An in vitro model for studying gene expression in ...1368359/FULLTEXT01.pdf · hatching. However, they are of suitable size for high throughput screening (Clayton & Duncan 1978, Storey

An in vitro model for studying gene

expression in Parascaris univalens larvae

Sofia Jonsson

__________________________________________ Master Degree Project in Infection Biology, 45 credits. Spring 2019

Department: Biomedical Sciences and Veterinary Public Health, SLU

Supervisors: Eva Tydén and Magnus Åbrink

UPPSALA UNIVERSITET S. Jonsson Master thesis 2 (16)

Abstract

Parascaris univalens, equine roundworm, is a large nematode infecting young horses and causes

respiratory syndromes, impaired condition and reduced growth. Adults can reach up to 50 cm in length

and heavy infection can lead to obstruction and rupture of the small intestines due to the worm’s size.

Emerging resistance against all substances available for treatment is threatening animal welfare.

Research in the area is troubled by the limited accessibility, size and poor in vitro survival of adult

worms. To increase understanding of genes involved in resistance, this study focused on genes involved

in drug metabolism and had three aims: i) Develop an in vitro model for P. univalens L3 larvae, ii)

compare gene expression between larvae and adult, and iii) investigate how drug exposure affects gene

expression in larvae. Larvae was hatched from eggs collected from faecal samples, cultured and exposed

to ivermectin. The expression of orthologous genes of Caenorhabditis elegans CYP-14A2, GST-20 and

SKN-1, Haemonchus contortus UGT and Ixodes scapularis putative ABC-transporter was compared

between unexposed larvae and an adult worm through qPCR. CYP-14A2, GST-20, SKN-1 and the

putative ABC-transporter were further investigated through qPCR in larvae exposed to 10−15 M or 10−7

M ivermectin. The model was functional, with a hatching ratio of 50% and 85% larval survival after 13

days culture in RPMI medium. Differential gene expression between larvae and adult was detected for

CYP-14A2, ABC-transporter, UGT and GST-20 orthologs. Trends of down regulation in ivermectin-

exposed larvae were detected for the ABC-transporter and CYP-14A2 orthologs.

Key words Parascaris univalens, equine roundworm, Parascaris, Parascaris univalens larvae, anthelmintic

resistance, drug metabolism, gene expression, in vitro model, ivermectin.

1. Introduction

1.1. Parascaris spp. infection and pathogenesis

Parascaris spp., equine roundworms, are parasitic nematodes infecting young horses. Infection develops

when the horse ingest eggs containing embryonated larva, stage L3, which hatches in the small intestine

and migrate through the liver to the lungs. From the lungs, the parasite is coughed up and returns to the

small intestines via tracheo-oesophagal migration. The migration is completed in approximately three

weeks. The worm matures during migration, molting to stage L4 and St5 before reaching adult stage, a

process of at least 7 weeks before becoming a reproducing adult in the small intestine. Adult worms have

an average size of 30 cm, but can reach a length of up to 50 cm. Females can shed hundreds of thousands

of eggs per day. The eggs have extensive survival in stables, paddocks and pastures, causing

environmental contamination and re-infection (Clayton & Duncan 1978, ESCCAP 2019). Infection

causes respiratory symtoms such as coughing and nasal discharge, affects general condition through

depression, weight loss, emaciation and lethargy and leads to reduced growth. Intestinal obstruction due

to heavy infection has been observed and can cause intestinal rupture and death. Horses develop natural

immunity to the infection around one year of age (Clayton & Duncan 1977).

1.2. Parascaris univalens or equorum?

P. univalens and P. equorum appears to have similar biology and pathogenesis and cannot be

distinguished morphologically (ESCCAP 2019). Equine roundworm infections have commonly been

referred to as caused by Parascaris equorum, but without verification of the specie. However, recent


studies have showed that Parascaris univalens is the most common cause of infection in the US,

Switzerland and Sweden (Jabbar et al. 2014, Nielsen et al. 2014, Martin et al. 2018). To determine the

specie cytological analysis of chromosomes is necessary. P. univalens has one pair of chromosomes

while P. equorum have two, making it possible to distinguish the species from each other (Goday &

Pimpinelli 1986).

1.3. Diagnosis and treatment

For clinical diagnosis of the infection direct detection of eggs, or even worms, in the faeces is used. To

detect eggs, a coproscopic analysis is necessary using either a quantitative or qualitative flotation method

(ESCCAP 2019). Upon positive diagnosing, treatment of Parascaris spp. infection is always

recommended. Routine deworming is recommended for foals at 8-10 and 16-18 weeks of age (SVA

2018). The anthelmintics used for Parascaris spp. treatment consists of three different groups;

macrocyclic lactones (ML), pyrantel (PYR) and benzimidazoles (BZ). Substances belonging to the

groups have broad-spectrum activity. ML are endectocides and are active against both nematodes and

arthropods (Elsheikha & Khan 2011)

1.5. Resistance

For clinical test of anthelmintic resistance, the only established method is the faecal egg count reduction

test (FECRT). The test estimates anthelmintic efficacy through comparison of faecal egg count before

and 14 days after treatment. An efficacy below 95% for ML, 90% for BZ and 85% for PYR is regarded

to be indicative for resistance (Coles et al. 1992, Nielsen et al. 2016). A reduced egg reappearance

period, were the interval between deworming and reappearance of eggs in faeces is shorter than

expected, is also considered to be indicative of reduced anthelmintic efficacy (ESCCAP 2019). Reports

of anthelmintic resistance in Parascaris spp. can be found for ML, PYR, and BZ (Peregrine et al. 2014,

Nielsen et al. 2016). With emerging resistance for all groups used for Parascaris spp. treatment (Nielsen

et al. 2016), and no new anthelmintics intended for equine use available in a foreseeable future, the

situation is increasingly alarming (Kaplan & Nielsen 2010).

1.6. Ivermectin

For this study ivermectin (IVM), a substance in the macrocyclic lactone (ML) group, was used. IVM is,

apart from veterinary medicine use, also used for treatment of onchocerciasis and lymphatic filariasis in

humans (Prichard et al. 2012). IVM selectively acts on glutamate-gated chloride channels (GluCl), which

are only found in invertebrates but are closely related to mammalian glycine receptors. It causes an

excessive chloride ion influx leading to hyperpolarisation, resulting in paralysis of the worm and cease of

pharyngeal pumping (Wolstenholme 2012, Köhler 2001). Ivermectin also exerts effect on Gamma-

aminobutyric acid-gated chloride channels, but this requires higher concentrations compared to GluCl

and appears to be a secondary target (Prichard et al. 2012). Reports of IVM resistant Parascaris spp.

include Europe, North and South America, Australia and Asia (Martin et al. 2018, Peregrine et al. 2014,

Craig et al. 2007, Molento et al. 2008, Armstrong et al. 2014, Shah et al. 2016). The mechanisms of IVM

resistance appear complex and are not fully understood. Structural changes of the GluCl through

mutations of the three α-type subunit genes avr-14, avr-15 and glc-1 lead to high-level IVM resistance in

Caenorhabditis elegans. Simultaneous mutation of all three genes appears necessary for high-level

resistance, since they each independently cause IVM sensitivity through parallel genetic pathways.

Mutation of any two of the three genes resulted in modest or even no resistance at all (Dent et al. 2000).

Apart from mutations of IVM target GluCl, alterations in permeability of the worm cuticula could affect

sensitivity. The Dyf (dye filling defective gene) gene osm-1 mutation had an additive effect to IVM

resistance in C. elegans, tentatively due to reduced drug uptake through the cuticula (Dent et al. 2000).


Drug metabolism also contributes to increased IVM tolerance. The drug metabolising process is a

detoxifying system protecting organisms from xenobiotic substances, i.e. a drug, through enzymatic

metabolism and alterations. The process is divided into phase I and phase II. Phase I reactions are

catabolic and includes oxidation, hydrolysis or reduction of the drug, often resulting in a reactive

compound. Many of the enzymes involved in phase I belongs to the cytochrome P450 family. Phase II

reactions are instead synthetic and conjugates the drug metabolite from phase I with an endogenous

compound, resulting in an inactive product (Ritter et al. 2019). Glutathione S-transferase (GST) and

UDP-glycosyltransferase (UGT) are a major part of phase II reactions. The cell can also avoid

xenobiotics through direct efflux using membrane efflux transporters. ABC-transporters, such as P-

glycoproteins, belong to this category (Matušková et al. 2016).

In a drug selection pressure study, C. elegans strains tolerant of high IVM concentrations overexpressed

several ABC transporters, phase I cytochrome P450 and phase II detoxification enzymes compared to

sensitive strains (Ménez et al. 2016). In Parascaris, Peq-pgp-11, a P-glycoprotein belonging to the ATP-

binding cassette transporter family and expressed in the intestines of the worm (Chelladurai & Brewer

2019), is associated with increased IVM tolerance. Three single nucleotide polymorphisms (SNPs)

resulting in missense mutations in Peq-pgp-11 correlates to reduced IVM susceptibility. In adult

Parascaris this was observed together with an overexpression of the gene (Janssen et al. 2013).

Transgenic C. elegans expressing Peq-pgp-11 had an increased IVM tolerance (Janssen et al. 2015). P-

glycoproteins have also been associated with resistance to ML in other species of nematode parasites,

such as Cylicocylus elongatus, a cyathostominae (Kaschny et al. 2015, Peachey et al. 2017). In

Haemonchus contortus, IVM inhibited the effect of Hco-pgp-16, suggesting that resistance could be

associated with mutations of the protein to overcome the inhibition (Godoy et al. 2015).

1.7. Lack of in vitro models

One of the reasons for that the complete picture of resistance mechanisms in Parascaris has not been

fully elucidated is the lack of functional in vitro models. The parasite does not have a free-living stage

except for the shed eggs (Clayton & Duncan 1978) and today there are no in vitro models in which it is

possible to monitor the whole life cycle and reproduction of the parasite. The remaining options are to

study the parasite in its different life stages or to use a model organism such as C. elegans. Using a model

organism limits the number of genes that can be investigated and is not suitable for screening of genes

involved in resistance, although it can be very useful for confirmation and further studies (Janssen et al.

2015). There are other difficulties when instead using Parascaris. Adult worms are very large, up to 50

cm long (ESCCAP 2019). Computerized screening systems, making high throughput screening possible,

are not adapted to worms this size (Marcellino et al. 2012). Adding to the inconvenience, adult worms

quickly decay and have a short life span in vitro. After 24 hours, or even faster in a suboptimal culture

medium, the worm viability quickly drops (Scare et al. 2018). This causes difficulties differing drug

exposure effects from reduced viability effects in vitro. For Parascaris L3 larva, there are very few

examples of the life stage being used as model. This might be due to the anecdotal difficulty of larval

hatching. However, they are of suitable size for high throughput screening (Clayton & Duncan 1978,

Storey et al. 2014) and appear to have sufficient longevity when cultured (Burk et al. 2014). L3 larvae

have previously been used for studying excretory-secretory products (Burk et al. 2014), but there are no

studies investigating gene expression.


1.8. Aims of the study

To increase understanding of genes involved in resistance, this study focused on genes involved in drug

metabolism and had three aims: i) Develop an in vitro model for P. univalens L3 larvae, ii) compare gene

expression between larvae and adult, and iii) investigate how drug exposure affects gene expression in

larvae.

2. Materials and Methods

2.1. Gathering of material

Faecal samples, containing Parascaris univalens eggs, was collected from naturally infected foals at a

Swedish farm with known ivermectin resistance. Samples mixed with tap water was sieved, strained

through a 1,4 mm aperture sieve followed by a 150 µm aperture sieve. Eggs where then collected in a 80

µm aperture sieve. After collection, eggs were washed three times with 2% sodium hypochlorite in

16,5% sodium chloride for cleaning and decortication, followed by a six times repeated wash in cold tap

water. For development of larvae, washed eggs were incubated in 25°C for 10 days. Hatching was then

introduced according to a protocol for hatching of Toxocara canis (Ponce-Macotela et al. 2011),

modified through addition of three strokes in a glass homogeniser.

An adult female worm was collected from the small intestine from a horse at approximately 10 months of

age at a slaughterhouse in Iceland on October 2018.

2.2. Larval culturing and ivermectin exposure

2.2.1. Survival study

Larvae was cultured in two different media, one group in RPMI Medium 1640 + GlutaMAX™-I

(Gibco®, USA) containing 10% fetal bovine serum (Life technologies), 1% Penicillin and Streptomycin

(Life technologies) and 1% L-glutamine (Life technologies) (abbreviation RPMI). The other group was

cultured in NCTC-135 (Gibco®, USA) with L-glutamine and NaHCO, and yeast extract 2.25 g/L

(Oxoid, UK), neutralised bacteriological peptone 2.813 g/L (Oxoid, UK) and bactodextrose 2.813 g/L

(Difco, USA) containing 49% fetal bovine serum (Life technologies) and 2% Antibiotic Antimycotic

Solution (Sigma, Germany) (abbreviation NCTC). Both groups were cultured in 37°C with 5% CO2 in

cell culture flasks. To remove debris and unhatched eggs, larvae were centrifuged in Ficoll-

Paque™PLUS (GE Healthcare, USA) 24 h. after hatching. 2 ml Ficoll was added to 4 ml culture media

before centrifugation for 30 min at 1800 rpm followed by removal of the supernatant. Larvae was then

washed in phosphate-buffered saline without Ca and Mg (SVA, Sweden) and centrifuged for 5 min at

1200 rpm. The supernatant was removed and larvae resuspended in 37°C culture media. After hatching,

larvae were cultured in NCTC for 3 days and then split into two groups. One group was then cultured in

RPMI and the other in NCTC, at 37°C with 5% CO2, for a total of 13 days. Estimation of survival and

medium change was performed every 2nd to 3rd day.

2.2.2. Unexposed larvae and adult

After hatching, larvae were cultured in RPMI (medium described under “Survival study”) in 37°C with

5% CO2. Ficoll-centrifugation (described under “Survival study”) was performed after 24 h. 48 h after

hatching, larvae was collected. The culture medium was removed after centrifugation for 8 min at 800xg,


and larvae were resuspended in Lysis Buffer RA1 from NucleoSpin RNA XS column kit (Macherey-

Nagel, Germany), frozen and stored in -70°C. The adult worm was cultured in same condition as larvae,

and was collected after 24 h. After removal of culture medium and resuspension in RNAlater (Ambion,

USA) it was frozen and stored in -70°C.

2.2.3. Ivermectin exposed larvae

Ivermectin (Sigma, Germany) was suspended in dimethyl sulfoxide (DMSO), which was then added to

RPMI medium (described under “Survival study”) to achieve the desired exposure concentrations of

10−7M and 10−15M respectively. The concentrations are based on previously used ivermectin exposure

(Janssen et al. 2013). The highest concentration was increased and a lower concentration was included to

enable detection of differences between the exposure levels. For the control medium, only DMSO was

added. Total concentration of DMSO in medium was 0.1% for all samples, both exposed and controls.

Larvae was hatched and cultured for 24 h in RPMI, 37°C with 5% CO2, after hatching. After 24 h,

culture medium was removed, Ficoll-centrifugation (described under “Survival study”) was performed,

and larvae was resuspended in exposure medium with a total IVM concentration of either 10−7 M or

10−15 M, or control medium containing DMSO. For all exposure levels and control three groups (n=3),

each consisting of approx. 200 larvae, were used. After resuspension in exposure or control medium,

larva was cultured in 37°C with 5% CO2 for 24 h. After 24 h estimation of survival was performed.

Culture medium was removed after centrifugation for 8 min at 800xg, and larvae were resuspended in

Lysis Buffer RA1 from NucleoSpin RNA XS column kit (Macherey-Nagel, Germany), frozen and stored

in -70°C.

2.3. RNA extraction and cDNA synthesis

Total RNA from unexposed and IVM exposed larvae was extracted and cleaned from contaminating

DNA using NucleoSpin® RNA XS kit (Macherey-Nagel, Germany). Total RNA from the anterior end of

the adult, eggs and embryonated larvae was extracted and cleaned from contaminating DNA using

NucleoSpin® RNA Plus kit(Macherey-Nagel, Germany) and DNase I (Invitrogen, USA). cDNA

synthesis from adult, egg and larval RNA was preformed using the Superscript III kit (Invitrogen, USA).

RNA quantification of the samples was performed according to the Quant-iT RiboGreen protocol

(Invitrogen, USA) using a Wallac VICTOR2™ 1420 Multilable counter (PerkinElmer, USA)

2.4. Polymerase chain reaction (PCR) and product verification

PCR primers were designed to amplify specific PCR products from P. univalens genes orthologous of

genes involved in drug metabolism in other parasites (see Table 1 and 2). All primer pairs spanned over

an intron, making contaminating genomic DNA detectable through PCR product size. PCR was

performed according to the AccuStart Genotyping ToughMix® (Quantabio, USA) kit protocol using a

MyCycler Thermal Cycler (BioRad, USA). Pooled cDNA from adult worm, eggs and embryonated

larvae was used as template. Amplification for all samples was performed under following conditions:

95°C for 5 min, 10 cycles of 95°C for 30 s., 60°C with a decrease of 1°C every cycle for 30 s. and 72°C

for 1 min, followed by 25 cycles of 95°C for 30 s., 50°C for 30 s. and 72°C for 1 min, followed by 72°C

for 5 min.

The PCR product size was verified through electrophoresis using a 1,2 % agarose gel at 125 V. PCR

products amplified at desired sized was sequenced through Sanger sequencing at Macrogen Europe.

Obtained sequences was aligned against the previously published P. univalens genome (GenBank

NINM00000000.1) using NCBI BLAST® to verify desired amplification.


2.5. Reverse transcription quantitative polymerase chain reaction (qPCR)

qPCR primers were designed to amplify specific qPCR products within the sequence obtained from PCR

product sequencing (see table 2). The qPCR primers spanned over an intron, making contaminating

genomic DNA detectable through PCR product size. One step qPCR was performed using the One Step

TB Green™ PrimeScript™ RT-PCR Kit II (Perfect Real Time) (TaKaRa Bio Inc., Japan) according to

the manufacturers protocol. 100 pg of RNA was used as template for each reaction in a total reaction

volume of 25 µL, with 12,5 µL 2X One Step TB Green™ RT-PCR Buffer 4, 1 µL PrimeScript 1 step

Enzyme Mix 2, 0.4 µM specific forward primer and 0.4 µM specific reverse primer. Two technical

replicates were used for all samples. Samples were amplified in a CFX96 Touch™Real-Time PCR

Detection System (BioRad, USA) and the amplification for all samples was performed under following

conditions: 42°C for 5 min, 95°C for 10 sec, followed by 40 cycles of 95°C for 5 sec and primer specific

annealing temperature for 30 s. Melting curves was recorded between 65-95°C at the end of each qPCR

reaction. For the comparison of larvae and adult, an annealing temperature of 59° was used. For

ivermectin exposed larvae and controls, an annealing temperature of 64°C for PgB20_g009, 59°C for

PgR070_g023, 62°C for PgR020_g037, 64°C for PgR007_g167 and PgB14X_g039 and 61°C for

PgR121_g017 was used. The product size was verified through electrophoresis using a 3% agarose gel at

100 V.

The data was analysed using BioRad CFX Manager, version 3.1 (BioRad, USA). Expression was

normalised using the method described by Livak & Schmittgen (2001). A geometric mean was calculated

for average Ct-values of the reference genes and subtracted from the average Ct-value of the gene of

interest, rendering ΔCt. ΔCt for the control groups was then subtracted from ΔCt of the IVM exposed

groups, rendering ΔΔCt. For the comparison between larvae and adult, ΔCt for adult was subtracted from

ΔCt of larvae rendering ΔΔCt. Fold change was then calculated through 2(−ΔΔCt) and log2 transformed.

The genes PgB20_g009 and Pg0R70_g023 have previously been used as reference genes for Parascaris

(Janssen et al. 2013) and were used as reference genes in this study (see table 3).

2.6. Statistical analysis

Hatching ratio was calculated using the equation 𝐻𝑎𝑡𝑐ℎ𝑒𝑑 𝑙𝑎𝑟𝑣𝑎

𝐸𝑚𝑏𝑟𝑦𝑜𝑛𝑎𝑡𝑒𝑑 𝑒𝑔𝑔𝑠= 𝐻𝑎𝑡𝑐𝑖𝑛𝑔 𝑟𝑎𝑡𝑖𝑜

Survival was calculated using the equation 𝐴𝑙𝑖𝑣𝑒 𝑙𝑎𝑟𝑣𝑎

𝐴𝑙𝑖𝑣𝑒 𝑙𝑎𝑟𝑣𝑎+𝑑𝑒𝑎𝑑 𝑙𝑎𝑟𝑣𝑎= 𝑉𝑖𝑎𝑏𝑖𝑙𝑖𝑡𝑦

Differences in gene expression between IVM exposed groups and un-exposed control groups were log2

transformed and tested with Kruskal-Wallis test using GraphPad Prism, version 8.1.1.

3. Results

3.1. Larval hatching and survival

Following the original protocol for hatching (Ponce-Macotela et al. 2011), hatching ratio was under 1%.

After modification through addition of three strokes in a glass homogeniser in the end of the protocol

hatching improved, resulting in a hatching ratio of 52.8%. Larval survival was 84.8 % in RPMI and 53.3

% NCTC after 13 days (see figure 1).


3.2. Ivermectin exposure

Survival of larvae exposed to 10−15M IVM was 97.6% and for larvae exposed to 10−7M IVM 96.7%.

For controls, the survival was 98.7%. Larvae exposed to the highest concentration of ivermectin, 10−7M,

displayed hypermobility compared to unexposed controls and larvae exposed to 10−15M.

3.3. PCR

PCR amplification products for primer pairs stated in table 1 were of the expected size when controlled

through gel electrophoresis. After sequencing, all of the product sequences matched the expected genetic

area when aligned against the reference genome.

3.4. qPCR

3.4.1. Comparison of unexposed larvae and adult

qPCR analysis comparing expression between adult and larvae was performed for six genes

(abbreviations are used in the text, see table 2). CYP-14A2, GST-20a, SKN-1 and the ABC-transporter

had a detectable expression in both larvae and adult (see fig. 2). Larvae expressed higher levels of CYP-

14A with a log2 fold change of 3,2 in larvae compared to adult. . A slight down regulation of expression

levels of GST-20a, log2 fold change of -0,8, was observed in larvae compared to adult. For SKN-1, the

expression level was almost equal in larvae and adult, with a down regulation of log2 fold change -0.1 in

larvae compared to adult. A marked differential expression in the two life stages was observed for UGT

which was only detected in larvae and for GST-20b which was only detected in adult (see fig. 3).

Since one biological replicate each was used for both adult and larvae no statistic analyses could be

performed.

3.4.2. Comparison of IVM exposure groups

Four genes from the adult-larvae comparison, including phase I and II drug metabolism and direct efflux,

were chosen for further investigation in IVM exposed larvae (see figure 4) (abbreviations are used in the

text, see table 2). The CYP-14A2 primer pair had an amplification efficiency of 97.2%. Amplification

was detected late in the assay, with Ct values over 34, and not for all technical replicates. The larvae

Figure 1. Larval survival Larval survival monitored for 13 days in two types of media, RPMI and NCTC. After hatching larvae was cultured in NCTC

for 3 days and then split into two groups. One group was cultured in RPMI and the other in NCTC, at 37°C with 5% CO2,

for a total of 13 days. Estimation of survival and medium change was performed every 2nd to 3rd day.

3 8 13 180

20

40

60

80

100

Days after hatching

% V

iab

ilit

y

NCTC- 49% NCTC-135 with L-glutamine, NaHCO, yeast extract, bacteriological peptone and bactodextrose- 49% fetal bovine serum- 2% Antibiotic Antimycotic solution

RPMI- 88% RPMI Medium 1640 + GlutaMAX™- 10% fetal bovine serum- 1% Penicillin and Streptomycin- 1% L-glutamine


Table 1. PCR primers

P. univalens gene Forward primer Reverse primer Product size

PgR020_g037 Pair 1 acccggatgttgcatttcaa tgaacgaatgtctccgctt 503 bp

PgR007_g167 Pair 1 atgccgcagtataagctcac gccaccagatttagcgagga 441 bp

PgB14X_g039 Pair 1 cgatgcagaggaaaggttgg cctcgctgccaacttgtttt 377 bp

Pair 2 cattctgctccacctcaacg gaccatagattgcgccgtg 404 bp

PgR121_g017 Pair 1 ctcttctgctttgccgatcc gagcgacaccatcactttca 353 bp

Pair 2 aggcaataagacgacgttcac gtgaagcatttaacccaccga 435 bp

PgR080_g007 Pair 1 agcgatgttgatcctagcga cgaagactgcgaatccacaa 461 bp

Pair 2 tcgtttggtcgtagtggtga tgcggtctttatcgttggtg 388 bp

PgR024_g118 Pair 1 cgacctccgttatcttggtg

ccacccaggtaagcgatttg 449 bp

Table 2. Candidate genes, their orthologs, abbreviations used in text and qPCR primers

P. univalens gene Ortholog Abbreviation Forward primer Reverse primer Product size

PgR020_g037 CYP-14A2 C. elegans WormBase ID: WBGene00010706

CYP-14A2 cgacttccgttggcctattc cccactacgtttcgcacaat 131 bp

PgR007_g167 GST-20 C. elegans WormBase ID: WBGene00001768

GST-20a ggtgcacgcctaattttcca ccatccacttcgagcaatgg 165 bp

PgB14X_g039 SKN-1 C. elegans WormBase ID: WBGene00004894

SKN-1 gttcgtggatctgcatcacc

gtcctgtctttcgcttcgtc

122 bp

PgR121_g017 Putative ABC-transporter I. scapularis EnsemblMetazoa ID: ISCW020349

ABC-transporter ggcgcaactaatcgagaagg

ggcgaatagtacgacgtttaac

120 bp

PgR080_g007 UGT H. contortus (Matuškova et al. 2018)

UGT tgttggtggaatcgctgttg

aaacgagatcaacaccgcac

99 bp

PgR024_g118 GST-20 C. elegans WormBase ID: WBGene00001768

GST-20b ccccatttggtcaacttccc

agagcttcttccataggcgt

126 bp

Table 3. qPCR reference genes

P. univalens gene Forward primer Reverse primer Product size

PgB20_g009 acagtggagagatggacgtg gccatgccagtcagtttacc 116 bp

PgR070_g023 tcgtttttaggggagggatg aaacaccgagcaaaatggag 137 bp

UPPSALA UNIVERSITET S. Jonsson Master thesis

10 (16)

exposed to 10−15 M IVM showed a trend of down regulation of CYP-14A2 compared to unexposed

controls, while larvae exposed to 10−7M IVM showed both up and down regulation compared to

controls. The GST-20a primer pair had an amplification efficiency of 97.2%. Larvae exposed to 10−15

M and 10−7M IVM showed both slight up and down regulation of GST-20a compared to control groups.

The SKN-1 primer pair had an amplification efficiency of 101.3%. Larvae exposed to 10−15 M IVM

showed a low down and up regulation of SKN-1 compared to control groups, while larvae exposed to

10−7M IVM showed a very low down regulation compared to controls. The ABC-transporter primer pair

had an amplification efficiency of 99.3%. Amplification was detected late in the assay, with Ct values

over 34, and not for all technical replicates. Larvae exposed to 10−15 M IVM showed a trend of down

regulation of the ABC-transporter when compared to control groups, and a trend of down regulation

could also be detected for larvae exposed 10−7 M IVM compared to control groups.

None of the investigated genes showed a statistical significant difference between IVM exposed and

unexposed larvae.

Figure 3. Gene expression in larvae after ivermectin exposure Groups of approx. 200 larvae were ivermectin exposed for 24 h. Each dot on the graph represents one group. Exposure

concentrations are found on the x-axis. Gene expression was compared towards unexposed control groups, represented by the

dotted line. Gene expression was normalised against two reference genes, PgB20_g009 and PgR070_g023, using the method

described by Livak & Schmittgen (2001).

10-15 M 10-7 M

-2

-1

0

1

2

Lo

g2 f

old

ch

an

ge

A. CYP-14A2 PgR020_g037

10-15 M 10-7 M

-2

-1

0

1

2 B. GST-20a PgR007_g167

10-15 M 10-7 M

-2

-1

0

1

2 C. SKN-1 PgB14X_g039

10-15 M 10-7 M

-2

-1

0

1

2 D. ABC-transporter PgR121_g017

Figure 2. Comparison of larval and adult gene expression A-D shows log2 fold change of genes with detectable expression in both larvae and adult. For UGT, expression could only be

detected in larvae (E) while expression of GST-20b only could be detected in adult (F). Expression was normalised against two

reference genes, PgB20_g009 and PgR070_g023, using the method described by Livak & Schmittgen (2001).

Adult Larvae

-4

-2

0

2

4

6

Lo

g2 f

old

ch

an

ge

A. CYP-14A2 PgR020_g037

Adult Larvae-4

-2

0

2

4

6 B. GST-20a PgR007_g167

Adult Larvae-4

-2

0

2

4

6 C. SKN-1 PgB14X_g039

Adult Larvae-4

-2

0

2

4

6 D. ABC-transporter PgR121_g017

Adult Larvae

4

5

6

7

8 E. UGT

PgR080_g007

N/A

DC

t

Adult Larvae4

5

6

7

8 F. GST-20b

PgR024_g118

N/A


4. Discussion

4.1 In vitro model

The starting point for the model, hatching, was a protocol used for Toxocara canis (Ponce-Macotela et al.

2011), that in its original form rendered a very low hatching ratio. To improve the hatching, three strokes

in a glass homogeniser were added to the end of the protocol. After this addition the protocol was better

suited for P. univalens and improved the hatching ratio to approx. 50%. Although considerable better, the

ratio is still quite low suggesting that further modifications could adjust it to suit hatching of P. univalens

even better. Very few studies have been performed using P. univalens larvae, but the published literature

suggests that additional washes in sodium hypochlorite could improve hatching ratio (Burk et al. 2014).

The larval survival was approx. 85% after 13 days of culturing in RPMI. Larvae cultured in NCTC had

lower survival, approx. 53% after 13 days. This agrees with a previous study on adult Parascaris, which

had the best viability when cultured in RPMI (Scare et al. 2018). The survival ratio was however better

for larvae in this study when compared to adult worms in the study by Scare (2018) where the maximum

survival observed was 7 days.

Altogether, it is possible to use larvae in an in vitro model including hatching and culturing. This entails

several advantages compared to using adult worms. Eggs for hatching can be collected from faecal

samples, which is non-invasive, while adult worms needs to be collected directly from hosts. Larvae have

good survival compared to adults when cultured, and have a suitable size for high through-put scanning

(Storey et al. 2014). Improvement of the hatching ratio would provide a more efficient use of collected

material.

The model also seems to be useful for drug exposure. For this study ivermectin was chosen, and was

added to the media after suspension in DMSO. PYR, ML and BZ, the anthelmintics used for treatment of

Parascaris infection, are all possible to add to the culture media through this method. The highest

achievable concentration is limited by the drug solubility in DMSO and the percentage of DMSO that is

acceptable to add to the media. For this study two IVM exposure concentrations was chosen, 10−7 M and

10−15 M. For each concentration, three groups each consisting of 200 larvae was exposed. With a

survival of 96,7% in the highest concentration and 98,7% for the control, IVM exposure did not have any

major effects on survival. This contrasts to a previous study were adult worms were killed by an IVM

concentration of 10−8 M (Janssen et al. 2013), and suggests that larvae have a higher IVM tolerance than

adults. After 24 h culturing in the exposure media, all of the three groups exposed to the highest

concentration displayed hypermobility. This reaction is quite contradictive to the expected paralysing

effect of IVM. The same reaction has previously been observed in Brugia malayi (Storey et al. 2014) and

Caenorhabditis elegans (Ardelli et al. 2009) when exposed to IVM. The mechanism behind this is not

explained in literature and remains unknown.

Since literature available today is focused on adult worms, there are no studies describing gene

expression in larvae. The model can be used to increase knowledge about life stages present in the host

and contribute to understanding of differences between life stages and how they affect the treatment

outcome.

4.2. Gene expression

Six genes, all orthologs of genes involved in drug metabolism in other parasites, were selected to include

both phase I, II and direct efflux in drug metabolism. CYP-14A2 is an enzyme involved in phase I. GST-


20a, GST-20b and UGT are part of phase II. SKN-1, a transcription factor, up regulates phase II

response. The ABC-transporter is part of direct drug efflux. All chosen genes had been amplified through

PCR, resulting in a product of correct size and sequence. As template for the PCR amplification, pooled

cDNA from adults, eggs and embryonated larvae was used. The obtained PCR products clearly indicated

that the genes were expressed. Since there is no published literature regarding these genes in Parascaris

spp., a comparison between adult and larvae was performed, using qPCR, to elucidate differences

between the life stages.

Differential expression of genes involved in drug metabolism was found in larvae and adult. CYP-14A2

had a higher expression in larvae compared to the adult. In contrast, expression of the ABC-transporter

was higher in the adult worm than in larvae. Gene expression of UGT was only detected in larvae and not

in the adult worm while expression of GST-20b was only detected in the adult, not in larvae. Differential

expression in adult worm and larvae were not observed for the genes GST-20a and SKN-1. Due to the

use of only one biological replicate representing larvae and adult, it was not possible to calculate

statistical significance. However, the results indicate that there might be differences in genetic expression

in all phases of drug metabolism depending on life stage of the parasite. Since the larva migrates through

the host and simultaneously matures, it is possible that genes are expressed in different ways depending

on life stage. Further research including an increased quantity of biological replicates would enhance

knowledge.

Four genes from the adult-larvae comparison were chosen for expression studies of the IVM exposed

larvae. The number of genes possible to investigate was limited by low concentrations of extracted RNA.

CYP-14A2, GST-20a, SKN-1 and the ABC-transporter were chosen to include both phase I, II and direct

efflux drug metabolism.

The IVM exposure did not affect the genes involved in phase II drug metabolism, GST-20a and SKN-1.

No differences were observed between 10−7M and 10−15M IVM exposure. Although the expression of

these two genes were not affected by IVM exposure, it is not possible to draw conclusions regarding

phase II metabolism as a whole. There could be several other genes responding to IVM exposure,

especially when considering that C. elegans encodes over a hundred genes involved in phase II

metabolism (Matuškova et al. 2016). There was a trend of down regulation of CYP-14A2, involved in

phase I drug metabolism, in larvae exposed to 10−15M IVM compared to unexposed larvae. In larvae

exposed to 10−7M IVM the expression of CYP-14A2 deviated, showing both up and down regulation.

This result was in contrast to the up regulation of CYP-450 in IVM exposed C. elegans in a previous

study (Ménez et al. 2016) Gene expression of the ABC-transporter, part of direct efflux, shows a trend of

down regulation in larvae exposed to 10−7M and 10−15M IVM compared to unexposed larvae. This

result was in contrast of the up regulation of a P-glycoprotein after IVM exposure seen in a previous

study on Parascaris (Janssen et al. 2013). The differences were not statistically significant for any of the

genes.

Continued research, including more genes involved in drug metabolism, would lead to a better

understanding of the role of drug metabolism in resistance.

4.3. Conclusions

The Parascaris L3 larva in vitro model is functional, and can be used for anthelmintic exposure. Given

the lack of in vitro models in the field, the model developed in this study contributes to the options for

future studies. Egg collection through sieving of faecal samples is a non-invasive and uncomplicated

process compared to collection of adult worms from the host. Larvae have good survival during culture


compared to adults and have a size better suited for high through put scanning. Although the hatching

should be possible to improve, the current hatching ratio of approx. 50% still provides larvae to cultivate

even though a higher ratio would make better use of collected material.

Very few studies are focused on expression of genes involved in drug metabolism in Parascaris. This is

the first time expression of CYP-14A2, GST-20, SKN-1, UGT and ABC-transporter is shown. The

results of this study imply that gene expression might differ depending on life stage. No statistically

significant differences of gene expression in larvae after IVM exposure were observed in this study,

although a trend of down regulation of the ABC-transporter could be observed for larvae exposed to

IVM, both 10−15M and 10−7M. A trend of down regulation of CYP-14A2 could also be observed in

larvae exposed to 10−15M IVM. Further research could highlight significant differences both between

life stages and in larvae after drug exposure. Improved RNA extraction would enable an increase in

template amount, improving amplification detection.

5. Acknowledgements The invaluable help from main supervisor Eva Tydén, co-supervisor Magnus Åbrink and Frida Martin,

PhD student at the Parasitology unit, SLU, is much appreciated.

References

Ardelli, B. F., Stitt, L. E., Tompkins, J. B., Pritchard, R. K. (2009). A comparison of the effects of

ivermectin and moxidectin on the nematode Caenorhabditis elegans. Veterinary Parasitology, vol. 165,

pp. 96-108

Armstrong, S. K., Woodgate, R. G., Gough, S., Heller, J., Sangster, N. C., Hughes, K. J. (2014). The

efficacy of ivermectin, pyrantel and fenbendazole against Parascaris equorum infection in foals on farms

in Australia. Veterinary Parasitology, vol. 205(3-4), pp. 575-580

Burk, S. V., Dangoudoubiyam, S., Brewster-Barnes, T., Bryant, U. K., Howe, D. K., Carter, C. N.,

Vanzant, E. S., Harmon, R. J., Kazacos, K. R., Rossano, M. G. (2014). In vitro culture of Parascaris

equorum larvae and initial investigation of parasite excretory-secretory products. Parasitology Research,

vol. 113, pp. 4217-4224

Chelladurai, J. J., Brewer, M. T. (2019). Detection and quantification of Parascaris P-glycoprotein drug

transporter expression with a novel mRNA hybridization technique. Veterinary Parasitology, vol. 267,

pp. 75-83

Clayton, H. M., Duncan, J. L. (1977). Clinical signs associated with Parascaris equorum infection in

worm-free pony foals and yearlings. Veterinary Parasitology, vol. 4, pp. 69-78

Clayton, H. M., Duncan, J. L. (1978). The migration and development of Parascaris equorum in the

horse. International Journal for Parasitology, vol. 9, pp. 285-292

Coles, G. C., Bauer, C., Borgsteede, F. H. M., Geerts, S., Klei, T. R., Taylor, M. A., Waller, P. J. (1992).

World Association for the Advancement of Veterinary Parasitology (W.A.A.V.P.) methods for the

detection of anthelmintic resistance in nematodes of veterinary importance. Veterinary Parasitology, vol.

44, pp. 35-44.


Craig, T. M., Diamond, P. L., Ferwerda, N. S., Thompson, J. A. (2007). Evidence of ivermectin

resistance by Parascaris equorum on a Texas horse farm. Journal of Equine Veterinary Science, vol. 27,

pp. 67-71

Dent, J. A., Smith, M. M., Vassilatis, D. K., Avery, L. (2000). The genetics of ivermectin resistance in

Caenorhabditis elegans. Proceedings of the National Academy of Sciences of the United States of

America, vol. 97, pp. 2674-2679

Elsheikha, H. M., Khan, N. A., (2011) Essentials of Veterinary Parasitology. Norfolk: Caister Academic

Press

ESCCAP, European Scientific Counsel Companion Animal Parasites (2019). A guide to the treatment

and control of equine gastrointestinal parasite infections. 2nd ed. Worcestershire, UK: ESCCAP

Goday, C., Pimpinelli, S. (1986). Cytological analysis of chromosomes in the two species Parascaris

univalens and P. equorum. Chromosoma, vol. 94, pp. 1-10

Godoy, P., Che, H., Beech, R. N., Prichard, R. K. (2015). Characterization of Haemonchus contortus P-

glycoprotein-16 and its interaction with the macrocyclic lactone anthelmintics. Molecular and

Biochemical Parasitology, vol. 204(1), pp. 11-15

Jabbar, A., Littlewood, D. T. J., Mohandas, N., Briscoe, A. G., Foster, P. G., Muller, F., von Samson-

Himmelstjerna, G., Jex, A. R., Gasser, R. B. (2014). The mitochondrial genome of Parascaris univalens

– implications for a “forgotten” parasite. Parasites & Vectors, vol. 7, p. 428

Janssen, I. J., Krücken, J., Demeler, J., Basiaga, M., Slawomir, K, von Samson-Himmelstjerna, G.

(2013). Genetic variants and increased expression of Parascaris equorum P-glycoprotein-11 in

populations with decreased ivermectin susceptibility. PloS ONE, DOI: 10.1371/journal.pone.0061635

Janssen, I. J., Krücken, J, Demeler, J., von Samson-Himmelstjerna, G. (2015). Transgenically expressed

Parascaris P-glycoprotein-11 can modulate ivermectin susceptibility in Caenorhabditis elegans.

International Journal for Parasitology: Drugs and Drug Resistance, vol. 5(2), pp. 44-47

Kaschny, M., Demeler, J., Janssen, I. J., Kuzmina, T. A., Beognet, B., Kanellos, T., Kerboeuf, D., von

Samson-Himmelstjerna, G., Krücken, J. (2015). Macrocyclic lactones differ in interaction with

recombinant P-glycoprotein 9 of the parasitic nematode Cylicocylus elongatus and ketoconazole in a

yeast growth assay. PLoS Pathogens, vol. 11(4)

DOI: 10.1371/journal.ppat.1004781

Kaplan, R. M., Nielsen, M. K. (2010). An evidence-based approach to equine parasite control: It ain’t the

60s anymore. Equine Veterinary Education, vol. 22(6)

DOI: 10.1111/j.2042-3292.2010.00084.x

Köhler, P. (2001). The biochemical basis of anthelmintic action and resistance. International Journal for

Parasitology, vol. 31(4), pp. 336-345

Livak, K. J., Schmittgen, T. D. (2001) Analysis of relative gene expression data using real-time

quantitative PCR and the 2−ΔΔCT method. Methods, vol. 25, pp. 402-408


Marcellino, C., Gut, J., Lim, K. C., Singh, R., McKerrow, J., Sakanari, J. (2012). WormAssay: A novel

computer application for whole-plate motion-based screening of macroscopic parasites. PLOS Neglected

Tropical Diseases, vol. 6 (1), e. 1494

Martin, F., Höglund, J., Bergström, T. F., Karlsson Lindsjö, O., Tydén, E. (2018). Resistance to pyrantel

embonate and efficacy of fenbendazole in Parascaris univalens on Swedish stud farms. Veterinary

Parasitology, vol. 264, pp. 69-73

Matušková, P., Vokřál, I., Lamka, J., Skálová, L. (2016) The role of xenobiotic-metabolizing enzymes in

anthelmintic deactivation resistance in helminths. Trends in Parasitology, vol. 32 (6), pp. 481-491

Matušková, P., Lecová, L., Laing, R., Dimunová, D., Vogel, H., Stuchlíková, L. R., Nguyen, L. T.,

Kellerová, P., Vokřál, I., Lamka, J., Szotáková, B., Várady, M., Skálová, L. (2018) UDP-

glycosyltransferase family in Haemonchus contortus: Phylogenetic analysis, constitutive expression, sex-

differences and resistance related differences. International Journal for Parasitology: Drugs and Drug

Resistance, vol. 8, pp. 420-429

Ménez, C., Alberich, M., Kansoh, D., Blanchard, A., Lespine, A. (2016). Acquired tolerance to

ivermectin and moxidectin after drug selection pressure in the nematode Caenorhabditis elegans.

Antimicrobial Agents and Chemotherapy, vol. 60 (8), pp. 4809-4819

Molento, M. B., Antunes, J., Bentes, R. N., Coles, G. C., (2008). Anthelmintic resistant nematodes in

Brazilian horses. Veterinary Record, vol. 162, pp. 384-385

Nielsen, M. K., Wang, J., Davis, R., Bellaw, J. L., Lyons, E. T., Lear, T. L., Goday, C. (2014).

Parascaris univalens – a victim of large-scale misidentification? Parasitology Research, vol. 113 (12)

pp. 4485-4490

Nielsen, M. K., Mittel, L, Grice, A., Erskine, M., Graves, E., Vaala, W., Tully, R. C., French, D. D.,

Bowman, R., Kaplan, R. M. (2016) AAEP Parasite Control Guidelines. American Association of Equine

Practitioners, Lexington. www.aaep.org

Peachey, L. E., Pinchbeck, G. L., Matthews, J. B., Burden, F. A., Lespine, A., von Samson-

Himmelstjerna, G., Krücken, J., Hodgkinson, J. E. (2017). P-glycoproteins play a role in ivermectin

resistance in cyathostomins. International Journal for Parasitology: Drugs and Drug Resistance, vol. 7,

pp. 389-398

Peregrine, A. S., Molento, M. B., Kaplan, R. M., Nielsen, M. K. (2014). Anthelmintic resistance in

important parasites of horses: does it really matter? Veterinary Parasitology, vol. 201, pp. 1-8

Ponce-Macotela, M., Rodríguez-Caballero, A., Peralta-Abarca, G. E., Martínez-Gordillo, M. N. (2010).

A simplified method for hatching and isolating Toxocara canis larvae to facilitate excretory-secretory

antigen collection in vitro. Veterinary Parasitology vol. 75, pp. 382-385

Prichard, R., Ménez, C., Lespine, A. (2012). Moxidectin and the avermectins: Consanguinity but not

identity. International Journal for Parasitology: Drugs and Drug Resistance, vol. 2, pp. 134-153

Ritter, J. M., Flower, R., Henderson, G., Loke, Y. K., MacEwan, D., Rang, H. P. (2019) Rang & Dale’s

Pharmacology. 9th ed. Edinburgh: Elsevier.


Scare, J. A., Steuer, A. E., Shaffer, C. L., Slusarewicz, P., Mousley, A., Nielsen, M. K. (2018). Long live

the worms: methods for maintaining and assessing the viability of intestinal stages of Parascaris spp. In

vitro. Parasitology, vol. 146 (5), pp. 685-693

Shah, S. Z. A., Khan, S., Compston, P., Upjohn, M., Jobling, R., (2016). Gastrointestinal parasite

infestation and the efficacy of Fenbendazole and Ivermectin in working equids in selected areas of

Pakistan. Journal of Equine Veterinary Science, vol. 39 (S103)

Storey, B., Marcellino, C., Miller, M., Maclean, M., Mostafa, E., Howell, S., Sakanari, J., Wolstenholme,

A., Kaplan, R. (2014). Utilization of computer processed high definition video imaging for measuring

motility of microscopic nematode stages on a quantitative scale: “The Worminator”. International

Journal for Parasitology: Drugs and Drug Resistance, vol. 4, pp. 233-243

SVA, National Veterinary Institute, Sweden (2018). Avmaskning av häst.

https://www.sva.se/djurhalsa/hast/parasiter-hos-hast/avmaskning-av-hast [2019-05-29]

Wolstenholme, A. J. (2012). Glutamate-gated chloride channels. The Journal of Biological Chemistry,

vol. 287(48), pp. 40232-40238.

Popular summary

Parascaris univalens, the equine roundworm, is a large parasite that infects young horses. Infection can

cause respiratory symtoms such as couch and nasal discharge, impaired general condition and reduced

growth. Due to the size of the parasite, an adult worm can reach up to 50 cm in size, heavy infections can

lead to obstruction and even rupture of the small intestine. To avoid illness, young horses are routinely

dewormed. However, anthelmintic resistance is an emerging problem that threatens equine welfare.

Reports of resistant worms can be found for all the available groups of anthelmintics used for treatment

of equine roundworm infection. To improve the knowledge of how the worms become resistant, this

study focused on genes that are involved in drug metabolism in the cells of the worms. A model for

hatching and culturing of larvae in lab environment was developed. Larvae were exposed to ivermectin,

one of the drugs used for treatment of equine roundworm infection. After exposure, the expression of

several genes involved in drug metabolism was investigated. Differences between the expression in

larvae and an adult worm were also studied. After completion of the study, it could be concluded that the

developed lab model for larvae was functional and could be used to drug expose larvae. The genetic

expression between larva and adult differed for some genes, while there were no major effects on gene

expression in larvae after ivermectin exposure.

Documents

An in vitro model for studying gene expression in ...1368359/FULLTEXT01.pdf · hatching. However, they are of suitable size for high throughput screening (Clayton & Duncan 1978, Storey