines. How-ever, further conclusions from these results are limited becausethe sensitive and tolerant lines most likely differ at many geneticloci unrelated to chilling tolerance (see "Materials and Meth-ods"). It is important to note that these results do not precludethe existence of either constitutively expressed or chill-induciblegenes whose mRNAs are unique to either the sensitive or tolerantline. Isolation of such clones will require a more extensive searchof the appropriate cDNA libraries.The C14 mRNA Encodes a Thiol Protease. The plant (actinidin,

papain) and animal (cathepsin H and B) thiol proteases representa class of highly related enzymes. Analyses of amino acid se-quences (5, 8, 32), three-dimensional x-ray crystallographicstructures (3, 20), and reaction mechanisms (33) indicate thatalthough their respective amino acid sequences differ apprecia-bly, the overall folding patterns of their respective polypeptidechains are very similar, and they utilize the same catalytic mech-anism (20, 33). As shown in Figure 6, many amino acids criticalto the structure and function of thiol proteases are conserved inthe C14 polypeptide. Of particular importance, amino acids areconserved that are involved in catalyzing the reaction, formingthe active site, and constructing disulfide bridges. These resultsstrongly suggest that the C14 mRNA encodes a thiol protease.

In addition to the thiol protease domain, the predicted C14polypeptide includes an NH2-terminal region (Figs. 5 and 6, aminoacids -17 to - 1). Other thiol protease MRNAs encode an NH2-

terminal signal peptide followed by a propeptide sequence (6,8). The signal sequence functions in secretion, while removal ofthe propeptide results in activation of the enzyme. By analogy,amino acids -17 to -1 of the C14 polypeptide might representpropeptide sequences. However, because the C14 cDNA se-quence is truncated at the 5' end, we do not yet know the entireputative propeptide sequence, or whether there is a signal pep-tide.Our DNA sequence analysis also predicts that the C14 poly-

peptide has a 109 amino acid COOH-terminal region (Fig. 6,amino acids 221-329). In contrast, the low mol wt thiol proteasegenes (aleurain [30], papain [8], cathepsin B [6]) do not encodean analogous COOH-terminal region. One possibility is that theCOOH-terminal region is cleaved and not present in the matureC14 protein. However, high mol wt thiol proteases contain mul-tiple domains (4). For example, an avian calcium-dependent thiolprotease consists of multiple domains, including an NH2-terminalthiol protease domain and a COOH-terminal calcium bindingdomain (28). It is thought that the calcium binding domain isresponsible for the regulation of protease activity by calcium.Although the C14 COOH-terminal region is not homologous tothe known calcium binding domains (10), it is possible that thisregion might function to regulate C14 protease activity by bindingto a molecule other than calcium.

Possible Functions for an Inducible Protease Activity duringLow Temperature Stress. In theory, induction of protease activitycould alter cellular metabolism in several ways (4). First, acti-vation of a protease could influence many biochemical pathwaysby increasing the turnover rates of specific enzymes. In animalcells, thiol proteases play a role in general protein degradation(32). Second, activation of a protease could alter cellular bio-chemistry by proteolytically activating specific polypeptides. Thiolproteases in animal cells process a number of protein precursors,such as proapolipoprotein A-II (12) and proinsulin (9). In plantcells, a vacuolar thiol protease is responsible for processing pro-globulin to globulin (16).A third possibility is that a cold-inducible protease might func-

tion by degrading polypeptides denatured by exposure to lowtemperature. Recently, it has been shown (1) that environmentalstresses that denature polypeptides activate mechanisms for theirproteolytic degradation. For example, in Escherichia coli, heatshock activates expression of the lon gene, encoding a proteasethat degrades the denatured polypeptides (11). In certain eu-karyotic systems, heat shock induces production of ubiquitin, amarker for proteolysis of damaged proteins (24). Low temper-ature might also lead to the denaturation of polypeptides. Duringcold stress, conformational changes in proteins have been shownto occur (7), and weakened hydrophobic interactions are thoughtto be responsible (13). In addition, cold stress results in thebreakdown of cellular structure (19) and the leakage of solutesand electrolytes (22) that could lead to polypeptide denaturation.Thus, we speculate that low temperature might denature poly-peptides so as to necessitate an increase in protease activity,provided by the induction of C14 thiol protease gene expression.Elucidating the function of the C14 thiol protease during lowtemperature stress will require isolation of the enzyme, analysisof its proteolytic activity, and localization of the enzyme withinthe plant cell.

Acknowledgments-We thank Dr. R. W. Robinson for the NY 280 tomato line.Computer resources used to carry out our studies were provided by the NationalInstitutes of Health-sponsored (Grant No. 1 U41 RR-01685-05) BIONET NationalComputer Resource for Molecular Biology.

LITERATURE CITED

1. ANANTHAN J, AL GOLDBERG, R VOELLMY 1986 Abnormal proteins serve aseukaryotic stress signals and trigger the activation of heat shock genes. Sci-ence 323: 522-524

2. AUTIO WR, WJ BRAMLAGE 1986 Chilling sensitivity of tomato fruit in relation

435

Dow



436 SCHAFFER AND FISCHER

to ripening and senescence. J Am Soc Hortic Sci 111: 201-2043. BAKER EN 1980 Structure of actinidin, after refinement at 1.7 A resolution. J

Mol Biol 141: 441-4844. BOND JS, PE BUTLER 1987 Intracellular proteases. Annu Rev Biochem 56:

333-3645. CARNE A, CH MOORE 1978 The amino acid sequence of the tryptic peptides

from actinidin, a proteolytic enzyme from the fruit of Actinidia chinensis.Biochem J 173: 73-83

6. CHAN SJ, B SAN SEGUNDO, MB MCCORMICK, DF STEINER 1986 Nucleotideand predicted amino acid sequences of cloned human and mouse prepro-cathepsin B cDNAs. Proc Natl Acad Sci USA 83: 7721-7725

7. CHOLLET R, LL ANDERSON 1977 Conformational changes associated with thereversible cold inactivation of ribulose-1,5-bisphosphate carboxylase-oxy-genase. Biochim Biophys Acta 482: 228-240

8. COHEN LW, VM COGHLAN, LC DIHEL 1986 Cloning and sequencing of papain-encoding cDNA. Gene 48: 219-227

9. DOCHERTY K, RJ CARROLL, DF STEINER 1982 Conversion of proinsulin toinsulin: involvement of a 31,500 molecular weight thiol protease. Proc NatlAcad Sci USA 79: 4613-4617

10. GARIEPY J, RS HODGES 1983 Prmary sequence analysis and folding behaviorof EF hands in relation to the mechanism of action of troponin C andcalmodulin. FEBS Lett 160: 1-6

11. GOFF SA, AL GOLDBERG 1985 Production of abnormal proteins in E. colistimulates transcription of lon and other heat shock genes. Cell 41: 587-595

12. GORDON JI, HF SIMS, C EDELSTEIN, AM SCANU, AW STRAUSS 1984 Humanproapolipoprotein A-II is cleaved following secretion from Hep G2 cells bya thiol protease. J Biol Chem 259: 15556-15563

13. GRAHAM D, BD PATTERSON 1982 Responses of plants to low, nonfreezingtemperatures: proteins, metabolism, and acclimation. Annu Rev Plant Phys-iol 33: 347-372

14. GRIERSON D, A SLATER, J SPEIRS, GA TUCKER 1985 The appearance ofpolygalacturonase mRNA in tomatoes: one of a series of changes in geneexpression during development and ripening. Planta 163: 263-271

15. GUY CL, KJ NIEMI, R BRAMBL 1985 Altered gene expression during coldacclimation of spinach. Proc Natl Acad Sci USA 82: 3673-3677

16. HARA-NISHIMURA I, M NISHIMURA 1987 Proglobulin processing enzyme invacuoles isolated from developing pumpkin cotyledons. Plant Physiol 85:440-445

17. HENIKOFF S 1984 Unidirectional digestion with exonuclease III creates tar-geted breakpoints for DNA sequencing. Gene 28: 351-359

18. HOBSON GE 1987 Low-temperature injury and the storage of ripening toma-toes. J Hortic Sci 62: 55-62

Plant Physiol. Vol. 87, 1988

19. ILKER R, RW BREIDENBACH, JM LYONS 1979 Sequence of ultrastructuralchanges in tomato cotyledons during short periods of chilling. In JM Lyons,D Graham, JK Raison, eds, Low Temperature Stress in Crop Plants. Ac-ademic Press, New York, pp 97-113

20. KAMPHUIS IG, J DRENTH, EN BAKER 1985 Thiol proteases: comparativestudies based on the high-resolution structures of papain and actinidin, andon amino acid sequence information for Cathepsins B and H, and stembromelain. J Mol Biol 182: 317-329

21. KING MM, PM LUDFORD 1983 Chilling injury and electrolyte leakage in fruitof different tomato cultivars. J Am Soc Hortic Sci 108: 74-77

22. LIEBERMAN M, CC CROFT, WV AUDIA, MS WILCOX 1958 Biochemical studiesof chilling injury in sweetpotatoes. Plant Physiol 33: 307-311

23. LINCOLN JE, S CORDES, E READ, RL FISCHER 1987 Regulation of gene expres-sion by ethylene during Lycopersicon esculentum (tomato) fruit develop-ment. Proc Natl Acad Sci USA 84: 2793-2797

24. LINDQUIST S 1986 The heat-shock response. Annu Rev Biochem 55: 1151-1191

25. MANIATIS T, EF FRITSCH, J SAMBROOK 1982 Molecular Cloning: A LaboratoryManual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp 211-246, 309-361

26. MARKHART AH III 1986 Chilling injury: a review of possible causes. Hort-Science 21: 1329-1333

27. MEZA-BAsso L, M ALBERDI, M RAYNAL, M-L FERRERO-CADINANOS, MDELSENY 1986 Changes in protein synthesis in rapeseed (Brassica napus)seedlings during a low temperature treatment. Plant Physiol 82: 733-738

28. OHNO S, Y EMORI, S IMAJOH, H KAWASAKI, M KISARAGI, K SUZUKI 1984Evolutionary origin of a calcium-dependent protease by fusion of genes fora thiol protease and a calcium-binding protein? Nature 312: 566-570

29. RHODES MJC, LSC WOOLTORTON 1977 Changes in the activity of enzymes ofphenylpropanoid metabolism in tomatoes stored at low temperatures. Phy-tochemistry 16: 655-659

30. ROGERS JC, D DEAN, GR HECK 1985 Aleurain: a barley thiol protease closelyrelated to mammalian cathepsin H. Proc Natl Acad Sci USA 82: 6512-6516

31. SACHS MM, T-HD Ho 1986 Alteration of gene expression during environ-mental stress in plants. Annu Rev Plant Physiol 37: 363-376

32. TAKIO K, TTOWATARI, N KATUNUMA, DC TELLER, KTITANI 1983 Homologyof amino acid sequences of rat liver cathepsins B and H with that of papain.Proc Natl Acad Sci USA 80: 3666-3670

33. WILLENBROCK F, K BROCKLEHURST 1985 A general framework of cysteine-proteinase mechanism deduced from studies on enzymes with structurallydifferent analogous catalytic-site residues Asp-158 and -161 (papain andactinidin), Gly-196 (cathepsin B) and Asn-165 (cathepsin H). Biochem J227: 521-528

Dow



Documents

Analysis of mRNAsthat Accumulate in Response - Plant Physiology