Analysis of Immune-Relevant Genes Expressed in Spleenof Capra hircus Kids Fed with Trivalent Chromium

Mostafa Sadeghi & Mohammad Javad Najafpanah

Received: 14 August 2013 /Accepted: 16 September 2013 /Published online: 29 September 2013# Springer Science+Business Media New York 2013

Abstract Chromium is a biologically important element forhumans and laboratory animals. Although the favorable effectsof trivalent chromium on immune responses of studied animalshave been well documented, the precise mechanisms by whichthe chromium acts on immune system is relatively poor stud-ied. In this study, real-time qPCR technique was employed toevaluate the expression profiles of four immune-related genes(B2M, MHCA, MHCB, and Rap2A) in spleens of the domes-tic goats, Capra hircus , feeding on four different levels ofsupplemental chromium (0, 0.5, 1, and 1.5 mg/day) as chro-mium–methionine. The results showed that 1.5 mg/day ofsupplemental chromium significantly increased the expressionof the four studied genes (P <0.01). Since the studied genesplay important roles in development, activation, and migrationof lymphocytes, their increased expression seems to be anunknown mechanism by which chromium impose reinforcingeffects on immune system. Therefore, supplemental chromiumcan be potentially used to improve immune responses espe-cially in animals experiencing any type of stress such asinvasion by a pathogen.

Keyword Chromium . Domestic goat . Gene expression .

Immunity . Real-time PCR

Introduction

A large number of biologically active substances, includingheavy metals, may have direct, primary, or secondary effects

on the immune system and are of interest to pathologists,immunologists, and toxicologists [1]. Chromium (Cr) is animportant element for humans and laboratory animals [2]which occurs preliminarily in two valence states: trivalentchromium Cr(III) and hexavalent chromium Cr(VI). Al-though, the toxicity and carcinogenic effects of hexavalentchromium were discovered toward the end of nineteenthcentury [3, 4], trivalent chromium had been established asan essential ultra-trace nutrient for nearly 30 years [5]. Recentstudies, however, reveal that chromium should not be consid-ered as essential element for mammals [5]. Trivalent chromi-um is especially a well-known element because it potentiatesthe actions of insulin [6, 7] and has been proposed to shuntmore energy towards growth and production [8]. Therefore,Cr(III) is effectively involved in normal metabolism of lipidsand carbohydrates and proteins [9]. A large body of evidenceindicates that trivalent chromium can alter the biologicalproperties of animals such as carcass traits, the area oflongissimus muscle, mass gain, dressing percentage, nutrientdigestibility, etc. [10–12]. Additionally, Cr(III) has been sug-gested to affect a variety of other biological traits such ashormonal regulation, fat accumulation, and immunity againstpathogens [7, 10, 12–16]. As an example for the latter case,Burton showed that chromium supplementation could lead toimproved immune status and health of both market-transit-stressed calves and early lactation dairy cows [14]. Similarly,supplementation of stressed calves with chromium yeast im-proved antibody production in response to human red bloodcells [17] and ovalbumin [16]. Since the beneficial effects ofchromium on immunity are especially evident during times ofstress [18], alleviating stress-related immunosuppressionseems to be the main mechanism by which the chromium acts[13]. More notably, recent studies have shown that both triva-lent and hexavalent states of chromium can alter the expres-sion of a variety of genes in human and laboratory animals[19–22]. For example, trivalent chromium has been suggestedto alter the expression of 20 genes in the fish Fundulusheteroclitus [20]. Similarly, it has been previously shown that

Mostafa Sadeghi and Mohammad Javad Najafpanah are joint firstauthors.

M. Sadeghi (*) :M. J. NajafpanahDepartment of Animal Science, College of Agriculture and NaturalResources, University of Tehran, Karaj, Irane-mail: sadeghimos@ut.ac.ir

M. J. Najafpanahe-mail: mjnajafpanah@ut.ac.ir

Biol Trace Elem Res (2013) 156:124–129DOI 10.1007/s12011-013-9828-z

supplementation of domestic goats (Capra hircus ) by 1.5 mg/day chromium decreases the accumulation of fats in adiposetissues such as liver, subcutaneous fat, and visceral fat throughdownregulation of the gene encoding acetyl coA carboxylase1, the main enzyme involved in biosynthesis of fatty acids inmammals (submitted for publication by MJ Najafpanah, MSadeghi, A Zali, H Moradi-Shahrebabak, and H Mousapour).As chromium plays an important role in increased immunityand health (see above), we hypothesized that it may alter theexpression of gene(s) responsible for immunity against envi-ronmental stressful agents. To test this hypothesis, in thisstudy, the expression profiles of four immune-relevant genes(beta-2-microglubulin (B2M), MHCII-DRA, MHCII-DRB,and Rap2A) were evaluated in spleens of the domestic goats,C. hircus , in response to four different levels of chromiumsupplementation (0, 0.5, 1, and 1.5 mg/day). MHC-alpha,MHC-beta, and B2M are three components of the majorhistocompatibility complex (MHC) molecules [23] that pres-ent peptides derived from either endogenous or foreign pro-teins to lymphocytes, thus, plays a key role in the discrimina-tion of self from non-self [24–26]. Rap2A belongs to a familyof monomeric low molecular weight GTP-binding proteins.Members of this family are well known to play important rolesin maturation, trafficking, and activation of lymphocytes[27–29].

Materials and Methods

Animals and Housing

Twenty-four male goat kids (4–5 months old) belonging to thenative Iranian breed, Mahabadi, were selected for this study,and all procedures related to immunity and nutrition wereconducted under protocols approved by the Research Stationof Department of Animal Science, College of Agriculture andNatural Resources, University of Tehran, Iran.

The kids were weighed (BM=22±2 kg) and allocatedrandomly to one of the four following dietary treatments:standard diet plus 0, 0.5, 1, and 1.5 mg chromium per day aschromium–methionine (Availa®Cr 1000, Zinpro Corporation,USA). The standard diet was prepared using NRC computersoftware (see Appendix 1). The kids were supplemented withchromium before each morning nutrition meal as a milledpowder mixed with 50 g barley. The kids were individuallypenned for 100 days (10 days for adaptation and 90 days forfeeding period), with accessibility to enough water and pro-vided with the prepared diets twice a day (0800 and1700 hours). To determine any change in body mass, the kidswere weighed before the morning feeding meal every 3 weeksthroughout the experiment period.

Slaughter and Sampling

After feeding on the prepared diets for 90 days, the kids weretransferred to the departmental abattoir, where they were keptfor 12 h under starvation with free access to water. They werethen slaughtered through decapitation, and fresh samples tak-en from their spleens were immediately frozen in liquid nitro-gen (−196 °C) and transferred to the laboratory, where theywere maintained at −80 °C until used.

Total RNA Extraction and cDNA Synthesis

Total RNA was extracted according to the method ofChomczynski and Sacchi using Trizol reagent [30] (InvitrogenCo., Carlsbad, CA, USA). To remove any remnant of thegenomic DNA from the samples, the extracted RNAwas thentreated with RNase-free DNase I (TaKaRa, Shuzo, Kyoto,Japan). RNA concentrations were estimated by Nanodropspectrophotometry at 260 nm, and their purities were checkedby determining the absorption ratios at 260/280 nm. Thequality of extracted RNA was assessed by electrophoresis at1 % agarose gel containing ethidium bromide. First-strandcDNA was synthesized from 100 ng of total RNA using anoligo (dT) primer, random hexamers, and a commerciallyavailable kit (AccuPower® RocketScript™ RT PreMix)according to manufacturer’s instructions. The process ofcDNA synthesis initiated by connection of the primers at37 °C for 1 min followed by cDNA synthesis at 50 °C for60 min and terminates by inactivation of the reverse transcrip-tase enzyme at 90 °C for 5 min. The synthesized cDNA wasincubated at −20 °C until used.

Primer Designing

In this study, the heat shock protein 90 gene (HSP-90) wasused as reference gene for normalization of expression dataobtained from reverse transcriptase–polymerase chain reac-tion (RT-PCR). This was selected based on a previous study inwhich the expression stability of nine candidate genes wasevaluated using six common software programs (submittedfor publication by M. Sadeghi, M. J. Najafpanah, and M. R.Bakhtiarizadeh). The nucleotide sequences of the two genes,MHCII-DRA and MHCII-DRB, as well as that of HSP-90reference gene belonging to the domestic goat (C. hircus) wereobtained from the public databases [GenBank, National Centerfor Biotechnology Information (NCBI)]. For each of B2M andRAP2A genes, only one sequence was available for the relativespecies Ovis aries . Primer pairs were designed from thesesequences (optimal Tm at 59.8 °C and GC% between 45 and50%) using primer3Plus [31] and Primer3 [32] online softwareprograms (Table 1) and checked for suitability using

Effect of Chromium on Immune-Relevant Genes Expression 125

OligoAnalyzer 3.1 (http://eu.idtdna.com/analyzer/applications/oligoanalyzer/) and OligoCalc [33]. The specificity of designedprimers was evaluated using PrimerBLAST software of NCBIdatabase [34].

Real-time RT-PCR

Real-time quantitative PCR was performed using SYBRGreen I technology on iQ5 System (BioRad, USA). Thereactions consisted of 10 μL SYBR Green PCR Master Mix(SYBR biopars, GUASNR, Iran) [10 pMol (1 μL)] of eachspecific forward and reverse primers, 3 μL of cDNA, and5 μL nuclease free water to a final volume of 20 μL. Reversetranscription–quantitative polymerase chain reaction (RT-qPCR) was performed for samples taken from spleens andsix biological replicates, three experimental replicates, andone control were considered for each reaction.

The PCR temperature profiles consisted of an initial dena-turation at 95 °C for 30 s followed by 35 cycles at 95 °C(denaturation, 10 s), 59.8 °C (annealing, 10 s), and 72 °C(elongation, 10 s), and a final extension at 72 °C for 5 min.The amplified DNA was incubated at 4 °C. PCR amplifiedproduct of 5.5 μl was purified by use of horizontal electro-phoresis in a 2 % agarose gel and visualized by ethidiumbromide to confirm the specificity of amplified fragments.

The efficiency of real-time RT-PCR was assessed for eachgene based on the slope of a linear regression model [35]. Thebulks of each cDNA sample were used as PCR template toproduce a graph of threshold cycle (CT) in a range of tenfolddilution series. The corresponding real-time RT-PCR efficien-cies were calculated based on the slope of the standard curveusing the following equation: (E=10−1/slope−1) [36]. Amelting curve analysis was conducted for each amplificationbetween 55 and 95 °C to eliminate any nonspecific productsuch as primer–dimers.

Statistical Analyses

The data obtained from RT-qPCR were analyzed according tothe method of Livak and Schmittgen [37] with HSP-90 gene

was served as reference gene for estimation of the initial Ctvalues. The mean Ct value was calculated for HSP-90, andeach of the four studied genes and ΔCt value was determinedfor each gene using the following formula:

ΔCt ¼ Ct target geneð Þ – Ct HSP−90ð Þ

After calculation of ΔCt for all samples taken from spleensof kids fed on different chromium levels, the expression statusof the four genes relative to HSP-90 was estimated using thefollowing formula [37]:

RE ¼ 2−ΔΔCt ¼ 2− ΔCð

ttarget geneð Þ−ΔC

tHSP−90ð Þ

All data were statistically analyzed using SAS computersoftware version 9.1 (SAS Institute Inc., Cary, NC, USA). Theaverage expression values of different diets were exposed toanalysis of variance (ANOVA) using the GLM procedure ofSAS software at level of 0.05.

Results

The amplifications were validated for specificity by analysisof melting curve, which was generated at the end of eachreaction. All of the four studied genes as well as HSP-90provided a single peak in the melting curve indicating theabsence of primer–dimer formation during the reaction, thusconfirming the specificity of the amplifications. The efficien-cy and linearity of reactions were checked using the tenfoldserial dilutions. The relationship between threshold cycle (Ct)and the log copy numbers of cDNA for the all studied geneswere linear. Moreover, the efficiency values of amplificationsranged from 1.86 to 2.11 which are near to the theoreticaloptimum level of two [38].

The Ct values in spleens of different nutritional groupsranged from 20.57 to 26.92 for MHCA, from 22.31 to 28.1for MHCB, from 18.7 to 30.41 for Rap2A, from 25.72 to32.65 for B2M, and from 17.82 to 33.44 for HSP-90. Thenearly equal Ct value for the four studied genes and HSP-90indicates that these genes reach the detection threshold with

Table 1 Sequence and some characterization of specific primer pairs for genes and the selected reference gene, HSP-90

Gene name Accessionnumber

Sense primer sequence5′→3′

Anti-sense primer sequence5′→3′

Length(bp)

Tm(°C)

HSP-90 AF548366.1 GCCCGAGATAGAAGACGTTG AGTCGTTGGTCAGGCTCTTG 197 59.8

MHC-alpha AB008754.1 AGCCCAACACACTCATCTGC AGTGGAACTTGCGGAAAAGGT 147 59.8

MHC-beta FN997660.1 GCGATTCCTGGACAGATACTTC GAATCTCCTTCTGGCTGTTCC 131 59.8

RAP2A NM_001161878.1 GAGAGTACAAAGTGGTGGTGC TCGATGGTGGGGTCATACTTC 106 59.8

B2M DQ386890.1 TGTCCCACGCTGAGTTCACT TGAGGCATCGTCAGACCTTGA 137 59.8

126 Sadeghi and Najafpanah

the same amounts of amplification cycles, indicating that theyare nearly equal in abundance in spleen.

The expression of all studied genes in spleen of goat kidsincreased significantly as a result of supplementation with1.5 mg/day chromium. Supplementation of kids with 1.5 mg/day chromium led to a nearly 12-fold increase in expression ofB2M (one-wayANOVA,F =46.67,P <0.01) (Fig. 1a), a nearlyeightfold increase in expression of MHCA (one-way ANOVA,F =4.26, P <0.01) (Fig. 1b), and a nearly 30-fold increase inexpression of MHCB (one-way ANOVA, F =27.73, P <0.01)(Fig. 1c), and Rap2A (one-way ANOVA, F =16.67, P <0.01)(Fig. 1d). Although the lower doses of chromium (i.e., 0.5 and1 mg/day) increased the expression of all studied genes, nosignificant difference was found in their expression comparedto control kids (see Fig. 1).

Discussion

In this study, the expression profiles of four immune-relatedgenes (B2M, MHCA, MHCB, and Rap2A) were evaluated inspleens of goat kids feeding on four different levels of chro-mium as food supplementation. Mammalian spleen is one ofthe most important organs involved in induction and mainte-nance of both innate and acquired immune defense mecha-nisms [39, 40]. In particular, spleen is regarded as an impor-tant center for both production and storage of lymphocytes,

the main white blood cells in vertebrate systems that directlycontribute to immunity against disease-carrying agents [41].Therefore, spleen seems to be an ideal tissue for studying theeffect of nutritional components on expression of immune-related genes.

MHC-alpha,MHC-beta, and B2M are three components ofthe major histocompatibility complex (MHC) molecules [23].The MHC is a highly polymorphic gene complex encodingcell surface receptors that play a critical role in the initiation ofimmune responses. By presenting peptides derived from ei-ther endogenous or foreign proteins to lymphocytes, theMHCplays a central role in the discrimination of self from non-self,thereby regulating recognition of infectious diseases [24–26].The genes belonging to the MHC group are now the mostfrequently studied genes because of their influences on manyimportant traits, such as resistance to infectious diseases,autoimmunity, compatibility of tissue transplants, and sponta-neous abortion [42].

Rap2A, on the other hand, belongs to the Rap group, afamily of monomeric low molecular weight GTP-bindingproteins that are believed to play important roles in immunity[29]. The Rap2 isoform of Rap family has been shown topromote the activation of integrin, a transmembrane receptorrequiring for maturation, trafficking, and activation of lym-phocytes [28]. Additionally, both Rap1 and Rap2 isoforms ofRap family have been suggested to facilitate the migration ofB-lymphocytes toward the stromal cell-derived factor-1, a

Fig 1 Relative expression of fourimmune-related genes, B2M (a),MHC-alpha (b), MHC-beta (c),and Rap2A (d) in spleen of goatkids feeding on four differentlevels (0, 0.5, 1, and 1.5 mg/day)of supplemental chromium; barswith different letters showsignificant difference at the 0.05level

Effect of Chromium on Immune-Relevant Genes Expression 127

chemokine protein that is strongly chemotactic for lympho-cytes and play crucial role in normal development and activa-tion of B cells [27].

Results of the current study revealed that goat kids feedingon different levels of chromium supplementation showedhigher expression of the four studied immune-related genescompared to those feeding on standard diet only (Fig. 1).Significant effects were only observed in kids feeding on1.5 mg/day chromium (P <0.01). The augmentative im-pacts of trivalent chromium on immunity of human andlaboratory animals have been documented in different stud-ies [7, 14, 16–18]. For example, Haldar et al. reported thatdwarf Bengal goats (C. hircus ) supplemented with chromi-um as CrCl3 showed a higher primary antibody responseagainst the peste des petits ruminants disease [7]. In anoth-er study, Burton et al. showed that supplemental dairychromium elevates anti-ovalbumin-antibody responsesand mitogen-stimulated blastogenic responses of peripheralblood mononuclear cells in dairy cows subjected to physi-cal and metabolic stresses [13]. Surprisingly, the positiveeffects of chromium supplementation on immunity andhealth have been more frequently documented in laboratoryanimals during times of stress when some functions oflymphocytes and neutrophils are impaired [13–18, 43]. Thisimplies that chromium alleviates stress-related suppression ofimmunity [13]. Despite the direct effects of chromium onimmunity have been well documented, no study has beenyet carried out to evaluate the effects of chromium on expres-sion of genes involved in immunity. The current study high-lights, for the first time, the augmentative effects of supple-mental chromium on expression of four important immune-related genes.

In summary, findings of this study indicated significanteffects of supplemental chromium on expression of genesinvolved in development, migration, and activation of whiteblood cells in spleen of domestic goat kids. Supplementationof kids with 1.5 mg/day chromium seems to be optimal as itinduced the greatest elevation in expression of the four studiedgenes (P <0.01). Uncovering the role of chromium on expres-sion of immune-related genes may improve understanding ofthe precise mechanisms by which chromium acts on immunesystem of mammals. Since the effects of chromium are moreevident in stressed animals, future experiments are proposedto explore the impacts of supplemental chromium on expres-sion of immune-related genes in animals experiencing anytype of stress such as invasion by a disease-carrying agent ormetabolic stresses.

Acknowledgments We are thankful to Dr. M. Ganjkhanlou, Dr. A. Zali,and A. Emami for their helps with this study. This work was financiallysupported by the University of Tehran.

Appendix 1

References

1. Shrivastava R, Upreti R, Seth P, Chaturvedi U (2002) Effects ofchromium on the immune system. FEMS Immunol Med Microbiol34(1):1–7

2. MertzW (1993) Chromium in human nutrition: a review. J Nutr 123(4):626–633

Table 2 Ingredient, chemical composition, andmacro- andmicromineralof basal standard diet fed to goat kids

Ingredient (% of DM)

Alfalfa hay 16.49

Corn silage 8.32

Wheat straw 5.19

Ground barley grain 50.65

Wheat bran 9.09

Canola meal 4.55

Soybean meal 2.21

Calcium carbonate 1.3

Mineral–vitamin supplementa 0.91

Sodium bicarbonate 0.77

Salt 0.52

Chemical composition

DM (%) 80.78

CP (%) 13.5

Ether extract (%) 2.6

NDF (%) 36.6

Ash (%) 9

NEL (Mcal/kg) 2.41

Macro- and micromineral

Calcium (%) 0.89

Phosphorus (%) 0.48

Magnesium (%) 0.27

Sulfur (%) 0.28

Zn (mg/kg DM) 219

Fe (mg/kg DM) 368

I (mg/kg DM) 3

Mn (mg/kg DM) 216

Cu (mg/kg DM) 54

Co (mg/kg DM) 1

Cr (mg/kg DM) 0.83

a Containing per kilogram DM: calcium, 195 g; phosphorus, 80 g; mag-nesium, 21,000 mg; sodium, 50 g; manganese, 2,200 mg; iron, 3,000 mg;copper, 300 mg; iodine, 120 mg; cobalt, 100 mg; zinc, 300 mg; selenium,1.1 mg; antioxidant, 2,500 mg; vitamin A, 600,000 IU; vitamin D3, 200,000 IU; vitamin E, 200 mg

128 Sadeghi and Najafpanah

3. De Flora S (2000) Threshold mechanisms and site specificity inchromium (VI) carcinogenesis. Carcinogenesis 21(4):533–541

4. Izzotti A, Cartiglia C, Balansky R, D’Agostini F, Longobardi M, DeFlora S (2002) Selective induction of gene expression in rat lung byhexavalent chromium. Mol Carcinog 35(2):75–84

5. Di Bona KR, Love S, Rhodes NR, McAdory D, Sinha SH, Kern N,Kent J, Strickland J,Wilson A, Beaird J, Ramage J, Rasco JF, VincentJB (2011) Chromium is not an essential trace element for mammals:effects of a “low-chromium” diet. J Biol Inorg Chem 16:381–390

6. Pechova A, Pavlata L (2007) Chromium as an essential nutrient: areview. Vet Med (Praha) 52(1):1

7. Haldar S, Mondal S, Samanta S, Ghosh T (2009) Effects of dietarychromium supplementation on glucose tolerance and primary anti-body response against peste des petits ruminants in dwarf Bengalgoats (Capra hircus). Animal 3(2):209–217

8. Swanson K, Harmon D, Jacques K, Larson B, Richards C, BohnertD, Paton S (2000) Efficacy of chromium-yeast supplementation forgrowing beef steers. Anim Feed Sci Technol 86(1):95–105

9. Yan X, Zhang W, Cheng J, Wang R, Kleemann DO, Zhu X, Jia Z(2008) Effects of chromium yeast on performance, insulin activity,and lipid metabolism in lambs fed different dietary protein levels.Asian Australas J Anim Sci 21(6):853

10. Anderson RA (1994) Stress effects on chromium nutrition of humansand farm animals. Nothingham University, Nothingam

11. Emami A, Zali A, Ganjkhanlou M, Akbari-Afjani A (2012) Nutrientdigestibility, carcass characteristics and plasma metabolites in kidsfed diets supplemented with chromium methionine. Online J AnimFeed Res 2(2):127–132

12. Pechova A, Podhorský A, Lokajova E, Pavlata L, Illek J (2002)Metabolic effects of chromium supplementation in dairy cows inthe peripartal period. Acta Vet Brno 71(1):9–18

13. Burton J, Mallard B, Mowat D (1993) Effects of supplementalchromium on immune responses of periparturient and early lactationdairy cows. J Anim Sci 71(6):1532–1539

14. Burton JL (1995) Supplemental chromium: its benefits to the bovineimmune system. Anim Feed Sci Technol 53(2):117–133

15. Burton JL, Mallard BA, Mowat DN (1994) Effects of supplementalchromium on antibody responses of newly weaned feedlot calves toimmunization with infectious bovine rhinotracheitis and parainfluenza3 virus. Can Vet Res 58(2):148

16. Chang GX, Mallard BA, Mowat D, Gallo G (1996) Effect of sup-plemental chromium on antibody responses of newly arrived feedercalves to vaccines and ovalbumin. Can J Vet Res 60(2):140

17. Moonsie-Shageer S, Mowat D (1993) Effect of level of supplementalchromium on performance, serum constituents, and immune status ofstressed feeder calves. J Anim Sci 71(1):232–238

18. Borgs P, Mallard B (1998) Immune-endocrine interactions in agri-cultural species: chromium and its effect on health and performance.Domest Anim Endocrinol 15(5):431–438

19. Clancy HA, Sun H, Passantino L, Kluz T, Munoz A, Zavadil J, CostaM (2012) Gene expression changes in human lung cells exposed toarsenic, chromium, nickel or vanadium indicate the first steps incancer. Metallomics 4(8):784–793

20. Maples NL, Bain L (2004) Trivalent chromium alters gene expres-sion in the mummichog (Fundulus heteroclitus). Environ ToxicolChem 23(3):626–631

21. Permenter MG, Lewis JA, Jackson DA (2011) Exposure to nickel,chromium, or cadmium causes distinct changes in the gene expres-sion patterns of a rat liver derived cell line. PloS One 6(11):e27730

22. Ye J, Shi X (2001) Gene expression profile in response to chromium-induced cell stress in A549 cells. Mol Mech Met Toxic Carcinogen34:189–197

23. GüssowD, Rein R, Ginjaar I, Hochstenbach F, Seemann G, KottmanA, Ploegh H (1987) The human beta 2-microglobulin gene. Primarystructure and definition of the transcriptional unit. J Immunol 139(9):3132–3138

24. Apanius V, Penn D, Slev PR, Ruff LR, Potts WK (1997) The natureof selection on the major histocompatibility complex. Crit RevImmunol 17(2):40

25. Penn DJ, Potts WK (1999) The evolution of mating preferences andmajor histocompatibility complex genes. Am Nat 153(2):145–164

26. Thornhill R, Gangestad SW, Miller R, Scheyd G, McCollough JK,Franklin M (2003) Major histocompatibility complex genes, symme-try, and body scent attractiveness in men and women. Behav Ecol14(5):668–678

27. McLeod SJ, Li AH, Lee RL, Burgess AE, Gold MR (2002) The RapGTPases regulate B cell migration toward the chemokine stromalcell-derived factor-1 (CXCL12): potential role for Rap2 in promotingB cell migration. J Immunol 169(3):1365–1371

28. McLeod SJ, Shum AJ, Lee RL, Takei F, Gold MR (2004) The RapGTPases regulate integrin-mediated adhesion, cell spreading, actinpolymerization, and Pyk2 tyrosine phosphorylation in B lympho-cytes. J Biol Chem 279(13):12009–12019

29. Paganini S, Guidetti GF, Catricalà S, Trionfini P, Panelli S, BalduiniC, Torti M (2006) Identification and biochemical characterization ofRap2C, a new member of the Rap family of small GTP-bindingproteins. Biochimie 88(3):285–295

30. Chomczynski P, Sacchi N (2006) The single-step method of RNAisolation by acid guanidinium thiocyanate–phenol–chloroform ex-traction: twenty-something years on. Nat prot 1(2):581–585

31. Untergasser A, Nijveen H, Rao X, Bisseling T, Geurts R, LeunissenJA (2007) Primer3Plus, an enhanced web interface to Primer3.Nucleic Acids Res 35(suppl 2):W71–W74

32. Rozen S, Skaletsky H (1999) Primer3 on theWWW for general usersand for biologist programmers. In: Bioinformatics methods and pro-tocols . Springer, pp 365–386

33. Kibbe WA (2007) OligoCalc: an online oligonucleotide propertiescalculator. Nucleic Acids Res 35(suppl 2):W43–W46

34. Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL(2012) Primer-BLAST: a tool to design target-specific primers forpolymerase chain reaction. BMC Bioinforma 13(1):134

35. Pfaffl MW (2001) A new mathematical model for relative quantifi-cation in real-time RT–PCR. Nucleic Acids Res 29(9):e45–e45

36. Radonić A, Thulke S, Mackay IM, Landt O, Siegert W, Nitsche A(2004) Guideline to reference gene selection for quantitative real-time PCR. Biochem Biophys Res Commun 313(4):856–862

37. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expres-sion data using real-time quantitative PCR and the 2− ΔΔC

t method.Methods 25(4):402–408

38. Wilkening S, Bader A (2004) Quantitative real-time polymerasechain reaction: methodical analysis and mathematical model. J BiolTechnol 15(2):107

39. Bohnsack J, Brown E (1986) The role of the spleen in resistance toinfection. Ann Rev Med 37(1):49–59

40. Wijburg O, VANROOIJENN (1997) Role of spleen macrophages ininnate and acquired immune responses against mouse hepatitis virusstrain A59. Immunology 92(2):252–258

41. Abbas AK, Lichtman AH, Pillai S (2005) Cellular and molecularimmunology. Saunders, Philadelphia

42. Penn DJ (2002) The scent of genetic compatibility: sexual selectionand the major histocompatibility complex. Ethology 108(1):1–21

43. Kegley E, Spears J, Brown T (1997) Effect of shipping and chromi-um supplementation on performance, immune response, and diseaseresistance of steers. J Anim Sci 75(7):1956–1964

Effect of Chromium on Immune-Relevant Genes Expression 129