An Exopolyphosphatase of Escherichia Coli

THE JOURNAL 0 1993 by The American Society for Blochemistry

OF BIOLOGICAL CHEM!STRY and Molecular Biology, Inc.

Vol. 268, No. 1, Issue of January 5, pp. 633-639.1993 Printed in U.S.A.

An Exopolyphosphatase of Escherichia coli THE ENZYME AND ITS ppx GENE IN A POLYPHOSPHATE OPERON*

(Received for publication, July 6,1992)

Masahiro AkiyamaS, Elliott Crooket, and Arthur Kornberg From the Department of Biochemistry, Stanford University School of Medicine, Stanford, California 94305-5307

A gene, ppx, that encodes a novel exopolyphosphatase of 513 amino acids (58,133 Da) was found downstream of the gene for polyphosphate kinase, ppk. Transcription of the ppx gene depends on the ppk promoters, indicating a polyphosphate (polyp) operon of ppk and ppx. Exopolyphosphatase, purified to ho- mogeneity from overproducing cells, is judged to be a dimer of 68-kDa subunits. Orthophosphate is released processively from the ends of polyp -500 residues long, but chains of -15 residues compete poorly with polyp as substrate; ATP is not a substrate. Mg2+ (1 mM) and a high concentration of K+ (175 mM) support optimal activity.

Inorganic polyphosphate (polyP) includes linear polymers of orthophosphate with chain lengths up to 1000 or more (1). Polyp is ubiquitous, having been found in bacteria, yeast, amebas, and mammals; yet relatively little is known about the enzymes that metabolize polyp or the physiological functions of polyp (2). Among the functions proposed for polyp are (i) phosphate and energy reservoirs with obvious osmotic advantage over Pi and ATP, (ii) a substitute for ATP for certain sugar kinases ( 3 4 , (iii) an association with poly-@- hydroxybutyrate and Ca2+ in a membrane domain of transformable cells (6), (iv) a pH-stat mechanism to counterbal- ance alkaline stress (7), and (v) a regulator of promoter selectivity by RNA polymerase in stationary phase cells.2

An Escherichia coli enzyme responsible for polyp synthesis is the homotetrameric polyphosphate kinase (8), which poly- merizes the terminal phosphate of ATP into polyp in a freely reversible reaction (nATP e nADP + polyP,) (9, 10). Poly-

* This work was supported in part by National Institutes of Health Grant GM07581 and National Science Foundation Grant DMB87- 1007945. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequencefs) reported in this paper has been submitted

LO6129. to the GenBankTM/EMBL Data Bank with accession number(s)

3 Present address: c/o Dr. Bruce Stillman, Cold Spring Harbor Laboratory, P. 0. Box 100, Bungtown Rd., Cold Spring Harbor, NY 11724.

Fellowship DRG-983. 8 Supported by Damon Runyon-Walter Winchell Cancer Fund

The abbreviations used are: polyp, long-chain polyphosphate, ADA, N-(2-acetamido)-2-iminodiacetic acid; CHES, 2-(cyclohexy- 1amino)ethanesulfonic acid; MES, 2-(N-morpholino)ethanesulfonic acid; MOPS, 3-(N-morpholino)propanesulfonic acid; polyP3, tripolyphosphate; polyP,, tetrapolyphosphate; polyP16, polyphosphate mixture with average chain length of 15; PPX, exopolyphosphatase; PAGE, polyacrylamide gel electrophoresis; Tricine, N-tris- (hydroxymethy1)methylglycine; kb, kilobase(s). A. Ishihama, personal communication.

63

phosphate kinase is associated with the membrane fraction in cell lysates and must be detached for purification; purified polyphosphate kinase reassociates with the membrane fraction (11). The ppk gene encoding polyphosphate kinase, located at 53.4 min on the E. coli linkage map (12), has been overexpressed (11).

In the course of analyzing clones of the ppk gene, we discovered an adjacent gene (ppx) encoding a novel exopolyphosphatase (PPX); the two genes constitute a polyp operon. Here we report the identification of the ppx gene, its DNA sequence, the expression of the gene by the ppk promoters, the purification of PPX, and characteristics of its action.

EXPERIMENTAL PROCEDURES

Reagents and Proteins-Sources were as follows: ATP, S-Sepha- rose fast flow, Mono Q HR5/5, and Superose-12 HR10/30, Pharmacia LKB Biotechnology Inc.; [y3P]ATP, Amersham Corp.; DNase I, RNase A, glucose 1-phosphate, and glucose 6-phosphate, Boehringer Mannheim; DE52-cellulose, Whatman; bacterial alkaline phosphatase, U. S. Biochemical Corp.; ADP, tripolyphosphate (polyp3), tetrapolyphosphate (polyP,), and a mixture (polyPI& Sigma; polyethyleneimine-cellulose F and cellulose plates, Merck; and dimethyl adi- pimidate dihydrochloride and dimethyl suberimidate dihydrochloride, Aldrich.

Bacterial Strains-Bacterial strains used are derivatives of E. coli K12: W3110 (X-,IN[rrnD-rrnE]I), DH5a (supE44,AlacUI69[~8OlacZ aM15],hsdRI7,recAl,endAl.gyrA96,thi-l,relAl), and CA36 (A(lac- proAB),supE,thi,srl-3OO::TnIO,recA56/F[traD36,proAB+,lacIq, lacZaM151). W3110 served as a host strain for pBClO to overproduce PPX for purification. DH5a or CA36 (11) was used to determine the levels of polyphosphate kinase and PPX overproduction induced by the plasmids. DH5a was also the host strain for preparation of plasmid DNA.

Construction of Plasmids-Starting from X phage 10H6 of the Kohara library of the E. coli genome (13), a 5.5-kb BglI fragment was subcloned into the S m I site of pUC18 in either orientation to produce pBC9 and pBClO (Fig. 1) (11). Similarly, a 3.8-kb EcoRI fragment was subcloned into the EcoRI site of pUC18 in either orientation to produce pBC5 and pBC6; both lack the ppk promoters (Fig. 1). In pBC6 and pBC10, the reading frame of the ppx gene is placed in the same orientation as that of the lac gene. Complete digestion of pBC9 by KpnI endonuclease and self-ligation resulted in pBC29; digestion

pBC30. of pBClO by KpnI endonuclease, followed by self-ligation, produced

DNA Sequencing-DNA sequencing of theppx gene was performed by Dr. Shauna Brummet (U. S. Biochemical Corp. Custom Sequenc- ing Service) and Alan Smith (PAN facility, Stanford University) as described (14). The strategy for sequencing the ppx gene is shown in Fig. 2. For ppx, -97% of the final sequence of 1884 base pairs was determined from both strands (see Fig. 3). The nucleotide and deduced protein sequences were analyzed with the FASTDB program (IntelliGenetics) and with BLASTP and BLASTN (15).

Assay for Polyphosphate Kinuse-The assay measured the produc- tion of acid-insoluble [32P]polyP from [T-~P]ATP (8). One unit of enzyme is defined as the amount incorporating 1 pmol of phosphate into acid-insoluble polyP/min at 37 C.

Preparation of P2P]PolyP-Synthesis was performed as in the assay for polyphosphate kinase, except that the reaction volume was increased 50-fold to 12.5 ml, and [T-~~P]ATP was used at 10 Ci/mol

;3

634 Exopolyphosphatase

FIG. 1. Polyphosphate operon and recombinant plasmids. A. orzaniza-

- "

tion of ppk an> ppx on E.' coli DNA carried in X phage 10H6 (13). The wavy arrow indicates the start and the direc- purN PPk ! PPX ! tion of transcription of the polyp operon. The stippled box is X phage vector DNA, and the other boxes are E. coli DNA. E, EcoRI; G, Bg& Q, KpnI. The EcoRI site shown at the junction of the E. coli DNA insert and the X vector DNA comes from the X vector DNA. An additional KpnI site is present in the vector. B, DNA fragments carried in the pUC18 vector. The plasmids were constructed as described under "Experimental Proce- dures." Arrows indicate the direction of transcription of both the lac and bla promoters of pUCl8.

O 0 E

- pBCS pBC10 - pBC5 P B a

t- pBC29

pBC30

""e-+ c- c- "c- *"

+ c - "-+" - .-, +"4 -t H

100 bp FIG. 2. Strategy for sequencing ppx. Nucleotide sequences in

ppx were determined as indicated by the directions and lengths of the arrows. The open reading frames shown are ppk (hatched box) and ppx (filled b o x ) . E, EcoRI; Q, KpnI. bp, base pairs.

TABLE I Polyphosphate kinase and PPX actiuity

of cells harboring various plasmids DH5a and CA36 cells harboring the indicated plasmids were grown

in LB medium (23) containing ampicillin (50 pg/ml) at 30 "C. At an absorbance (Amnm) of 0.04, the culture was shifted to 37 "C and grown to an Amm of -1.0. Cell pellets were collected, resuspended, and treated as described previously (8). The values include the ac- tivities of both the soluble and particulate fractions.

0 1 2 3 4 5 6 I I kb

PPW PPX

Host 10' units/g -fold lo' units/g -fold cells ovemroduction cells ovemroduction

~

DH5a p U C l 8 DH5a pBC6 DH5a pBClO DH5a pBC29 DH5a pBC3O

CA36 pUC18 CA36 pBC5 CA36 D B C ~

39 1.0 14 4.5 0.1 360

2500 64 830 2200 56 14

43 1.1 12

14 52

1100

26 59

1.0

1.0 0.9

1.0 3.7

79 PPK, polyphosphate kinase.

(8). With lo6 units of purified polyphosphate kinase, -50% of the 32P was incorporated into acid-insoluble polyp after 3 h a t 37 "C. The reaction was stopped by adding EDTA (50 mM) and extracted with phenol/CHC13 (1:l) once, followed by CHC13/isoamyl alcohol (24:l) three times. The long-chain polyp was further purified with slight modifications as described (16). The aqueous phase was mixed with 2 volumes of 2-butanol and placed at -20 "C for 30 min. [32P]PolyP was precipitated by centrifugation at 15,000 X g for 15 min (4 "C). The resulting pellet was washed twice with cold 70% acetone and dried. The dried pellet was dissolved twice in 0.5 ml of 50 mM EDTA and precipitated with 2 volumes of 2-butanol. The recovery of acid- insoluble [32P]polyP was 80%, and the purity of polyp was >99%. The average chain length of this ["P]polyP based on polyacrylamide gel analysis (17) was -500 residues.

Assay for PPX-The assay for PPX measured the loss of acid- insoluble [32P]polyP. The reaction mixture (100 pl) contained 50 mM Tricine/KOH (pH 8.0),1 mM MgCl', 175 mM KCI, 50 nM [32P]polyP (25 p M in phosphate residues), and PPX as indicated. MgC1, was added last to avoid precipitation of the polyp. After incubation for 15 min at 37 "C, the reaction was stopped by adding 100 pl of 7% HClO, and 20 pl of 2 mg/ml bovine serum albumin. The [32P]polyP remaining was measured in a liquid scintillation counter after collec- tion on a Whatman GF/C glass-fiber filter and washing with a solution of 1 M HCl and 0.1 M sodium pyrophosphate, followed by ethanol. One unit of enzyme is defined as the amount that decreases the acid-insoluble polyp by 1 pmol/min at 37 "C.

Assay for Bacterial Alkaline Phosphatase-Bacteria1 alkaline phosphatase was assayed by measuring hydrolysis of [y3'P]ATP. The reaction mixture (10, 20, or 100 pl) was 1 M Tris-HC1 (pH 8.0), 25 p~ [y3'P]ATP, and bacterial alkaline phosphatase as indicated. After incubation at 37 "C for 15 min, the reaction was stopped by adding an equal volume of nonlabeled 10 mM ATP and chilling on ice. A sample (2 pl) was spotted on a polyethyleneimine-cellulose F plate, and chromatography was performed with 0.4 M LiCl, 1 M formic acid. The ATP spot was located by 256 nm UV light and cut out with scissors; the [T-~'P]ATP that remained was measured in a liquid scintillation counter. Bacterial alkaline phosphatase specific activity was measured using p-nitrophenyl phosphate (18). One bacterial alkaline phosphatase unit is defined as the amount hydrolyzing 1 pmol of p-nitrophenyl phosphate/min at 25 "C.

Analysis of PPX Hydrolysis Products-The PPX reaction (200 11) was performed at 37 "C; samples (20 pl) were taken periodically. The reaction was terminated by adding 5 pl of 450 mM Tris borate (pH 8.3), 13.5 mM EDTA. The acid-insoluble polyp was detected by HCIOI precipitation as in the PPX assay. The amount of total polyp was determined as polyp remaining at the origin on a polyethyleneimine plate after development with solvent system A (0.25 M Licl, 1 M formic acid). Orthophosphate was separated by chromatography on the polyethyleneimine plate with solvent system A. To determine the amount of long-chain polyp, samples were loaded on a polyacrylamide gel (6% acrylamide, 0.3% bisacrylamide, 8 M urea, 89 mM Tris borate (pH 8.3), 2.7 mM EDTA), and electrophoresis was performed at 750 V with electrophoresis buffer (90 mM Tris borate (pH 8.3), 2.7 mM EDTA) (17). Short chains were determined on a cellulose plate developed for 24 h with isobutyric acid/NH,OH/water (25:3:12) containing 0.8 mM EDTA (7). As references, sodium phosphate, polyP3, and polyp4 were used and, after chromatography, visualized with an ammonium molybdate spray (19).

Other Methods-Cross-linking of the protein with dimethyl adi- pimidate dihydrochloride or dimethyl suberimidate dihydrochloride (20), SDS-PAGE (21), protein concentrations (22) using bovine serum albumin as a standard, and DNA manipulations (23) were performed as described. The amino-terminal sequence of PPX was determined with an Applied Biosystems 470 Gas-phase Protein Sequencer with on-line high pressure liquid chromatography by Alan Smith.

RESULTS

Identification of Exopolyphosphutase and Its Gene, ppx-An extract from cells bearing pBC6, a plasmid that carries a 3.8-

Exopolyphosphatase 635

10 20 30 40 50 60 70 80 90

CTTGGTTC~CAGTTTTCACATGGTCATAGCCCGTGTGGTAGATGGTGCCATGCAGATTATTGGCCGCCTG~CAGCGGGTGCATCTG LeuGlySerAsnSerPheHisMetValIleAlaArgValValAspGlyAlaMetGlnIleIleGlyArgLeuLysGlnArgValHisLeu

GCGGACGGCCTGGGGCCAGATMTATGTTGAGTGMGAGGCMTGACGCGCGGTTT~CTGTCTGTCGCTGTTTGCCGMCGGCTACM AlaAspGlyLeuGlyProAspAsnMetLeuSerGluGluAlaMecThrArgG1yLeuAsnCysLeuSerLeuPheAlaGluArgLeuG~n

GGGTTTTCTCCTGCCAGCGTCTGTATAGTTGGTACCCATACGCTGCGTCAGGCGCTGMCGCCACTGACTTTCTG~CGCGCGG-G GlyPheSerProAlaSerValCysIleValGlyThrHisThrLeuArgGlnAlaLeuAsnAlaThrAspPheLeuLysArgA~aGluLys

GTCATTCCCTACCCGATTGATATTTCCGGTMTGMGMGCCCGTCTGATTTTTAT~GCGTGGMCATACCC~CCGG~GGT ValIleProTyrProIleGluIleIleSerGlyAsnGluGluAlaArgLeuIlePheMetGlyValGluHisThrGlnProGluLysGly

CGCAAACTGGTTATTGATATTGGCGGCGGATCTACGGMCTGGTGATTGGTG~TTTCGMCCTATTCTCGTTG~GCCGCCGGATG ArgLysLeuValIleAspI1eGlyGlyGlySerThrGluLeuValIleGlyGluAsnPheGluProIleLeuValGluSerArgArgMet

GGTTGTGTCAGCTTTGCCCAGCTTTATTTTCCTGGCGGGGTCATCMT~GAGMTTTTCAGCGCGCTCGCATGGCGGCAGCAC~ GlyCysValSerPheAlaGlnLeuTyrPheProGlyGlyValIleAsnLysGluAsnPheGlnArgAlaArgMetAlaAlaAlaGlnLys

CTGGAAACTTTMCCTGGCMTTCCGTATTCAGGGCTGGMCGTTGCMTGGGCGCTTCCGGTACCAT-GCCGCCCATGMGTGTTA LeuGluThrLeuThrTrpGlnPheArgIleGlnGlyTrpAsnValAlaMetGlyAlaSerGlyThrIleLysAlaAlaHisGluValL@u

ATGGAAATGGGCGAGAAAGAC~GATMTTACCCCGGMCGTCT~~CTGGT-GMGTTTTACGTCACCGTMTTTCGCATCG MetGluMetGlyGluLysAspGlyI1eIleThrProGluArgLeuGluLysLeuValLysGluValLeuArgHisArgAsnPheAlaSer

CTGAGTTTACCGGGTCTTTCCGMGAGCGGAAAACAGTCTTCGTTCCGGGACTGGCGATTTTATGCGGTGTGTTTGATGCTTTAGCCATC LeuSerLeuProGlyLeuSerGluGluArgLysThrValPheValProGlyLeuAlaIleL@uCysGlyValPheAspAlaLeuAlaIle

CGTGMCTGCGCCTTTCTGACGGGGCGTTACGCGMGGCGTACTGTATG~TGG~GGACGTTTCCGTCATCAGGATGTGCGTAGTCGC ArgGluLeuArgLeuSerAspGlyAlaLeuArgGluGlyValLeuTyrGluMetGluGlyArgPheArgHisGlnAspValArgSerArg

ACCGCCAGCAGCCTCGCCMCCAGTATCACATCGACAGCGMCAGGCCCGACGGGTGCTGGATACCACTATGC~TGTACG~CAGTGG ThrAlaSerSerLeuAlaAsnGlnTyrHisIleAspSerGluGlnAlaArgArgValLeuAspThrThrMetGlnMetTyrGluGlnTrp

CGGGMCAGCMCCGMGCTGGCGCATCCGCMCTGGAGGCGCTACTGCGATGGGCCGCCATGCTGCATGAGGTCGGGTTGMTATCMC ArgGluGlnGlnProLysLeuAlaHisProGlnLeuGluAlaLeuLeuArgTrpAlaAlaMecLeuHisGluValGlyLeuAsnIleAsn

CACAGCGGTTTGCATCGCCACTCCGCTTATATTCTGC-CAGTGACTTGCCGGGTTTTMTCAGGMCAGCAGCTGATGATGGCGACA HisSerGlyLeuHisArgHisSerAlaTyrIleLeuGlnAsnS~rAspLeuProGlyPheA~nGlnGluGlnGlnLeuMetMetAlaThr

CTGGTGCGCTATCACCGTACGATTMGCTCGACGATCTACCGCGCTTTACCTTGTTT~GMG~CAGTTCCTGCCACTGATACAG LeuValArgTyrHisArgLysAlaIleLysLeuAspAspLeuProArgPheThrLeuPh@LysLysLysGlnPheLeuProLeuIleGln

CTATTGCGCCTTGGCGTATTACTCMCMTCMCGTCAGGCMCCACCA~CCGCCMCATTGACGCTGATTACTGATGACAGTCACTGG LeuLeuArgLeuGlyValLeuLeuAsnAsnGlnArgGlnAlaThrThrThrProProThrLeuThrLeuIleThrAspAspSerHisTrp

ACACTGCGTTTCCCGCATGACTGGTTTAGTCAGMTGCGCTGGTACTGCTTGATCTGG~GGAGCMGMTACTGGGMGGCGTGGCT ThrLeuArgPheProHisAspTrpPheSerGlnAsnAlaLeuValLeuLeuAspLeuGluLysGluGlnGluTyrTrpGluGlyValAla

G G C T G G C G G T T G A A A A T T G M G M G ~ G T A C A C C A G A A A T G T C G G C C C G C A T T A T T GlyTrpArgLeuLysIleGluGluGluSerThrProGluIleAlaAla

CAGGCACTTTCGCGMTGGGTTCGATTTCATTCAGCGTATCMTTMCGGCTGCGGCTTACC~TMGATMCCCTGCATATMTCGATC

CCC~GAGAGCACCGCCTCGCGGATCTCTTCGTTTTCMCGTACTCTGCCACTACCAGCATTTTCTTCATTCGCGCCAGGTGGC~TC

GATGCCACTATCTGATMTCCAGACTATTTGACACMTATTGCGGATAAAACTGCCGTCMTTTT~GCAGATCCGGGG~TTC

90

180

270

360

4 5 0

5 4 0

630

720

810

900

990

1080

1170

1260

1350

1440

1530

1620

1710

1800

1 8 8 4

FIG. 3. Nucleotide sequence of ppx. The nucleotide sequence of the noncoding strand of ppx is given from 5 to 3, starting at nucleotide 40 and terminating at nucleotide 1581. The predicted amino acid sequence is also shown. The amino-terminal amino acid sequence determined from the pure PPX (underlined) agrees with the deduced amino acid sequence. The 3-end of the ppk gene is indicated by the box .

kb EcoRI fragment but lacks the intact gene for the polyphosphate kinase (Fig. l ) , not only showed a 10-fold decrease in polyphosphate kinase activity compared with cells harboring vector pUC18 (Table I), but also hydrolyzed [32P]polyP to orthophosphate more effectively than cells harboring the vector plasmid. These results suggested that a region downstream of ppk carries a gene encoding a phosphatase for polyp.

The ppk gene had been located in a 5.5-kb DNA fragment from X phage 10H6 (11) and cloned in pUC18 as shown in Fig. 1. High levels of polyphosphatase activity were associated with both pBC6 and pBC10, which carry the region downstream of ppk (Fig. 1 and Table I). Digestion of this region with KpnI endonuclease abolished the phosphatase activity (as in pBC3O). DNA sequence analyses revealed that this region contains an open reading frame of 1539 base pairs (nucleotides 40-1578) that spans the two KpnI sites and encodes a protein of 513 amino acids with a calculated mass of 58,133 Da (Fig. 3). This open reading frame (ppx) , which encodes the PPX (see below), is located 7 base pairs downstream of ppk and transcribed in the same direction as ppk.

Polyp Operon Made Up of ppk and ppx-PPX was not overproduced from pBC6 in lacF cells (CA36), in which the lac repressor is present at levels higher than in wild-type cells

(data not shown). In view of the overproduction of PPX from pBC6 in lad+ cells (DH5a), there would appear to be a loose repression of the lac promoter. To study the expression ofppx without the influence of strong promoters in the vector DNA, ppx was oriented in the direction opposite to transcription of both the lac and blu genes (Fig. 1). The resultant plasmids were pBC5 with a 3.8-kb EcoRI fragment lacking a 0.9-kb BgZI-EcoRI fragment presumably carrying the ppk promoters and pBC9 with a 5.5-kb BglI fragment containing the ppk promoters (11). When CA36 cells harboring each plasmid were grown ( l l ) , overproduction of PPX was 79-fold for pBC9 and only 3.7-fold for pBC5 (Table I). Thus, althoughppx may have its own very weak promoter, most of the expression of ppx depends on the 0.9-kb fragment with the presumed ppk promoters. Furthermore, insertion of the knn gene into ppk on the chromosome disrupted not only polyphosphate kinase, but also the PPX a~tivity.~ These data suggested that ppx constitutes a polyp operon with the ppk gene. Whereas a Shine-Dalgarno sequence was identified upstream of ppk, none is apparent for ppx (Fig. 3).

Purification of PPX-Inasmuch as ppx is cotranscribed

E. Crooke, M. Akiyama, and A. Kornberg, unpublished data.

636 Exopolyphosphatase TABLE I1

Purification of PPX from overproducing cells Strain W3110/pBC10 was grown in LB medium (23) containing 50 pg/ml ampicillin a t 30 "C. At an absorbance (Amnm) of 0.05, the

temperature was shifted to 37 "C, and growth was continued for 4 h to an Amnm of -1.4. Unless indicated, all manipulations were 0-4 "C. The harvested cells were resuspended in an equal volume of 50 mM Tris-HC1 (pH 7.5), 10% sucrose; frozen in liquid nitrogen; and stored at -80 "C. Dithiothreitol (to 2 mM) and lysozyme (to 300 pg/ml) were added to the thawed cell suspension (300 g), and the mixture was immediately transferred to Beckman Ti-45 centrifuge tubes and incubated at 0 "C for 30 min. The cells were lysed by exposure to 37 "C for 4 min, followed by immediate chilling in ice water. The particulate fraction was collected by centrifugation in a Ti-45 rotor at 20,000 rpm for 1 h (46,500 X gmex). The resulting pellet (144 g) was dispersed by sonication in the presence of 50 mM Tris-HC1 (pH 7.51, 10% sucrose, 5 mM MgC12, 10 pg/ml DNase I, and 10 pg/ml RNase A. The temperature during the sonication procedure was maintained at or below 4 "C. To assure the dissociation of PPX from the membrane fraction, solid KC1 was dissolved to 1.0 M, followed by addition of 0.1 volume of 1 M Na2C03. The mixture was stirred for 30 min at 0 "C. Debris was removed by centrifugation in a Ti-45 rotor a t 44,000 rpm for 1 h (225,000 X gmaX); the supernatant was immediately dialyzed (three times for 1 h each, followed by an 8-h dialysis) against 3-liter volumes of 0.2 M potassium phosphate (pH 7.0), 10% glycerol, 1 mM dithiothreitol, and 1 mM EDTA. The dialyzed extract (1100 ml) was stored at -80 "C. Five percent of the dialyzed extract (45 ml) used for further purification was dialyzed further against two 500-ml portions (for 2 and 10 h) of Buffer A (50 mM HEPES/KOH (pH 7.5), 10% glycerol, 1 mM dithiothreitol and 1 mM EDTA) (fraction I, 54 ml). Fraction I adjusted to 0.2 M NaCl was centrifuged in a Sorvall SS-34 rotor a t 6000 rpm for 20 min (43,000 X gmax). The supernatant (55 ml) was applied to a DE52 column (165 ml, 2.5 X 34 cm) equilibrated in Buffer A containing 0.2 M NaCI. Active fractions in the flow-through fraction with a high ratio of were pooled (fraction 11, 83 ml). To Fraction 11, solid (NH4)*S04 was added (0.35 g/ml) and stirred for 30 min. The suspension was centrifuged for 20 min at 17,200 X g. The pellet was dissolved in 16 ml of Buffer A, and the solution was dialyzed against two 500-ml portions (for 2 and 10 h) of Buffer A. The dialyzed solution was centrifuged, and the supernatant (fraction 111, 17 ml) was applied to an S- Sepharose fast flow column (30 ml, 2.5 X 7 cm) equilibrated in Buffer A. The column was washed with 3 column volumes of Buffer A; bound proteins were eluted with Buffer A containing 0.2 M NaCl. Active fractions were pooled (fraction IV, 15 ml) and dialyzed against two 750-ml portions of Buffer A containing 50 mM NaCl (for 2 and 10 h). Dialyzed fraction IV was centrifuged in an SS-34 rotor a t 18,000 rpm for 20 min (38,700 X g m J , and the supernatant was applied to a Mono Q HR5/5 column equilibrated in Buffer A containing 50 mM NaCl. The column was washed with 3 column volumes of Buffer A containing 50 mM NaCl and eluted with an 8-column volume linear gradient (0.05- 0.7 M NaCl) in Buffer A. Active fractions eluted at -0.2 M NaCl were pooled (fraction V, 1 ml). A subsequent preparation yielded fraction V with a 5-fold higher specific activity, presumably due to less inactivation of PPX.

Fraction Steu Protein PPX activitv Suecific activitv Yield Purification A,,,, mg units X units X 10"lmg 75 -fold

I Sonicated lysate 194 95 0.5 100 1.0 0.6

I1 DE52 116 83 0.7 87 1.4 1.0 111 Ammonium sulfate 37 43 1.2 45 2.4 1.4 IV S-Sepharose 5.3 55 10 58 20 V Mono Q 0.9 20 22 21 44

pellet

FRACTION

I I1 111 IV , V , I 20,000-60,000 unlts

kDa " ""

200 -

97 - 68"

29-

18-

FIG. 4. Analysis of PPX by SDS-PAGE. Samples of PPX (2.0 X lo4 units) from fractions I-V (Table 11) were analyzed by SDS- PAGE (15%); a larger sample of fraction V (6.0 X lo' units) was also analyzed. Proteins were visualized by Coomassie Blue staining.

with ppk, PPX was overproduced in W3110 cells harboring pBClO (1.3 X lo7 units/g of cells) as described for polyphosphate kinase (11). After heat lysis, -60% of PPX activity was found in the particulate fraction of the lysate. An early passage through a DE52 column in the presence of 0.2 M NaCl was needed to remove nucleic acids and to facilitate subsequent steps. PPX purified 44-fold (Table 11) was a single

1 0 4 0 L ~ 0.1 I 0.15 I 0.2 I 0.25 I

'd

FIG. 5. Gel filtration of PPX. PPX (fraction V, 45 pg) was applied to a Superose-12 HR10/30 column (Pharmacia) equilibrated in Buffer A containing 0.2 M NaCl (see legend to Table 11). Elution was performed with equilibration buffer at a flow rate of 0.4 ml/min. PPX and marker proteins were detected by monitoring UV absorbance (Am nm). cat, catalase (232 kDa); aMo, aldolase (158 kDa); BSA, bovine serum albumin (67 kDa); oval, ovalbumin (43 kDa). K d is the distribution coefficient.

polypeptide (molecular mass of 57 kDa) on SDS-PAGE (Fig. 4). A sequence of 10 amino acids from the amino terminus of PPX agreed with that predicted from the DNA sequence of ppx (nucleotides 43-72 in Fig. 3).


50u 25 0 0 50 100 150 200 SALT (mM)

b: a 100 1 ,100 ,

TEMPERATURE PC) PH

FIG. 6. PPX response to MgC12, salts, temperature, and pH. Purified PPX (fraction V, 25 fmol as dimer) was added to 100 pl of the PPX assay (see Experimental Procedures). The conditions for the assay were varied independently as follows. A, MgC12; B, the indicated salts; C, temperature for incubation; D, pH. The buffers (50 mM) used for each pH (D, 0) were MES (pH 5.5 and 6.0), ADA (pH 6.5), MOPS (pH 7.0), HEPES (pH 7.5 and 8.0), Tricine (pH 8.5), and CHES (pH 9.0). With Tricine, various pH values were also assayed (D, 0).

A 0

PPX dimer (fmol) BAP dimer (fmol)

FIG. 7. Substrate specificities of PPX and bacterial alkaline phosphatase. Reaction mixtures were incubated at 37 C for 15 min. Hydrolysis was detected as in the bacterial alkaline phosphatase (BAP) assay for [-p3P]ATP and the PPX assay for [32P]polyP (see Experimental Procedures). A , PPX specificity. Purified PPX (fraction V) and either 25 p~ [y-*P]ATP or 50 nM [32P]polyP as polymer were present in a reaction mixture of 100 pl. B, bacterial alkaline phosphatase specificity. Bacterial alkaline phosphatase and 10 p~ [T-~~P]ATP or 10 pM [32P]polyP as polymer were present in a reaction mlxture of 10 pl.

PPXAppears to Be a Dimer-Comparison of the Superose- 12 elution volume of PPX with those of reference proteins indicated a molecular mass of -100 kDa (Fig. 5), suggestive of a dimer. With the bifunctional reagent dimethyl adipimi- date dihydrochloride or dimethyl suberimidate dihydrochloride, PPX was cross-linked, appearing as a 120-kDa polypeptide on SDS-PAGE; monomeric ovalbumin remained as a 43- kDa band as expected (data not shown).

0 0.5 1.0 a Glucose l-phosphab (mM) Glucose &phosphate (mM)

OO 0.5 1.0 0 0.5 1.0 ATP (mM) ADP (mM)

FIG. 8. Inhibition of PPX and bacterial alkaline phosphatase reactions. PPX (fraction V, 160 units, 60 fmol as dimer) hydrolysis of [32P]polyP and bacterial alkaline phosphatase (BAP) (100 units, 14 fmol as dimer) hydrolysis of [y3P]ATP were assayed as described under Experimental Procedures in the presence of each bacterial alkaline phosphatase substrate (unlabeled); the reaction volume of the bacterial alkaline phosphatase assay was 20 pl.

Requirements for PPX-Under optimal pH (-8) and temperature (37 C), 1 mM M$ was required for PPX activity (Fig. 6). KC1 at 175 mM stimulated PPX 21-fold (Fig. 6), but was inhibitory at higher levels; NaCl was not as effective. Ammonium sulfate a t 50 mM stimulated 7-fold. PPX was completely inhibited by 20 mM phosphate, but was unaffected by 1 mM NaF (data not shown).

Substrate Specificity of PPX-The chain length of the [PI polyp substrate synthesized by polyphosphate kinase is -500 as judged by polyacrylamide gel analysis. Under optimal conditions, 0.2 pmol (as dimer) of PPX hydrolyzed 5 pmol (as polymer) of polyp (Fig. 7A), yet showed no activity on 2.5 nmol of [y-PIATP (25 p ~ ) . Assuming the length of [PI polyp to be 500, the K,,, of polyp for PPX is -9 nM as polymer, a value well below that used in the assays. Upon raising the polyp level in the bacterial alkaline phosphatase assay to 10 p~ as polymer, comparable to the K,,, for ATP (18), polyp hydrolysis by bacterial alkaline phosphatase was still undetectable ( 4 % ) during an incubation in which 10 p~ ATP was hydrolyzed completely (Fig. 7B). The hydrolysis of 12.5 nmol of phosphate residues/pmol of PPX is 50 times that of ATP molecules/pmol of bacterial alkaline phosphatase. The capacity of bacterial alkaline phosphatase substrates to compete with polyp for PPX was also examined (Fig. 8). Glucose 1-phosphate, glucose 6-phosphate, ATP, and ADP were ineffective inhibitors for PPX (Fig. 8), but served as inhibitors for bacterial alkaline phosphatase.

Inhibition by Substrate Analogs-In the short-chain polyp series, showed little inhibition of PPX hydrolysis of

638 Exopolyphosphatase

polyp even a t a 2000-fold polymer molar excess over the long- chain polyp substrate (Fig. 9A); polyp, inhibited 50% at a 2000-fold ratio, and polyP,, showed this level of inhibition when present a t a 200-fold ratio. Inhibitory effects by these millimolar levels of short-chain polyphosphate compounds were observed even when the Mg2' concentration was increased to 10 mM in the PPX assay. These short-chain polyphosphate compounds were far more effective inhibitors of bacterial alkaline phosphatase (Fig. 9B). A 50% inhibition

mM

1

I

2 2.5 I I I

1.5 2 2.5 mM

FIG. 9. Inhibition of PPX and bacterial alkaline phosphatase reactions by short-chain polyp. Assays were performed as described under "Experimental Procedures" in the presence of each of the indicated short-chain polyp forms. Whereas polyP3 and polyPl are homogeneous compounds, polyPls is a mixture of polyp with an average chain length of 15. A , PPX action on 50 nM [32P]polyP as polymer. The PPX assay (100 pl) included 160 units of PPX (fraction V). B, bacterial alkaline phosphatase action on 25 p~ [y3*P]ATP. The bacterial alkaline phosphatase assay (20 pl) included 150 units of bacterial alkaline phosphatase.

of ATP hydrolysis was achieved at an -50-fold polymer ratio for polyPs, a 20-fold ratio for polyp,, and a 4-fold ratio for POlYPlS.

PPX Releases Orthophosphate from Ends of Polyp-In the course of hydrolysis of [R"P]polyP by PPX, Pi release matched the loss of high molecular weight polyp (Fig. 1OA). Inorganic pyrophosphate, polyP, and polyp, were not detected among the products (data not shown). Inasmuch as no perceptible decrease in polymer size occurred during the course of its extensive conversion to Pi (Fig. 10B), the hydrolysis from the chain ends appears to be highly processive. A chain in the size range of 10-20 residues, as an end product of hydrolysis of each polyPsoo chain, could have been missed because of heterogeneity and relatively low abundance. The level of phosphate residues in each member of a short-chain polyphosphate series may be


is strongly stimulated by potassium salts and is not inhibited by sodium fluoride. Direct comparisons of PPX with bacterial alkaline phosphatase reveal their striking differences (Figs. 7-91,

Whether PPX of E. coli is closely related to the polyphosphatase identified in other microorganisms will require further characterization of these other enzymes. Exopolyphos- phatases have been obtained from Corynebacterium xerosis (25), Saccharomyces cereuisiue (l), Aerobacter aerogenes (261, and Neurospora crassa (1). The enzymes from A. aerogenes and N. crassa also require Mg2+ and a high concentration of K', characteristics also similar to those of the E. coli PPX. Whether these factors influence the structure of the polyp substrate or the enzyme is not known.

The action of PPX is directed to the ends of the polyp chain, from which it removes orthophosphate processively (Fig. 10). During the course of the reaction, the size of the remaining large-chain polyp is undiminished, and only orthophosphate is released. Inasmuch as polyp chains of -15 residues are weak competitors with the long-chain polyp substrate and would presumably be poorly attacked, it would seem that they should also accumulate as an end product. However, with only one such small chain produced per long- chain substrate and the likely heterogeneity of these small- chain products, the failure to observe any discrete bands in the small size range by electrophoretic gel analysis would be expected. The mechanism that enables PPX to distinguish the ends of a long chain from those of a short one is obscure and intriguing. As for the cellular salvage and disposal of short chains, they may be used as primers for polyphosphate kinase (8) or degraded by numerous other phosphatases, such as the tripolyphosphatases of A. aerogenes (26) and N. crmsa (1).

The membranous attachments observed for polyphosphate kinase (11) and possibly for PPX suggest that their actions in making and disposing polyp are membrane-oriented and should direct our attention to where polyp is found in the cell and the clues that such localization may offer to its physiological functions. Polyp granules are prominent in many

microorganisms and, under some circumstances, fill the vac- uoles of yeast cells (2). Although such polyp deposits are not prominent in E. coli, they have nevertheless been seen as electron-dense spheres, enveloped in some way and often attached to a DNA fiber.6 These observations may be related to the proposal that membrane domains of polyhydroxybu- tyrate, calcium, and polyp may function as channels for DNA entry into transformable microorganisms (6).

Acknowledgment-We are grateful to Tod Klingler for computer analysis of the DNA sequence.

REFERENCES 1. Kulaev, I. S. (1979) The Biochemistry of Inorganic Polyphosphates, John

Wile & Sons New York 2. Wood, h. G., a i d Clark, J. E. (1988) Annu. Reu. Biochem. 67,235-260 3. Szvmona. M.. Kowalska. H.. and Pastuszak. I. (1977) Acta Bmchim. Pol.

, I , . , 24,133-142

4. Dirheimer, G., and Ebel, J. P. (1968) Bull. SOC. Chim. Biol. 60,1933-1947 5. Pepin C. A,, and Wood, H. G. (1987) J. Biol. Chem. 262,5223-5226 6. Reusc'h, R. N., and Sadoff, H. L. (1988) Proc. Nutl. Aead. Sei. LI. S. A. 86,

AI W-AI Rn . - - - - - 7. Pick, U., Bental, M., Chitlaru, E., and Weiss, M. (1990) FEBS Lett. 274,

8. Ahn, K., and Kornberg, A. (1990) J. Biol. Chem. 265,11734-11739 9. Kornberg A., Kornberg S. R., and Simms E. S. (1956) Biochim. Biophys.

15-18

Acta 20,215-227 10. Kornberg, S. R. (1957) Biochim. Biophys. Acta 26,294-300 11. Akiyama, M., Crooke, E., and Kornberg, A. (1992) J. Biol. Chem. 267,

12. Bachmann, 8. J. (1990) Microbiol. Reu. 64,130-197 13. Kohara Y., Akiyama, K., and Isono, K. (1987) Cell 50,495-508 14. Henikoif, S. (1984) Gene (Amst.) 28,351-359 15. Altschul S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J.

16. Robinson, N. A., Clark, J. E., and Wood, H. G. (1987) J. Biol. Chem. 262,

17. Clark, J. E., and Wood, H. G. (1987) Anal. Biochem. 161,280-290 18. Garen A. and Levinthal C. (1960) Biochim. Biophys. Acta 38,470-483 19. Stah1,'E. (ed) (1969) Thih-layer Chromatography: A Laboratory Handbook,

20. Tinberg H. h. and Packer L. (1979) Methods Enz mol 56,622-629 21. Ito K., bate T'., and WickAer W. (1980) J. Biol. C&m. '266,2123-2130 22. BrAdford, MT M. (1976) Anal. Biochem. 72,248-254 23. Sambrook J Fritsch, E. F. and Maniatis, T. (1989) Molecular Clonin A

LaboratAj'Manuul, 2nd dd., Cold Spring Harbor Laboratory Press, {old Spring Harbor, New York

24. Torriani-Gorini, A,, Rothman, F. G., Silver, S., Wright, A,,, and YaFil, E.

gunisms, American Society for Microbiology, Washington, D. C. (eds) (1987) Phosphate Metabolum and Cellular Regulutwn tn Mccroor-

25. Muhammed, A., Rodgers, A., and Hughes D. E. (1959) J. Gen. Microbiol.

26. Harold F. M., and Harold R. L. (1965) J. Bacteriol. 89,1262-1270 20,482-495

22556-22561

(199ojJ. MOL B ~ O L 215,403-410

5216-5222

2nd Ed., S ringer-Verlag, New York

J. Griffith, personal communication.

Documents

An Exopolyphosphatase of Escherichia Coli