Upload
lyliem
View
212
Download
0
Embed Size (px)
Citation preview
UNIVERSIDADE DE LISBOA FACULDADE DE CIÊNCIAS
DEPARTAMENTO DE BIOLOGIA ANIMAL
Analysis of Hox10 specific peptide motifs in
their patterning functions of the axial skeleton
Isabel Misteli Guerreiro
Mestrado em Biologia Evolutiva e do Desenvolvimento 2009
UNIVERSIDADE DE LISBOA FACULDADE DE CIÊNCIAS
DEPARTAMENTO DE BIOLOGIA ANIMAL
Analysis of Hox10 specific peptide motifs in
their patterning functions of the axial skeleton
Isabel Misteli Guerreiro
Dissertação orientada por:
Professor Doutor Eduardo José de Frias Gonçalves Crespo
Doutor Moisés Mallo Perez
Mestrado em Biologia Evolutiva e do Desenvolvimento 2009
Acknowledgments São muitas as pessoas que tiveram uma contribuição essencial para a realização desta tese.
Ao Moisés, que me deixou encontrar o meu lugar no seu laboratório e perceber o valor da
curiosidade, da independência e da perseverança para ter sucesso no mundo da Ciência. Por
continuar a acreditar em mim e dar valor ao meu trabalho. Porque o que aprendi com ele foi
muito mais do que apenas técnicas laboratoriais.
Ao Professor Eduardo Crespo, por ter aceitado ser meu orientador interno.
Ao Instituto Gulbenkian de Ciência, uma instituição com excelentes condições e espírito
científico.
A todas as pessoas com quem trabalhei lado a lado todos os dias e com quem partilhei
frustrações, risos, parvoíces, cervejas, conversas com maior ou menor valor científico.
À Vanessa, a “minha colega de mesa”, que todos os dias me dava um exemplo de força e boa
disposição. Agradeço-lhe pelo apoio, pela compreensão, pelos desabafos. Desejo-lhe muita
sorte para ela e a sua linda família.
À Jen, por me ter ensinado tanto, pelas conversas longas, pela amizade e pela ajuda. Thank
you for being patient and explaining everything so well. You helped me more than you know.
Ao Arnon pelo bom humor brasileiro, pelo encorajamento, pelos cafés, pela companhia até às
tantas. Pelas brincadeiras e pelos momentos divertidos “Cara!”. Até mesmo pelas piadas de
portugueses e loiras.
À Mafalda que, apesar de não ter ficado muito tempo, conseguia pôr um sorriso na cara de
toda a gente assim que chegava. Por estar cheia de vida e por ser um “bicho social”.
À Tânia, pelo apoio, por ter começado o trabalho e ter garantido que eu entrava com o pé
direito na minha tese. Por se disponibilizar sempre para ajudar. Pela companhia e conselhos no
“meeting” em Carmona.
À Ana, por tratar dos ratinhos e pelo excelente trabalho que desenvolve na unidade de
transgénicos. Por ter sido um pouco responsável por cada um dos fenótipos que obtive.
Ainda que não tenha estado muito presente, à Filipa pelo seu jeito tão bem-disposto e
particular. Pela sua entrega às artes dramáticas.
Ao grupo da organogénese, com o qual dividíamos a ala … e reagentes. À Raquel, pelas
noitadas e pelas gargalhadas. Pelos “Domingos” e os lanches. Porque o laboratório ficava
sempre mais triste quando ela voltava a Badajoz. À Rita por estar sempre lá tanto dentro como
fora do laboratório, pela companhia e pelos desabafos. Pelo apoio incondicional e pela
amizade. À Joana pelas “manias”, pelas piadas e por tentar pegar fogo ao laboratório.
Ao “grupo de estudo”, por ter tornado a escrita da tese divertida. À Rita e à Célia pela comida
de plástico, gargalhadas e entreajuda. Pela amizade e muitos, muitos cafés.
Aos amigos e à família sem os quais teria sido difícil manter a minha sanidade mental.
VII
Abstract Hox genes play a fundamental role in anterior-posterior patterning and are remarkably
conserved throughout evolution (Slack et al., 1993). Their products are transcription factors
that regulate a specific set of genes with essential functions in development. Although
different Hox genes show a notable functional specificity in vivo, they demonstrate a
surprisingly low DNA-binding specificity in vitro. Sequence analysis can provide a way to
understand how Hox genes achieve their biological specificity (Prince, 2002).
Genetic experiments revealed that Hox genes are involved in global patterning processes in
the axial skeleton to produce the axial formulae. Hox group 10 genes, in particular, have been
shown to repress thoracic rib formation, since their overexpression in the presomitic
mesoderm causes a ribless phenotype and their global inactivation resulted in extra ribs
(Wellik et al., 2003, Carapuço et al., 2005).
Two peptide domains were identified in Hox10 proteins which are conserved among all the
Hox 10 members and are absent from all other Hox proteins. One of these is an octapeptide
located just N-terminal to the homeodomain. The purpose of this work is to understand the
role of this octapeptide in Hox10 protein function. This is being approached by the genesis and
functional analysis of transgenic mice expressing mutant Hoxa10 proteins that contain specific
deletions or amino acid changes in this domain. In previous transgenic assays, the
overexpression of Hoxb9 gene in the presomitic mesoderm did not produce an abnormal axial
skeleton phenotype. For this reason, this gene was used to generate chimeric contructs with
the Hoxa10 gene.
The results obtained show that the removal of the octapeptide is sufficient to block the rib-
repressing activity of Hoxa10 when expressed in the presomitic mesoderm. In addition,
introduction of this peptide motif, as well as the whole Hoxa10 sequence N-terminal to it, into
the Hoxb9 protein produced a partial ribless phenotype. These results indicate that the
octapeptide is necessary for the rib-repressing activity of Hoxa10 but it does not seem to be
sufficient for this function, at least individually.
Keywords: Hox genes, axial patterning, functional specificity, protein sequence
VIII
IX
Resumo Em mamíferos, existem 39 genes Hox responsáveis por especificar a polaridade antero-
posterior (AP). Estes genes são homólogos dos genes selectores homeóticos que especificam a
identidade segmentar em Drosophila melanogaster. Nos vertebrados, tal como em Drosophila
estes genes são expressos pela mesma ordem pela qual estão distribuídos nos cromossomas.
Os genes Hox dos mamíferos demonstram não só esta colinearidade a nível espacial como
também a nível temporal, sendo que os genes que se encontram mais a montante no
cromossoma são também os que começam a ser expressos em primeiro lugar (Duboule, 1998,
Duboule et al., 1989). Para além da sua expressão ser regulada pelos seus próprios produtos,
os genes Hox são também directamente regulados pelos genes Cdx. As proteínas Fgf, Wnt e o
ácido retinóico regulam também, de forma directa ou indirecta, a expressão de genes Hox
(Deschamps et al., 2005).
As proteínas Hox são responsáveis pela regulação de vários genes envolvidos em diversas
funções essenciais do desenvolvimento animal, incluindo a adesão, ritmos de divisão, morte e
movimento celular (Favier et al., 1997).
Os factores de transcrição codificados por estes genes têm um elemento altamente
conservado de ligação ao DNA ao qual se dá o nome de homeodomínio (HD) (Gehring et al.,
1990). O HD é constituído por três hélices-α e uma extensão N-terminal adjacente à primeira
hélice. A terceira hélice-α reconhece uma sequência de DNA composta por seis pares de base
com um núcleo conservado de quatro pares de base. No entanto, esta sequência que o HD
reconhece nos seus genes-alvo surge com relativa frequência no genoma, não parecendo, por
isso ter uma especificidade de ligação ao DNA muito elevada (Ekker et al., 1991). Assim, apesar
destes genes demonstrarem uma elevada especificidade funcional in vivo, a sua especificidade
de ligação ao DNA in vitro demonstrou ser muito baixa. Uma vez que o homeodomínio mostra
uma elevada conservação entre os vários grupos de genes Hox, é pouco provável que este seja
suficiente ou mesmo necessário para conferir as funções específicas de cada grupo parálogo. A
análise das sequências e estrutura das proteínas Hox aponta cada vez mais para a possibilidade
da especificidade biológica ser essencialmente conferida por resíduos que não contactam com
o DNA (Merabet et al., 2009, Merabet et al., 2003, Sharkey et al., 1997). Algumas proteínas
Hox mostram poucos aminoácidos conservados dentro do HD em todo o grupo parálogo,
indicando que a sua especificidade funcional poderá residir essencialmente em sequências
exteriores ao HD (Sharkey et al., 1997).
Os modelos sugeridos indicam para a possibilidade da ligação a outras proteínas (co-factores)
ser responsável por despoletar a regulação dos genes a jusante ou por aumentar a
especificidade e afinidade de ligação dos factores de transcrição aos elementos cis-
regulatórios (Biggin et al., 1997, Li et al., 1999).
Experiências genéticas já mostraram que os genes Hox são importantes em vários aspectos do
desenvolvimento animal, incluindo na modulação do esqueleto axial (Wellik, 2007). Foi,
inclusivamente, demonstrada uma correlação entre a expressão anterior de genes Hox e os
limites de regiões morfologicamente distintas do esqueleto axial (Burke et al., 1995). Este
deriva de estruturas mesodérmicas que ladeiam o tubo neural denominadas sómitos (Dale et
al., 2000).
Em ratinho, os genes Hox do grupo 10 mostraram impedir a formação de costelas torácicas. Ao
impedir a expressão deste gene formam-se costelas torácicas na zona lombo-sacral (Wellik et
X
al., 2003). Por outro lado, a sua sobre-expressão na mesoderme pré-somítica gera esqueletos
sem costelas (Carapuço et al., 2005).
Este estudo tem como objectivo entender que aminoácidos são necessários para conferir a
especificidade funcional aos genes Hox10 no controlo da formação do esqueleto axial.
Foram identificados dois domínios peptídicos nas proteínas Hox do grupo 10 que apresentam
uma conservação perfeita restringida apenas a este grupo de proteínas. Um destes é um
octapéptido que se localiza a N-terminal do homeodomínio. Para perceber a contribuição
deste octapéptido na função das proteínas Hox do grupo parálogo 10, foram geradas
construções diferentes em que o cDNA de Hoxa10 foi alterado utilizando técnicas básicas de
clonagem. As proteínas mutantes e quiméricas foram criadas por uma técnica de mutagénese
por PCR. Depois de clonados, os cDNAs foram microinjectados de forma a gerar ratinhos
transgénicos que foram recolhidos no dia embrionário 18.5. O seu esqueleto foi então corado
e analisado em detalhe. No total, foram geradas quatro construções mutantes. De forma a
perceber se este domínio é necessário à função das proteínas Hox10, o octapéptido foi
removido. Dos esqueletos obtidos de embriões transgénicos a maioria tinha um fenótipo
normal. Apenas um apresentou defeitos de fraca intensidade no esqueleto axial,
nomeadamente a nível do esterno. Este motivo peptídico parece, por isso, ser necessário à
função das proteínas Hox10. Dois aminoácidos pertencentes a este domínio peptídico foram
também modificados para uma análise mais detalhada do octapéptido. Os esqueletos
resultantes da sobre-expressão deste cDNA modificado não mostraram qualquer tipo de
deficiências ao nível do esqueleto axial. Este resultado poderá indicar que a fosforilação destes
dois aminoácidos confere a actividade repressora da formação de costelas torácicas. Para
confirmar que esta proteína estava a ser produzida, a construção mutada foi transfectada para
duas linhas celulares distintas. Em ambas as situações a produção de proteína foi confirmada,
apesar de uma das linhas celulares ter gerado proteínas mais pequena do que o esperado.
O gene Hoxb9 já tinha mostrado não ter fenótipo a nível do esqueleto axial quando sobre-
expresso na mesoderme pré-somítica (Laboratório de M. Mallo, dados não publicados). Para
determinar se o octapéptido é suficiente para conferir a funcionalidade das proteínas Hox10,
este domínio peptídico foi inserido na proteína Hoxb9. Ao sobre-expressar esta construção
obtiveram-se transgénicos com defeitos no esqueleto axial, incluindo deficiências na ligação
das costelas ao esterno e alteração da morfologia das vértebras. No embrião com o fenótipo
mais grave foi também observada a ausência de costelas em três vértebras torácicas. Estes
resultados indicam que o octapéptido tem um papel relevante na especificidade funcional das
proteínas Hox10 não conseguindo, no entanto, reprimir completamente a formação de
costelas torácicas.
De forma a explorar outros aminoácidos que pudessem, juntamente com o octapéptido, ser
suficientes para conferir a especificidade funcional às proteínas Hoxa10, foi gerada outra
proteína quimérica. Esta proteína inclui toda a parte da sequência de Hoxa10 a montante do
octapéptido e, a jusante deste, a sequência é exclusivamente de Hoxb9. Os fenótipos
transgénicos obtidos não foram significativamente diferentes dos gerados pela construção que
continha apenas o octapéptido. Estes resultados parecem indicar que os aminoácidos de
Hoxa10 adicionados à construção não têm impacto detectável na função normal das proteínas
Hox9.
Este estudo sugere que as sequências fora do HD têm um papel extremamente importante na
função dos genes Hox. Observados na sua globalidade, estes resultados parecem indicar que o
XI
octapéptido é necessário para a função repressora de costelas torácicas do Hoxa10. No
entanto, este domínio peptídico não parece ser suficiente para levar a cabo esta função, pelo
menos não por si só. Outros aminoácidos, dentro ou fora do HD, parecem ser necessários para
este factor de transcrição regular correctamente os seus genes-alvo. O uso de proteínas
mutantes ou quiméricas é um importante passo inicial para compreender os mecanismos
pelos quais os genes Hox exercem a sua especificidade funcional e, consequentemente,
estabelecem diferenças ao longo do eixo AP.
Palavras-chave: Genes Hox, padronização axial, especificidade funcional, sequências
peptídicas
XII
XIII
Table of contents
Acknowledgments ....................................................................................................................... V
Abstract ..................................................................................................................................... VII
Resumo .......................................................................................................................................IX
I. Introduction ..............................................................................................................................1
I.1 Hox genes ........................................................................................................................1
I.1.1 Hox gene expression .................................................................................................2
I.1.2 Hox gene regulation .................................................................................................3
I.1.3 Hox target genes.......................................................................................................4
I.2 Hox functional specificity ................................................................................................4
I.2.1 The paradox ..............................................................................................................4
I.2.2 Hox protein structure and sequence analysis ...........................................................5
I.2.3 Hox co-factors ..........................................................................................................6
I.3 Hox genes and axial skeleton ..........................................................................................7
I.3.1 Somitogenesis ..........................................................................................................7
I.3.2 Hox and the axial skeleton ........................................................................................9
I.4 Objective .......................................................................................................................12
II. Material and methods ........................................................................................................13
II.1 Mice strain and housing conditions ..............................................................................13
II.2 Making of transgenic constructs ..................................................................................13
II.2.1 Mutagenesis by PCR ..............................................................................................13
II.2.2 Molecular cloning ..................................................................................................16
II.2.3 Sequencing reaction ..............................................................................................17
II.2.4 Agarose gel electrophoresis ..................................................................................18
II.3 Microinjection ..............................................................................................................18
II.4 Embryo collection .........................................................................................................19
II.4.1 Embryo genotyping ...............................................................................................19
II.4.2 Skeletal analysis .....................................................................................................20
II.5 in vitro protein analysis ................................................................................................20
II.5.1 in vitro protein synthesis and detection ................................................................20
II.5.2 Electrophoretic mobility shift assay .......................................................................21
II.6 Cell culture ...................................................................................................................22
II.6.1 Transfection ...........................................................................................................22
II.6.2 Cell lysis .................................................................................................................23
XIV
II.6.3 Cell extract protein analysis ...................................................................................23
III. Results ...............................................................................................................................25
III.1 Is the octapeptide necessary for Hox10 functional specificity? ...................................26
III.2 The mutation of possible phosphorylation sites within the homeodomain ................27
III.3 Is the octapeptide sufficient to produce a ribless phenotype?....................................28
III.4 Other functionally relevant residues ...........................................................................30
III.5 Protein synthesis and DNA-binding ability ..................................................................31
IV. Discussion .........................................................................................................................33
References .............................................................................................................................37
APPENDIX I – BUFFERS, SOLUTIONS AND MEDIA .................................................................. A- 1 -
APPENDIX II – CODING SEQUENCES OF TEMPLATES AND MUTATED CONSTRUCTS.............. A- 7 -
Introduction
1
I. Introduction
I.1 Hox genes
In 1984, William Bateson coined the term “homeosis” as a type of variation in which certain
body parts assumed a morphological identity similar to that of another region (Bateson, 1984).
Later, mutations in a group of genes initially identified in the fruit fly Drosophila melanogaster,
was found to be responsible for homeotic transformations of specific segments along the
anterior-posterior (AP) axis. These genes were thus designated homeotic genes (Lewis, 1978,
Gehring, 1987).
In Drosophila melanogaster, there are eight clustered Homeotic genes that control segmental
identity along the AP axis: labial (lab), proboscipedia (pb), bicoid (bcd), Deformed (Dfd), Sex
combs reduced (Scr), Antennapedia (Antp), Ultrabithorax (Ubx), Abdominal-A (Abd-A),
Abdominal-B (Abd-B). These are grouped in two complexes located in the third chromosome:
the Bithorax (BX-C) and the Antennapedia (ANT-C) complexes (Fig 1a)(Lewis, 1978).
The homeotic genes are characterized by the presence of a conserved 183 base pair DNA
sequence, the homeobox, which encodes the homeodomain (HD). This 61 aminoacid motif has
DNA binding ability and is essential for Hox proteins to function as transcription factors,
regulating the expression of genes with important roles in development (Gehring et al., 1990).
Homeobox-containing genes were later identified in many metazoan genomes by low
stringency screening, including mice (Hart et al., 1985), frogs (Carrasco et al., 1984) and
humans (Boncinelli et al., 1985). It now seems likely that a linked cluster of Hox genes is a
character shared by all metazoan and may be fundamental to control axial patterning in
animals (Slack et al., 1993).
In mammals there are 39 Hox genes that have been shown to have sequence and structural
similarities to the homeotic selector genes found in Drosophila. Contrary to arthropod
homeotic genes, mammalian Hox genes are organized in four clusters (A, B, C, and D) located
in four different chromosomes. These appear to have originated from an ancestral single
cluster through whole-genome duplication events. Within each cluster, Hox genes can be
subdivided into 13 sets of genes called paralogous groups based on their homology to the
homeotic Drosophila genes and to each other. However, not all paralogs are represented in
each cluster probably as a result of secondary gene losses (Fig 1b) (Prince, 2002).
All animals exhibiting AP axial polarity have their Hox genes organized in the chromosome in
such a way that reflects the position in the developing body axis where their transcription is
activated. In mammals, Hox genes closer to the 3’ extremity are activated first and in more
anterior domains, whereas 5’-located genes are transcribed later and in more posterior areas.
This phenomenon was termed spatial and temporal collinearity (Duboule et al., 1989, Duboule,
1998). However, the temporal aspect of the colinearity is only shared by vertebrate and short
germ insect species (Duboule, 1998). Another interesting feature that characterizes Hox genes
is that, both in Drosophila and in mice, they all have the same transcriptional orientation.
Introduction
2
Figure 1 Hox gene expression and genomic organization in Drosophila and mouse.
a) Schematic representation of a Drosophila embryo (top) with colors showing the approximate domains of
expression. Bellow, the gene distribution along the chromosome and the Antennapedia and Bithorax complexes are
represented. b) The paralogous goups within the four clusters are color-coded according to their assumed
phylogenetic relationship with the Drosophila Hox genes. At the bottom, a mouse embryo is represented and each
color illustrates the anterior-most expression domain of each subfamily of Hox genes. Adapted from Pearson et al.,
2005.
I.1.1 Hox gene expression
Mouse genes, located in the 3’ extremity of the clusters, start to be expressed in the
mesoderm and more weakly in the primitive ectoderm of the embryo’s posterior primitive
streak (Gaunt, 1988, Gaunt et al., 1994, Deschamps et al., 1999). Transcription initiation of
more 5’ genes occurs in the same region, at progressively later stages where new epiblast cells
have been brought by gastrulation movements. In general, after this initial expression, Hox
transcripts spread in a posterior to anterior movement until they reach their most rostral
position (Tam et al., 1987). Gene expression levels continue increasing until embryonic day (E)
12,5 (Kessel et al., 1991). By this time, collinear sharp anterior boundaries have been
established, while transcript levels decline gradually as they reach the posterior end of the
embryo. Consequently, there is an increase in overlapping regions and diversity of Hox gene
expression in more posterior areas of the body (Favier et al., 1997). However, these genes do
not appear to act together to determine the patterning information. In fact, when a posterior
gene is ectopically expressed in a more anterior domain, it also undergoes a homeotic
transformation in which posterior-like structures are formed. Interestingly, the opposite does
a1 a2 a3 a4 a5 a6 a7 a11a10a9 a13
b1 b2 b3 b4 b5 b6 b8 b9 b13
c4 c5 c6 c8 c12c11c10c9 c13
d1 d3 d4 d8 d12d11d10d9 d13
lab pb Dfd Scr Antp Ubx Abd-A Abd-B
ANT-C BX-C
a)
b)
Introduction
3
not occur. This phenomenon, by which more posterior genes impose their function over that
of Hox genes expressed in more anterior regions, is termed posterior prevalence (Duboule et
al., 1994, Kmita et al., 2003).
Hox gene expression is found in several germ layer derivatives and has crucial functions in
various developing systems such as the limbs, the developing hindbrain, the pharyngeal
arches, the developing genito-urinary tract and the axial skeleton (Favier et al., 1997). The role
of Hox genes in the axial skeleton in particular will be approached in more detail for its
relevance to the present study.
I.1.2 Hox gene regulation
The correct timing at which Hox genes are initially activated is crucial for the establishment of
accurate expression domains. In this initial phase, Hox genes appear to be regulated by Wnt
and Fgf proteins which have a role in the formation and morphogenetic movements through
the primitive streak. In later stages, as Hox gene expression spreads further toward the
anterior end, paraxial mesoderm cells are exposed to patterning signals. Either directly or
indirectly, Fgf and Wnt proteins have all been shown to regulate Hox gene expression.
Likewise, the presence of different levels of retinoic acid along the PSM seems to be essential
for Hox regulation and successful axial patterning (Deschamps et al., 2005).
Figure 2 Hox gene regulation network.
Simple schematic representation of interactions between genes involved in axial elongation, somitogenesis and AP
patterning. Adapted from Deschamps and Van Nes, 2005.
Hox gene expression is also affected by genes involved in the segmentation program. For
instance, the loss-of-function of a Notch ligand (Delta-like 1) results in anterior homeotic
transformations of the vertebrae as well as a posterior shift of Hox expression domains,
providing evidence for the involvement of the Notch pathway in Hox gene regulation (Cordes
et al., 2004).
The Cdx genes, a Hox-related family, have been shown to directly regulate Hox genes in the
mesoderm and neuroectoderm in a dose-dependent manner. A summary of the different
genes involved in Hox gene regulation and establishment of AP identity is illustrated in Fig 2.
Cdx HoxRA
Wnt
Fgf
Dll1
Notch
AP identity
Axi
al e
lon
gati
on
Mesoderm segmentation
Introduction
4
Furthermore, Hox genes may be autoregulated by their own products or controlled by other
Hox proteins, although the mechanism of this complex interaction remains largely undefined.
In addition to the regulation provided by these molecular signals, Polycomb (PcG) and trithorax
(trxG) group proteins play an important role in maintaining Hox gene expression spatially
restricted. These protein groups act by altering the transcriptional states of Hox genes through
chromatin structure modifications (Deschamps et al., 2005). The combined action of PcG
proteins that maintain repression of Hox gene expression and trxG proteins that sustain it,
ensures that Hox genes have their expression restricted to the correct areas (Mahmoudi et al.,
2001).
I.1.3 Hox target genes
Hox proteins, as monomers, heterodimers or part of larger complexes are responsible for the
regulation of a large pool of genes. Apart from their ability to regulate themselves, as well as
some of their known co-factors, Hox transcription factors also act on genes that mediate
adhesion, cell division rates, cell death and cell movement. However, many target genes still
remain to be discovered. Either directly or indirectly, Hox proteins clearly have a pivotal role in
regulating most of the genes involved in animal development (Pearson et al., 2005).
I.2 Hox functional specificity
I.2.1 The paradox
The homeodomain structure has been determined both by nuclear magnetic resonance
spectroscopy (Otting et al., 1990) and X-ray crystallography (Kissinger et al., 1990). It consists
of three α-helices and a flexible N-terminal arm adjacent to the first helix (Fig 3a). The third
helix, also called recognition helix, contacts the major groove of DNA and recognizes a six base-
pair DNA sequence that contains a four base pair recognition core (Fig 3b)(Ekker et al., 1991).
Shen et al. showed that, in the presence of Pbx, more anterior Hox proteins preferentially bind
to a TGAT core sequence while Hox proteins 6-10 essentially recognize a TTAT core. Hox
proteins 3-8 can also bind to a TAAT core sequence (Shen et al., 1997). However, this TNAT
sequence is very common in the genome, which raises some very interesting questions.
Homeodomain-containing proteins show a remarkable functional specificity in vivo and are
obviously capable of activating or repressing the correct set of genes in the right place at the
right time. So how can these transcription factors bind to the correct target sequences? How
do they know which genes to activate or repress? And how come different homeoproteins act
differently even though they have the ability to bind to very similar sequences?
Two models have been proposed to explain this paradox. In the first model the Hox protein is
only able to attach to DNA when bound to other proteins (co-factors) (Biggin et al., 1997, Li et
al., 1999). In fact, different Hox/cofactor heterodimers have in several cases shown distinct
DNA-binding specificities (Chan et al., 1996).
The other model, on the other hand, assumes that Hox proteins are already bound to several
DNA sites as monomers. Co-factors will differentially bind to the attached transcription factors,
Introduction
5
changing them to an activated state in order to allow the transcription of the correct target
genes (Biggin et al., 1997, Li et al., 1999).
These models are not mutually exclusive. In fact, both cases have been reported and
experimentally verified. It is clear that Hox proteins act using a complex array of molecular
strategies to regulate the correct set of genes, which will originate distinct structures according
to their position along the body axis and developmental timing.
Figure 3 Hox protein structure.
a) Secondary structure representation of a Hox protein and (b) 3-dimensional structure of the Hox-DNA interaction
adapted from Merabet et al., 2009. The N-terminal arm (N-ter), helix1 (H1), helix2 (H2) and helix3 (H3) are
indicated.
I.2.2 Hox protein structure and sequence analysis
Sequence analysis of Hox proteins and identification of residues specific to a given paralog
group have proven to be very important to clarify how Hox proteins achieve functional
specificity in vivo.
When comparing Hox proteins with other homeodomain-containing proteins it was shown
that most residues found in all Hox proteins are also conserved in most homeodomain classes.
These common residues are either required for proper HD folding or essential for DNA binding.
There are just four amino acids that can be classified as Hox generic signatures and are not
found in other homeodomain protein classes. Only one of the amino acids that distinguish Hox
proteins from other HD proteins has a DNA-binding function, whereas the other three are
located in regions that could possibly interact with other proteins (Merabet et al., 2009).
UNIQUE PARALOG SIGNATURES
The mutation of a single paralogous group member usually yields a very mild phenotype,
particularly in the axial skeleton. However, when more genes from the same paralogous group
are mutated, a synergistic effect occurs and a much serious phenotype is observed. Therefore,
the members of a given paralogous group seem to have a great deal of redundancy in their
Hoxprotein
N-terminal arm Helix 1 Loop Helix 2 Helix 3Loop
N-ter
a)
b)
Introduction
6
function (Wellik et al., 2003, Fromental-Ramain et al., 1996). Thus, residues that are conserved
in all members of a paralogous group but are not observed in others could clarify which amino
acids are necessary for the functional specificity of Hox proteins (Sharkey et al., 1997).
The comparison of residues exclusively conserved in the HD of each paralog group revealed
that most of the unique paralog signature residues are in positions favorable for protein-
protein interactions (Merabet et al., 2009). On the other hand, the ones that contact DNA are
mostly located in the N-terminal arm, which has been reported to play a major role in
providing functional specificity to Hox proteins. It has been recently suggested that, while the
conserved third helix of different paralogs recognizes similar binding sites, the N-terminal arm
residues bind in a more specific manner by recognizing the structure and electrostatic
potential of the minor groove (Fig 3b) (Joshi et al., 2007).
In order to determine the contribution of unique paralog residues to Hox protein function,
chimeric Hox protein experiments have been performed, in which these specific residues were
swapped by those of another Hox protein (Zeng et al., 1993, Furukubo-Tokunaga et al., 1993,
Lin et al., 1992, Chauvet et al., 2000, Joshi et al., 2007). Even though the HD has proven to
have a critical role in DNA-binding specificity in vivo, some Hox proteins lack features that
distinguish them from members of other paralog groups. For this reason, it is to be expected
that peptide motifs outside the HD might have a crucial role in the establishment of
characteristic Hox protein function. It was found that paralogs 12 and 13 have very few or no
conserved aminoacids outside the HD. However, Hox proteins 1-8 all share a hexapeptide
motif with a conserved YPWM core motif, located N-terminal to the HD. Paralog groups 9, 10
and 11 have conserved aminoacids immediately adjacent to the HD. Hox9 has characteristic
residues N-terminal to the HD, while Hox11 has conserved residues C-terminal to the
homeodomain. Hox10 signatures, on the other hand, are found both upstream and
downstream the HD (Sharkey et al., 1997). More specifically, Hox10 proteins show a
conserved NWLTAKSG octapeptide motif adjacent and N-terminal to the HD, as well as a
RENRIRELT motif just C-terminal to the HD (Fig 12a).
I.2.3 Hox co-factors
Results obtained by sequence analysis strongly suggest that biological specificity is mostly
achieved through protein-protein interactions, since many of the paralog group characteristic
residues do not contact DNA (Chauvet et al., 2000, Sharkey et al., 1997). In fact, Hox proteins
have already been reported to be unable to achieve functional specificity solely by DNA-
protein interactions (Schier et al., 1993). Most Hox co-factors identified so far are
homeoproteins with Hox-independent functions that belong to the TALE as well as the POU
family. The best studied and well known co-factors are part of the TALE family of
homeodomain proteins, which is characterized by the presence of a three-amino acid
extension in the loop between helices 1 and 2 of their HD (Mann et al., 1998, Moens et al.,
2006).
The first Hox co-factor was identified in Drosophila and termed Extradenticle (Exd). The loss of
function of this gene produced mutations in embryonic pattern without altering Hox gene
expression. Later, a vertebrate homolog called Pbx1 was independently discovered as the
cause of human preB cell acute lymphoblastic leukemia. Exd and Pbx proteins are included in
the PBC subclass of TALE proteins which have highly characteristic and conserved peptide
Introduction
7
domains N-terminal to the HD (Mann et al., 1996, Chan et al., 1996). Proteins from the PBC
class have the ability to bind to the conserved hexapeptide observed in Hox proteins 1-8.
Initially it was reported that Abd-B class proteins were unable to bind to PBC protein class
members but this was later found to be due to the use of the wrong target DNA (Chang et al.,
1995). Hoxa10 and Hoxb9, which lack a YPWM motif, have been shown to form a DNA binding
complex with Pbx1, mediated by a motif that comprises a conserved tryptophan located just
upstream to the homeodomain (Chang et al., 1996, Shen et al., 1997). However, members of
the 11, 12, and 13 paralogs were found to be unable to bind DNA with Pbx (Shen et al., 1997).
PBC proteins cooperatively associate with Hox proteins via the three-amino acid loop in the
homeodomain, apparently increasing Hox-binding selectivity (Burglin, 1997, Chan et al., 1996).
The heterodimer binds to DNA via a bipartite sequence and can either activate or repress its
target genes (Moens et al., 2006). However, not all Hox proteins seem to require Pbx for
higher DNA-binding specificity (LaRonde-LeBlanc et al., 2003).
The MEIS class is another well known class of TALE proteins that have the ability to bind to PBC
proteins and may also bind directly to the Hox protein, (Burglin, 1997). In vertebrates, this
class of homeoproteins includes Meis and Prep proteins and are involved in nuclear
localization and stability of Pbx proteins (Moens et al., 2006).
Extensive studies have been conducted on these co-factors in order to understand the exact
mechanisms by which they are able to direct Hox DNA-binding (Mann et al., 1996, Rieckhof et
al., 1997, Berthelsen et al., 1998). However, many questions remain unanswered. For example,
the fact that PBC proteins have the ability to bind to most Hox proteins does not clarify why
they choose to bind to one particular Hox protein instead of any other expressed in the same
region. Since all co-factors analyzed to date have Hox-independent function, it seems likely
that Hox proteins bind to pre-existing complexes, providing them with spatial information to
correctly control downstream genes (Mann et al., 1998). Most components of the several
possible complexes responsible for the regulation of the massive pool of Hox target genes
have not been fully described. It is likely that more Hox-interacting proteins are yet to be
identified. The Antennapedia YPWM peptide motif, for example, was reported to interact with
a protein other than Pbx in order to cause the typical eye-to-wing transformation observed
when Antennapedia is ectopically expressed (Prince et al., 2008). In addition Hox genes can
bind to proteins such as histone acetyltransferases and histone deacetylases that modify
chromatin structure, regulating downstream targets through epigenetic mechanisms (Shen et
al., 2001, Saleh et al., 2000, Lu et al., 2003). The presence of conserved residues characteristic
of a given paralog group with no DNA-binding functions is a step forward toward the
understanding of Hox functional specificity mechanisms. It is also possible that these
conserved residues are necessary for structural reasons and have no direct influence in
protein-protein interactions. In any case, new ways for Hox transcription factors to regulate
developmental pathways could be uncovered.
I.3 Hox genes and axial skeleton
I.3.1 Somitogenesis
In the vertebrate embryo, the axial skeleton, skeletal muscle and dorsal dermis arise from
transient mesodermal structures that lie on both sides of the neural tube called somites.
Somites are sequentially produced from the anterior end of the unsegmented paraxial
Introduction
8
mesoderm in a rostral to caudal direction. The formation of somites is precisely regulated and
occurs at regular time intervals (Brent et al., 2002, Dale et al., 2000, Aoyama et al., 1988). At
the molecular level, the formation of somites includes two processes. One of them is
characterized by the oscillating expression of a set of genes along the presomitic mesoderm.
The chick gene Hairy1 was the first gene described to have this kind of “clock-like” behavior
(Palmeirim et al., 1997). Since then, many genes have been found to have the same oscillatory
behavior in a variety of vertebrate species (Dale et al., 2000). These genes belong mostly to the
Wnt and Notch signaling pathways. The second process required for somitogenesis is the
segmentation signal, which seems to be regulated by the opposing gradients of Wnt/Fgf
(posterior to anterior) and retinoic acid (anterior to posterior). As cells progress towards the
anterior end of the PSM, they become less exposed to the Fgf signal. Eventually, cells reach an
Fgf threshold where the segmentation program is activated. This “determination front” defines
a change in gene regulation, ultimately resulting in the formation of somites (Mallo, 2007,
Dubrulle et al., 2004, Mallo et al., 2008, Pourquie, 2003).
After its formation, molecules from surrounding tissues signal the somites to differentiate into
compartments that will give rise to distinct cell lineages. The dorso-lateral part of the somite
originates the dermomyotome, whereas the ventro-medial part de-epithelializes to form the
mesenchymal sclerotome. The dermomyotome further differentiates into the dermotome,
which gives rise to dermis, and the myotome, which gives rise to the axial musculature. The
sclerotome undergoes a resegmentation process so that the posterior half of one somite and
the anterior half of the next somite give rise to a single vertebral element. The cells in the
ventro-medial sclerotome undergo an epithelial-to-mesenchymal transition and migrate to
form the chondrocytes of the vertebrae and the proximal part of the ribs. Although most of
the axial skeleton is derived from the somites, the sternum arises from the lateral plate
mesoderm (Fig 4)(Brent et al., 2002, Wellik, 2007, Gilbert, 2006, Monsoro-Burq, 2005, Aoyama
et al., 1988, Buckingham, 2001).
Figure 4 Schematic representation of vertebrate somitogenesis.
Somites mature following a posterior to anterior direction. From Buckingham,2001.
Introduction
9
I.3.2 Hox and the axial skeleton
Although somites appear morphologically similar, they will differentiate into morphologically
distinct vertebrae depending on the position they assume along the AP axis. The number of
vertebrae in each morphological type (i.e. cervical, thoracic, lumbar, sacral and caudal), known
as the axial formula, is largely determined by Hox gene expression. In mice, the axial formula is
composed of seven cervical, thirteen thoracic (with ribs), six lumbar, four sacral and a variable
number of caudal vertebrae (Burke et al., 1995). Thoracic vertebrae are characterized by the
presence of ribs. Sacral vertebrae lack the fully formed ribs found in the thorax but they bear
modified rib-like structures that fuse to form the sacrum (Fig 5).
The observation of anterior expression domains of many paralogous group Hox genes in both
chickens and mice, demonstrated a correlation between these expression limits and the
boundaries of morphologically distinct regions of the axial skeleton (Burke et al., 1995, Burke,
2000). Accordingly, mutations of genes with an anterior expression limit close to a transition in
vertebrae morphological type have confirmed this apparent correlation (Wellik, 2007).
Figure 5 Representation of the different vertebrae types of a normal mouse embryo and somites that give rise to
each of them.
At the right, Hox gene expression domains along the AP axis are illustrated in a simplified manner. The reducing
gradient shows the general trend for decreased expression in more posterior domains. Adapted from Burke et al.,
1995 and Favier and Dolle, 1997.
The fact that the axial skeleton is derived from two different primitive tissues, makes it hard to
correctly interpret phenotypes at the thoracic rib cage level. While the vertebrae and the
proximal part of the ribs originate from the somites, the sternum and the more distal part of
the ribs are derived from the lateral plate mesoderm (McIntyre et al., 2007). It has been
reported that the inactivation of entire paralogous groups resulted in anterior homeotic
a7 b9b7c8c9a9d8a10a11d9
a1 b1
a3 b4d4
a4a5 b5c4c5c6a6
d10
d11
d12d13
Somites
1
5
12
25
31
35
Occipital bone
Lumbar
Cervical
Thoracic
Sacral
Caudal
Introduction
10
transformations in the axial skeleton. Interestingly, mutations of different paralog groups
varied in their affected areas in a collinear fashion. That is, more anterior genes are
responsible for the patterning of more anterior axial structures, while mutants of more
posterior genes influence more posterior structures. However, this is not observed in the
abaxial part of the skeleton. Instead, Hox genes pattern the lateral plate mesoderm in a non-
collinear way, independently from the somite-derived part of the skeleton (McIntyre et al.,
2007, Wellik, 2007).
In the past it was suggested that different combinations of Hox gene expression would define
the formation of diverse structures along the AP axis – the “Hox code” (Kessel et al., 1991).
Later experiments showed that, even though the mutation of adjacent Hox paralogous groups
resulted in partly overlapping affected areas, the morphological effects were quite different. It
was then concluded that the “Hox code” in the somitic mesoderm was the result of the distinct
contributions of each group expressed in a given region (McIntyre et al., 2007, Wellik, 2007).
Initially, loss-of-function experiments resulted in minor effects on the axial skeleton since only
part of the paralog group was mutated. These results were not in agreement with the role Hox
genes supposedly had in vertebrate axial skeleton segmentation and differentiation along the
AP axis. In later studies, it was concluded that Hox genes were largely redundant within each
paralog group (Wellik et al., 2003). Hoxa3 and Hoxd3 individual mutations, for example, show
distinct phenotypes. However, when both genes were mutated, a synergistic effect was
observed and, when the two genes were swapped, they successfully replaced each other
functionally (Greer et al., 2000). For this reason, it was necessary to mutate an entire paralog
group to accurately determine its importance in vertebrate axial patterning. The loss of
function of Hox10 genes causes the formation of rib-bearing vertebrae in the place of lumbar
vertebrae (that normally do not have ribs) that extend past the sacral region (Fig 6). A
mechanism arose by which the vertebrae have ribs as a ground-state from head to tail that is
repressed in some regions of evolved vertebrates. According to this hypothesis, Hox10 genes
would repress rib formation in the lumbar and sacral regions. Since the knock-out of
paralogous group 11 causes sacral vertebrae to assume a lumbar identity instead, Hox11 genes
were proposed to partially repress Hox10 activity (Wellik et al., 2003).
Figure 6 Effect of Hox10 loss-of-function in the axial skeleton.
Axial skeletons of a Hox10 triple mutant (top) and a control at E18.5 (bottom). Vertebra types are identified.
Adapted from Wellik and Capecchi, 2003.
LumbarThoracic
Sacral
Ho
x10a
accd
dC
on
tro
l
Introduction
11
Several loss-of-function experiments demonstrated that the functional domains of Hox genes
did not always correlate with their previously described boundary of expression (Carapuço et
al., 2005). Indeed, Hox10 genes were shown to be functionally important up to the
thoracic/lumbar transition, where its anterior expression boundary was expected to be
observed (Wellik et al., 2003). However, the expression domain of these genes was reported to
rarely extend that far (Burke et al., 1995). It was later shown that the Hox10 expression
domain is not stable through the entire embryonic development. The anterior expression
border of the three Hox10 genes corresponds to the functional domain only while somites at
the thoracic/lumbar transition are being formed. In later stages of development, the domain of
expression becomes progressively more posterior. In order to assess if Hox10 genes were
functionally relevant at the stage of somitic formation, the Delta-like1 (Dll1) promoter was
used to drive the expression of the Hoxa10 gene (Carapuço et al., 2005). The mouse Dll1 is a
homologue of the Drosophila Delta gene. It is expressed in presomitic mesoderm (PSM) as well
as in newly formed somites (Bettenhausen et al., 1995, Beckers et al., 2000). The
overexpression of Hoxa10 in the PSM resulted in striking skeleton abnormalities. The highest
transgene copy number caused the removal of all thoracic vertebrae (Carapuço et al., 2005).
This observation is consistent with the rib-repressing function attributed to the Hox10
paralogous group through loss-of-function experiments (Wellik et al., 2003). The ribless
phenotype was also characterized by the presence of an ossified sternum with no sternebrae
(segments of the sternum), larger cervical vertebrae than normal and the absence of the
cartilaginous fusions that usually form in the sacral region of the skeleton (Fig 7). Low-copy
transgenes showed milder defects, affecting just the first and two last rib-bearing vertebrae.
Hox10 genes were therefore demontrated to be functionally relevant in axial skeleton
patterning at the presomitic mesoderm level, before the formation of somites. Aside from
Hox10 group genes, Hox11 and Hox6 paralogous groups also produced mutant phenotypes
with the use of the same experimental approach. Dll-Hoxb6 embryos, in agreement with the
knock-out experimental approaches, resulted in the formation of rib-bearing vertebrae from
the second cervical vertebrae (C2) to the caudal region (Mallo lab, unpublished data). In fact,
this paralog group was reported to be essential in rib cage patterning (McIntyre et al., 2007).
Hoxa11 overexpression was expected to expand sacral and caudal morphologies to more
anterior parts of the skeleton. Indeed, Dll-Hoxa11 embryos showed fused ribs (a sign of
sacralization) and a more anterior position for the sacrum. However, the use of a promoter of
a gene expressed in formed somites driving Hoxa11 also showed a mutant phenotype. This
means that, although Hox10 and Hox6 proteins regulate the necessary genes for axial skeleton
patterning before or just after somite formation, Hox11 proteins seem to need signals from
both the pre-somitic and somitic mesoderm to fully perform its function.
Introduction
12
Figure 7 Patterning activity of Hoxa10 overexpressed in the PSM.
At the top a general view of a wild-type (left) and a transgenic (right) skeleton is showed. The asterisk indicates the
absence of thoracic ribs. At the bottom an anterior view of the sternum and the associated cartilaginous part of the
ribs is showed for both wild-type (left) and transgenic (right) embryos. Adapted from Carapuço et al., 2005.
I.4 Objective
Hox10 genes were shown to have a rib-repressing activity both by loss-of-function and
overexpression experiments (Wellik et al., 2003, Carapuço et al., 2005). The aim of this work is
to understand what amino acid residues are necessary for Hox10 genes to achieve their
functional specificity in the axial skeleton. An octapeptide located just N-terminal to the HD,
conserved in all the members of the paralog group 10 and absent in all other Hox proteins, has
been identified. Four constructs were generated and overexpressed in the PSM to determine if
this peptide motif is necessary or even sufficient to repress the formation of ribs in thoracic
vertebrae. This study could extend the present knowledge on how Hox genes achieve such
precise functional specificity in vivo that contrasts with their apparent lack of DNA-binding
specificity in vitro.
Control Dll1:Hoxa10
Material and methods
13
II. Material and methods
II.1 Mice strain and housing conditions
The animal model used for this study was the mouse. All animals were from the FVB strain
maintained on a 12-h dark/light cycle in a specific pathogen–free animal facility at Instituto
Gulbenkian de Ciência (IGC).
II.2 Making of transgenic constructs
Transgenic constructs were generated using standard molecular biology techniques.
II.2.1 Mutagenesis by PCR
Most transgenic constructs were generated using a mutagenesis protocol based on PCR
(polymerase chain reaction) (Fig 8). Four primers were used to generate each of the mutated
and chimeric constructs: two of them annealed perfectly to each of the extremities of the DNA
fragment and the other two were internal, overlapping primers encompassing the area to be
modified or the border area in chimeric constructs. The primers used are detailed in table 1
and the PCR conditions used are shown in table 2. The Pfu DNA polymerase was used for its
proof-reading abilities.
For each construct, two separate PCR reactions were initially performed. Both used one of the
extremity primers and one of the internal primers, generating two complementary fragments.
The resulting PCR products were ran in an agarose gel and the bands with the expected size
were cut out and purified with the QiaexII Gel Extraction kit. Then, equimolecular amounts of
the two fragments were mixed in a single reaction which had all the standard PCR components
except for primers. To specifically amplify the few fragments that span the whole region of
interest and contain the desired mutation, both extremity primers were then added to the
reaction. After the final reaction was completed the DNA was purified by phenol-chloroform
extraction. For this, TE buffer was used to make a final volume of 100µL and an equal volume
of phenol-chloform was added. The samples were mixed and centrifuged for 4min at 14000
rpm. The DNA was recovered from the aqueous phase and precipitated with 0.1 of 3M sodium
acetate (pH5.2) and 2.5 volumes of 100% ethanol for 30min at -80ºC. The precipitated DNA
was recovered by centrifugation at 14000rpm for 10min at 4ºC. The supernatant was
discarded and the DNA pellet was air-dried. The precipitaded DNA was resuspended in an
appropriate volume of water for further cloning.
The Hoxa10ΔOct construct which lacked the octapeptide had been previously generated. For
this reason the mutated Hoxa10 sequence was amplified using the same conditions as the final
PCR reaction step (Table 2 - bottom).
GENERATION OF CHIMERIC PROTEINS
An adapted version of the initial mutagenesis by PCR protocol was also used to generate
chimeric proteins. Two kinds of chimeric proteins were produced. In the case of the Hoxb9Oct
construct, only a small peptide motif was swapped by that of a different protein (Fig 8b). In
this case, the internal primers were designed to flank the part of the sequence that will be
swapped and include the sequence to be inserted as a 3’overlapping extension. However,
Material and methods
14
there was a second type of chimeric protein generated composed partly of Hoxa10 and partly
of Hoxb9 (Hoxa10b9). In this case, two different templates were used in each of the initial PCR
reactions (Fig 8c).
Figure 8 Schematic representation of the standard mutagenesis by PCR protocol.
a) standard procedure – the red dot indicates the inserted mutation. b) and c) generation of chimeric proteins to a
different extent. In b) the inserted sequence is marked in red. In c) two different templates (illustrated with
different colors) are used.
PCR
Pre-amplification
Final amplification
PCR and preamplification
Final amplification
PCR and preamplification
Final amplification
a
b
cTemplate 1
Template 2
PCR
Pre-amplification
Final amplification
a
Material and methods
15
Table 1 Sequences of the primers used for mutagenesis. The nucleotides that do not anneal to the template
sequence are marked in red.
Internal primers
Orientation Sequence
ΔOct *
*
TSAA Forward 5'AACTGGCTCGCAGCAAAGGCCGGCCGGAAGAAACG3'
Reverse 5'TTCTTCCGGCCGGCCTTTGCTGCGAGCCAGTTG3'
B9Oct Forward 5'AACTGGCTCACAGCAAAGAGCGGCCGGAAAAAGCGCTGTCCCTAC3'
Reverse 5'GCCGCTCTTTGCTGTGAGCCAGTTGGCGGAGGGGTTGGTTTGATC3'
A10-B9 Forward 5'GTACCCGGCTACTTCCGCCTGTCGGTCCCGCCGGCCGAGAGCAGG3'
Reverse 5'CGACAGGCGGAAGTAGCCGGGTACCGGGACGCCCTGGGGCTGGATG3'
External primers
Orientation Sequence Restriction site
ΔOct Forward 5'CTGGATCCTGCTCGGAGAGCCCTGCCGCG3' BamH1
Reverse 5'CAGCGGCCGCCGGCACAGGTGTGAGTTCTG3' Not1
TSAA
Forward 5'GCCTGCAGGCCTACGGCACGGCC3' Pst1**
Reverse 5'CAGCGGCCGCCGGCACAGGTGTGAGTTCTG3' Not1
B9Oct
Forward 5'CGGGATCCATTTCTGGGACGCTTAGC3' BamH1
Reverse 5'CGGCGGCCGCAGTCGTCACATAACTAAGAG3' Not1
A10-B9
Forward 5'GCCTGCAGGCCTACGGCACGGCC3' Pst1**
Reverse 5'CAGCGGCCGCCGGCACAGGTGTGAGTTCTG3' Not1
* This construct did not require the use of internal primers. ** Although these restriction sites were in the primer sequence, this enzyme was never used for the subsequent cloning steps; a HindIII restriction site in the fragment was used instead.
Table 2 PCR conditions for mutagenesis
Initial PCR Primer 1 1µL Temperature Time (minutes)
Primer 2 1µL
95ºC 4
Template (10ng/µL) 1µL
95ºC 1
10x buffer (+20mM MgSO4) 5µL (1x)
62ºC 1 30 cycles
dNTPs (25mM) 1µL
72ºC 1.5
Pfu (2.5U/µL) 1µL
72ºC 7
H2O to 50µL
Preamplification Fragment 1 * Temperature Time (minutes)
Fragment 2 *
95ºC 4
10x buffer (+20mM MgSO4) 3µL (1x)
95ºC 1
dNTPs (25mM) 0.6µL
62ºC 1 4 cycles
Pfu (2.5U/µL) 1µL
72ºC 1.5
H2O to 30µL
72ºC 7
* equimolecular amounts were used
Material and methods
16
Final amplification Primer 1 (25mM) 1µL Temperature Time (minutes)
Primer 2 (25mM) 1µL
95ºC 4
95ºC 1.5
62ºC 1.5 35 cycles
72ºC 2
72ºC 7
II.2.2 Molecular cloning
The mutated, chimeric and unaltered PCR fragments obtained were cloned downstream of a
DNA sequence that coded for the FLAG-tag, placing them in the same open reading frame. To
obtain transgenic mice the resulting constructs were cloned downstream of the Dll1 promoter
and upstream of the Hoxa10 3’UTR and the polyA tail. The pBluescript® II KS+ phagemid was
used as a vector for these cloning steps. However, for in vitro protein production, the same
constructs were cloned into the multiple cloning site of the pCMV-Sport6.1 vector.
DIGESTION WITH RESTRICTION ENZYMES AND LIGATION
After obtaining the mutated sequences these were digested with the appropriate restriction
enzymes (see restriction sites in Table 1). Either way, the fragment of interest was ligated to a
vector attached to the sequence that encodes the FLAG-tag. The amount of DNA used in
digestions was usually 3µg. The total volume of the digestion reaction was 20µL. The
completion of the digestion was verified by agarose gel electrophoresis. The whole reaction
was then loaded on an agarose gel and the bands of interest were then cut out and purified
using the QIAEX II Gel Extraction kit. An equimolar amount of vector and insert, 1U of the T4
DNA ligase, and 1x ligation buffer were then used in a ligation reaction. At all times a negative
control was employed, using the same conditions except for the absence of insert DNA. The
mix was then left at room temperature or incubated at 16ºC for 2h or more. The ligation
reaction was directly used to transform DH5-α competent cells as described below.
PREPARATION OF COMPETENT CELLS
The DH5-α strain of E. coli was used for all transformations performed in this study. Before
these cells can be transformed they need to go through a process that allows the intake of
exogenous DNA. The cells were inoculated from a frozen stock in 1mL of LB and grown for 16-
20h at 37°C, with shaking (225rpm). Then, 1mL of the culture was diluted into 100mL of fresh
LB and incubated at 37°C, 225rpm, until the culture reached a 600nm optic density of 0.5. The
culture was chilled on ice for 15min and the bacteria collected by centrifugation at 4000rpm
for 15min at 4ºC. The supernatant was removed and the pellet was resuspended in 33mL of
ice-cold RF1 buffer (1/3 of the volume collected) and incubated on ice for 1h. The resulting
solution was centrifuged with the same conditions as before and the supernatant discarded.
The cell pellet was then resuspended in 8mL of pre-chilled RF2 buffer (1/12.5 of the volume
collected) and left on ice for 15min. The final volume was aliquoted into 1.5ml centrifuge
tubes, flash-frozen, using a bath of dry ice and 100% ethanol. The aliquots were stored at -
80°C.
Material and methods
17
TRANSFORMATION OF DH5-α CELLS
3µL of the ligation reaction were added to 50µL of DH5-α competent cells and incubated on ice
for 25min. The bacteria were incubated at 42ºC for 45 seconds and chilled on ice for 2min.
After adding 1mL of LB medium, the cells were incubated at 37ºC for 45min with shaking. The
culture was centrifuged at 4000rpm for 4min and about 800µL of the supernatant medium was
removed. The remaining supernatant was used to resuspend the cell pellet in order to
concentrate the cell suspension. The bacteria were then plated on solid LB medium with
ampicillin (50µg/mL) and incubated overnight at 37ºC.
PLASMID DNA MINI-PREPARATION
Single colonies were picked using pipette tips and grown on 3mL LB medium with ampicillin
(50µg/mL) at 37°C with shaking overnight. 1.5mL of the culture were centrifuged at 4000rpm
for 4min and the pellet resuspended in 100μl of TE with RNase (10µg/mL). Then, 300μl of TENS
were added, the mix was vortexed and 150μl of 3M potassium acetate (pH5.2) were added.
After this, the mixture was centrifuged 4min at 14000rpm. The supernatant was transferred
into a fresh tube that contained 900μl of 100% ethanol. After mixing and centrifuging 4min at
14000rpm, the supernatant was removed and the pellet air-dried and resuspended in 50μl of
TE. The resulting plasmid preparation was then screened for positive colonies by digestion with
the appropriate restriction enzymes.
When higher purity DNA was required for experiments such as sequencing reactions, plasmids
were purified using plasmid preparation kits. Briefly, the protocol is based on plasmidic DNA
binding to an anion-exchange resin and subsequent elution after the cell lysis and plasmidic
DNA precipitation steps. When small amounts of the plasmid were needed, for example in
intermediate cloning steps, a mini-preparation was conducted using a QIAprep® spin miniprep
kit. However, when larger amounts of plasmid DNA were needed, usually in the final cloning
step, a midi-preparation was conducted using the NucleoBond® plasmid DNA purification kit.
In both cases, the protocol was followed according to the manufacturer specifications and the
concentration of plasmidic DNA was measured using the NanoDrop® ND-1000
spectrophotometer.
II.2.3 Sequencing reaction
After the first cloning step, all sequences were checked. The primers used in the sequencing
reaction annealed to RNA polymerase promoters T3 and T7, which flank the multiple cloning
site of the pBluescript® II KS vector. Each 10µL reaction contained 2µL of BigDye® terminator
sequencing buffer (5X), 2µL BigDye® terminator ready reaction mix, 500ng of template DNA
and 5pmol of primers. The PCR conditions were the following:
Temperature Time
96ºC 1min
96ºC 10sec
25 cycles 50ºC 5sec
60ºC 4min
4ºC until ready to purify
Material and methods
18
After the PCR, the reaction product was transferred to a microcentrifuge and the amplified
DNA was precipitated (see DNA precipitation in section II.2.1). After mixing, the tubes were
incubated at room temperature for 30min and centrifuged at 14000rpm for another 30min at
4ºC. The supernatant was removed and the pellet was washed in 250µL of 70% ethanol. The
tubes were centrifuged at 14000 rpm for 15min at 4ºC. The supernatant was again removed
and the pellet was air-dried. The samples were then sent to the IGC sequencing service. The
resulting output sequences were analyzed in detail by the combined use of the BLAST
(http://www.ncbi.nlm.nih.gov/BLAST/), Bioedit, Chromas and Sequence Analysis software.
II.2.4 Agarose gel electrophoresis
This technique that is used to separate and visualize nucleic acids was necessary to check the
efficiency of restriction enzyme digestions, to purify specific DNA fragments and to check the
integrity of a DNA sample, among other applications. Agarose was dissolved in 1X TAE, usually
at a concentration of 0.8%. However, in some cases a 2% agarose gel was used instead.
Ethidium bromide was added in order to visualize the DNA with the use of a UV light to a final
concentration of 0.2µg/mL. Loading buffer was added to each sample to a 1x final
concentration and a DNA ladder was used to estimate the size of the DNA fragments. An
electric current of 100-120V was applied to the gel immersed in 1X TAE buffer.
BAND PURIFICATION
DNA fragments were purified from an agarose gel, using the QIAEXII gel extraction kit,
according to the protocol recommended by the manufacturer. In the final step, the DNA
fragments were eluted with TE.
The QIAquick gel extraction kit was used to prepare DNA fragments for microinjection,
according with the protocol recommended by the manufacturer. The concentration of the
DNA construct was measured using the NanoDrop® ND-1000 spectrophotometer.
II.3 Microinjection
Transgenic embryos were generated by pronuclear injection, which was carried out by
personal at the IGC’s transgenics unit. Briefly, female mice were superovulated with the use of
hormones and mated with males. The fertilized oocytes were then recovered and DNA
fragments (Fig 9) were microinjected into one of the pronuclei, which are subsequently
implanted in the oviduct of pseudopregnant females.
Material and methods
19
Figure 9 Final cloning step.
The final construct contains the Delta-like1 promoter, an N-terminal FLAG-Tag, the mutated coding sequence, the
Hoxa10 3’UTR and the polyA tail (pA).
II.4 Embryo collection
All embryos were collected at embryonic day (E) 18.5 by caesarean section.
II.4.1 Embryo genotyping
To identify transgenic embryos, the intestine of each embryo was used for genotyping. The
intestines were digested in 500µL of Laird’s buffer with 100µg/mL of proteinase K at 50ºC,
overnight, with shaking. In order to precipitate the genomic DNA, 500µL of isopropanol were
added and mixed by gently inverting the tubes. The DNA was “fished” with a pipette tip and
dissolved in 250µL of TE buffer at 37ºC with shaking for 3h or more. The presence of the
transgene was determined by PCR using the conditions shown in table 4. When mouse cDNAs
were used in the transgenic constructs, the primers were designed to flank an intron to
distinguish it from the endogenous DNA. A bigger band will be the result of endogenous
genomic DNA amplification and a smaller band will be the consequence of the presence of the
microinjected cDNA. For chimeric constructs, it was sufficient to use one primer that annealed
to the cDNA of one of the proteins and a second primer that annealed to the cDNA of the
other protein. The sequences of the primers designed to genotype each construct is shown in
table 3.
Digestion
Purification
Material and methods
20
Table 3 Sequences of the primers used for genotyping.
Orientation Sequence
DllHoxa10EFGpA Forward 5'AGCGAGTCCTAGACTCC3'
DllHoxa10TSAApA Reverse 5'GTCCGTGAGGTGGACGCTACG3'
DllHoxb9Oct-A103'UTRpA Forward 5'GTCACGAGAGTGAGGACGCGC3'
Reverse 5’CGGCGGCCGCAGTCGTCACATAACTAAGAG3’
DllHoxba10/b9-A103'UTRpA Forward 5'AGCGAGTCCTAGACTCC3'
Reverse 5’CGGCGGCCGCAGTCGTCACATAACTAAGAG3’
Table 4 Conditions for genotyping PCR reactions.
DNA 1µL 10x buffer 2,5µL (1x)
Temperature Time DMSO 2µL (8%v/v)
95ºC 4 min
Primer 1 (25mM) 0,25µL
95ºC 45 sec
Primer 2 (25mM) 0,25µL
65ºC 45 sec 35 cycles
dNTPs (25mM) 0,2µL
72ºC 45 sec Taq (5U/ µL) 0,2µL (1U)
72ºC 7 min
H2O to 25µL
II.4.2 Skeletal analysis
Embryos collected at E18.5 were eviscerated, skinned and fixed in absolute ethanol. In order to
stain the cartilage part of the skeleton, the fetuses were incubated in an alcian blue solution
for 12-20h at room temperature and then incubated in 100% ethanol overnight. The tissues
were then partially digested with 2% Potassium Hydroxide and the bones were stained with an
alizarin red solution. To complete soft tissue digestion, the embryos were further digested in
2% Potassium Hydroxide for 12-20h and stored in 25% glycerol.
II.5 in vitro protein analysis
II.5.1 in vitro protein synthesis and detection
All wild-type, mutant and chimeric proteins were synthesized by in vitro translation using the
TNT® Sp6 reticulocyte lysate system. This system allows for both transcription and translation
reactions to take place in a single experimental step. The protocol was followed according to
the manufacturer instructions. During the reaction, biotinylated lysine residues were
incorporated into the proteins to allow their detection using the Transcend™ Non-Radioactive
Translation Detection System.
In order to do this, 1µL of each TNT reaction was added to 15µL of SDS-containing loading
buffer and incubated at 70ºC for 15min. The samples were loaded on a gel composed by a 5%
SDS polyacrylamide stacking gel and a 10-12% SDS polyacrylamide resolving gel. They were
then run in running buffer at 110V, for about 1.5h. To estimate protein sizes an appropriate
protein ladder was used. After the run, the proteins were transferred to a PVDF membrane
previously wetted in methanol, washed in water and equilibrated in transfer buffer. In order to
Material and methods
21
do this, the “sandwich” represented in figure 10 was assembled and immersed in transfer
buffer at 4ºC. A 200mA electric current was applied for 1 hour. The proteins were visualized in
the polyvinylidene difluoride (PVDF) membrane by Streptavidin-Alkaline Phosphatase (#V5591)
from Promega that binds to the biotinylated lysines added to the in vitro synthesized proteins.
The protocol was followed according to the manufacturer specifications.
Figure 10 Protein transfer schematic
II.5.2 Electrophoretic mobility shift assay
The electrophoretic mobility shift assay (EMSA) was used to verify if the modified proteins had
the ability to bind to a specific target DNA. The probe was synthesized by PCR amplification of
approximately 100bp of the promoter region of the Lbx1 gene, using the primers and the
annealing temperature described in table 6. The remaining PCR conditions were the same that
were used for genotyping, shown in table 4. The reaction product was then purified with the
QIAquick PCR purification kit according with the manufacturer specifications. 5µL of the
fragment were labeled with 32P-ATPγ, using 10-20U of T4 kinase and 1X T4 kinase buffer in a
20µL final volume. The reaction was incubated for 2h at 37ºC. The labeled probes were
purified using the QIAquick PCR purification kit and stored at -20ºC. 3µL of reticulocyte lysate
were incubated with a variable amount of DNA probe, 2x binding buffer and 1 µg of poly-dIdC
(a non-specific competitor) in final volume of 20 µL. After incubating for 30min at room
temperature, the samples were run in a 5% non-denaturing polyacrylamide gel at 150V, in 0.5x
TBE. The gel was previously run for 30-60min at 100V. After the run, the plates were
disassembled and the gel was placed on top of a precut 3mm Whatman paper. The gel was
then covered with a plastic wrap and dried in a vacuum heating device at 80ºC for 1 hour. The
covered dry gel was exposed to an X-ray film overnight at -80ºC. If a weak signal was observed,
the film was exposed for longer time periods.
Material and methods
22
Table 5 Primer sequences for Lbx1 probe synthesis
Orientation Sequence Ta
Lbx Forward 5'CAAACATCTCGGGCCGAGCAC3'
61ºC Reverse 5'TCTGTCCAATGCAGGCGGCTC3'
II.6 Cell culture
The cells used for transfection were C3H-10T1/2 cells and 293-T cells. Both lines of cells were
grown in Dulbecco’s Modified Eagle's Medium (DMEM) containing 20% Fetal calf serum (FCS),
1x penicillin and streptomycin and 1x L-glutamine. After thawing the cells in a 37ºC water bath,
they were transferred to 5mL of growth medium, centrifuged at 1000rpm for 5min and the
supernatant was discarded. Cells were always plated using a media volume to surface area
ratio of 0.2-0.3ml/cm2. The pellet was therefore resuspended in an appropriate amount of
media, plated and incubated overnight at 37ºC, in a humidified environment containing
5%CO2. The medium was changed daily until cells reached confluency, at which point it was
necessary to pass the cells. For this, the media was removed and the cells were washed with
Dulbecco’s phosphate buffered saline (PBS). In order to detach the cells, 30-35µL/cm2 of
trypsin with EDTA were added and the plates were incubated at 37ºC for about 5min. When
cells detached, trypsin was inactivated by addition of about 10 times the trypsin volume of
complete medium. Cells were then recovered by centrifugation at 1000rpm for 5min. The cells
were then resuspended in an adequate volume of growth media, plated and incubated at
37ºC, in a humidified environment containing 5%CO2.
II.6.1 Transfection
The media was changed daily until cells became 90-95% confluent and were ready for
transfection. About three hours prior to transfection, the medium was changed for a similar
one without antibiotics. Transfections were performed using Lipofectamin™ 2000 according to
manufacturer instructions. 8µg of the pCMVSport6.1 containing both the unaltered Hoxa10
cDNA (Sp6.1Hoxa10) and the Hoxa10 with two potential phosphorylation sites mutated
(Sp6.1Hoxa10TSAA) were transfected (Table 5). A GFP-expressing plasmid was also used to
control for transfection efficiency.
Table 6 List of trasnfected samples and negative controls
cell line construct
293T none
293T Sp6.1Hoxa10
293T Sp6.1Hoxa10TSAA
10T1/2 none
10T1/2 Sp6.1Hoxa10
10T1/2 Sp6.1Hoxa10TSAA
Material and methods
23
II.6.2 Cell lysis
After transfection, cells were incubated for about 24h. At this point, cells were trypsinized
again as described above. They were then washed twice in ice-cold Dulbecco’s PBS by gentle
resuspension and collected by centrifugation at 1000rpm, for 5min, at 4ºC. Cells were lysed by
resuspension in 100-400µL of an SDS/NP-40 buffer followed by a 15min incubation on ice.
After centrifugation at 14000rpm, for 10min, at 4ºC, the protein-containing supernatant was
transferred to a new tube and stored at -80ºC. The pellet was discarded.
II.6.3 Cell extract protein analysis
WESTERN BLOT
The western blot procedure was used to visualize the production of Hoxa10 and Hoxa10TSAA
proteins in C3H-10T1/2 cells and 293-T cells. 5µL of 293-T samples and 10-15µL of C3H-10T1/2
samples were added to an equal amount of SDS-containing loading buffer and incubated for
about 3min at 100ºC. The SDS polyacrylamide gel electrophoresis (PAGE) and protein transfer
was conducted as described in section II.4.1. However, a chemiluminescent detection method
was used to detect the proteins. After transfer, nonspecific binding sites were blocked by
incubation with a blocking buffer for 1h with shacking at room temperature. The monoclonal
primary antibody ANTI-FLAG® M2 (#F1804) from Sigma-Aldrich raised in mouse was used in a
1:1000 dilution in blocking buffer. The membrane was incubated in the antibody solution at
4ºC overnight with shaking. The blot was then washed 2-3 times with PBS with 0.1% Tween20
(PBT) for 10min and incubated with a goat α-mouse secondary antibody conjugated with the
horseradish peroxidase (HRP) enzyme diluted 1:2000 in blocking buffer, for 1h at room
temperature. The membrane was washed in PBT 3 times for 15min. The proteins were
detected using the Pierce SuperSignal® West Pico Chemiluminescent HRP substrate and the
protocol employed followed the recommended procedure. A film was exposed for variable
periods of time and developed manually.
The underlined solutions are detailed in Appendix I – Buffers, Solutions and Media
24
Results
25
III. Results In order to facilitate detection of the Hoxa10 protein derivatives generated, a FLAG-tag was
added N-terminally to each of them. To ensure that the presence of the FLAG-tag was not
influencing protein function, a construct containing the Hoxa10 cDNA downstream of the
sequence coding for the FLAG-tag was overexpressed in the PSM. Two phenotypes with
different intensities were obtained (Fig 11). One of the phenotypes was completely ribless,
while the other only lacked ribs in the T1, T12 and T13 thoracic vertebrae. These phenotypes
are consistent with the overexpression of Hoxa10 cDNA without the FLAG-Tag attached
(Carapuço et al., 2005). This indicates that the use of the FLAG-Tag does not influence the rib-
repressing activity of the protein when overexpressed in the PSM.
To identify the motifs responsible for Hoxa10 protein functional activity, Hox protein
sequences were analyzed. Two peptide motifs outside the HD of Hox10 proteins showed
complete conservation in all paralogous group 10 members and were absent in all the
remaining Hox proteins. Both peptides lie adjacent to the HD (Fig 12a): the NWLTAKSG
octapeptide is located upstream of the HD, while the RENRIRELT peptide is located C-
terminally to it. To determine their contribution to the rib-repressing function of Hox10
proteins, the peptide motifs were removed and the resulting mutant proteins were
overexpressed in the presomitic mesoderm driven by the Dll1 promoter. Although a construct
was produced in which the RENRIRELT peptide was removed from the original protein, so far
no transgenic embryos could be produced. For this reason this peptide motif will not be
approached in more detail in this work. However, the octapeptide deletion resulted in
interesting phenotypes that might clarify the importance of sequences outside the HD in
specific functions of Hox genes.
Figure 11 Skeletal staining of E18.5 embryo collected after microinjection with the DllHoxa10pA construct.
The Hoxa10 construct is expressed with the Dll1 promoter and a FLAG-Tag attached N-terminally. A wild-type
embryo (top), a mild-phenotype transgenic (middle) and a ribless transgenic (bottom) are represented. a), b) and c)
lateral view; d), e) and f) dorsal view of the embryos – red triangles indicate the absence of ribs. g), h) and i) ventral
part of the rib cage – the red rectangle highlights abnormal attachment of the ribs to the sternum.
WT
DllH
oxa
10
pA
a
c
b
d
e
f
g
h
i
DllH
oxa
10
pA
Results
26
Figure 12 Schematic representation of the templates used to make the mutant constructs.
a) Hoxa10 and b) Hoxb9. The Homeodomain (HD) is flanked by the conserved peptide motifs indicated.
Figure 13 Schematic representation of the constructs generated.
a) Hoxa10 missing the octapeptide - Hoxa10ΔOct, b) Hoxa10 with a serine and a threonine mutated to alanines -
Hoxa10TSAA, c) Hoxb9 with the Hoxa10 octapeptide - Hoxb9Oct, d) Hoxa10/Hoxb9 chimeric protein – Hoxa10/b9.
III.1 Is the octapeptide necessary for Hox10 functional specificity?
To check if the octapeptide is necessary for the Hoxa10 protein to achieve its functional
specificity, a construct of the Hoxa10 protein lacking the octapeptide was produced and
overexpressed in the presomitic mesoderm (DllHoxa10ΔOctpA – Fig 13a). None of the four
transgenics analyzed at E18.5 showed severe skeletal abnormalities (Fig 14). One of the
embryos was missing fully-formed ribs in the first thoracic vertebra (Fig 14d) and showed
abnormal attachment of the ribs to the sternum (Fig 14h). The other three transgenic embryos
had normal axial skeleton phenotypes. Since Hoxa10 overexpression in the PSM has been
shown to produce a ribless phenotype (Carapuço et al., 2005), these results suggest that the
octapeptide is necessary for Hox group 10 genes to achieve their functional specificity in the
axial skeleton.
a
b
a
b
d
c
Results
27
Figure 14 Skeletal staining of E18.5 embryos collected after microinjection with the DllHoxa10EFGpA construct.
The Hoxa10 construct without the octapeptide is expressed. A wild-type embryo (top) and a transgenic (bottom) are
represented. a) and b) lateral view; c) and d) close-up of the cervical and first thoracic ribs - the transgenic is missing
the first rib (red triangle); e) and f) dorsal view of the embryos. g) and h) ventral part of the rib cage – the red
rectangle highlights abnormal attachment of the ribs to the sternum.
III.2 The mutation of possible phosphorylation sites within the homeodomain
Since the octapeptide seems to play such an important role in Hox group 10 protein function,
specific aminoacids within this peptide motif were examined more closely. Two possible
phosphorylation sites, a serine and a threonine were identified. Both amino acids were
mutated to alanines and the modified protein was overexpressed in the PSM
(DllHoxa10TSAApA – Fig 13b). Nine transgenic embryos were obtained and none of them
showed any kind of defects in the axial skeleton (Fig 15). These results strongly suggest that
the mutation of these amino acids renders the protein unable to perform its function.
Figure 15 Skeletal staining of E18,5 embryos collected after microinjection with the DllHoxa10TSAApA.
Hoxa10 construct with two possible phosphorylation sites mutated is expressed. A wild-type embryo (top) and a
transgenic (bottom) are represented. a) and b) lateral view; c) and d) close-up of the cervical and first thoracic ribs;
e) and f) dorsal view of the embryos. g) and h) ventral part of the rib cage.
hb d f
a c e gD
llHo
xa1
0EF
Gp
AW
T
a c e g
hb d f
DllH
oxa
10
TSA
Ap
AW
T
Results
28
Since the mutated aminoacids are possible phosphorylation sites, the results raised the
possibility that their phosphorylation was necessary for the Hoxa10 rib-repressing activity. In
order to determine if these residues were phosphorylated in vivo, cells were transfected and
the first steps were taken to conduct a two-dimensional polyacrylamide gel electrophoresis
(2D-PAGE). Two different cell lines were transfected both with the normal Hoxa10
(Sp6.1Hoxa10) and the construct with the two possible phosphorylation sites mutated
(Sp6.1Hoxa10TSAA). It was expected that this comparison would provide initial hints as to
whether Hoxa10 becomes phosphorylated in the mutated residues. 293-T cells are convenient
since they have an extremely high transfection efficiency. However, C3H-10T1/2 cells are
mesenchymal and might mimic more accurately the in vivo behaviour of presomitic mesoderm
cells. In order to check if the transfected proteins were being produced by both cell lines, a
western blot was conducted. The blot showed no detectable differences between mutated
and non-mutated protein production. However, there was a significant band size difference
between 293-T and C3H-10T1/2 samples: protein bands from 293-T lysates had the expected
size (about 41KDa) but C3H-10T1/2 produced smaller proteins from the same initial cDNA (Fig
16). The meaning of this finding is still unknown but it will be further explored in future
experiments. Ultimately, these samples will be run in a 2D-PAGE that has not been conducted
yet due to time constraints.
Figure 16 Western blot for transfected 293-T and 10T1/2 cell type lysates with Hoxa10 and Hoxa10TSAA.
The Hoxa10TSAA has a threonine and a serine mutated to alanines. There is also a negative control where no DNA
was transfected. Protein molecular weight indicators are in KDa.
III.3 Is the octapeptide sufficient to produce a ribless phenotype?
The approach taken to determine if the octapeptide is sufficient for Hoxa10 to achieve its rib-
repressing activity was to select a gene which when overexpressed does not produce a
phenotype in the axial skeleton phenotype and use it to generate chimeric constructs. Previous
data from Mallo’s lab suggested that the Hoxb9 gene was an adequate candidate for this
experiment. This gene is very closely related to Hox10 genes and it codes for a protein that
possesses a peptide motif located just upstream of the HD that differs in three amino acids
from the Hox10 octapeptide (Fig 12b).
For consistency reasons, every construct involving both the presence of Hoxa10 and Hoxb9
cDNA possessed the Hoxa10’s 3’UTR, in accordance with the other constructs generated. To
make sure that the phenotypes obtained would result only from the modified cDNA, the
Hoxa10 Hoxa10TSAA Hoxa10 Hoxa10TSAA
293-T 10T1/2
- -
133
71
41.8
Results
29
unaltered Hoxb9 cDNA was cloned into the plasmid containing the Hoxa10 3’UTR (DllHoxb9-
A103’UTRpA). Three transgenics resulted from the microinjection and no deficiencies were
detected in the axial skeleton (Fig 17). Therefore, the presence of the 3’UTR seems not to be
enough to cause a mutant phenotype.
Figure 17 Skeletal staining of E18,5 embryos collected after microinjection of the DllHoxb9-A103’UTRpA
construct.
The Hoxb9 construct with the Hoxa10 3’UTR is expressed. A wild-type embryo (top) and a transgenic (bottom) are
represented. a) and b) lateral view; c) and dorsal view of the embryos; e) and f) ventral part of the rib cage.
Figure 18 Skeletal staining of E18,5 embryos collected after microinjection of the DllHoxb9Oct-A103’UTRpA
construct.
A Hoxb9 construct with the Hoxa10 octapeptide inserted just before the homeodomain is expressed. A wild-type
embryo (top), a mild-phenotype transgenic (middle) and a transgenic with a more severe phenotype (bottom) are
represented. a), b) and c) lateral view; d), e) and f) dorsal view of the embryos – red triangles indicate the absence
of ribs. g), h) and i) ventral part of the rib cage – the red rectangle highlights abnormal attachment of the ribs to the
sternum.
a
b
c
d
e
f
WT
DllH
oxb
9-A
10
3’U
TRp
A
a
c
b
d
e
f
g
h
i
WT
DllH
oxb
9O
ct-A
10
3’U
TRp
A
Results
30
To determine if the Hoxa10 octapeptide was sufficient to incorporate a rib-blocking phenotype
into the Hoxb9 protein the NWLHARSS motif was replaced by the Hox10 octapeptide
(NWLTAKSG) (DllHoxb9Oct-A103’UTRpA – Fig 13c). The chimeric construct was then cloned
into the 3’UTR of the Hoxa10 for consistency reasons. Three transgenics expressing the
chimeric construct had mutant phenotypes (Fig 18). They all showed severe sternum defects,
which were probably the result of abnormal rib formation (Fig 18h-i). Additionally, the cervical
vertebrae in transgenic embryos seemed to have lost their typical morphology. They were
larger and most of them had underdeveloped ribs (Fig 18e-f). The most severe phenotype
showed absence of a few ribs both at the anterior and at the posterior borders of the thoracic
region (Fig 18f). The results obtained suggest that the octapeptide has a role in rib-repressing
functions but is not sufficient on its own to produce a fully ribless skeleton.
III.4 Other functionally relevant residues
The data obtained from the transgenic embryos overexpressing the Hoxb9oct construct
suggested that other parts of the Hoxa10 sequence are necessary for this protein to achieve its
function. For this reason, another construct was generated that contained the Hoxa10
octapeptide and the sequences N-terminal to it, as well as the Hoxb9 homeodomain and
sequences C-terminal to it. Overexpression of a cDNA coding for this chimeric protein
(DllHoxa10b9-A103’UTRpA - Fig 13d) in the PSM produced three transgenics, from which only
one showed a detectable axial skeleton phenotype (Fig 19). Similarly to Hoxb9Oct transgenics,
the embryo had sternum defects (Fig 19f). Ribs from thoracic vertebrae T1, T2 and T13 were
almost absent and the other thoracic vertebrae were smaller than those observed in the wild-
type skeleton (Fig 19d). Cervical vertebrae were not as affected as in Hoxb9oct transgenics.
However, they were more spaced and resembled cervical vertebrae observed in Hoxa10
hypomorphic transgenics (Fig 11e). This phenotype suggests that residues in the N-terminal
part of the Hoxa10 protein are not sufficient to repress thoracic rib formation.
Figure 19 Skeletal staining of E18,5 embryos collected after microinjection of the DllHoxa10/b9-A103’UTRpA
construct.
A Hoxa10/Hoxb9 chimeric construct with the octapeptide inserted just before the homeodomain is expressed. A
wild-type embryo (top) and a transgenic (bottom) are represented. a) and b) lateral view; c) and d) dorsal view of
the embryos red triangles indicate the absence of ribs; e) and f) ventral part of the rib cage– the red rectangle
highlights abnormal attachment of the ribs to the sternum.
a
b
c
d
e
f
DllH
oxa
10
b9
-A1
03
’UTR
pA
WT
Results
31
III.5 Protein synthesis and DNA-binding ability
Since the sequence of the Hoxa10 cDNA was manipulated, the mutated constructs were
further analyzed to determine if they were still able to produce protein and if they had
retained their DNA-binding properties. All mutated coding sequences were successfully
translated in vitro by a reticulocyte lysate system (Fig 20).
Previous data from Mallo’s lab had shown that Hox proteins were able to bind to a region in
the promoter of the Lbx1 gene. In order to evaluate DNA-binding ability of the mutated
proteins, the same Lbx1 DNA probe was used to conduct an electrophoretic mobility shift
assay (EMSA) using the reticulocyte lysates. All proteins, including chimeric and mutant
constructs, conserved the ability to bind to this Lbx1 promoter region (Fig 21).
These results indicate that in vitro, the different phenotypes obtained were not a result of
differential DNA-binding ability.
Figure 20 Western blot for proteins produced by a reticulocyte lysate system.
Both the unaltered proteins and mutated proteins are represented. Protein standard molecular weights are in KDa.
Figure 21 Electrophoretic mobility shift assay.
Both the unaltered and mutated proteins produced in vitro bind to an Lbx1 DNA probe.
133
71
41.8
30.6
17.8
6.9
133
71
41.8
30.6
17.8
6.9
250
130
100
70
55
35
27
32
Discussion
33
IV. Discussion
This work has addressed protein signatures that give specificity to the Hox group 10 proteins in
their axial patterning function.
HD swapping experiments in mice have been performed in order to test if the HDs were
functionally interchangeable. The swap of the Hoxa11 HD for that of the Hoxa13, Hoxa10 and
Hoxa4 indicated that some functions are affected by the swap of a different homeodomain.
However, the axial skeleton was not significantly affected in any of the mutant mice.
Apparently, the HD function in the axial skeleton has been highly conserved, while its function
in other tissues has diverged over time (Zhao et al., 2001, Zhao et al., 2002). Previous reports
have showed that HD amino acids play an important role in Hox protein specificity (Chan et al.,
1993). However, the results obtained in these HD swapping experiments strongly suggest that
the Hoxa10 HD is not likely to have a role in its axial patterning functions.
Some paralogs, including Hox group 10, have been reported to possess signature residues
adjacent to the HD and very few conserved in the whole paralogous group within the HD. It is
therefore likely that these peptide motifs outside the HD contribute to the functional
specificity that does not seem to be provided by the HD alone (Sharkey et al., 1997). In fact,
the removal of the conserved Hox10 octapeptide impaired almost completely Hox10’s rib-
repressing activity, showing that sequences outside the HD are necessary for Hox protein
function. In addition, the insertion of this octapeptide in the Hoxb9 protein caused an
abnormal axial skeleton phenotype, confirming the importance of this octapeptide. However,
only mild axial skeleton phenotypes were obtained, suggesting that, in addition to the
octapeptide, other residues within or outside the HD could be necessary for these proteins to
carry out their patterning function. In particular, the other signature peptide motif of Hox
group 10 proteins located just C-terminal to the HD could be necessary for Hoxb9 proteins to
acquire a rib-repressing function. There is also the possibility that the octapeptide is not
correctly positioned to perform the same function it does in Hoxa10. However, the Hoxb9
protein has a very similar peptide motif that differs only in three amino acids when compared
to the Hoxa10 octapeptide. This makes a conformational issue unlikely to occur, although it
does not fully exclude the possibility.
The presence of other residues lying N-terminally to the HD was also not sufficient to obtain a
fully ribless phenotype. Instead they closely resemble the hypomorphic phenotype that results
from low-copy Hoxa10 overexpression in the PSM (Fig 11 b, e, h and Fig 19 b, d, f). For this
reason, it is possible that the DllHoxa10/b9-A103’UTR chimeric contruct can, in fact, produce a
more serious phenotype that has not been observed yet in the reduced number of transgenic
embryos analyzed so far. In any case, the data provided so far indicates that C-terminal amino
acids or the HD itself can also play a role in Hox10 patterning function. Experiments to test this
hypothesis are underway. Two Hoxa10 constructs have been prepared: one of them codes for
a Hoxa10 protein lacking the conserved peptide motif C-terminal to the HD and the other
contains the Hoxb9 HD instead of its own. The overexpression of these constructs will
hopefully clarify this matter.
There is strong evidence for the importance of the Hox10 octapeptide in Hox protein function.
Pbx proteins have been shown to influence the DNA-binding ability of Hox proteins (Mann,
1997). The octapeptide analyzed here comprises the conserved tryptophan that has been
shown to be essential for Hox-Pbx interaction (Chang et al., 1996, Shen et al., 1997). Since Pbx
Discussion
34
proteins have been proposed to confer functional specificity to Hox proteins (Mann et al.,
1996), it is possible that the octapeptide is involved in providing specificity by interacting with
Pbx. In order to test this idea, a construct with the tryptophan amino acid mutated to an
alanine has already been generated, although it has not been microinjected yet. However, it
has been previously documented that Pbx1 interactions might not be as relevant in AbdB-like
Hox proteins (LaRonde-LeBlanc et al., 2003). LaRonde-LeBlanc et al. described the structure of
Hoxa9 and Pbx1 homeodomains bound to a DNA fragment. The Hoxa9 and Hoxa10
octapeptides were portrayed as hexapeptides with a three-amino acid linker to the HD to
facilitate the comparison with the PBX-binding hexapeptide observed in Hox1-8 proteins. The
conserved tryptophan residue preserved, as expected, its location in the Pbx pocket.
Otherwise the divergent Abd-B-like hexapeptide was found to have a significantly different
conformation compared with other documented structures. Although Pbx1 increased DNA-
binding specificity of more anterior expressing Hox proteins such as Hoxb1, it did not do so for
Hoxa9 and presumably other Abd-B related proteins such as Hoxa10 (LaRonde-LeBlanc et al.,
2003). It is therefore likely the mechanism responsible for providing Hoxa10 rib-repressing
activity is not dependent on binding to Pbx1. Binding to other co-factors, post-translational
modifications or recruitment of proteins that modulate chromatin structure are far more likely
possibilities.
Protein phosphorylation is an essential mechanism for the regulation of many cellular
functions like metabolism, proliferation, differentiation and apoptosis (Brinkworth et al.,
2003). It has been reported that Hox genes can also have their activity modified as a result of
phosphorylation (Jaffe et al., 1997). Therefore, it is possible that Hox10 proteins could have
their rib-repressing activity regulated by phosphorylation, as well. The results obtained in this
work seem to be consistent with this hypothesis, since mutations in the phosphorylation sites
blocked the activity of Hoxa10 in inhibiting rib formation. However, phosphorylation has also
been associated with ubiquitination, which suggests that protein degradation can also be part
of the mechanism (Dimmeler et al., 1999, Chang et al., 1998). Although the protein was
successfully produced in two cell types, a western blot should be conducted using transgenic
embryonic tissue to confirm that the mutated protein is not being degraded in vivo.
Surprisingly, C3H-10T1/2 cells show a significantly smaller band in the western blot, which
could indicate the presence of a different splice variant. This unexpected result has not been
further explored yet due to time constraints.
In order to determine if the Hoxa10 protein is being phosphorylated, a two-dimensional
polyacrylamide gel electrophoresis (2D PAGE), that combines both isoelectric focusing and
SDS-PAGE, will be conducted. This method allows the detection of specific qualitative and
quantitative protein changes, such as post-translational modifications. The phosphorylation
alters both the protein molecular weight and its isoelectric point. A difference in the 2D gel
patterns obtained with the normal Hoxa10 protein and the Hoxa10 protein with both possible
phosphorylation sites mutated could indicate that these residues, conserved throughout the
whole paralogous group 10 proteins, are being phosphorylated.
All mutated and chimeric constructs were shown to be able to produce protein and bind to
DNA. However, the Hoxa10/b9 construct showed a weak band in the EMSA which cannot be
interpreted as a decrease in DNA-binding ability (Fig 21). It simply means that there was less
protein synthesized in vitro and, consequently, less protein available to bind to the radioactive
probe (Fig 20).
Discussion
35
This study strongly suggests that sequences outside the HD have a critical role in Hox protein
functional specificity. In this case, an octapeptide just upstream of the HD seems to be
necessary for Hoxa10’s rib-repressing activity. It is however insufficient to produce a full ribless
phenotype on its own. It remains to be seen what other residues, within or outside the HD, are
necessary for this transcription factor to achieve its functional specificity. The study through
mutated and chimeric proteins is an important initial step to understand the mechanisms by
which Hox genes operate on their downstream targets and ultimately establish differences
along the AP axis.
36
References
37
References
Aoyama, H. and Asamoto, K. (1988). Determination of somite cells: independence of cell differentiation and morphogenesis. Development 104, 15-28.
Bateson, W. (1984) Materials for the study of variation treated with especial regard to discontinuity in the origin of species Macmillan, London.
Beckers, J., Caron, A., Hrabe de Angelis, M., Hans, S., Campos-Ortega, J.A. and Gossler, A. (2000). Distinct regulatory elements direct Delta1 expression in the nervous system and paraxial mesoderm of transgenic mice Mechanisms of development 95, 23-34.
Berthelsen, J., Zappavigna, V., Mavilio, F. and Blasi, F. (1998). Prep1, a novel functional partner of Pbx proteins. The EMBO Journal 17, 1423-1433.
Bettenhausen, B., Hrabe de Angelis, M., Simon, D., Guenet, J.L. and Gossler, A. (1995). Transient and restricted expression during mouse embryogenesis of Dll1, a murine gene closely related to Drosophila Delta. Development 121, 2407-2418.
Biggin, M.D. and McGinnis, W. (1997). Regulation of segmentation and segmental identity by Drosophila homeoproteins: the role of DNA binding in functional activity and specificity. Development 124, 4425-4433.
Boncinelli, E., Simeone, A., La Volpe, A., Faiella, A., Fidanza, V., Campora, D. and Scotto, L. (1985). Human cDNA clones containing homeobox sequences. Cold Spring Harb. Symp. quant. Biol 50, 301-306.
Brent, A.E. and Tabin, C.J. (2002). Developmental regulation of somite derivatives: muscle, cartilage and tendon. Current Opinion in Genetics & Development 12, 548-557.
Brinkworth, R.I., Breinl, R.A. and Kobe, B. (2003). Structural basis and prediction of substrate specificity in protein serine/threonine kinases. Proceedings of the National Academy of Sciences of the United States of America 100, 74-79.
Buckingham, M. (2001). Skeletal muscle formation in vertebrates. Curr Opin Genet Dev 11, 440-448.
Burglin, T.R. (1997). Analysis of TALE superclass homeobox genes (MEIS, PBC, KNOX, Iroquois, TGIF) reveals a novel domain conserved between plants and animals. Nucl. Acids Res. 25, 4173-4180.
Burke, A.C. (2000). Hox genes and the global patterning of the somitic mesoderm. Curr Top Dev Biol 47, 155-181.
Burke, A.C., Nelson, C.E., Morgan, B.A. and Tabin, C. (1995). Hox genes and the evolution of vertebrate axial morphology. Development 121, 333-346.
Carapuço, M., Névoa, A., Bobola, N. and Mallo, M. (2005). Hox genes specify vertebral types in the presomitic mesoderm. Genes & Development 19, 2116-2121.
Carrasco, A., McGinnis, W., Gehring, W. and De Robertis, E. (1984). Cloning of an X. laevis gene expressed during early embryogenesis coding for a peptide region homologous to Drosophila homeotic genes. Cell 37, 409-414.
Chan, S.K. and Mann, R.S. (1993). The segment identity functions of Ultrabithorax are contained within its homeo domain and carboxy-terminal sequences. Genes & Development 7, 796-811.
Chan, S.K. and Mann, R.S. (1996). A structural model for a homeotic protein-extradenticle-DNA complex accounts for the choice of HOX protein in the heterodimer. Proceedings of the National Academy of Sciences of the United States of America 93, 5223-5228.
Chang, C.P., Brocchieri, L., Shen, W.F., Largman, C. and Cleary, M.L. (1996). Pbx modulation of Hox homeodomain amino-terminal arms establishes different DNA-binding specificities across the Hox locus. Mol. Cell. Biol. 16, 1734-1745.
References
38
Chang, C.P., Shen, W.F., Rozenfeld, S., Lawrence, H.J., Largman, C. and Cleary, M.L. (1995). Pbx proteins display hexapeptide-dependent cooperative DNA binding with a subset of Hox proteins. Genes & Development 9, 663-674.
Chang, W.-T., Thomason, P.A., Gross, J.D. and Newell, P.C. (1998). Evidence that the RdeA protein is a component of a multistep phosphorelay modulating rate of development in Dictyostelium. EMBO J 17, 2809-2816.
Chauvet, S., Merabet, S., Bilder, D., Scott, M.P., Pradel, J. and Graba, Y. (2000). Distinct Hox protein sequences determine specificity in different tissues. Proceedings of the National Academy of Sciences of the United States of America 97, 4064-4069.
Cordes, R., Schuster-Gossler, K., Serth, K. and Gossler, A. (2004). Specification of vertebral identity is coupled to Notch signalling and the segmentation clock. Development 131, 1221-1233.
Dale, K. and Pourquié, O. (2000). A clock-work somite. BioEssays 22, 72-83. Deschamps, J., Van den Akker, E., Forlani, S., Graaff, W., Oosterveen, T., Roelen, B. and
Roelfsema, J. (1999). Initiation, establishment and maintenance of Hox gene expression patterns in the mouse. Int J Dev Biol 43, 635-650.
Deschamps, J. and van Nes, J. (2005). Developmental regulation of the Hox genes during axial morphogenesis in the mouse. Development 132, 2931-2942.
Dimmeler, S., Breitschopf, K., Haendeler, J. and Zeiher, A.M. (1999). Dephosphorylation Targets Bcl-2 for Ubiquitin-dependent Degradation: A Link between the Apoptosome and the Proteasome Pathway. J. Exp. Med. 189, 1815-1822.
Duboule, D. (1998). Vertebrate Hox gene regulation: clustering and/or colinearity? Current Opinion in Genetics & Development 8, 514-518.
Duboule, D. and Dollé, P. (1989). The structural and functional organization of the murine HOX gene family resembles that of Drosophila homeotic genes. EMBO J 8, 1497–1505.
Duboule, D. and Morata, G. (1994). Colinearity and functional hierarchy among genes of the homeotic complexes. Trends in Genetics 10, 358-364.
Dubrulle, J. and Pourquie, O. (2004). Coupling segmentation to axis formation. Development 131, 5783-5793.
Ekker, S.C., Young, K.E., Vonkessler, D.P. and Beachy, P.A. (1991). Optimal DNA-sequence recognition by the Ultrabithorax homeodomain of Drosophila. Embo Journal 10, 1179-1186.
Favier, B. and Dolle, P. (1997). Developmental functions of mammalian Hox genes. Mol. Hum. Reprod. 3, 115-131.
Fromental-Ramain, C., Warot, X., Lakkaraju, S., Favier, B., Haack, H., Birling, C., et al. (1996). Specific and redundant functions of the paralogous Hoxa-9 and Hoxd-9 genes in forelimb and axial skeleton patterning. Development 122, 461-472.
Furukubo-Tokunaga, K., Flister, S. and Gehring, W.J. (1993). Functional specificity of the Antennapedia homeodomain. Proceedings of the National Academy of Sciences of the United States of America 90, 6360-6364.
Gaunt, S. and Strachan, L. (1994). Forward spreading in the establishment of a vertebrate Hox expression boundary: The expression domain separates into anterior and posterior zones, and the spread occurs across implanted glass barriers. Developmental Dynamics 199, 229-240.
Gaunt, S.J. (1988). Mouse homeobox gene transcripts occupy different but overlapping domains in embryonic germ layers and organs: a comparison of Hox-3.1 and Hox-1.5. Development 103, 135-144.
Gehring, W., Müller, M., Affolter, M., Percival-Smith, A., Billeter, M., Qian, Y., et al. (1990). The structure of the homeodomain and its functional implications. Trends in Genetics 6, 323-329.
Gehring, W.J. (1987). Homeo boxes in the study of development. Science 236, 1245-1252. Gilbert, S.F. (2006) Developmental biology Sunderland, MA, Sinauer Associates Inc.
References
39
Greer, J.M., Puetz, J., Thomas, K.R. and Capecchi, M.R. (2000). Maintenance of functional equivalence during paralogous Hox gene evolution. Nature 403, 661-665.
Hart, C., Awgulewitsch, A., Fainsod, A., McGinnis, W. and Ruddle, F. (1985). Homeo box gene complex on mouse chromosome 11: Molecular cloning, expression in embryogenesis, and homology to a human homeo box locus. Cell 43, 9-18.
Jaffe, L., Ryoo, H.D. and Mann, R.S. (1997). A role for phosphorylation by casein kinase II in modulating Antennapedia activity in Drosophila. Genes & Development 11, 1327-1340.
Joshi, R., Passner, J.M., Rohs, R., Jain, R., Sosinsky, A., Crickmore, M.A., et al. (2007). Functional specificity of a Hox protein mediated by the recognition of minor groove structure. Cell 131, 530-543.
Kessel, M. and Gruss, P. (1991). Homeotic transformations of murine vertebrae and concomitant alteration of Hox codes induced by retinoic acid. Cell 67, 89-104.
Kissinger, C., Liu, B., Martin-Blanco, E., Kornberg, T. and Pabo, C. (1990). Crystal structure of an engrailed homeodomain-DNA complex at 2.8 A resolution: a framework for understanding homeodomain-DNA interactions. Cell 63, 579-590.
Kmita, M. and Duboule, D. (2003). Organizing Axes in Time and Space; 25 Years of Colinear Tinkering. Science 301, 331-333.
LaRonde-LeBlanc, N. and Wolberger, C. (2003). Structure of HoxA9 and Pbx1 bound to DNA: Hox hexapeptide and DNA recognition anterior to posterior. Genes and Development 17, 2060-2072.
Lewis, E.B. (1978). Gene complex controlling segmentation in Drosophila. Nature 276, 565-570. Li, X. and McGinnis, W. (1999). Activity regulation of Hox proteins, a mechanism for altering
functional specificity in development and evolution. Proceedings of the National Academy of Sciences of the United States of America 96, 6802-6807.
Lin, L. and McGinnis, W. (1992). Mapping functional specificity in the Dfd and Ubx homeo domains. Genes & Development 6, 1071-1081.
Lu, Y., Goldenberg, I., Bei, L., Andrejic, J. and Eklund, E.A. (2003). HoxA10 Represses Gene Transcription in Undifferentiated Myeloid Cells by Interaction with Histone Deacetylase 2. Journal of Biological Chemistry 278, 47792-47802.
Mahmoudi, T. and Verrijzer, P. (2001). Chromatin silencing and activation by Polycomb and trithorax group proteins. Oncogene 20, 3055-3066.
Mallo, M. (2007). And the segmentation clock keeps ticking. BioEssays 29, 412-415. Mallo, M., Vinagre, T. and Carapuço, M. (2008). The road to the vertebral formula. Int J Dev
Biol 52. Mann, R. (1997). Why are Hox genes clustered? BioEssays 19, 661-664. Mann, R.S. and Affolter, M. (1998). Hox proteins meet more partners. Current Opinion in
Genetics & Development 8, 423-429. Mann, R.S. and Chan, S.K. (1996). Extra specificity from extradenticle: the partnership between
Hox and Pbx/Exd homeodomain proteins. Trends in Genetics 12, 258-262. McIntyre, D.C., Rakshit, S., Yallowitz, A.R., Loken, L., Jeannotte, L., Capecchi, M.R. and Wellik,
D.M. (2007). Hox patterning of the vertebrate rib cage. Development 134, 2981-2989. Merabet, S., Hudry, B., Saadaoui, M. and Graba, Y. (2009). Classification of sequence
signatures: a guide to Hox protein function. BioEssays 31, 500-511. Merabet, S., Kambris, Z., Capovilla, M., Berenger, H., Pradel, J. and Graba, Y. (2003). The
hexapeptide and linker regions of the AbdA Hox protein regulate its activating and repressive functions. Developmental Cell 4, 761-768.
Moens, C. and Selleri, L. (2006). Hox cofactors in vertebrate development Developmental Biology 291, 193-206.
Monsoro-Burq, A.H. (2005). Sclerotome development and morphogenesis: when experimental embryology meets genetics. Int J Dev Biol 49, 301-308.
References
40
Otting, G., Qian, Y., Billeter, M., Müller, M., Affolter, M., Gehring, W. and Wüthrich, K. (1990). Protein-DNA contacts in the structure of a homeodomain-DNA complex determined by nuclear magnetic resonance spectroscopy in solution. Embo Journal 9, 3085-3092.
Palmeirim, I., Henrique, D., Ish-Horowicz, D. and Pourquié, O. (1997). Avian hairy gene expression identifies a molecular clock linked to vertebrate segmentation and somitogenesis. Cell 91, 639-648.
Pearson, J., Lemons, D. and McGinnis, W. (2005). Modulating Hox gene functions during animal body patterning. Nature reviews genetics 6, 893-904.
Pourquie, O. (2003). The Segmentation Clock: Converting Embryonic Time into Spatial Pattern. Science 301, 328-330.
Prince, F., Katsuyama, T., Oshima, Y., Plaza, S., Resendez-Perez, D., Berry, M., et al. (2008). The YPWM motif links Antennapedia to the basal transcriptional machinery. Development 135, 1669-1679.
Prince, V. (2002). The Hox Paradox: More Complex(es) Than Imagined Developmental Biology 249, 1-15.
Rieckhof, G.E., Casares, F., Ryoo, H.D., Abu-Shaar, M. and Mann, R.S. (1997). Nuclear translocation of extradenticle requires homothorax, which encodes an extradenticle-related homeodomain protein. Cell 91, 171-183.
Saleh, M., Rambaldi, I., Yang, X.-J. and Featherstone, M.S. (2000). Cell Signaling Switches HOX-PBX Complexes from Repressors to Activators of Transcription Mediated by Histone Deacetylases and Histone Acetyltransferases. Mol. Cell. Biol. 20, 8623-8633.
Schier, A.F. and Gehring, W.J. (1993). Functional specificity of the homeodomain protein fushi tarazu: the role of DNA-binding specificity in vivo. Proceedings of the National Academy of Sciences of the United States of America 90, 1450-1454.
Sharkey, M., Graba, Y. and Scott, M. (1997). Hox genes in evolution: protein surfaces and paralog groups Trends in Genetics 13, 145-151.
Shen, W.-f., Krishnan, K., Lawrence, H.J. and Largman, C. (2001). The HOX Homeodomain Proteins Block CBP Histone Acetyltransferase Activity. Mol. Cell. Biol. 21, 7509-7522.
Shen, W.-F., Rozenfeld, S., Lawrence, H.J. and Largman, C. (1997). The Abd-B-like Hox Homeodomain Proteins Can Be Subdivided by the Ability to Form Complexes with Pbx1a on a Novel DNA Target. J. Biol. Chem. 272, 8198-8206.
Slack, J.M.W., Holland, P.W.H. and Graham, C.F. (1993). The zootype and the phylotypic stage. Nature 361, 490-492.
Tam, P.P. and Beddington, R.S. (1987). The formation of mesodermal tissues in the mouse embryo during gastrulation and early organogenesis. Development 99, 109-126.
Wellik, D.M. (2007). Hox patterning of the vertebrate axial skeleton. Developmental Dynamics 236, 2454-2463.
Wellik, D.M. and Capecchi, M.R. (2003). Hox10 and Hox11 Genes Are Required to Globally Pattern the Mammalian Skeleton. Science 301, 363-367.
Zeng, W., Andrew, D.J., Mathies, L.D., Horner, M.A. and Scott, M.P. (1993). Ectopic expression and function of the Antp and Scr homeotic genes: the N terminus of the homeodomain is critical to functional specificity. Development 118, 339-352.
Zhao, Y. and Potter, S. (2001). Functional specificity of the Hoxa13 homeobox. Development 128, 3197-3207.
Zhao, Y. and Potter, S. (2002). Functional Comparison of the Hoxa 4, Hoxa 10, and Hoxa 11 Homeoboxes. Developmental Biology 244, 21-36.
41
42
AppendixI
A- 1 -
APPENDIX I – BUFFERS, SOLUTIONS AND MEDIA
AppendixI
A- 2 -
Ladders
DNA ladder Fermentas #SM0331
Protein ladder Fermentas #SM1819
Bio-Rad #161-0324
TO GENERATE COMPETENT CELLS RF1
RbCl 100 mM MnCl2.4H2O 50 mM Potassium Acetate 30 mM CaCl2.2H20 10 mM Glycerol 15 % (w/v)
Adjust to pH 5.8 with 0.2M acetic acid
Sterilized by filtration
RF2 MOPS 10 mM RbCl 10 mM CaCl2.2H20 75 mM Glycerol 15 % (w/v)
Adjust to pH 6.8 with NaOH
Sterilized by filtration
BUFFERS FOR MULTIPLE USES 1x TE
EDTA 1mM
Tris-HCl 10mM
1xTAE
EDTA (pH 8) 1mM
Acetic acid 20mM
Tris base 40mM
Gel loading buffer 6x
Glycerol 30%
Bromophenol blue 0.25%
AppendixI
A- 3 -
BACTERIAL GROWTH AND PLASMID PURIFICATION
Lysogeny Broth (LB) medium
Tryptone 1%
Yeast extract 0.5%
NaCl 1%
TENS
Tris, pH 7.5 10 mM
EDTA 1 mM
NaOH 0.1 M
SDS 0.5 %
PCR
Enzymes
Pfu DNA polymerase Fermentas (#EP0572)
Taq DNA polymerase Fermentas (#EP0281)
10 x Buffers provided with the enzymes
KITS
DNA Kits
QIAEX II Gel Extraction kit QIAGEN (#20051)
QIAprep spin miniprep kit QIAGEN (#27104)
QIAquick gel extraction kit QIAGEN (#28706)
QIAquick PCR Purification Kit QIAGEN (#28106)
Plasmid DNA purification kit NucleoBond (#740573)
in vitro protein synthesis
TNT® Sp6 reticulocyte lysate system Promega (#L4601)
GENOTYPING
Laird's buffer
Tris-HCl, pH 8.5 100mM
EDTA 5mM
SDS 0.2%
NaCl 200mM
AppendixI
A- 4 -
SKELETAL STAINING
Alcian blue solution
Alcian Blue 8 GX 150mg/L
Ethanol 80%
Acetic acid 20%
Alizarin red solution
Alizarin red S 50mg/L
KOH 2%
WESTERN
Lysis Buffer
1 M NaCl 7.5 mL
10% NP-40 5 mL
20% SDS 0.25 mL
1M Tris-HCl pH 8.0 2.5 mL
10x Tris-Glycine
Tris base 25mM
Glycine 192mM
Running buffer
Tris-Glycine 1X
SDS 0,1%
Transfer buffer
Tris-Glycine 1X
Methanol 20%
2X SDS-containing loading buffer
Tris-HCl pH 6.8 125mM
SDS 4%
Glycerol 20%
Bromophenol blue 0.006%
beta-mercaptoethanol 1.8%
10-12% SDS polyacrylamide resolving gel 30%acrylamide/bisacrylamide 10%
1.5 M Tris pH 8.8 390mM 20% SDS 0.05% 10% ammonium persulfate 0.1% TEMED 0.04%
AppendixI
A- 5 -
5% SDS polyacrylamide stacking gel 30%acrylamide/bisacrylamide 5%
1M Tris pH 6.8 125mM 20% SDS 0.05% 10% ammonium persulfate 0.1% TEMED 0.04%
Blocking Buffer BSA 3%
10% Tween 20 0.1%
PBS to final vol
1x PBS NaCl 137 mM
KCl 2.7 mM
Na2HPO4 10 mM
KH2PO4 2 mM
Adjust pH to 7.4 with HCl
CELL CULTURE
Growth media
DMEM Sigma (#D5796)
Fetal Calf serum Sigma (#7524)
Penicillin and Streptomycin Sigma (#P0781)
L-glutamine Sigma (#G7513) Trypsinization
Trypsin with EDTA Sigma (#T3924)
Dulbecco's PBS Sigma (#D1408)
Transfection
Lipofectamin™ 2000 Invitrogen (#11668-019) EMSA
Probe labelling
T4 Polynucleotide Kinase Promega (#M4101)
T4 PNK Buffer Promega (#C1313)
5XTBE
Tris Base 445 mM
boric acid 445 mM
AppendixI
A- 6 -
EDTA (pH 8.0) 10 mM
5% non-denaturing polyacrylamide gel
30%acrylamide/bisacrylamide 5%
TBE 0.5x 10% ammonium persulfate 0.1% TEMED 0.1%
AppendixII
A- 7 -
APPENDIX II – CODING SEQUENCES OF TEMPLATES AND MUTATED
CONSTRUCTS
AppendixII
A- 8 -
All Hoxa10 sequences are uppercase and Hoxb9 sequences are in lowercase. The octapepide is
underlined. Amino acid point mutations are in bold.
Hoxa10
ATGTCATGCTCGGAGAGCCCTGCCGCGAACTCCTTTTTGGTCGACTCGCTCATCAGCTCAGGCAGAGGC
GAGGCTGGTGGTGGTGGCGGTAGCGCGGGGGGCGGTGGAGGTGGCTACTACGCCCACGGTGGGGTC
TACCTGCCGCCTGCCAGCGACCTGCCCTACGGGCTGCAAAGCTGCGGGCTCTTCCCCGCGCTGGGCAG
CAAGCGTAATGAAGCGCCGTCGCCCGGAGGCGGTGGCGGTGGTGGCAGCGGGGGCCTGGGTCCTGG
GACGCATGGCTACGCGCCCGCGCCCCTAGACCTGTGGCTGGACGCGCCCCGCTCCTGCCGGATGGAGC
CGCCCGACGGGCCGCCGCCACCGCAGCCACAACCCCAGCAGCAGCAGCAGCAGCCGCCGCCGCCCCC
GCCGCAGCCACCTCAACCCCAGCCACAGGCCACTTCGTGTTCTTTTGCGCAGAACATCAAAGAAGAGAG
CTCCTACTGCCTCTACGATGCTGCGGACAAATGCCCCAAGGGCTCGGCCGCCGCTGATCTGGCCCCTTT
CCCGCGGGGCCCGCCGCCCGACGGCTGCGCCCTGGGCGCCTCCAGCGGAGTGCCAGTACCCGGCTACT
TCCGCCTGTCGCAGGCCTACGGCACGGCCAAGGGCTTCGGCAGTGGCGGCGGCGGCACGCAGCAGCT
CGCTAGTCCCTTTCCTGCGCAGCCCCCGGGGCGCGGTTTCGACCCGCCGCCCGCACTGGCCTCTGGCTC
GACCGAGGCAGCCGGGAAGGAGCGAGTCCTAGACTCCACGCCACCACCCACTCTGGTTTGCACCGGTG
GCGGCGGCTCGCAGGGCGACGAGGAGGCACACGCGTCATCCTCGGCGGCTGAGGAGCTGTCTCCAGC
CCCTTCAGAAAACAGTAAAGCTTCGCCGGAGAAGGACTCCCTGGGCAGTTCCAAAGGCGAAAATGCAG
CCAACTGGCTCACAGCAAAGAGCGGCCGGAAGAAACGCTGCCCTTACACGAAGCACCAGACGCTGGA
GCTGGAGAAGGAGTTTCTATTCAACATGTACCTTACTCGAGAGCGGCGCCTAGAGATCAGCCGTAGCG
TCCACCTCACGGACAGACAAGTGAAAATCTGGTTTCAGAATCGCAGGATGAAACTGAAGAAAATGAAC
CGAGAAAACCGAATCCGGGAGCTCACAGCCAACTTTAATTTTTCC
Hoxa10EFG
ATGTCATGCTCGGAGAGCCCTGCCGCGAACTCCTTTTTGGTCGACTCGCTCATCAGCTCAGGCAGAGGC
GAGGCTGGTGGTGGTGGCGGTAGCGCGGGGGGCGGTGGAGGTGGCTACTACGCCCACGGTGGGGTC
TACCTGCCGCCTGCCAGCGACCTGCCCTACGGGCTGCAAAGCTGCGGGCTCTTCCCCGCGCTGGGCAG
CAAGCGTAATGAAGCGCCGTCGCCCGGAGGCGGTGGCGGTGGTGGCAGCGGGGGCCTGGGTCCTGG
GACGCATGGCTACGCGCCCGCGCCCCTAGACCTGTGGCTGGACGCGCCCCGCTCCTGCCGGATGGAGC
CGCCCGACGGGCCGCCGCCACCGCAGCCACAACCCCAGCAGCAGCAGCAGCAGCCGCCGCCGCCCCC
GCCGCAGCCACCTCAACCCCAGCCACAGGCCACTTCGTGTTCTTTTGCGCAGAACATCAAAGAAGAGAG
CTCCTACTGCCTCTACGATGCTGCGGACAAATGCCCCAAGGGCTCGGCCGCCGCTGATCTGGCCCCTTT
CCCGCGGGGCCCGCCGCCCGACGGCTGCGCCCTGGGCGCCTCCAGCGGAGTGCCAGTACCCGGCTACT
TCCGCCTGTCGCAGGCCTACGGCACGGCCAAGGGCTTCGGCAGTGGCGGCGGCGGCACGCAGCAGCT
CGCTAGTCCCTTTCCTGCGCAGCCCCCGGGGCGCGGTTTCGACCCGCCGCCCGCACTGGCCTCTGGCTC
GACCGAGGCAGCCGGGAAGGAGCGAGTCCTAGACTCCACGCCACCACCCACTCTGGTTTGCACCGGTG
GCGGCGGCTCGCAGGGCGACGAGGAGGCACACGCGTCATCCTCGGCGGCTGAGGAGCTGTCTCCAGC
CCCTTCAGAAAACAGTAAAGCTTCGCCGGAGAAGGACTCCCTGGGCAGTTCCAAAGGCGAAAATGCAG
CCCGGAAGAAACGCTGCCCTTACACGAAGCACCAGACGCTGGAGCTGGAGAAGGAGTTTCTATTCAAC
ATGTACCTTACTCGAGAGCGGCGCCTAGAGATCAGCCGTAGCGTCCACCTCACGGACAGACAAGTGAA
AATCTGGTTTCAGAATCGCAGGATGAAACTGAAGAAAATGAACCGAGAAAACCGAATCCGGGAGCTCA
CAGCCAACTTTAATTTTTCC
AppendixII
A- 9 -
Hoxa10TSAA
ATGTCATGCTCGGAGAGCCCTGCCGCGAACTCCTTTTTGGTCGACTCGCTCATCAGCTCAGGCAGAGGC
GAGGCTGGTGGTGGTGGCGGTAGCGCGGGGGGCGGTGGAGGTGGCTACTACGCCCACGGTGGGGTC
TACCTGCCGCCTGCCAGCGACCTGCCCTACGGGCTGCAAAGCTGCGGGCTCTTCCCCGCGCTGGGCAG
CAAGCGTAATGAAGCGCCGTCGCCCGGAGGCGGTGGCGGTGGTGGCAGCGGGGGCCTGGGTCCTGG
GACGCATGGCTACGCGCCCGCGCCCCTAGACCTGTGGCTGGACGCGCCCCGCTCCTGCCGGATGGAGC
CGCCCGACGGGCCGCCGCCACCGCAGCCACAACCCCAGCAGCAGCAGCAGCAGCCGCCGCCGCCCCC
GCCGCAGCCACCTCAACCCCAGCCACAGGCCACTTCGTGTTCTTTTGCGCAGAACATCAAAGAAGAGAG
CTCCTACTGCCTCTACGATGCTGCGGACAAATGCCCCAAGGGCTCGGCCGCCGCTGATCTGGCCCCTTT
CCCGCGGGGCCCGCCGCCCGACGGCTGCGCCCTGGGCGCCTCCAGCGGAGTGCCAGTACCCGGCTACT
TCCGCCTGTCGCAGGCCTACGGCACGGCCAAGGGCTTCGGCAGTGGCGGCGGCGGCACGCAGCAGCT
CGCTAGTCCCTTTCCTGCGCAGCCCCCGGGGCGCGGTTTCGACCCGCCGCCCGCACTGGCCTCTGGCTC
GACCGAGGCAGCCGGGAAGGAGCGAGTCCTAGACTCCACGCCACCACCCACTCTGGTTTGCACCGGTG
GCGGCGGCTCGCAGGGCGACGAGGAGGCACACGCGTCATCCTCGGCGGCTGAGGAGCTGTCTCCAGC
CCCTTCAGAAAACAGTAAAGCTTCGCCGGAGAAGGACTCCCTGGGCAGTTCCAAAGGCGAAAATGCAG
CCAACTGGCTCGCAGCAAAGGCCGGCCGGAAGAAACGCTGCCCTTACACGAAGCACCAGACGCTGGA
GCTGGAGAAGGAGTTTCTATTCAACATGTACCTTACTCGAGAGCGGCGCCTAGAGATCAGCCGTAGCG
TCCACCTCACGGACAGACAAGTGAAAATCTGGTTTCAGAATCGCAGGATGAAACTGAAGAAAATGAAC
CGAGAAAACCGAATCCGGGAGCTCACAGCCAACTTTAATTTTTCC
Hoxb9
atgtccatttctgggacgcttagcagctattatgtcgactcgatcataagtcacgagagtgaggacgcgcctccagccaagtttccttctg
gccagtacgcgagctcgcggcagccgggccacgcggagcacctggagttcccctcgtgcagcttccagcccaaagcgccggtgttcgg
cgcctcctgggcgccgctgagcccgcacgcgtccgggagcctgccgtccgtctaccacccttacatccagccccagggcgtcccgccgg
ccgagagcaggtacctccgcacctggctggagccggcgccgcgcggcgaagcggccccggggcagggccaggcggcggtgaaggcg
gagccgctgctgggcgcgcctggggagctgctcaaacagggcacgcccgagtacagtttggaaacttcggcgggcagggaggccgtg
ctgtctaatcaaagacccggctacggggacaataaaatttgcgaaggaagcgaggacaaagagaggccggatcaaaccaacccctcc
gccaactggctgcacgctcgctcttcccggaaaaagcgctgtccctacaccaaataccagacgctggagctagagaaggagtttctgtt
caatatgtacctcaccagggaccgtaggcacgaagtggccagactcctcaatctgagtgagagacaagtcaaaatctggtttcagaac
cggcggatgaaaatgaagaaaatgaataaggagcagggcaaagag
Hoxb9Oct
atgtccatttctgggacgcttagcagctattatgtcgactcgatcataagtcacgagagtgaggacgcgcctccagccaagtttccttctg
gccagtacgcgagctcgcggcagccgggccacgcggagcacctggagttcccctcgtgcagcttccagcccaaagcgccggtgttcgg
cgcctcctgggcgccgctgagcccgcacgcgtccgggagcctgccgtccgtctaccacccttacatccagccccagggcgtcccgccgg
ccgagagcaggtacctccgcacctggctggagccggcgccgcgcggcgaagcggccccggggcagggccaggcggcggtgaaggcg
gagccgctgctgggcgcgcctggggagctgctcaaacagggcacgcccgagtacagtttggaaacttcggcgggcagggaggccgtg
ctgtctaatcaaagacccggctacggggacaataaaatttgcgaaggaagcgaggacaaagagaggccggatcaaaccaacccctcc
gccAACTGGCTCACAGCAAAGAGCGGCcggaaaaagcgctgtccctacaccaaataccagacgctggagctagagaagg
AppendixII
A- 10 -
agtttctgttcaatatgtacctcaccagggaccgtaggcacgaagtggccagactcctcaatctgagtgagagacaagtcaaaatctgg
tttcagaaccggcggatgaaaatgaagaaaatgaataaggagcagggcaaagag
Hoxa10b9
ATGCTCGGAGAGCCCTGCCGCGAACTCCTTTTTGGTCGACTCGCTCATCAGCTCAGGCAGAGGCGAGGCT
GGTGGTGGTGGCGGTAGCGCGGGGGGCGGTGGAGGTGGCTACTACGCCCACGGTGGGGTCTACCTGCCGC
CTGCCAGCGACCTGCCCTACGGGCTGCAAAGCTGCGGGCTCTTCCCCGCGCTGGGCAGCAAGCGTAATGA
AGCGCCGTCGCCCGGAGGCGGTGGCGGTGGTGGCAGCGGGGGCCTGGGTCCTGGGACGCATGGCTACGCG
CCCGCGCCCCTAGACCTGTGGCTGGACGCGCCCCGCTCCTGCCGGATGGAGCCGCCCGACGGGCCGCCGC
CACCGCAGCCACAACCCCAGCAGCAGCAGCAGCAGCCGCCGCCGCCCCCGCCGCAGCCACCTCAACCCCA
GCCACAGGCCACTTCGTGTTCTTTTGCGCAGAACATCAAAGAAGAGAGCTCCTACTGCCTCTACGATGCT
GCGGACAAATGCCCCAAGGGCTCGGCCGCCGCTGATCTGGCCCCTTTCCCGCGGGGCCCGCCGCCCGACG
GCTGCGCCCTGGGCGCCTCCAGCGGAGTGCCAGTACCCGGCTACTTCCGCCTGTCGCAGGCCTACGGCAC
GGCCAAGGGCTTCGGCAGTGGCGGCGGCGGCACGCAGCAGCTCGCTAGTCCCTTTCCTGCGCAGCCCCCG
GGGCGCGGTTTCGACCCGCCGCCCGCACTGGCCTCTGGCTCGACCGAGGCAGCCGGGAAGGAGCGAGTCC
TAGACTCCACGCCACCACCCACTCTGGTTTGCACCGGTGGCGGCGGCTCGCAGGGCGACGAGGAGGCACA
CGCGTCATCCTCGGCGGCTGAGGAGCTGTCTCCAGCCCCTTCAGAAAACAGTAAAGCTTCGCCGGAGAAG
GACTCCCTGGGCAGTTCCAAAGGCGAAAATGCAGCCAACTGGCTCACAGCAAAGAGCGGCCGGcggaaaa
agcgctgtccctacaccaaataccagacgctggagctagagaaggagtttctgttcaatatgtacctcac
cagggaccgtaggcacgaagtggccagactcctcaatctgagtgagagacaagtcaaaatctggtttcag
aaccggcggatgaaaatgaagaaaatgaataaggagcagggcaaagag