Publicaton of the International Union Against Cancer Publication de I'Union Internationale Contre le Cancer

Int. J. Cancer: 68,571 -576 (1996)

ANALYSIS FOR MICROSATELLITE INSTABILITY AND MUTATIONS OF THE DNA MISMATCH REPAIR GENE hMLHl IN FAMILIAL GASTRIC CANCER

+ I \ qg& 0 1996 Wiley-Liss, Inc.

Gisela KELLER1.4, Volker GKIMM', Holger VOGEISANG~, Petra BISCHOFF', James MUELLER~.?, Jorg Riidiger SIEWERT~ and Heinz H6FLER1.3 Departments of lPathology and 2Surgety, Technical University Munich, Ismaningerstr. 22 ,023675 Munich; and 31nstitute of Pathology, GSF-Forschungszentrum, Ingolstadter Landstr. 1, 0-85758 Oberschleissheim, Germany.

We examined 30 gastric-cancer patients with a varying degree of family history of stomach cancer and/or synchronous gastri: tumors for microsatellite instability. We observed micro- satellite instability at at least I of8 loci tested in tumors of 14/30 patients; of these 14, 8 had single locus alterations and 6 had alterations at at least half of the 8 loci. Among the patients with microsatellite instabilii at 24 loci, 3 patients showed a strong familial clustering of gastric cancer. Mutation analysis of the DNA mismatch repair gene hMLHl on paired non-tumorous and tumor DNA from I0 patients, 6 with microsatellite imtabil- ity at 2 4 loci and 4 with an alteration at one locus, revealed a novel missense mutation, present in the normal and tumor DNA of one patient with microsatellite instability at multiple loci in his tumor. H is family history of cancer included one second-degree relative affected with gastric cancer. These data suggest that germline mutations in the hMLHl gene occur in some gastric-cancer patients and that in the majority of cases microsatellite instability in gastric tumors may be due to defects in other genes responsible for DNA replication fidelity than the hMLH I . o 1996 Wiley-Lh, Inc.

A high rate of somatic mutations of short microsatellite sequences (microsatellite instability) is a characteristic feature of tumors from patients affected with the HNPCC or Lynch syndrome (Aaltonen et al., 1993; Liu et al., 1996). These alterations have also been found at a lower frequency and to a more varying degree in a wide variety of sporadic tumors (Eshleman and Markowitz, 1995) including carcinomas of the stomach (Chong et af., 1994; Dos Santos et af., 1996; Han et af., 1993; Keller et al., 1995; Peltomaki el al., 1993; Mironov et al., 1994; Rhyu ef al., 1994; Strickler et al., 1994). It has been shown that the majority of HNPCC is due to germline mutations in one of the mismatch repair genes hMSH2, hMLH1, hPMSl and hPMS2, among which mutations in the hMSH2 and hMLHl genes are the most frequent (Bronner et al., 1994; Fishel et a/., 1993; Han et al., 1995; Kolodner et al., 1995; Leach et al., 1993; Liu et al., 1996; Nicolaides et al., 1994; Papadopoulos et al., 1994). Somatic mutations of these genes have also been described in tumors of HNPCC patients (Leach et al., 1993; Nicolaides et al., 1994; Papadopoulos et al., 1994), in some sporadic colorectal and endometrial cancers and cell lines (Borresen et al., 1995; Katabuchi et al., 1995; Kobayashi eta/ . , 1996; Liu et al., 19956) and in 2 tumors from patients with multiple primary cancers (Sasaki et al., 1996).

In a previous study we identified microsatellite instability at multiple loci in 2 synchronous gastric tumors of a patient, who, in addition, had a strong family history of gastric cancer (Keller et al., 1995). Gastric carcinomas are part of the tumor spectrum of the Lynch syndrome and have been dcscribed mainly in earlier generations (Lynch et al., 1993; Warthin, 1913). These patients also have a tendency to develop synchro- nous or metachronous tumors. This suggests that the occur- rence of microsatellite instability in multiple gastric tumors and/or in tumors of patients with a familial clustering of gastric cancer may be due in some cases to an inherited mutation in a mismatch repair gene. In this study we extended our screening for microsatellite instability to a group of 30 patients with a positive family history of gastric cancer and/or with synchro-

nous gastric tumors (8 analyzed previously; Keller et al., 1995). Since information on the family history of cancer may be incomplete or limited by small family size or the early death of key relatives, we also included gastric-cancer patients with only one affected second-degree relative. To investigate whether somatic and/or germline mutations in mismatch repair genes may be involved in the pathogenesis of microsatellite unstable tumors in this group of patients, we analyzed paired normal and tumor DNA from a subset of these patients for mutations in the DNA mismatch repair gene hMLH1.

MATERIAL AND METHODS Patients and tumors

Information on family history was collected retrospectively or prospectively from 133 gastric-cancer patients, admitted to the Department of Surgery at the Technical University of Munich, using standardized written questionnaires. Of these 133 patients, 29 had a positive family history of gastric cancer and were examined for microsatellite instability. Tumors from 8 patients were included in a previous study (Keller et al., 1995). The patients examined were divided into the following groups on the basis of their family history: Group 1: 11 patients with at least 2 first- or second-degree relatives in one parental line, with gastric cancer. One of these patients had 2 synchro- nous gastric tumors; group 2: 10 patients with onc first-degree relative with gastric cancer; group 3: 8 patients with one second-degree relative with gastric cancer. One additional patient with an unknown family history had 3 synchronous tumors, 2 of the stomach and 1 of the colon, and was also included in the study.

The median age at diagnosis of the patients in group 1 was 63 years (range 53-71), in group 2,69 years (range 22-77) and in group 3, 68 years (range 46-72). The patient with the 3 synchronous tumors was 80 years old at the time of diagnosis.

Among the 32 gastric tumors of the 30 patients, 18 were of the intestinal, 6 of the diffuse and 8 of the mixed type according to the classification of LaurCn. All synchronous tumors were of the intestinal type.

DNA samples from the normal mucosa of 63 patients affected with gastric carcinoma, of 34 patients affected with colon carcinoma and of 10 patients affected with carcinomas of the esophagus were used as controls for SSCP analysis of exon 17 of the hMLHl gene.

4To whom correspondence and reprints requests should be ad- dressed, at the Laboratory for Molecular Pathology, Technical Unkersi Munich, Trogerstr. 32, D-81675 Munich, Germany. Fax: 089/4140/491?

Abbreviations: HNPCC, hereditary nonpolyposis colorectal cancer; SSCP, single-strand conformation polymorphism.

Received: June 28,1996 and in revised form August 23,1996.

572 KELLER ETAL.

Isolation of DNA For microsatellite analysis, non-tumorous and tumor DNA

samples from of 25 cases were isolated from microdissected, formalin-fixed, paraffin-embedded tissue sections as previously described (Keller et al., 1995). DNA from 5 cases was isolated from frozen-tissue sections by phenol/chloroform extraction. To minimize contamination of tumor cells with non-tumorous cells, only tumor areas composed predominantly of tumor cells were used for DNA isolation. DNA from blood was isolated by phenol/chloroform extraction.

Microsafellite ana(ysk Microsatellite analysis using 7 (CA)n dinucleotide repeats

(loci: D2S71, D3S1317, D5S107, D5S346, D17S520, D17S261, D18S34) and one (CAG)n trinucleotide repeat (located intra- genic in the TATA-box-binding protein gene on chromosome 6q27) was performed as previously described (Keller et al., 1995). The only exception was that 6 cases, not amplifiable at locus D2S71, wcrc analyzed at locus DZS123. Tumors were scored positivc for microsatellite instability when an clectropho- retic mobility shift of the PCR product was seen in the tumor DNA compared to the non-tumorous DNA, confirmed by a second PCR and electrophoretic run.

Mutation analysis of the hMLH 1 gene All 8 gastric tumors and the 1 colon tumor with microsatel-

lite instability at 2 4 loci of 6 patients, in comparison with the paired non-tumorous DNA, were analyzed for mutations in the entire coding region of the hMLHl gene. In order to determine whether mutations of the hMLHl gene may also be found in tumors cxhibiting a lower degree of microsatellite instability, we included 2 tumors from patients of group 1 and 2 tumors from patients of group 2 having a single locus alter- ation.

PCR primers for amplification of each exon included the intron/cxon boundaries with exception of the 5’ intron-exon junction of exon 12. Primers for exons 1-7, 9, 10 and 13-19 were selected according to Kolodner et al. (1995) and for exons 8 and 11 according to Han et al. (1995). Exon 12 was amplified in 2 overlapping fragments using the following primer pairs: 5’ TTAATACAGACTTTGCTACCAGG and 5’ GTTTGCT- CAGAGGCTGC (Kolodncr et al., 1995) for the 5’ prime half, and 5‘ TTCTGCAGCCTCTGAGCAAA and 5’ GGAGG- TAGGCTGTACTTTTC for the 3’ prime half. PCR running conditions for DNA from paraffin-embedded material were

modified by varying the reaction buffer and the number of cycles. PCR reactions were performed in 25 pI containing 2 pl of DNA preparation, 10 mM Tris-HCI, (pH 8.3, 8.6, 8.9, or 9.2), 50 mM KCI, 1 or 1.5 mM MgCI2, 0.01% (w/v) gelatin, 200 pM dNTP, 0.4 or 0.8 pM of each primer and 1.25 U Taq polymerase. For some fragments 10% glycerol or 5% polyeth- yleneglycol were added. After an initial denaturation step at 94°C for 4 min, 35 or 40 cycles were performed consisting of 30 sec at 94”C, 30 see at 5540°C and 30 sec at 72”C, followed by a final extension for 7 min at 72°C. The exact conditions used for each exon are available from the author on request. SSCP analysis

PCR products wcrc diluted 1:2 to 1:4 with 95% formamide, 10 mM NaOH. 0.05% xylene cyanol and 0.05% bromophenol blue, denatured at 95°C for 5 min and chilled on ice. Electro- phoresis of 5 FI denatured PCR product was performed for each exon under 3 different running conditions. We used horizontal 8% polyacrylamide gels (aerylamide/bisacrylamide, 29.59.5) containing 2% glycerine in a 20 mM MOPS (4- morpholinepropanesulfonic acid), 1 mM EDTA, pH 8.0, as running buffer at 15°C (TGGE system, Diagen, Dusseldorf, Germany). In addition, electrophoresis was performed in a discontinuous borate-phosphate-buffer system at 15”C, using 90 mM Tris/boratc, 2mM EDTA, pH 8.0, as running buffer and 8% polyacrylamide gels containing 2% glycerol prepared in a 90 mM Tris/phosphate buffer, pH 8.0, as described (Candidus et al., 1996). The third running condition consisted of electrophoresis at 25°C in 0.5 x MDE gels (Serw, Heidel- berg, Germany) using 54 mM Tris/borate, 1.2 mM EDTA, pH 8.0, as running buffer. Visualization of DNA was performed by silver staining. DNA sequence analysis

Aberrant PCR products as revealed by SSCP were purified by the Quiaquiek gel extraction kit (Quiagen, Hildcn, Ger- many) and directly sequenced by the dideoxy-nucleotide- termination method using a - ’%-dATP or by an ALF express system (Pharmacia, Freiburg, Germany) using dye primers , according to the manufacturer’s protocol.

RESULTS Microsatellite instability

Microsatellite instability at at least one locus was identified in tumors of 14/30 (47%) patients. Of these 14, 6 (20%)

N T N T N T N T NTlT2T3 NTlT2T3 N T N T

1 2

FIGCRE I - Examples of microsatellite instability. PCR products of paired non-tumorous (N) and tumor (T) DNA are shown. Microsatellite instability is characterized by the ap earance of additional bands in the tumor DNA: Lanes 1 + 2, patient 82 at locus D5S107 and at the TBPgenc on chromosome 6q27; Panes 3 + 4, patient 92 at loci D5S107 and D17S520; lanes 5 + 6, patient 100 at locus D5S107 and at the TBP ene on chromosome 6q27; T1, T2, synchronous gastric tumors, T3, colon carcinoma; lane 7, patient 83 at locus D18S34; lane 8, patient 81 at locus D5S107.

MICROSATELLITE INSTABILITY AND MUTATION ANALYSIS OF hMLHI 573

showed alterations at a t least half of the loci tested, while 8 (27%) exhibited only single locus alterations. All synchronous tumors of the stomach and the one such tumor of the colon exhibited microsatellite instability at multiple loci (Fig. 1).

Among the 6 patients with microsatellite instability at multiple loci, 3 were in group 1 (patients with at least 2 first- or second-degree relatives affected with gastric cancer). Two other patients belonged to group 3 (one second-degree relative affected with gastric cancer) (Fig. 2). One patient had an unknown family history and 3 synchronous tumors.

Among the 8 patients with single locus alterations, 2 were in group 1, 4 in group 2 (one first-degree relative affected with gastric cancer) and 2 in group 3. Mutation analysis of the hMLH 1 gene

Mutation analysis of the hMLH1 gene was performed on 13 tumors from 10 patients. These included 8 gastric tumors and the single colon carcinoma exhibiting microsatellite instability at multiple loci and 4 gastric tumors with a single locus alteration. One patient with microsatellite instability at mul- tiple loci in the tumor showed an aberrant SSCP pattern in exon 17 of the hMLHZ gene in the tumor and in the matched non-tumorous DNA (Fig. 3a). Sequencing of non-tumorous and tumor DNA revealed a T to C transition at codon 655,

B

A

leading to an amino-acid change from isoleucine to threonine (Fig. 3b). The same aberrant SSCP pattern and sequencing result was also found in genomic DNA isolated from the blood of this patient. In an SSCP analysis of 214 chromosomes we did not observe an altered pattern in this exon.

The patient with the hMLH1 mutation was 71 years old at the time of diagnosis and had one second-degree relative with stomach carcinoma in a relatively small kindred (Fig. 2).

Aberrant SSCP patterns, present in the paired non- tumorous and tumor DNA, were also identified by analysis of exons 8 and 15 which were shown by sequencing analysis to be due to known polymorphisms (Liu et al., 19956 ; Papadopoulos et al., 1994).

DISCUSSION

The hMLHZ gene is one of the mismatch repair genes in which gcrmline mutations in HNPCC families are most fre- quently found (Han el al., 1995; Liu et al., 1996; Wijnen et al., 1996). Mutation analysis of the hMLHZ gene of 10 gastric- cancer patients in our study revealed a missense mutation in exon 17 in a gastric-cancer patient with microsatellite instabil- ity at multiple loci in his tumor. This mutation was present in

50 66 71 %a 6B ZB

sto sto sto StO sto

C

I

RCURE 2 - Pedi rees of 3 families with microsatellite instability at multiple loci in the tumor of the index patients. Symbols: 0, a, males; 0 0, femafes, 0, male or female; individuals with a diagonal are deceased. 0, 0, no neoplasm, and a, 0 carcinoma of the stomach (Sto), skin (Sk) or endometrium (En); * no clinical information available. Numbers beside the symbols indicate age at death (underlined) or age at diagnosis (not underlined). Arrow; analyzed patient. (a) family 77; (b) family 82; (c) family 92; a missense mutation in exon 17 of the hMLIIl gene was identified in the normal and tumor DNA of the analyzed patient. The mother and the sister of the patient both died at a relatively young age (51 and 50 years) with no evidence of carcinoma.

574 KELLER ETAL.

FIGURE 3 - Mutation anal sis of exon 17 of the hMLHZ gene. (a) SSCP gel showing an aberrant migration pattern in the non-tumorous and tumor DNA (arrow). (i) Sequence analysis. PCR products of genomic DNA were used as templates for direct sequencing. The wild-type sequence is shown in comparison with non-tumorous and tumor DNA. Lines indicate a T to C transition at codon 655 present in both the non-tumorous and tumor DNA of the patient.

the heterozygous state in both the normal and the tumor DNA, indicating a germline mutation. The majority of mutations in the hMLHI gene identified so far have been shown to result in a truncated protein, but some missensc mutations have also been reported (Bronner et al., 1994; Han et al., 1995; Kolodner et al., 1995; Liu et al., 1996; Papadopoulos et al., 1994; Tannergard et al., 1995; Wijnen el al., 1996). The mutation identified in this study, lcading to a change from isolcucinc to threonine at codon 655 has, to our knowledge, not yet bccn reported. Although it rcsults in a change from an apolar to a polar aminoacid, this position is not phylogenctically strongly conserved in all known mutL homologucs, making an assess- ment of its functional significance difficult. No material from the patient’s uncle was available to test for a possible relation of the mutation with the disease in this family. The analysis of 214 chromosomes, which showed a normal SSCP pattern in this exon, indicates that it does not represent a common polymorphism, but does not exclude the possibility that it may represent a very rare DNA variant unrelated to the disease. Nevertheless, it is tempting to speculate that this gastric-

cancer patient with microsatellite instability at multiple loci in his tumor is in fact a Lynch syndrome patient, who would not have been classified as such on the basis of clinical observation and pedigree analysis.

Our failure to identify further mutations may have the following explanations; (1) SSCP mutation analysis docs not identify all types of mutations, for example large deletions or insertions; (2) there may bc mutations in regulatory DNA sequences which were not analyzed; (3) the hMLHZ gene is only one of the known mismatch repair genes, of which mutations can lead to microsatcllite instability. There may also be defects in the hMSH2, hPMSI or hPMS2 genes, or in GTBP, a recently identified gene, which also participates in mismatch repair (Drummond et al., 1995; Palombo et al., 1995; Papado- poulos et al., 1995), or in other, as yet identified genes involved in the complex pathway which maintains DNA replication fidelity. Mutation analysis of sporadic coloreetal and endome- trial cancer and cell lines and of tumors from patients with multiple primary cancers has also revealed that mutations in

MICROSATELLITE INSTABILITY AND MUTATION ANALYSIS OF hMLHl 5 75

the hMLHZ gene in microsatellite unstable tumors are rare (Katabuchi et al., 1995; Kobayashi et al., 1996; Liu et al., 1995; Sasaki et al., 1996).

In the group of patients with a positive family history of gastric cancer or with synchronous gastric tumors, we observed microsatellite instability in the tumors of 14/30 (47%) patients. This incidence is substantially higher than the 24% found in our previous study in which we analyzed a randomly chosen group of gastric-cancer patients with nearly the same panel of microsatellite markers (Keller et al., 1995). This may suggest the presence of an inherited factor affecting correct DNA replication in a subset of these patients.

Among our tumors with microsatellite instability, we ob- served a considerable variation in the rate of altered loci. Microsatellite instability at at least half of the tested loci was observed in tumors of 6 patients, 3 of them with a strong family history of gastric carcinoma. Such a high degree of microsatel- lite instability is extremely common in tumors from HNPCC patients (Aaltonen et al., 1993; Liu et al., 1996). Gastric carcinomas have been reported to occur more frequently in HNPCC or Lynch syndrome families than in the normal population (Lynch et al., 1993). Thus, our observation of microsatellite instability at multiple loci in the tumors of 3 patients with a strong family history of gastric cancer is suggestive of an inherited mutation in a mismatch repair gene, other than the hMLHZ gene, and indicates that the families of these patients may represent variants of the Lynch syndrome with preferential development of stomach carcinomas. The finding of microsatellite instability in the synchronous tumors of 2 patients may also be indicative of a germline mutation in a mismatch repair gene, although one of these patients was already 80 years old at the time of diagnosis. While, in general, HNPCC patients are characterized by a young age at onset, considerable variation in the age of onset and the expression of the disease has also been observed (Lynch et al.. 1993). Interestingly, germline mutations identified in the hMSH2 gene in some young patients with colorectal cancer did not

correlate with cancer in one of their parents (Liu etal., 1995a), leading to speculation about the interaction of modifying genes and/or environmental factors, which may also influence the organ-specificity of tumor development.

Microsatellite instability at a single locus was found in tumors of 8 patients. Such a low degree of microsatellite instability has been observed in a wide variety of tumors (Eshleman and Markowitz, 1995). Recently it has been shown that in some colorectal cancer cell lines a low rate of alter- ations, mainly when analyzing dinucleotide repeats, was associ- ated with a defect in the GTBP-gene (Papadopoulos el al., 1995). Studies of yeast mutants have also revealed that defects in specific genes involved in DNA replication fidelity result in varying degrees of microsatellite instability (Marsischky et al., 1996; Strand et al., 1993). The significance of this type of microsatellite instability in the pathogenesis of stomach carci- noma and its underlying genetic mechanism remains to be examined. In this context it is of interest that a low degree of microsatellite instability in lung cancer has been correlated with the occurrence of rare HRASZ alleles, a heritable genetic factor (Ryberget al., 1995).

In summary, our results suggest that microsatellite instabil- ity in the tumors of gastric cancer patients and a clustering of stomach carcinoma in their families may be indicative of a germline mutation in a mismatch repair gene in these gastric- cancer families. Furthermore, the identification of a mutation in the hMLHZ gene, also present in the normal DNA of one patient, indicates that germline mutations in this gene may be involved in tumor development in some gastric-cancer pa- tients. Our findings also suggest that microsatellite instability in the majority of cases of stomach carcinoma may be due to defects in mismatch repair genes other than the hMLH1.

ACKNOWLEDGEMENT

This work was supported by the Deutsche Krebshilfe grant 10-0945-HO I.

REFERENCES

AALTONEN, L.A. and 13 OTHERS, Clues to the pathogenesis of familial colorectal cancer. Science (Wash.), 260,812-816 (1993). BORRESEN, A., LOTHE, A., MELING, G., LYSTAD, S., MORRISON, P., LIPFORD, J., KANE, M., ROGNUM, T. and KOLODNER, R., Somatic mutations in the hMSH2 gene in microsatellite unstable colorcctal carcinomas. Ifum. mol. Genet., 4,2065-2072 (1995). BRONNER, C.E. and 17 OTHERS., Mutation in the DNA mismatch repair gene homologue IiMLHI is associated with hereditary non- polyposis colon cancer. Nature (Lond.), 368,258-261 (1994). CANDIDUS, S., BISCHOFF, P., BECKCR, K. and HOFLER, H., No evidence for mutations in the a- and @-catenin genes in human gastric and breast carcinomas. Cancer Res., 56,49-52 (1996). CHONG, J.-M., FUKAYAMA, M., HAYASHI, Y., TAKIZAWA, T., K o i w M.. KONISHI. M.. KIKUCHI-YANOSHITA. R.AND MIYAKI, M.. Microsatel- lite instability in'the progression of gastric carcinoma. Cancer Res., 54, 4595-4597 (1994). DOS SkW"I'S, N.R., SERUCA, R., CONSTANCIA. M., SEIXAS, M. and SOBRINHO-SIMOES, M., Microsatellite instability at multiple loci in gastric carcinoma: clinicopathologic implications and prognosis. Gas- troenterology, 110,3844 (1996). DRUMMOND, J., LI, G., LONGLEY, M. and MODRICH, P., Isolation of an hMSH2-pl60 heterodimer that restores DNA mismatch repair to tumor cells. Science (Wash.), 268,1909-1912 (1995). ESHLEMAN, J. and MARKOWITZ, S., Microsatellite instability in inher- ited and sporadic neoplasms. Cum. Opin. Oncol., 7 ,8349 (1995). FISHEL, R., LESCOE, M.K., RAO. M.R.S., COPELASD, N.G., JENKINS, N.A., GARBER, J., KANE, M. and KOLODSER, R., The human mutator gene homolog MSH2 and its association with hereditary nonpolyposis colon cancer. Cell, 75, 1027-1038 (1993). f I m , H.-J., MARUYAMA, M., BABA, S., PAR, J. and NAKAMURA. Y.,

Genomic structure of human mismatch repair gene, hMLHI, and its mutation anal sis in patients with hereditary nonpolyposis colorectal cancer (HNPZC). Hum. mol. Gener., 4,237-242 (1995). HAN, H.-J., YANAGISAWA, A., KATO, Y., PARK, J.-G. and NAKAMURA, Y., Genetic instability in pancreatic and poorly differentiated type of gastric cancer. Cancer Res., 53,5087-5089 (1993).

M., LEACH, S., CHO, K. and HEDRICK, L., Mutations in DNA mismatch repair genes are not responsible for microsatellite instability in most sporadic endometrial carcinomas. Cancer Rex, 55,5556-5560 (1995).

MUELLER, J., BRAUCH, H., SIEWERT, J. and HOFI.EK, H., Microsatellite instability in adenocarcinomas of the upper gastrointestinal tract. Relaction to clinicopathological data and family history. Amer. 1. farhol., 147,593-600 (1995). KOBAYASHI, K., MATSUSHIMA, M., Koi, S., SAITO, H., SAGAB, S., KUDO, R. and NAKAMURA, Y.. Mutational analysis of mismatch repair genes hMI.HI and hMSH2 in s radic endometrial carcinomas with microsat- ellite instability. Jap. J. Encer Res., 87, 141-145 (1996). KOLODNER, R., IIALL, N., LIPFORD, J., KANI:, M., MORRISON, P.,

BISHOP, D., Structure of the human MLHZ locus and analysis of a large hereditary nonpolyposis colorectal carcinoma kindred for mlhl muta- tions. Cancer Res., 55,242-248 (1995). LEACH, F.S. and 34 OIHERS, Mutations of a mutS homolog in hereditary nonpolyposis colorectal cancer. Cell, 75,1215-1225 (1993). Liu, B. and 1 1 OTHERS, Genetic instability occurs in the majority of young patients with colorectal cancer. Narure Med., 4,348-352 (199%). LIU, B. and 1 1 OTHERS, Mismatch repair gene defects in sporadic colorectal cancers with microsatellite instability. Nature Genet., 9,

KATABUCHI, H., VAN REES, B., LAMBERS, A,, RONNEW, B., BLAZES,

KEI.I.ER, G., ROTTER, M., VOGELSANG, H., BISCHOFF, P., BECKER, K.,

FINAN, P., B ~ J R N , J., CHAPMAN, P., EARABINO, C., MERCHANT, E. and

48-55 (19956).

576 KELLER ICTAI.

LIU. B. and 13 OrHERs, Analysis of mismatch repair genes in hereditary non-polyposis colorectal cancer patients. Narure Med., 2, 169-174 (1996). LYNCH, H., SMYRK, T., WATSON, P., LANSPA, S.. LYNCH, J., LYNCH. P., CAVALIERI, J. and BOLAND. R., Genetics. natural history, tumor spectrum, and pathology of hereditary nonpolyposis colorectal cancer: an updated review. Gastroenterology, 104, 1535-1549 (1993). MARSISCIIKY, G.T., FILOSI. N., KASE. M.F. and KOLODS~R, R., Redundancy of Saccharomyces cerevisiae MSH3 and MSH6 in MSH2- depcndent mismatch repair. Genes Devel., 10,407420 (1996).

GORHUNOV, O.V., KLIMENKOV, A.A. and YAMASAKI, H., Alterations of (CA), DNA repeats and tumor suppressor genes in human gastric cancer. Cancer Res., 5 4 , 4 1 4 4 (1994). NICOLAIDES, N.C. and 17 OTHERS, Mutations of two PMS homologs in hereditary nonpolyposis colon cancer. Nature (Lond.), 371, 75-80 (1994). PALOMBO, F., GALI.INAR1, P., IACCARINO, I., LETIJERI, T.. IIUGHES, M., DARRIGO, A., TRLOSG, O., HSUAN, J. and JIRINCY. J., GTBP, a 160-kilodalton protein essential for mismatch-binding activity in hu- man cells. Science (Wash.), 268, 1912-1914 (1995). PAPADOPOULOS, N. and 1 1 OTHERS, Mutations of GTBP in genetically unstable cells. Science (Wash.), 268, 1915-1917 (1995). PAPADOPOULOS. N. and 19 OTHERS, Mutation of a mutL homolog in hereditary colon cancer. Science (Wash.), 263,1625-1629 (1994). PEL'IOMAKI, P. and 12 OTHIRS, Microsatellite instability is associated with tumors that characterize the hereditary non-poly sis colorectal carcinoma syndrome. Cancer Res., 53,5853-5855 ( 1 9 9 3 r

MIRONOV, M.M., AGUELON, M.A.-M., POIAPOVA, G.I., OMORI, Y.,

RHYU, M.-G., PARK, W-S., and MELTZER, S.J., Microsatellite instabil- ity occurs frequently in human gastric carcinoma. Oncogene, 9, 29-32 ( 1 994).

RYBERG, D., LINDSTEDT, B., ZIESOLDDINY, S. and HAUGEN, A,. A hereditary genetic marker closely associated with microsatellite insta- bility in lung cancer. Cancer Res., 55,3996-3999 (1995).

Muro, T. and NAKAMURA, Y., Somatic mutations of a human mismatch repair ene, hMLHI, in tumors from patients with multiple primary cancers. hum. Mut., 7,275-278 (1996).

STKAKD, M., PROLIA, T.. LISKAY, R. and PETES, T., Destabilization of tracts of simple re etitive DNA in yeast by mutations affecting DNA mismatch repair. suture (Lord.), 365,274-276 (1993).

and SHIBATA, D., p53 mutations and microsatellite instability in sporadic gastric cancer: when guardians fail. Cancer Res., 54, 4750- 4755 (1994).

TANNERGARI), P., LIPFORD, J.R., KOLODNER, R., FRODIK, J.E., NORDENSKJ~LD, M. and LISDHLOM, A,, Mutation screening in the hMLHI gene in Swedish heredita nonpolyposis colon cancer fami- lies. Cuncer Res.. 55,60924096 (19%).

SASAKI, s., HORII, A.. SHIMADA. M., HYE-JUNG, H.. YANAGISAWA, A.,

STRICKLER, J.G., ZHENG, J . , S H U , Q., BL'RGART, L.J., ALBERTS, S.R.

WARTHIS, A., Heredity with reference to carcinoma. Arch. intern. Med., 12,546-555 (1913).

WIJNEN, J. and 18 OTHERS, Majority ofhMLHl mutations responsible for hereditary nonpolyposis colorectal cancer cluster at the exonic region 15-16, Amer. J. hum. Genet., 58,30&307 (1996).