www.nature.com/natureimmunology • december 2002 • volume 3 no 12 • nature immunology

Tomo Saric1*, Shih-Chung Chang1,Akira Hattori2, Ian A.York3, Shirley Markant1,Kenneth L. Rock3, Masafumi Tsujimoto2 and Alfred L. Goldberg1

Published online 18 November 2002; doi:10.1038/ni859

Precursors to major histocompatibility complex (MHC) class I–presented peptides with extra NH2-terminal residues can be efficiently trimmed to mature epitopes in the endoplasmic reticulum (ER).Here, we purified from liver microsomes a lumenal, soluble aminopeptidase that removes NH2-terminal residues from many antigenic precursors. It was identified as a metallopeptidase named“adipocyte-derived leucine” or “puromycin-insensitive leucine-specific” aminopeptidase. However,because we localized it to the ER, we propose it be renamed ER–aminopeptidase 1 (ERAP1). ERAP1 isinhibited by agents that block precursor trimming in ER vesicles and although it trimmed NH2-extended precursors, it spared presented peptides of 8 amino acid and less. Like other proteinsinvolved in antigen presentation, ERAP1 is induced by interferon-γ. When overexpressed in vivo, wefound that ERAP1 stimulates the processing and presentation of an antigenic precursor in the ER.

1Department of Cell Biology, Harvard Medical School, Boston, MA 02115, USA. 2Laboratory of Cellular Biochemistry, RIKEN, 2-1 Hirosawa,Wako, Saitama, 351-0198 Japan.3Department of Pathology, University of Massachusetts Medical School,Worcester, MA 06155, USA. *Present address: ATABIS GmbH, Joseph-Stelzmann Str. 50, 50931

Cologne, Germany. Correspondence should be addressed to A. L. G. (alfred_goldberg@hms.harvard.edu).

An IFN-γ–induced aminopeptidase inthe ER, ERAP1, trims precursors to

MHC class I–presented peptides

The ability of the immune system to recognize and eliminate virallyinfected and cancer cells depends upon the cells’ capacity to present onits surface major histocompatibility complex (MHC) class I moleculespeptide fragments derived from intracellular proteins. Most of these anti-genic peptides are derived from peptides generated in the cytosol ornucleus during protein degradation by the ubiquitin-proteasome path-way1–4. The 26S proteasome degrades proteins to peptides of ∼ 2–25residues long5,6. Nearly all these peptides are hydrolyzed quickly toamino acids by cytosolic peptidases6,7. However, in higher vertebrates, asmall fraction escapes complete degradation and is transported into theendoplasmic reticulum (ER), where it binds to MHC class I moleculesand is exported to the cell surface8.

To fit into the groove in MHC class I molecules, these peptides must be8–11 residues long. Approximately 70% of proteasome products are tooshort to do so5, about 15% are of appropriate length and 15% are too long,but could function in antigen presentation if trimmed by exopeptidases5,6,12.Studies with inhibitors have shown that proteasomes generate the correctCOOH terminus for the MHC class I–presented peptide9,10 and sometimesalso the correct NH2 terminus11,12. However, proteasomes—and especiallythe alternative forms induced by interferon-γ (IFN-γ) termed “immunopro-teasomes”12—primarily generate longer precursors of MHC class I epi-topes that are extended at their NH2 termini by one or more residues12–15.The conversion of these NH2-extended precursors to mature epitopes is notcatalyzed by proteasomes9 but by aminopeptidases, as this process can beblocked by derivatization of the peptide’s NH2-terminal group10.

This trimming of precursor peptides to mature epitopes can occur in thecytosol or the ER. Three aminopeptidases have been implicated in this

cytosolic process: leucine aminopeptidase (LAP)16, puromycin-sensitiveaminopeptidase and bleomycin hydrolase17. One of these cytosolicenzymes, LAP, is induced by IFN-γ16, which stimulates antigen presenta-tion, and thus LAP is likely to play a special role in processing antigenicprecursors in vivo. IFN-γ also stimulates the induction of other compo-nents of this pathway; these components include MHC class I, the peptidetransporter (TAP) and three proteasome β-subunits, whose incorporationin place of the constitutive subunits alters the cleavage specificity so thatmore peptides are generated with the correct COOH-terminal residues forMHC class I binding12,19–21. In addition, these changes in specificity influ-ence the NH2 termini of the proteasomal products and increase specifical-ly the yield of NH2-extended precursors to antigenic peptides12.

Aminopeptidase(s) in the ER also can contribute to the generation ofmature MHC class I epitopes from these larger precursors. In fact, cer-tain MHC class I epitopes appear to be transported into the ER primar-ily as NH2-extended peptides. This is probably because such precursorshave higher affinities for TAP than the mature epitopes22,23 and perhapsbecause these longer forms are destroyed more slowly by peptidases inthe cytosol6,24. A variety of studies have demonstrated proteolytic pro-cessing of precursor peptides transported into the ER in vivo and in iso-lated microsomes. For example, when NH2-extended versions of anti-genic peptides fused to an ER-targeting sequence were expressed incells, the mature epitopes were presented on surface MHC class I mol-ecules9,25–27 after cleavage of the signal sequences by signal peptidaseand removal of the additional NH2-terminal residues by aminopepti-dase(s) in the ER. Studies with purified microsomes have demonstratedthat this trimming of TAP-translocated precursors occurs in the lumen of

ARTICLES

1169

©20

02 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://w

ww

.nat

ure

.co

m/n

atu

reim

mu

no

log

y

nature immunology • volume 3 no 12 • december 2002 • www.nature.com/natureimmunology

ARTICLES

the ER, involves metallopeptidase(s) that can be inhibited by o-phenan-throline, leucinethiol and leucine-chloromethylketone (L-Cmk) and can

efficiently remove from the NH2 termini all flanking residues exceptproline14,28–30.

However, the ER aminopeptidase(s) that catalyzes this critical step hasnot yet been identified. Aside from signal peptidase31, no known peptidasehas been demonstrated convincingly in the ER32. The proposal33 that MHCclass I might function as the trimming enzyme has been disproved26. Morerecently, the ER-lumenal chaperone Grp94 (also known as gp96) has beenreported as having aminopeptidase activity34; however, this claim is nowin question35.

We undertook these studies to identify and characterize the ER-aminopeptidase involved in antigen presentation. Using traditional bio-chemical approaches, we isolated from the ER lumen an enzyme that iscapable of trimming various NH2-extended antigenic peptides and showedthat it corresponds to an aminopeptidase called adipocyte-derived leucineaminopeptidase (A-LAP)36–38 or puromycin-insensitive leucyl-specificaminopeptidase (PILS-AP)39. We show here that this enzyme, like manycomponents of the antigen-presentation pathway, is induced by IFN-γ. Inaddition, its inhibitor sensitivity and preference for longer peptide sub-strates accounts for the processing activity reported in the ER. We foundthat when overexpressed, this enzyme enhanced processing in the ER ofan NH2-extended ovalbumin-derived precursor, LEQLESIINFEKL, andpresentation of the mature epitope SIINFEKL. Because the present namesfor this enzyme are inaccurate and misleading, we propose that it berenamed endoplasmic reticulum aminopeptidase 1 (ERAP1).

ResultsAminopeptidases are localized in the ER lumenPeptide trimming must occur primarily inside the ER, as the processing inisolated microsomes of NH2-extended precursors to MHC class I epitopesrequires their transport by TAP and does not involve proteins on the outerface of the ER14,28–30. To determine whether the responsible aminopeptidas-es are associated with the membrane fraction or are soluble in the ERlumen, rough ER vesicles purified from rat liver were fractionated withdigitonin (Fig. 1a). The soluble fraction contained high amounts of thelumenal marker protein disulfide isomerase (PDI) and was free of ERmembranes, as shown by the complete absence of the membrane markerTRAPα (translocon-associated protein α) (Fig. 1b). Virtually all of the

1170

Figure 1. Aminopeptidase activities are associated with the ER-lumenalfraction. (a) ER vesicles were permeabilized with digitonin, and the lumenal andmembrane fractions were separated by ultracentrifugation. Comparable amounts oftotal rough ER (T), lumenal (L) and membrane (M) fractions were analyzed by 12%SDS-PAGE and Coomassie blue staining. S, molecular weight standards. (b) A dupli-cate gel was blotted onto a PVDF membrane, and the ER membrane protein TRAPαor the ER-lumenal protein PDI were detected by immunoblotting. (c) RP-HPLCanalysis of ESIINFEKL-trimming by the ER-lumenal fraction.Asterisk (*), although theESIINFEKL was >95% pure by MS analysis, at pH 6.8, it eluted in two peaks due tothe presence of differently charged species.

S T L M

TRAPα

PDI

kD250986450

36

30

19

0

100

200

300

400

500

3 4 5 6 7 8 9 10 11 12

0

100

200

300

400

500

3 4 5 6 7 8 9 10 11 12

ESIINFEKL

ESIINFEKL

SIINFEKL

0 min

120 min

*

IINFEKL

A21

4A

214

Elution time (min)

a

b

c

Figure 2. Purification and identification of ERAP1. (a) ER-lumenal proteins were fractionated on a UNO Q-1 column with an NaCl gradient.Aminopeptidase activi-ties in each fraction were analyzed with ESIINFEKL, L-Amc and R-Amc as substrates. Four peaks of activity are indicated. Asterisk (*), ESIINFEKL-trimming activity in thecombined UNO Q-1 flow-through fractions. (b) SDS-PAGE analysis of fractions (32–45) in peak IIA, which contained most of the ESIINFEKL-trimming activity.A Coomassieblue–stained gel is shown.Arrows indicate the bands that coeluted with this activity and were sequenced by LC–MS-MS.The faint 106 kD band marked with an asterisk (*)was identical to an enzyme known as A-LAP or PILS-AP (referred to here as ERAP1). Other protein bands sequenced matched known proteins that lack aminopeptidaseactivity. (c) A duplicate gel was blotted onto a PVDF membrane, and the content of ERAP1 in each fraction was determined by immunoblotting with antiserum to recombi-nant human enzyme. No Grp94-immunoreactive protein was detected in these fractions.

0

3000

6000

9000

12000

15000

0 10 20 30 40 50 60 70 80Fractions

Tri

mm

ing

activ

ity

NaC

lgr

adie

nt(M

)

0. 5

0.3

0.2

0.1

0

0.4L-AmcESIINFEKL

R-AmcR-Amc

I

IIA

IIB

III

*

191

97

64

51

39

28

kD

19

M FT 32 34 35 36 37 38 39 40 41 42 43 44 45

*

ERAP197 kD

*

a b

c

©20

02 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://w

ww

.nat

ure

.co

m/n

atu

reim

mu

no

log

y

ARTICLES

www.nature.com/natureimmunology • december 2002 • volume 3 no 12 • nature immunology

aminopeptidase activity recovered (94% of the activity against leucine-7-amino-4-methylcoumarin (L-Amc), 98% of the activity against R-Amc-and 86% of the activity against AAF-Amc) were recovered in the ER lume-nal fraction. We also analyzed by reverse-phase high-performance liquidchromatography (RP-HPLC) trimming of ESIINFEKL, the NH2-extendedprecursor to the ovalbumin-derived H-2Kb–binding epitope SIINFEKL.This process, which is catalyzed by liver vesicles30, occurred predominant-ly (89%) in the lumenal fraction of our preparation. No endoproteolyticactivity was present, but single amino acids were trimmed sequentiallyfrom the NH2 terminus of ESIINFEKL (Fig. 1c), QLESIINFEKL and sev-eral other NH2-extended precursors to antigenic peptides (see below). Theinability of the membrane fraction to hydrolyze these substrates was notdue to the substrate’s limited access into membrane vesicles because allreactions were carried out with 0.2% digitonin (which did not itself inhib-it the aminopeptidase activities). Thus, the enzyme responsible for antigenprocessing was found predominantly in the lumenal fraction.

Purification and identification of the key aminopeptidaseTo identify the enzymes responsible for trimming ESIINFEKL, we care-fully fractionated ER-lumenal proteins on a UNO Q-1 anion exchange

column. At least four peaks of aminopeptidase activity were identifiedupon high-resolution anion exchange chromatography of ER lumenal pro-teins (Fig. 2a). Weak ESIINFEKL-trimming and major L-Amc– and R-Amc–degrading activities were detected in the flow-through fractions inpeak I (Fig. 2a), but the major trimming activity coeluted specifically withL-Amc–degrading aminopeptidase in peak IIA (Fig. 2a). One additionalR-Amc–degrading peak was found in peak IIB (Fig. 2a). We were unableto detect Grp94 in peak fractions, which had been suggested to functionas the ER-trimming aminopeptidase34.

To identify the responsible enzyme, we performed SDS–polyacry-lamide gel electrophoresis (SDS-PAGE) analysis of the fractions active inthe trimming of the antigenic precursors (Fig. 2a). Three Coomassieblue–stained protein bands appeared to coelute with the ESIINFEKL-trimming activity (Fig. 2b). These candidate proteins were excised,digested with trypsin and the peptide sequences were obtained by onlineRP-HPLC and tandem mass spectrometrical (MS-MS) analysis. Amongthe sequences obtained, 11 tryptic fragments derived from a 106-kD pro-tein matched to sequences in a zinc-dependent metallopeptidase that hasbeen described36,39. This protein has been assigned the names A-LAP andPILS-AP, which are misleading in light of its localization and biochemi-cal properties (see below)36,39. Therefore, we suggest that it be renamed theER aminopeptidase 1 (ERAP1). This enzyme coeluted with the ESIIN-FEKL-trimming activity in chromatographic fractions, as demonstratedby immunoblotting with antiserum raised against the recombinant humanprotein (Fig. 2c). Size-exclusion chromatography of the ER lumenrevealed one peak of ESIINFEKL trimming, which coeluted with theERAP1 immunoreactivity (Web Fig. 1 online). The polypeptide sequencepredicts a molecular weight of 106 kD without glycosylation. The molec-ular mass of this trimming peak was 150 kD, which agrees with thatreported for this enzyme37.

Subcellular localization of ERAP1Purification of ERAP1 from microsomes suggested that this enzyme islocalized to the ER. However, published reports have concluded that thisenzyme is cytosolic36, secreted37 or associated with undefined intracellu-lar vesicles39. To localize the endogenous enzyme, HeLa S3 cells wereanalyzed immunocytochemically with affinity-purified ERAP1 anti-serum and antibodies raised against the ER-retention signal sequenceKDEL. With confocal microscopy, the enzyme was located in vesicularstructures in the cytosol of HeLa S3 cells together with the KDELimmunoreactivity (Fig. 3). This colocalization—which was consistentwith the presence of a signal sequence at the enzyme’s NH2 terminus39—indicated that ERAP1, although it lacks a KDEL sequence36,39, is foundspecifically in the ER lumen in intact cells together with the KDEL-con-taining proteins.

1171

Figure 3. ERAP1 is localized in the ER of HeLa cells. Immunocytochemicaldetection was done with antibodies to recombinant human ERAP1 and KDEL, theER-retention sequence. (a) Phase contrast (b) ERAP1-stained (c) KDEL-stained and(d) merged images are shown. Bar, 10 µm.

a b

c d

Figure 4. Trimming of NH2-extended precursors but notshort peptides by ERAP1. (a) Sequential removal by ERAP1 ofNH2-terminal residues from QLESIINFEKL to yield the matureepitope SIINFEKL.The reaction contained 150 nmol/ml of QLESI-INFEKL and 3.5 µg/ml of recombinant human ERAP1. At eachtime point, an aliquot was fractionated by RP-HPLC.The amountof each peptide was calculated by the integration of each individ-ual peptide peak. (b) Relative rates of hydrolysis of NH2-extend-ed precursors and SIINFEKL and IINFEKL; 150 nmol/ml of eachpeptide was incubated with 3 µg/ml of recombinant humanERAP1. At each time point, an aliquot was removed and fraction-ated by RP-HPLC, and the percentage of the original peptideremaining was determined.

Time (min)

0 30 60 90 120 150 180

Pep

tide

(nm

ol/m

l)

0

20

40

60

80

100

120

140

160

QLESIINFEKL LESIINFEKL ESIINFEKL SIINFEKL

Time (min)0 30 60 90 120

Deg

read

atio

n (%

)

0

20

40

60

80

100

QLESIINFEKLESIINFEKLSIINFEKLIINFEKL

a b

©20

02 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://w

ww

.nat

ure

.co

m/n

atu

reim

mu

no

log

y

nature immunology • volume 3 no 12 • december 2002 • www.nature.com/natureimmunology

ARTICLES

Trimming of precursors of antigenic peptides by ERAP1Initial work on this enzyme concluded that it hydrolyzed L-Amc rapidly,M-Amc slowly and did not hydrolyze other amino acid–Amc sub-strates36,39. Such narrow substrate specificity is not consistent with a rolein processing the diverse sequences preceding MHC class I epitopes.More recently, however, this enzyme was reported to remove a muchbroader set of residues from the NH2 termini of peptide hormones37. Totest whether ERAP1 can trim antigen precursors in a similar way to ERvesicles (Fig. 1c), we incubated the recombinant enzyme with NH2-extended versions of SIINFEKL, ESIINFEKL and QLESIINFEKL, andprecursors of the Sendai virus–derived epitope FAPGNYPAL,EFAPGNYPAL and HGEFAPGNYPAL. RP-HPLC analysis of the prod-ucts revealed that the pure enzyme efficiently removed diverse NH2-ter-minal residues from these and other NH2-extended antigen precursors togenerate the final epitopes (Fig. 4 and Web Fig. 2 online); this result con-trasted with its strong specificity for leucines in dipeptides, which we con-firmed with various fluorogenic dipeptides (Web Table 1 online).

This apparent preference for longer peptides was investigated furtherbecause it could be particularly important in the processing of NH2-extended precursors to the MHC class I epitopes, most of which are 8–10

residues long. Further analysis of these data revealed that, upon incubationwith pure ERAP1, the 11-residue precursor QLESIINFEKL disappearedrapidly (as shown by RP-HPLC at different times). Concomitantly, therewas a transient buildup of the 10-residue peptide and a later, transientaccumulation of the 9-residue peptide ESIINFEKL. With time, theamount of mature 8-residue peptide steadily increased, and the trimmingprocess almost ceased when most of the 11-residue peptide was convert-ed to SIINFEKL (Fig. 4a). This lack of further trimming was not causedby enzyme inactivation because, if additional substrate was provided,ERAP1 remained active. These kinetics indicated sequential (nonproces-sive) removal of the NH2-terminal residues to yield the mature epitope andsuggested preferential degradation of the longer precursors, as was direct-ly demonstrated by incubating ERAP1 with equal concentrations of thesepeptides. Both QLESIINFEKL and ESIINFEKL were digested muchfaster than the 8-residue peptide or the 7-residue peptide IINFEKL (Fig.4b). Preferential digestion of peptides longer than 9 residues was also seenwith HGEFAPGNYPAL (Web Fig. 2 online) and other antigenic precur-sors. This inability to digest rapidly peptides of 8 residues or shorter sug-gested that ERAP1 is specially adapted to function in antigen processing.

Effect of inhibitors on trimming activitiesThe processing of antigenic precursors in microsomes is inhibited byleucinethiol14, 1,10-phenanthroline28,30 and L-Cmk29. These inhibitors, butnot puromycin, AAF-Cmk or F-Cmk, completely blocked the conversionof ESIINFEKL to SIINFEKL by both the ER lumen and pure ERAP1(Table 1). The general aminopeptidase inhibitor bestatin also blockedtrimming by the pure enzyme completely, but reduced this process in the

1172

Table 1. Effect of various protease inhibitors on ESIINFEKLtrimming by the ER-lumenal fraction and recombinantERAP1

Inhibitor Concentration Inhibition (%)

(µM) ER lumen Pure ERAP1

Leucinethiol 1 87 6010 88 96

1,10-phenanthroline 500 97 89Bestatin 50 36 74

100 49 97L-Cmk 50 76 99F-Cmk 50 22 16AAF-Cmk 100 3 1Puromycin 100 0 0

Inhibitors were preincubated for 20 min at room temperature with 200 µg/ml ofER-lumenal proteins or 3 µg/ml of recombinant human ERAP1. Incubations werestarted at 37 °C by addition of ESIINFEKL (150 nmol/ml), whose conversion toSIINFEKL was monitored by RP-HPLC.

Figure 5. Immunodepletion of ERAP1 from ER lumen reduces trimmingof NH2-extended precursors. (a) The ER-lumenal fraction was treated with rab-bit nonimmune serum (Mock) or rabbit antiserum raised against human ERAP1.Proteins in the supernatants and bound to Protein G Plus–Protein A Agarose wereanalyzed by SDS-PAGE and immunoblotting. IP, immunoprecipitation. Signals specificfor ERAP1 or Grp94 were detected by enhanced chemiluminescence.An aliquot ofMock- or ERAP1-immunodepleted ER lumen was incubated with (b) ESIINFEKL or(c) QLESIINFEKL and trimming activity was assessed by RP-HPLC.The elution pro-file of products is shown.The asterisk (*) in c denotes a QLESIINFEKL-contaminat-ing peptide peak.

Mock

ER lumen

ER lumen

Protein A pellet

ERAP1

Grp94

IP

ERAP1

ERAP1 0

100

200

300

400

500

600

0

100

200

300

400

500

600

3 4 5 6 7 8 9 10 11 12

ESIINFEKL

SIINFEKLESIINFEKL

*

0 min

Mock IP130 min

A21

4A

214

3 4 5 6 7 8 9 10 11 12

A21

4

0

100

200

300

400

500

600

3 4 5 6 7 8 9 10 11 12

ESIINFEKL

*

ERAP1 IP130 min

Elution time (min)

0

100

200

300

400

3 4 5 6 7 8 9 10 11 12

0

100

200

300

400

3 4 5 6 7 8 9 10 11 12

QLESIINFEKL

QLESIINFEKL

ESIINFEKL

LESIINFEKL

SIINFEKL

*

Mock IP240 min

0 min

0

100

200

300

400

3 4 5 6 7 8 9 10 11 12

QLESIINFEKL

*

Elution time (min)

ERAP1 IP240 min

*

a

b c

©20

02 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://w

ww

.nat

ure

.co

m/n

atu

reim

mu

no

log

y

ARTICLES

www.nature.com/natureimmunology • december 2002 • volume 3 no 12 • nature immunology

lumenal fraction by 49% (Table 1); this was presumably because of theother aminopeptidases present in this fraction. Inhibitors of proteasomes(lactacystin) and of serine (phenylmethyl sulfonyl fluoride), cysteine(E64) and aspartic (pepstatin) peptidases had no consistent effects on thelumenal extract or pure enzyme36,39. Because of these similar susceptibili-ties to inhibitors and similar substrate specificities, ERAP1 appearsresponsible for the trimming activity in microsomes and in the ER lumen.

Effect of ERAP1 depletion on trimming in the ERTo test whether ERAP1 is in fact responsible for most of this activity inthe ER, we studied the effects of loss of this enzyme on differentaminopeptidase activities in the lumenal fraction. After immunodepletionwith an antiserum against human ERAP1, immunoblot analysis con-firmed almost complete removal of this protein without any loss of Grp94(Fig. 5a). As expected, loss of ERAP1 did not affect the hydrolysis of R-Amc, which was cleaved by a distinct enzyme (Fig. 2a). After removal ofERAP1, L-Amc hydrolysis decreased by only 19%, in accordance withthe finding that the ER lumen contained at least three other proteins thatare active against L-Amc (Fig. 2a). In contrast, immunodepletion ofERAP1 decreased cleavage of the NH2-terminal residue of ESIINFEKLby 75% (Fig. 5b), of QLESIINFEKL by 54% (Fig. 5c) and of the NH2-extended Sendai virus peptide HGEFAPGNYPAL by 40% (data notshown). Thus, ERAP1 is a key player in the trimming of certain precur-sors to antigenic peptides in the ER of normal cells.

Effect of IFN-γ on ERAP1 expression and activityIFN-γ induces many components of the MHC class I pathway, includingLAP, the major ESIINFEKL-trimming activity in the cytosol16. To testwhether ERAP1 is likely to contribute to antigen processing in vivo, wetested whether it is also induced by IFN-γ. After treatment of HeLa S3cells with this cytokine, the expression of ERAP1 protein and mRNA wasdetermined. This protein (but not Grp94) was induced several fold in aconcentration-dependent manner by IFN-γ (Fig. 6a); induction was evenstronger in U937 (Fig. 6b) and SW620 cells (data not shown). In addition,differential centrifugation of the HeLa cell extracts after IFN-γ treatmentshowed that most of the ERAP1 immunoreactivity (in contrast to that ofLAP) was in the microsomal fraction (Fig. 6c). This induction appears tohave resulted from increased transcription, as ERAP1 mRNA alsoincreased after IFN-γ treatment (Fig. 6d). In contrast, IFN-γ did not affectmRNA abundance for other aminopeptidases or thimet oligopeptidase24

(data not shown).To examine the biochemical consequences of this increase in

ERAP1 content, we analyzed ESIINFEKL-trimming in the microso-mal lumen from IFN-γ–treated and untreated HeLa S3 cells. IFN-γenhanced the conversion of ESIINFEKL to SIINFEKL, and this

increase was completely eliminated by immunodepletion of ERAP1(Fig. 7). Thus, ERAP1 represented the major trimming activity in theER lumen after IFN-γ treatment and appeared to be the only ESIIN-FEKL-trimming activity induced by IFN-γ (Fig. 7).

ERAP1 enhances antigen presentation in vivoThese findings suggested that ERAP plays an important role in the pro-cessing of antigenic peptides in vivo. To test whether an increase in ERAP1content, as occurs upon IFN-γ treatment, can actually enhance the genera-tion of antigenic peptides from NH2-extended precursors in the ER of intactcells, we used as a model substrate LEQLESIINFEKL targeted to the ERwith a signal sequence. This construct is trimmed efficiently in the ER tothe presented peptide9. COS cells stably transfected with H-2Kb werecotransfected with plasmids expressing LEQLESIINFEKL and eitherERAP1 or an empty vector. Two days later, cell-surface expression ofSIINFEKL–H-2Kb complexes was measured with the specific antibody25.D1.16. When ERAP1 was overexpressed, the generation of SIIN-FEKL–H-2Kb complexes from this precursor was increased approximate-ly threefold (Fig. 8a). This increase in SIINFEKL presentation required theaminopeptidase activity of ERAP1, as no such stimulation was seen upontransfection of an inactive form—an E354A mutant that was generated bysite-directed mutagenesis and should lack the catalytic Zn2+—(Fig. 8b). Torule out nonspecific effects on ER function, we cotransfected ERAP1 orthe vector alone with a plasmid expressing influenza hemagglutinin (HA).The expression and proper folding of this surface protein was not greatly

1173

Figure 6. Effect of IFN-γ on ERAP1 expression in culturedcells. (a) HeLa cells were incubated with IFN-γ for 2 days. Equalamounts of microsomal proteins were analyzed by SDS-PAGE andimmunoblotting with ERAP1 antiserum or Grp94 monoclonal antibod-ies. (b) Effect of IFN-γ treatment on ERAP1 expression in U937 cells.Equal amounts of whole-cell lysates were analyzed similarly. (c) Equalamounts of the HeLa cell cytosolic (centrifuged at 10,000g for 5 min,Supernatant) and microsomal proteins (centrifuged at 10,000g for 5min, Pellet) were analyzed by immunoblotting for ERAP1 and LAP.(d) RNA hybridization of ERAP1 transcripts in IFN-γ–treated and con-trol HeLa cells.

ERAP1

Grp94

HeLacells

0 30 300

IFN-γ (U/ml)

600 U/ml of IFN-γ (days)

0 1 2 3 4

U937cellsERAP1

IFN-γ (U/ml)

0 100 500 1500RNA

hybridizationERAP1

0 50 25 00 50 25 0

IFN-γ (U/ml)

ERAP1

LAP

Supernatant Pellet

HeLacells

a

b

c

d

Time (min)0 20 40 60 80 100

ESIIN

FEK

L tr

imm

ing

(%)

0

20

40

60

80

100

ControlIFN-γControl+ERAP1-IPIFN- γ+ERAP1-IP

Figure 7. IFN-γ enhances peptide trimming in ER lumen by induction ofERAP1. After IFN-γ treatment of HeLa cells for 2 days, ER-lumenal proteins wereextracted from microsomes of control or IFN-γ–treated cells with digitonin, andERAP1 was immunodepleted as in Fig. 5. The rates of conversion of ESIINFEKL toSIINFEKL with and without ERAP1 immunodepletion were analyzed by RP-HPLC.

©20

02 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://w

ww

.nat

ure

.co

m/n

atu

reim

mu

no

log

y

nature immunology • volume 3 no 12 • december 2002 • www.nature.com/natureimmunology

ARTICLES

affected by ERAP1 overexpression (Fig. 8c). These data demonstrated thattrimming of antigenic precursors in the ER was rate-limiting for antigenpresentation in vivo, and increasing ERAP1 expression by transfection orIFN-γ treatment enhanced this process.

DiscussionThere is growing evidence that the production by proteasomes (or signalpeptidase) of antigenic peptides with one or more additional NH2-termi-nal residue is an important source of MHC class I epitopes7. For ovalbu-min, the one model antigen that has been extensively studied, NH2-extend-ed precursors of SIINFEKL are released preferentially by proteasomes,and especially by immunoproteasomes12, and appear to be more stable incytosolic extracts6,24. Trimming of these precursors in vivo is highly effi-cient and can be catalyzed by aminopeptidases in both the cytosol andER14,22,27–30,32,40. In the ER, ERAP1 appears to be the major aminopeptidasethat is active in trimming many antigenic precursors. This enzyme dis-plays a high homology (45–49% identity) to other enzymes in the M1family of zinc-metallopeptidases, all of which contain a catalyticHEXXH(X)18E Zn-binding motif41,42 that is essential for the function ofERAP1 in antigen processing.

The function of this enzyme was unclear and roles in blood pressureregulation43 and angiogenesis44 have been suggested. We have demon-strated here that an important function of this metallopeptidase is in theprocessing of NH2-extended precursors of MHC class I epitopes in theER. Not only is it in the correct cellular compartment for such a role, butit accounts for most of the trimming of SIINFEKL precursors in microso-mal extracts, especially after IFN-γ treatment. Also, ERAP1 is sensitive tothe same protease inhibitors that block precursor processing in ER vesi-cles14,28–30 and it is expressed in all tissues tested36,39. Such a broad distrib-ution is consistent with a role in MHC class I presentation, which occursin all nucleated cells.

The subcellular localization of this enzyme has been controver-sial36,37,39. We have established here that its normal localization is inthe ER lumen because it was purified from rough microsomes, wasrecovered primarily in this fraction and was colocalized by immuno-cytochemistry with the KDEL-retention signal, a specific marker ofthe ER. The previously reported localization of A-LAP to the cytosolwas probably caused by disruption of the ER during cell homoge-nization36. In addition, this protein contains a predicted 20-residuesignal sequence at its NH2 terminus39. Because ERAP1 lacks a KDELsequence on its COOH terminus, its retention in the ER lumen isprobably mediated through an association with a KDEL-containing

protein or an ER-membrane component, such as the TAP-MHC-tapasin complex.

For certain antigenic precursors, ERAP1 is the primary processingenzyme in the ER. We found no evidence to support the proposal thatthe ER chaperone Grp94 could serve this role34, which had also beenquestioned by others35. Grp94 did not coelute with any aminopeptidasepeak, and the inhibitor sensitivity reported for its proposed aminopepti-dase activity34 does not correlate with that found for ESIINFEKL-trim-ming by the ER lumen or ERAP130. Although immunodepletion ofERAP1 from the ER lumen reduced the trimming of SIINFEKL precur-sors, additional soluble aminopeptidases were detected in the microso-mal extracts that might play a role in the processing of other antigen pre-cursors. However, it is presently unclear whether these enzymes are infact ER-resident proteins.

We found in the ER only soluble aminopeptidases and found no evi-dence of endoproteolytic or carboxypeptidase activity against extendedantigenic peptides. The cytosol also lacks carboxypeptidase activities9,10,16

but does contain several endopeptidases, which—in concert withaminopeptidases—catalyze rapid digestion of the majority of proteasomeproducts to amino acids (unpublished data). These endopeptidases, espe-cially thimet oligopeptidase, can destroy MHC class I antigenic peptidesor their precursors in the cytosol6,24 and thus limit the rate of antigen pre-sentation in vivo45.

An unusual feature of this enzyme, which suggests a role in antigen pro-cessing, is that it removes sequentially a wide range of NH2-terminal aminoacids from NH2-extended antigenic peptides, but not from peptides of 8residues or shorter. In fact, our initial identification of the ESIINFEKL-trimming activity with the enzyme termed A-LAP and PILS-AP, ERAP1,seemed problematic based on its reported specificities. When first charac-terized against fluorogenic aminopeptidase substrates, it was active onlyagainst L-Amc36,39, which led to the inaccurate name “leucyl-specificaminopeptidase”. However, it was later shown that it acts on peptide hor-mones with diverse NH2 termini37, and we found that it can cleave all NH2-terminal residues tested from antigenic precursors. This inability of ERAP1to cleave these same residues from dipeptides reflects its preference forsubstrates longer than 8 residues. For example, ERAP1 converted the 11-residue precursor to SIINFEKL, which resisted further hydrolysis. Thesefeatures are unprecedented for aminopeptidases and even suggest thatERAP1’s substrate-binding site may somehow resemble that in MHC classI molecules.

We found that efficient trimming of antigenic precursors by ERAP1 to8-residue peptides45 thus occurred in the absence of ER membranes, and

1174

Figure 8. Overexpression of ERAP1 enhances SIINFEKL generation from NH2-extended precursors in the ER. (a) COS-Kb cells were transfected with plas-mids expressing pTracerCMV-ERAP1 (bold lines) or pTracerCMV (fine lines) and cotransfected with a plasmid expressing LEQLESIINFEKL targeted to the ER by an NH2-terminal signal sequence (ss-N5-SIINFEKL). (b) COS-Kb cells were cotransfected with pTracerCMV-ss-N5-SIINFEKL and pcDNA6 expressing an inactive ERAP1 with E354mutated to A354 (bold lines) or empty vector (fine lines). (c) Cells were transfected as in a and cotransfected with influenza HA.Two days after ERAP1 transfection, the cellswere stained with (a,b) 25.D1.16 (anti–H-2Kb–SIINFEKL) or (c) H36.4.5 (anti-HA) and GFP+ cells were analyzed by flow cytometry. Shaded area (Bkg), background stainingwhere cells were transfected with empty vector and stained with 25.D1.16 or H36.4.5. Mean fluorescent intensities for each trace were (a) Bkg 7,Vector 78, ERAP1 231;(b) Bkg 8,Vector 256, E354A 256; and (c) Bkg 5,Vector 411, ERAP1 485.

1 10 100 1000 10000

Fluorescence intensity (HA)

Cel

lnu

mbe

r

Bk g ERAP1Vector

Fluorescence intensity (H-2Kb-SIINFEKL)

1 10 100 1000 10000

Cel

lnu

mbe

r

Bkg ERAP1Vector

Fluorescence intensity (H-2Kb-SIINFEKL)

1 10 100 1000 10000

Cel

lnu

mbe

r

Bk g E354AVectora b c

©20

02 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://w

ww

.nat

ure

.co

m/n

atu

reim

mu

no

log

y

ARTICLES

www.nature.com/natureimmunology • december 2002 • volume 3 no 12 • nature immunology

peptide processing in the ER does not require MHC class I or TAP28,30. Itis possible that tight binding of the mature epitopes to MHC complexes invivo may prevent further cleavages by aminopeptidases because in micro-somes lacking the appropriate MHC class I, antigenic peptides tend to bedegraded rapidly13,28–30. ERAP1 may also play a role in this degradativeprocess, as shown by its ability to trim the mature epitope FAPGNYPALat similar rates to its NH2-extended precursors. Thus, in addition to pro-cessing antigenic precursors, under certain conditions, ERAP1 candestroy certain epitopes, as shown by York et al. in this issue45.

Further evidence that ERAP1 plays a key role in antigen presentation invivo was provided by the finding that it is induced by IFN-γ, which leadsto increased processing of antigenic precursors in the ER lumen. In addi-tion to ERAP1, IFN-γ induces LAP—the enzyme most active in trimmingESIINFEKL in the cytosol16—and stimulates antigen presentation byincreasing the expression of many other components of the MHC class Ipathway, including immunoproteasomes, which generate preferentiallyNH2-extended versions of SIINFEKL during ovalbumin degradation12.IFN-γ also induces the PA28 complex and the formation of hybrid,PA28–20S-19S, proteasome complexes, which generate a greater diversi-ty of peptide products48 and may also produce longer forms of antigenicprecursors12,46,47. These NH2-extended precursors tend to be less suscepti-ble to cytosolic peptidases24 and to be transported efficiently by TAP22,23.Therefore, the IFN-γ–induced changes in proteasome function and TAP(by favoring the generation of longer precursors) and the induction of themajor ER and cytosolic aminopeptidases should have synergistic effectsin increasing the yield of antigenic peptides. Presumably the inducibilityof these enzymes helps maintain antigen presentation at low levels nor-mally, except during inflammatory states, when IFN-γ production rises.

We have presented here a variety of circumstantial evidence that indi-cates a major role for ERAP1 in MHC class I antigen processing in vivo.However, definitive evidence for a key role in antigen processing in vivowas obtained by overexpressing ERAP1 in cultured cells, which mimic-ked the response of cells to IFN-γ and stimulated the presentation of anER-targeted precursor. Thus, ERAP1 can catalyze a rate-limiting step inantigen presentation, but its actual importance in the processing of anyparticular antigenic peptide must depend on the amino acid sequencereleased by proteasomes, its affinity for the TAP transporter and its sus-ceptibility to hydrolysis by cytosolic peptidases. The findings we havepresented here show that ERAP1 can catalyze a rate-limiting step in anti-gen processing; for systematic studies on ERAP1’s importance in vivounder different physiological conditions, see the article by York et al. inthis issue45.

MethodsReagents. Peptides were synthesized by Research Genetics (Huntsville, AL), New EnglandPeptide, Inc. (Fitchburg, MA) or at a core facility at UMass Medical School and were stored indimethyl sulfoxide at –20 °C. The peptide ESIINFEKL was >95% pure by MS analysis andeluted as a single peak when a trifluoroacetic acid (TFA)–acetonitrile mobile phase was usedin RP-HPLC. The purity of other peptides was at least 80% by HPLC. The fluorogenic sub-strates and chloromethylketone inhibitors were obtained from Bachem (Basel, Switzerland)and all others were from Sigma (St. Louis, MO). Digitonin (5% solution) and the TRAPα anti-serum were provided by T. Rapoport (Harvard Medical School) and the PDI-antiserum by H. Ploegh (Harvard Medical School). Recombinant human A-LAP and the antisera against A-LAP were as described37. The monoclonal antibodies to Grp94 and ER-retention signal KDELwere from StressGen Bioreagents (Victoria, Canada).

Cell lines. All cells were from ATCC (Manassas, VA). HeLa S3 cells were grown at 37 °C inDulbecco’s modified Eagle’s medium (Irving Scientific, Santa Ana, CA), the SW620 cells werein Leibovitz’s L-15 medium (Invitrogen Corporation, Carlsbad, CA) and the U937 cells werein RPMI-1640 medium (ICN Biochemicals, Aurora, OI). All media were supplemented with10% fetal calf serum and antibiotics.

Purification of the rough ER. The ER was isolated from rat liver by discontinuous densitygradient centrifugation49. Livers were removed from freshly killed rats (200–350 g) and homo-

genized in four volumes (w/v) of buffer (50 mM HEPES-KOH at pH 7.6, 50 mM K acetate, 5 mM MgCl2, 1 mM DTT and 250 mM sucrose) in a Potter-Elvehjem glass-Teflon type tissuegrinder. All procedures were done on ice or at 4 °C. The homogenate was centrifuged at 1,500gfor 10 min and then at 20,000g for 10 min. The lipid layer was discarded and the rough ER inthe supernatant was pelleted by ultracentrifugation through a cushion of 1.3 M sucrose in thehomogenization buffer for 2.5 h at a maximum of 240,000g. To reduce contamination bycytosolic proteins, pellets were resuspended and recentrifuged at a maximum of 240,000g for60 min. Final pellets were resuspended in 50 mM HEPES-KOH at pH 7.6 containing 1 mMDTT and 250 mM sucrose and were frozen in liquid nitrogen and stored in aliquots at –80 °C.Protein concentration in the purified ER was 10–25 mg/ml. The concentration of ER proteinswas also determined by UV-absorbance at 280 nm, where 1 Eq corresponded to a vesicle con-centration in 1 µl of solution adjusted to 50 U/ml at A280. Contamination of the purified ER bycytosolic proteins was negligible, as assessed by assay of the cytosolic enzymes, thimetoligopeptidase and prolyl oligopeptidase24.

Extraction of the ER-lumenal fraction. Separation of the soluble (lumenal) and membranefractions was done as described50. The purified ER vesicles were permeabilized at a concentra-tion of 0.5 Eq/µl in 20 mM Tris-HCl buffer at pH 7.6, containing 5 mM Mg acetate, 2 mM DTT,50 mM NaCl, 12% glycerol and 0.2% digitonin. After 15–30 min on ice, samples were cen-trifuged at 300,000g for 40 min at 4 °C in a TLA 120.2 rotor. The supernatants containing lume-nal proteins were combined, and the pelleted membrane components resuspended in the start-ing volume. All samples were snap frozen in liquid nitrogen and stored at –80 °C.

Anion-exchange chromatography. Proteins extracted from the ER lumen (14 mg) wereloaded on the UNO Q-1 column (BioRad Laboratories, Hercules, CA) equilibrated in 20 mMTris-HCl buffer adjusted to pH 7.4 at room temperature, containing 2 mM Mg acetate and 12%glycerol. Bound proteins were eluted at a flow rate of 1 ml/min with a 30 ml 0–0.4 M NaClgradient. Fractions (0.5 ml) were collected, and aliquots were analyzed for aminopeptidaseactivities or by SDS-PAGE (4–12% NuPAGE Bis-Tris gradient gel, Invitrogen). Gels werestained with Coomassie blue and the protein bands that coeluted with the ESIINFEKL-trim-ming activity were selected for online RP-HPLC fractionation and tandem mass spectrometri-cal analysis and sequencing (LC–MS-MS). Mass spectrometric analysis was performed by theTaplin Spectrometry Facility (Harvard Medical School).

Aminopeptidase assays. Aminopeptidase activities were monitored with L-Amc, R-Amc orvarious NH2-extended antigenic peptides as substrates. Samples were incubated at 37 °C withfluorogenic substrates (100 µM) or synthetic peptides (150 nmol/ml) in 50 µl of buffer con-taining 50 mM Tris-HCl at pH 7.8 and 0.5 µg/µl protease-free bovine serum albumin (Sigma).Hydrolysis of fluorogenic substrates was measured at excitation and emission wavelengths of380 and 460 nm, respectively, in a continuous assay on a microplate fluorescence reader(FLUOstar Galaxy, BMG Labtechnologies GmbH, Offenburg, Germany).

The trimming of synthetic peptides was analyzed by RP-HPLC. The reactions were termi-nated by adding an equal volume of 20% trichloroacetic acid or 0.6% TFA. After 15 min onice, the precipitated protein was removed by centrifugation. The peptide-containing supernatantwas loaded on a 4.6 × 50 mm TARGA 3 µm C18 column (Higgins Analytical, Inc., MountainView, CA) in 10 mM sodium phosphate buffer at pH 6.8 containing 7% acetonitrile or in 0.06%TFA–7% acetonitrile. Elution was done with a linear 7–31.5% acetonitrile gradient. Theamount of a peptide trimmed was calculated by the integration of peptide peaks. The identityof peaks was determined by comparing their retention times to those of pure synthetic peptides.

Immunodepletion of ERAP1. Protein G Plus–Protein A Agarose (30 µl of settled resin,Oncogene, San Diego, CA) was incubated with 4 µl of rabbit preimmune serum or anti–humanA-LAP serum in 300 µl of 50 mM HEPES at pH 7.6 containing 140 mM NaCl and 10 mMKCl (immunoprecipitation-buffer). After 60 min at room temperature, resins were washed, and200 µg of the ER-lumenal proteins were added in a final volume of 300 µl/resin. After mixingfor 2 h at 4 °C, resins were pelleted and the supernatants transferred to new tubes. Resins werewashed with the immunoprecipitation buffer, and the proteins bound to resins were eluted byboiling in SDS-PAGE–loading buffer. All samples were stored at –80 °C.

Immunocytochemistry. HeLa S3 cells grown on coverslips were rinsed in PBS and fixed with4% paraformaldehyde in PBS for 15 min at room temperature. After washing with PBS, cellswere permeabilized for 5 min in PBS containing 0.3% Triton X-100 (T-PBS). Coverslips wereblocked for 1 h with T-PBS containing 3% bovine serum albumin (blocking buffer), then incu-bated with 5 µg/ml of affinity-purified anti A-LAP and anti-KDEL in blocking buffer for 1.5 h.After washing with T-PBS, cells were incubated for 1 h with 0.5 µg/ml of Alexa Fluor488–labeled anti–rabbit IgG and Alexa Fluor 568–labeled anti–mouse IgG (Molecular Probes,Eugene, OR) in blocking buffer, mounted on microscope slides with PermaFluor AqueousMounting Medium (Immunon, Pittsburgh, PA), and viewed with a Leica TCS NT laser scan-ning microscope (Leica, Wetzlar, Germany.

IFN-γ treatment and immunoblot analysis. HeLa S3 and U937 cells were treated with IFN-γ (PeproTech, Rocky Hill, NJ and Biogen, Cambridge, MA). After treatment, cells werewashed with PBS, and HeLa cells were scraped into a buffer (50 mM HEPES-KOH at pH 7.6,50 mM K acetate, 5 mM Mg acetate, 1 mM DTT, 0.5 mM EDTA and 250 mM sucrose). Aftergentle homogenization in a Potter-Elvehjem glass-Teflon tissue grinder, the homogenate wascentrifuged at 1,500g for 5 min at 4 °C. The microsomes were separated from the cytosolicfraction by spinning the 1,500g supernatant at 10,000g for 5 min. The U937 cells were lysed in50 mM Tris-HCl at pH 7.4, 150 mM NaCl, 1% NP-40, 0.25% Na deoxycholate, 0.1% SDS and

1175

©20

02 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://w

ww

.nat

ure

.co

m/n

atu

reim

mu

no

log

y

nature immunology • volume 3 no 12 • december 2002 • www.nature.com/natureimmunology

ARTICLES

1mM EDTA. HeLa lysate (20 µg) and the cytosolic or ER fractions (10 µg) were separated bySDS-PAGE. Immunoblot analysis was done as described37.

Transfection of ERAP1 and antigen-presentation assay. Cos-Kb (COS7 cells stably trans-fected with H-2Kb) cells were cultured in RPMI-1640 medium and supplemented with 10%fetal calf serum and G418 in the presence of 5% CO2. Human ERAP1 cDNA36,37 was subclonedinto pTracerCMV (Invitrogen). A minigene encoding LEQLESIINFEKL9 targeted to the ERwith a signal sequence was subcloned into pcDNA3.1 (Invitrogen), and an influenza A/PR8/34HA cDNA was subcloned into pcDNA1Amp (Invitrogen). COS-Kb cells were cotransfectedwith the use of FuGene6 with pTracerERAP1 (or a control plasmid) and a pCDNA plasmidexpressing ERAP1, HA or no antigen, according to the manufacturer’s directions (Roche,Indianapolis, IN). After 24–48 h, surface SIINFEKL-MHC complexes were detected with theantibody 25.D1.1651, which recognizes SIINFEKL in combination with H-2Kb. Influenza HAwas detected with the monoclonal antibody H36.4.5 (provided by W. Gerhard, University ofPennsylvania). Surface fluorescence of transfected, green fluorescent protein–positive (GFP+)cells was quantified by flow cytometry.

Site-directed mutagenesis. Human ERAP1 cDNA was subcloned into pcDNA6/myc-His(Invitrogen). Glu354 within the active site of ERAP1 was mutated to alanine by the PCR over-lap primer method (QuikChange XL Site-Directed Mutagenesis Kit, Stratagene, La Jolla, CA)with the 5′ primer-1 CATCACAATGACTGTGGCCCATGCACTAGCCC and the 3′ primer-2CCCAAACCACTGGTGGGCTAGTGCATGGGCCA to create the point mutation (GAA toGCA). The resulting plasmid was used for in vivo transfection. Italics denote changed codon.

Note: Supplementary information is available on the Nature Immunology website.

Note added in proof. While this article was in press, similar results were reported in Serwold,T. et al., ERAAP customizes peptides for MHC class I molecules in the endoplasmic reticu-lum. Nature 419, 480–483 (2002).

Acknowledgments

We thank S.Trombley for assistance in preparing this manuscript, A.Tibebu Kassa in for helpwith experiments and M. Jedrychowski and S. Gygi for LC-MS/MS analyses. Supported bygrants from the NIH (to A. L. G. and K. L. R.).

Competing interests statementThe authors declare that they have no competing financial interests.

Received 3 July 2002; accepted 18 October 2002.

1. Rock, K. L. et al. Inhibitors of the proteasome block the degradation of most cell proteins and the gen-eration of peptides presented on MHC class I molecules. Cell 78, 761–771 (1994).

2. Harding, C.V. et al. Novel dipeptide aldehydes are proteasome inhibitors and block the MHC-I antigen-processing pathway. J. Immunol. 155, 1767–1775 (1995).

3. Cerundolo,V. et al.The proteasome-specific inhibitor lactacystin blocks presentation of cytotoxic T lym-phocyte epitopes in human and murine cells. Eur. J. Immunol. 27, 336–341 (1997).

4. Craiu,A. et al. Lactacystin and clasto-lactacystin β-lactone modify multiple proteasome β-subunits andinhibit intracellular protein degradation and major histocompatibility complex class I antigen presenta-tion. J. Biol. Chem. 272, 13437–13445 (1997).

5. Kisselev,A. F.,Akopian,T. N.,Woo, K. M. & Goldberg,A. L.The sizes of peptides generated from proteinby mammalian 26 and 20S proteasomes. Implications for understanding the degradative mechanism andantigen presentation. J. Biol. Chem. 274, 3363–3371 (1999).

6. Goldberg,A. L., Cascio, P., Saric,T. & Rock, K. L.The importance of the proteasome and subsequent pro-teolytic steps in the generation of antigenic peptides. Mol. Immunol. 39, 147–164 (2002).

7. Botbol,V. & Scornik, O.A. Peptide intermediates in the degradation of cellular proteins. Progress Biol. Res.180, 573–583 (1985).

8. Rock, K. L. & Goldberg,A. L. Degradation of cell proteins and the generation of MHC class I-presentedpeptides. Annu. Rev. Immunol. 17, 739–779 (1999).

9. Craiu,A.,Akopian,T., Goldberg,A. & Rock, K. L.Two distinct proteolytic processes in the generation ofa major histocompatibility complex class I-presented peptide. Proc. Natl. Acad. Sci. USA 94,10850–10855 (1997).

10. Mo, X.Y., Cascio, P., Lemerise, K., Goldberg,A. L. & Rock, K. Distinct proteolytic processes generate theC and N termini of MHC class I-binding peptides. J. Immunol. 163, 5851–5859 (1999).

11. Lucchiari-Hartz, M. et al. Cytotoxic T lymphocyte epitopes of HIV-1 Nef: Generation of multiple defini-tive major histocompatibility complex class I ligands by proteasomes. J. Exp. Med. 191, 239–252 (2000).

12. Cascio, P., Hilton, C., Kisselev,A. F., Rock, K. L. & Goldberg,A. L. 26S proteasomes and immunoprotea-somes produce mainly NH2-extended versions of an antigenic peptide. EMBO J. 20, 2357–2366 (2001).

13. Paz, P., Brouwenstijn, N., Perry, R. & Shastri, N. Discrete proteolytic intermediates in the MHC class I anti-gen processing pathway and MHC I-dependent peptide trimming in the ER. Immunity 11, 241–251 (1999).

14. Serwold,T., Gaw, S. & Shastri, N. ER aminopeptidase generate a unique pool of peptides for MHC class Imolecules. Nature Immunol. 2, 644–651 (2001).

15. Knuehl, C. et al. The murine cytomegalovirus pp89 immunodominant H-2Ld epitope is generated andtranslocated into the endoplasmic reticulum as an 11-mer precursor peptide. J. Immunol. 167,1515–1521 (2001).

16. Beninga, J., Rock, K. L. & Goldberg,A. L. Interferon-γ can stimulate post-proteasomal trimming of theN terminus of an antigenic peptide by inducing leucine aminopeptidase. J. Biol. Chem. 273,18734–18742 (1998).

17. Stoltze, L. et al.Two new proteases in the MHC class I processing pathway. Nature Immunol. 1,413–418 (2000).

18. Harris, C.A., Hunte, B., Krauss, M. R.,Taylor,A. & Epstein, L. B. Induction of leucine aminopeptidase byinterferon-γ. Identification by protein microsequencing after purification by preparative two-dimensionalgel electrophoresis. J. Biol. Chem. 267, 6865–6869 (1992).

19. Gaczynska, M., Rock, K. L. & Goldberg,A. L. γ-interferon and expression of MHC genes regulate peptidehydrolysis by proteasomes. Nature 365, 264–267 (1993).

20. Gaczynska, M., Rock, K. L., Spies,T. & Goldberg,A. L. Peptidase activities of proteasomes are differentiallyregulated by the major histocompatibility complex-encoded genes for LMP2 and LMP7. Proc. Natl.Acad.Sci. USA 91, 9213–9217 (1994).

21. Gaczynska, M., Goldberg,A. L.,Tanaka, K., Hendil, K. B. & Rock, K. L. Proteasome subunits X and Y alterpeptidase activities in opposite ways to the interferon-γ-induced subunits LMP2 and LMP7. J. Biol. Chem.271, 17275–17280 (1996).

22. Lauvau, G. et al. Human transporters associated with antigen processing (TAPs) select epitope precursorpeptides for processing in the endoplasmic reticulum and presentation to T cells. J. Exp. Med. 190,1227–1239 (1999).

23. Neisig,A. et al. Major differences in transporter associated with antigen presentation (TAP)-dependenttranslocation of MHC class I-presentable peptides and the effect of flanking sequences. J. Immunol. 154,1273–1279 (1995).

24. Saric,T. et al. Major histocompatibility complex class I-presented antigenic peptides are degraded incytosolic extracts primarily by thimet oligopeptidase. J. Biol. Chem. 276, 36474–36481 (2001).

25. Elliott,T.,Willis,A., Cerundolo,V. & Townsend,A. Processing of major histocompatibility class I-restrictedantigens in the endoplasmic reticulum. J. Exp. Med. 181, 1481–1491 (1995).

26. Lobigs, M., Chelvanayagam, G. & Mullbacher,A. Proteolytic processing of peptides in the lumen of theendoplasmic reticulum for antigen presentation by major histocompatibility class I. Eur. J. Immunol. 30,1496–1506 (2000).

27. Snyder, H. L.,Yewdell, J.W. & Bennink, J. R.Trimming of antigenic peptides in an early secretory compart-ment. J. Exp. Med. 180, 2389–2394 (1994).

28. Fruci, D., Niedermann, G., Butler, R. H. & van Endert, P. M. Efficient MHC class I-independent amino-termi-nal trimming of epitope precursor peptides in the endoplasmic reticulum. Immunity 15, 467–476 (2001).

29. Brouwenstijn, N., Serwold,T. & Shastri, N. MHC class I molecules can direct proteolytic cleavage of anti-genic precursors in the endoplasmic reticulum. Immunity 15, 95–104 (2001).

30. Komlosh,A. et al.A role for a novel luminal endoplasmic reticulum aminopeptidase in final trimming of26S proteasome-generated major histocompatability complex class I antigenic peptides. J. Biol. Chem.276, 30050–30056 (2001).

31. Lyko, F., Martoglio, B., Jungnickel, B., Rapoport,T.A. & Dobberstein, B. Signal sequence processing in roughmicrosomes. J. Biol. Chem. 270, 19873–19878 (1995).

32. Snyder, H. L., Bacik, I.,Yewdell, J.W., Behrens,T.W. & Bennink, J. R. Promiscuous liberation of MHC-class I-binding peptides from the C termini of membrane and soluble proteins in the secretory pathway. Eur. J.Immunol. 28, 1339–1346 (1998).

33. Falk, K., Rötzschke, O. & Rammensee, H.-J. Cellular peptide composition governed by major histocom-patibility complex class I molecules. Nature 348, 248–250 (1990).

34. Menoret,A., Li, Z. H., Niswonger, M. L.,Altmeyer,A. & Srivastava, P. K.An endoplasmic reticulum proteinimplicated in chaperoning peptides to major histocompatibility of class I is an aminopeptidase. J. Biol.Chem. 276, 33313–33318 (2001).

35. Reed, R. C., Zheng,T. & Nicchitta, C.V. Grp94-associated enzymatic activities: Resolution by chromato-graphic fractionation. J. Biol. Chem. 277, 25082–25089 (2002).

36. Hattori,A., Matsumoto, H., Mizutani, S. & Tsujimoto, M. Molecular cloning of adipocyte-derived leucineaminopeptidase highly related to placental leucine aminopeptidase/oxytocinase. J. Biochem. (Tokyo) 125,931–938 (1999).

37. Hattori,A. et al. Characterization of recombinant human adipocyte-derived leucine aminopeptidaseexpressed in Chinese hamster ovary cells. J. Biochem. (Tokyo) 128, 755–762 (2000).

38. Hattori,A., Matsumoto, K., Mizutani, S. & Tsujimoto, M. Genomic organization of the human adipocyte-derived leucine aminopeptidase gene and its relationship to the placental leucine aminopeptidase/oxy-tocinase gene. J. Biochem. (Tokyo) 130, 235–241 (2001).

39. Schomburg, L., Kollmus, H., Friedrichsen, S. & Bauer, K. Molecular characterization of a puromycin-insen-sitive leucyl-specific aminopeptidase, PILS-AP. Eur. J. Biochem. 267, 3198–3207 (2000).

40. Roelse, J., Gromme, M., Momburg, F., Hämmerling, G. & Neefjes, J.Trimming of TAP-translocated peptidesin the endoplasmic reticulum and in the cytosol during recycling. J. Exp. Med. 11, 1591–1597 (1994).

41. Keller, S. R., Scott, H. M., Mastick, C. C.,Aebersold, R. & Lienhard, G. E. Cloning and characterization ofa novel insulin-regulated membrane aminopeptidase from Glut4 vesicles. J. Biol. Chem. 270,23612–23618 (1995).

42. Rogi,T.,Tsujimoto, M., Nakazato, H., Mizutani, S. & Tomoda,Y. Human placental leucineaminopeptidase/oxytocinase.A new member of type II membrane-spanning zinc metallopeptidase family.J. Biol. Chem. 271, 56–61 (1996).

43. Yamamoto, N. et al. Identification of 33 polymorphisms in the adipocyte-derived leucine aminopeptidase(ALAP) gene and possible association with hypertension. Hum. Mutat. 19, 251–257 (2002).

44. Miyashita, H. et al. A mouse orthologue of puromycin-insensitive leucyl-specific aminopeptidase isexpressed in endothelial cells and plays an important role in angiogenesis. Blood 99, 3241–3249 (2002).

45. York, I.A. et al. The ER aminopeptidase, ERAP1, enhances or limits antigen presentation by trimming epi-topes to 8–9 residues. Nature Immunol. 3, 1177–1184 (2002).

46. Kohler,A. et al. The axial channel of the proteasome core particle is gated by the Rpt2 ATPase and con-trols both substrate entry and product release. Mol. Cell 7, 1143–1152 (2001).

47. Whitby, F. G. et al. Structural basis for the activation of 20S proteasomes by 11S regulators. Nature 408,115–120 (2000).

48. Cascio, P., Call, M., Petre, B. M.,Walz,T. & Goldberg,A. L. Properties of the hybrid form of the 26S pro-teasome containing both 19S and PA28 complexes. EMBO J. 21, 2636–2645 (2002).

49. Walter, P. & Blobel, G. Preparation of microsomal membranes for cotranslational protein translocation.Meth. Enzymol. 96, 84–93 (1983).

50. Wang, L. & Dobberstein, B. Oligomeric complexes involved in translocation of proteins across the mem-brane of the endoplasmic reticulum. FEBS Lett. 457, 316–322 (1999).

51. Porgador,A.,Yewdell, J.W., Deng,Y., Bennink, J. R. & Germain, R. N. Localization, quantitation, and insitu detection of specific peptide-MHC class I complexes using a monoclonal antibody. Immunity 6,715–726 (1997).

1176

©20

02 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://w

ww

.nat

ure

.co

m/n

atu

reim

mu

no

log

y