Alu PCR, 2017

Alu PV92 PCR Table of Contents

Teacher Guide Letter to Teacher……………………………………………………………………………………………………..I Inventory Sheet………………………………………………………………………………………………….…..II Laboratory Preparation Sheet: Day 1 , DNA Extraction………………………………………..………………IV Laboratory Preparation Sheet: Day 2, PCR……………………………………………………….………….....V Laboratory Preparation Sheet: Day 3, Gel Electrophoresis………………………...…………………...........VI BABEC Recipes for Alu PV92 PCR……………………………………………………………………………..VII Informed Consent Release Form…………………………………..…………………………………………….IX Thermal Cycler Grid………………………………………………………………………………………………..X Alu PV92 Trouble-Shooting Guide……………………………………………...……………………………….XI Entering Class Data into Allele Server……………………………………………………………………..….XIII Class Results Table………………………………………………………………………………………….…..XV Ah, Lou! There Really Are Differences Between Us! Introduction…………………………………………………………………………………………………………..1 The Polymerase Chain Reaction………………………………………………………………………………….3 Laboratory Exercise: DNA Extraction..………………………………………………………………………...…4 Important Laboratory Practices……………………………………………………………...……………4 DNA Preparation Using a Saline Mouthwash……………………………………………...……………5 Laboratory Exercise: Polymerase Chain Reaction…...……………………………………………...………….8 Laboratory Exercise: Agarose Gel Electrophoresis……………………………………………………..……..10 Electrophoresis of Amplified DNA………………………………………………...…….......................11 Staining and Photographing Agarose Gels…………………………………………………...………..12 Results………………………………………………………………………………………………………………13 Biostatistics Activity One: Calculating Allele and Genotype Frequencies……………….…………………..15 Review Questions: Allele and Genotype Frequencies………………………..……………………...19 Biostatistics Activity Two: Using the Allele Server at the CSHL DNA Learning Center……………………20 Part 1: Using the Allele Server to Check Your Allele and Genotype Frequencies…..…………….20 Part 2: Using the Allele Server to Look at Different World Populations…………………..………...22 Global Map and Table for Analyzing Alu PV92 Allele Frequencies……………………..................24 Part 3: Using Allele Server to Test if Your Class is in Hardy-Weinberg Equilibrium …………..….27 Review Questions: Hardy-Weinberg Equilibrium and Biostatistics…………………..….…………..29 Part 4: Using Chi-Square to Compare Two Population Groups…………….……………….………30 Review Question: Studying Populations……………………………………………..………………...32 Acknowledgements………………………………………………………………………………………………..33

Alu PCR, 2017 I

Alu PV92 PCR Teacher Guide

Dear Teacher, This packet is designed to make your job easier. Please read over the Teacher Guide carefully before beginning this lab. Included in this packet are the following: 1. Inventory Sheet. Please check to see that all the materials listed on the Inventory Sheet have safely arrived to

you and store each item appropriately. 2. Laboratory Preparation Sheet. Read the Laboratory Preparation carefully for suggestions on setting up this

PCR activity in your classroom. 3. Informed Consent Release. All students participating in PCR amplification of their own DNA need to sign an

Informed Consent Release form provided in this packet. Please keep these in your records. Fill in the appropriate spaces (date, class, school, phone number, signature) before photocopying this form and passing it out to students.

4. Thermal Cycler Grid. Schematics showing the layout of the spaces in the GeneAmp 2400 and GeneAmp

9700/2700/2720 thermal cyclers are provided for students to record where they put their samples. NOTE: Keep the original sheet for grids to photocopy from for future use.

5. Feedback Survey. After completing this Alu PCR lab, please fill out the enclosed Feedback Survey and send it

back to the BABEC Education Manager. This form helps BABEC monitor the success of their PCR-based curricula. The data collected from these forms also play an important role in reports for continued grant support for these labs. Surveys can also be filled out online at www.babec.org.

6. Teacher’s Manual. The teacher’s version of the lab manual includes both the student version and important

notes at points in the protocol where mistakes may occur. Please make sure to read the lab manual carefully and closely monitor student technique during these steps.

If you have questions please contact the BABEC Promgram Manager. Contact information can be found at www.babec.org. Enjoy! -- BABEC Team

Alu PCR, 2017 II

Inventory Sheet

Listed below are the reagents and consumables provided in the PCR kit from BABEC, as well as additional reagents and consumables. Make sure to also read the list of equipment needed for this PCR activity. If you need access to some of these additional materials, please contact your local biotech education partnership coordinator. Following the aliquoting procedures outlined in this teacher packet, 1 kit contains reagents for approximately 50 reactions. In a class of 35–40 students, 40 students will have enough reagents for each student, a positive control, a negative control and 15% overage for transferring reagents. In the table below, the volume of each reagent is listed per student. If aliquoting for groups, use the following equation: x µL # of students x x 1.1 (overage factor) = amount per team student team PCR Reagents/Consumables Provided in BABEC/Life Technologies Kit

√ Item Storage Volume Per Kit

Volume Per Student (see directions above)

5% Chelex Refrigerator (4-8ºC) OR

Room Temp (20-25ºC) 10 mL 200 µL/student

Alu PV92 Master Mix Refrigerator (4-8ºC)

OR Freezer (-20°C) 1 mL 20 µL/student

Alu PV92 Primer Mix Refrigerator (4-8ºC)

OR Freezer (-20°C) 1 mL 20 µL/student

Positive control DNA Refrigerator (4-8ºC)

OR Freezer (-20°C) 60 µL 10 µL/reaction

100 bp DNA ladder Refrigerator (4–8ºC)

OR Freezer (-20°C) 60 µL 5-10 µL/gel

PCR tubes Room Temp

(20-25ºC) 50 tubes 1 tube/student

NOTE: Thawed reagents can be stored in the refrigerator for up to one month. If you are not going to use the reagents within a month, you should store in the freezer. If you do not use the frozen reagents by the end of the school year, please contact the BABEC education manager or your partnership coordinator to determine if they should be discarded.

Alu PCR, 2017 III

Reagents/Consumables NOT Provided in BABEC/Life Technologies Kit

Item Comments

0.9 % saline 10 mL per student for the mouthwash AND an additional 30 µL per student during the DNA extraction process. NOTE: Use store-bought plain, non-iodized salt. DO NOT use NaCl from your chemical shelves.

Sterile water For setting negative PCR controls for the class.

0.5 X TBE or 1 X TAE buffer

Amount varies depending on the brand of electrophoresis chamber and casting tray sizes, roughly 300 mL/chamber for electrophoresis and 25–45 mL per agarose gel. Store at room temperature.

Agarose powder To make a 2 % agarose gel: 2 grams of agarose in 100 mL of appropriate buffer. Store at room temperature.

Loading dye 5 µL per student. Store at room temperature.

Ethidium bromide (EtBr) Use 0.5 µg/mL solution. Amount varies depending on size of staining trays/ gels, roughly 50 mL/gel. Store at room temperature. EtBr stain is reusable. Please handle EtBr stain safely.

1.5 mL microfuge tubes These should be clean, but don’t need to be autoclaved; 1 per student for 5% Chelex, 2 per student for DNA preparation/storage, and 2 per team of 4 for reagent aliquots (MM, PM). Store empty tubes at room temperature.

Sterile micropipette tips P-20s, P-200s for student use and P-1000s for teacher aliquoting. Store at room temperature.

Crushed ice Ice for reagents at lab stations while setting up PCR. Gloves / lab coat / goggles Use these when handling ethidium bromide.

Additional Equipment Required for Lab:

• Micropipettes (P-20s, P-200s, and P-1000s) • Gel boxes, casting trays, and combs • Cap locks • Heat blocks or water baths • Microfuge tube racks • Permanent markers • Staining trays • Goggles (use when handling ethidium bromide) • Photography equipment (UV light box, camera and film, digital camera or Minivisionary) • Power supplies • Waste containers • Microcentrifuges • Vortex mixers (optional) • PCR tube racks • Ice containers • Applied Biosystems thermal cycler

Alu PCR, 2017 IV

Laboratory Preparation Sheet: Day 1, DNA Extraction What to Do Prior to DNA Extraction:

√ Item Preparation Instructions

5% Chelex

Dispense 200 µL of 5% Chelex into 1.5 mL microfuge tubes (or 0.2 mL PCR tubes if you plan to use the thermal cycler as your heat block), one per student. Make sure to keep swirling the Chelex as you pipet so that every aliquot has a consistent 5% Chelex concentration. Use a P-1000 micropipet so the Chelex beads do not get clogged in the smaller P-200 tips. If you only have a P-200 available, use a sharp razor blade to cut off the very tip of a P-200 tip.

0.9% saline solution for mouthwash

Make 0.9% saline. The easiest way to make this is to add 9.0 grams of NON-IODIZED salt to a new 1-liter bottle of drinking water. Swirl to dissolve the salt. Use a sterile graduated culture tube or sterile pipet to transfer 10 mL into disposable cups for students just prior to class.

Thermal cycler, heat blocks or water baths

You can set up the thermal cycler for a 99˚C hold. Set heat blocks or water baths at 98˚C–100˚C before class begins.

P-1000 micropipettes or 1 mL transfer pipets Use for saline wash transfer.

P-200 micropipettes For DNA transfer Cap locks Only for heat block version 1.5 mL microfuge tubes Use for Chelex, saline, and DNA suspension transfers. Sterile tips Need both yellow and blue tips for all solution transfers Waste containers For tips and tube disposal Microfuge tube racks To hold tubes Permanent markers To label tubes, etc. Microcentrifuge To spin samples Disposable cups Use for saline mouthwash (3 or 4 oz. Dixie cups) Vortex mixers (Optional) Thermal cycler grid If using thermal cycler as the heat block Disinfectant solution or

10% bleach solution To disinfect all the saline mouthwash generated by the students

Methods of Heating Samples 1. Heat block method

a. Uses 1.5 mL microfuge tubes for the Chelex step b. Students must use cap locks so the tubes do not pop open during heating.

2. Thermal cycler method

a. Uses 0.2 mL thin-walled tubes for the Chelex step b. Set thermal cycler at 99.0 ºC for ∞ (infinity). [99.59 minutes] c. Consider collecting all student Chelex tubes and placing them on the thermal cycler tray on top of a base

at room temperature. Once all the tubes are on the tray, lift the tray off the base and place it in the thermal cycler.

d. Note: These tubes may pop open during the heating step, so be careful when collecting the tubes. They will be hot. You may remove the tray off the thermal cycler and place them on ice briefly before allowing the students to collect their tubes

Alu PCR, 2017 V

Laboratory Preparation Sheet: Day 2, PCR What to Do Prior to PCR:

√ Item Preparation Instructions

Ice (crushed)

Buy/prepare crushed ice for each lab station. It is very important to keep the master mix and primer mix cold while students are preparing their PCR reactions. The DNA polymerase and/or dNTPs may degrade, resulting in no amplification if the reagents warm up too much.

Master Mix and Primer Mix aliquots

Aliquot Master Mix and Primer Mix for each team. (To determine the amount needed, multiply the number of students per group by the volume of each reagent, and then multiply that number by 1.1 for overage). Keep these refrigerated until needed, and then keep on ice during use.

Positive control DNA Use to set up positive control PCR reactions for the class. Sterile water Use to set up negative control reactions for the class.

Thermal cycler grid Photocopy and place grid(s) next to thermal cycler for students to record their tube locations with their own ID#. Two grids are provided, one for the GeneAmp 2400 (24 spaces) and one for the GeneAmp 9700 (96 spaces).

Thermal cycler tray

Ensure you have the correct tray that sits in the thermal cycler (it is usually red, teal, tan, black or natural in color, and will have a notched upper right-hand corner to fit against its support in the thermal cycler). Without the tray, tubes may melt.

P-20 micropipettes Only the P-20 micropipettes are needed on this day. 0.2 mL PCR tubes Use for setting up the PCR reactions. Tips Yellow tips only. Use sterile tips if possible. Waste containers For tips and tube disposal Permanent markers To label tubes, etc. Microcentrifuge For spinning down reagents in PCR tubes. PCR tube racks/bases For holding the PCR tubes while setting up the reaction mix. Make sure that the

PCR rack or base is on ice during the PCR reaction set up. Ice containers or

styrofoam cups Use to store the PCR reagents and DNA on ice while setting up PCR reactions.

Thermal cycler Check the parameters for the Alu PCR in the PCR machine. Make appropriate changes where needed.

“Self-check” reference tube of 50 µL colored dye in a PCR tube

Have students compare the volume of the liquid of their PCR reaction set up with this “self-check” tube, making sure that they are pipetting correctly.

Alu PCR, 2017 VI

Laboratory Preparation Sheet: Day 3, Gel Electrophoresis What to Do Prior to Electrophoresis:

√ Item Preparation Instructions Microcentrifuge To spin down the liquid in the PCR tubes Loading dye For visualizing the loading and running of samples on the gel Tips To load and transfer solution–yellow tips only Waste containers For tips and tube disposal 100 bp ladder Size marker for the bands in the gel P-20 micropipettes Only P-20 micropipettes are needed on this day. 0.5X TBE buffer or 1X

TAE buffer Make 0.5X TBE buffer or 1X TAE buffer for electrophoresis and agarose gels.

2% agarose

Make 2% agarose gels (2g agarose for every 100 mL of electrophoresis buffer) for students, or allow time to do this with your students. Be sure to use the same buffer as was used to make the agarose gel (TAE or TBE).

Gel boxes To run the PCR samples. Power supplies To run the PCR samples. Gel grids for loading

samples Use to track student samples in each gel for the class. This can be done after the gels are poured since it will depend on the number of wells per gel.

Ethidium bromide solution (0.5µg/mL)

Prepare/obtain ethidium bromide solution for gel staining (0.5 µg/mL). Wear safety glasses and gloves when handling stained gels. Pour the used EtBr stain back in the original bottle after staining the gels.

Gloves, goggles, and protective clothing

Wear gloves, goggles, and protective clothing when staining and photographing gels.

Spatula Use a designated spatula for handling EtBr-stained gels. Staining weigh boat

trays/containers Use designated staining trays and containers for staining gels with ethidium bromide.

Disposal bags Please throw the EtBr stained gels in appropriate disposal bags and dispose of according to school and /or district guidelines.

UV transilluminator To view the stained gels MiniVisionary setup,

camera and Polaroid film, or digital camera

Set up the MiniVisionary system before staining the gels. Use to view and take photos of the gels for the students. For the camera system, you will need Polaroid film 667 for photographing the gels. You may also use a standard digital camera; be sure to turn off the flash.

Alu PCR, 2017 VII

BABEC Recipes for Alu PV92 PCR 2% w/v Agarose gels - 100 mL 2 grams agarose powder 100 mL of running buffer (either 1X TAE or 0.5X TBE) Pour buffer into a heatproof glass container. Add small amounts of agarose powder gradually to avoid clumping of granules in the buffer solution. Heat the agarose and buffer solution in the microwave. Stop periodically and swirl the solution gently. You may have to stop more frequently and swirl more often when the solution begins boiling. Make sure that all agarose granules are completely dissolved. Agarose will superheat. Please remember to protect your hands and arms! Allow the boiling solution cool until able to hold comfortably before pouring into gel casting trays. If too hot, the solution will weaken the epoxy holding together the casting tray! 5% w/v Chelex Chelex 100 Resin Bio-Rad catalog # 143-2832 Add 5 grams of Chelex 100 Resin to 100 mL of sterile, distilled water. Store in the refrigerator, discard if you see growth or contamination 0.9% w/v Saline Add 9 g of NON-IODIZED table salt to 1 liter of bottled water. Do not use the NaCl out of your chemical cupboards! Loading Dyes for Alu PV92 PCR 25X Dye Stock Solution

Dye Total Volume: 50 mL Total Volume: 100 mL 6.25% orange G 2.5 g 5 g 6.25% xylene cyanol 2.5 g 5 g 1 M Tris, pH 8.0 4 mL 8 mL

Add buffer and dye first. Dissolve well. Bring up the volume with distilled water. Mix well and store at RT. Discard if you see growth or contamination. Loading Dye Preparation from DNA Science

Ingredients Final [ ] Amount: 100 mL Orange G 0.25% 0.25 g or 4 mL of 25X stock Xylene cyanol 0.25% 0.25 g or 4 mL of 25X stock Sucrose or glycerol 50% 50 g or 50 mL 1 M Tris, pH 8.0 10 mM 1 mL of 1 M stock

100 bp ladder – 1 mL (50 µg/mL final concentration) 100 µL of concentrated 500 µg/ mL New England Biolabs, catalog #N3231L 100 µL of prepared loading dye (Xylene Cyanol and Orange G) 800 µL of 1X TE buffer Use 5–10 µL per gel well. PCR Cycling Parameters forAlu PV92 PCR 1) 95°C hold for 2 minutes 2) 30 cycles of: 94°C for 30 seconds 60°C for 30 seconds 72°C for 2 minutes 3) 72°C hold for 10 minutes 4) 4°C hold, ∞ infinity

Alu PCR, 2017 VIII

General PCR Programs 4ºC hold: use for keeping your samples at refrigeration temperature 99ºC hold: use for heating your samples 99ºC 10min + 4ºC hold: use if all your class samples are ready at the same time PCR Reagents—Alu PV92 Lab Alu PV92 Master Mix—Made Using Applied Biosystems’ Reagents

Component Volume in 1 mL of Master Mix

Concentration in Master Mix

Final concentration (in 50 µL PCR reaction)

10X PCR Buffer II 250 µL 2.5X 1X 25 mM MgCl2 150 µL 3.75 mM 1.5 mM 10 mM dNTP blend 200 µL 2 mM 0.8 mM 5 U/µL AmpliTaq DNA Polymerase

15 µL 0.075 U/µL 0.03 U/µL

Bring up to volume in sterile, deionized water. Store at 4ºC for short-term storage or freeze at -20ºC for long-term storage. Avoid repeated freeze/thaw cycles. Alu PV92 Primer Mix 0.5 µM each primer 5’- GGATCTCAGGGTGGGTGGCAATGC -3’ 5’- GAAAGGCAAGCTACCAGAAGCCCCAA -3’ Bring up to volume with sterile, deionized water. Store at 4ºC for short-term storage or freeze at -20ºC for long-term storage. Avoid repeated freeze/thaw cycles. Alu PV92 Positive Control DNA Novagen catalog # 70605, female genomic DNA, 200 µg/mL Dilute concentrated stock in sterile, deionized water to a final concentration of 1 ng/µL. Store at 4ºC for short-term storage or freeze at -20ºC for long-term storage. Avoid repeated freeze/thaw cycles. Gel Running Buffers 50X TAE–1 L 242 g Tris base (FW 121.1), final 2M 18.6 g EDTA (MW 372.24), final 55mM 57.1 mL glacial acetic acid Bring volume up to 1 L with distilled water. Check for pH around 8.0. Dilute to 1X concentration for making and running gels. 10X TBE–1 L 108 g Tris base (FW 121.1), final 892mM 55 g boric acid (MW 61.83), final 890mM 7.4 g EDTA (MW 372.24), final 20mM 1 g NaOH (MW 40), final 25mM Bring volume up to 1 L with distilled water. Check for pH around 8.0. Dilute to 0.5X concentration for making and running agarose gels. Use at 1X concentration for running TBE polyacrylamide gels. Gel Staining Reagents Ethidium Bromide (EtBr) Staining Solution–1 L Sigma catalog #E-1510, 10 mg/mL stock solution. Make final concentration of 0.5 µg/mL by adding 50 µL per 1 L of distilled water. Store at RT. Discard if you see growth or contamination. Discard according to hazardous waste guidelines for your institution.

Alu PCR, 2017 IX

Informed Consent Release

Date:_____________________ Dear Parent(s) or Guardian, The ___________________class at _____________________school has the opportunity to participate in a class exercise in which an important technique in biotechnology will be used to analyze the students’ DNA. The technique the students will be using is called the Polymerase Chain Reaction (PCR). It is a method by which a particular piece of DNA can be amplified many million-fold. PCR has a number of applications in the scientific community, including uses in forensics, diagnostics, parentage testing, and evolutionary studies. It is used by forensic laboratories for the identification of possible suspects involved with a crime. It is used for the diagnosis of different genetic diseases. It is routinely used in most molecular biology laboratories for the cloning and characterization of specific genes. In this laboratory protocol, students will be isolating DNA from their own cheek cells. They will then apply the PCR technique to amplify a particular segment of their DNA. This segment is not known to be associated with any genetic disease and variation between individuals in this region is in no way an indicator of health or genetic fitness. The results of this particular lab exercise are for teaching purposes only and will NOT be used for any diagnostic or identification purposes. Your student’s privacy will be protected. The student’s name will not be linked to his/her DNA and the results of the lab exercise will remain anonymous. Participation is voluntary. By signing this permission form, you are allowing your student to participate in this exciting learning experience. If you have any concerns or questions, please contact me at ___________________. Sincerely, ___________________________________ ___________________________________ Print Student Name ___________________________________ _______________ Student Signature Date __________________________________ _______________

Parent/Guardian Signature Date

Alu PCR, 2017 X

GeneAmp 2400 Thermal Cycler Grid

1 2 3 4 5 6 7 8 A

B

C

Teacher: __________________________ Class & Period: __________________________ Date: __________________________

GeneAmp 9700 and 2700/2720 Thermal Cycler Grid

1 2 3 4 5 6 7 8 9 10 11 12 A

B

C

D

E

F

G

H

Teacher: __________________________ Class & Period: __________________________ Date: __________________________

Alu PCR, 2017 XI

Alu PV92 Trouble-Shooting Guide NOTE: The following pages are NOT in the Student Manual.

Desired Alu results. The bands of the 100 bp ladder are sharp and well resolved. Student samples should contain either one band (for students homozygous -/- or +/+) or two bands (for students heterozygous +/- for the Alu insertion). For heterozygous genotypes, it is typical that the larger 715 bp band will be less intense than the smaller 415 bp band. This is called preferential amplification and results from the fact that shorter fragments are amplified by PCR more efficiently than larger fragments.

Artifact bands. This gel shows a number of the artifact bands that might be generated during the Alu PCR amplification. In the +/- student lane, we see the desired 415 bp and 715 bp products but also a number of other bands. Primer dimer (at the bottom of the gel) forms by an interaction between the primers. We also see a number of large fragments that we believe are heteroduplex molecules generated by annealing between a 415 base single strand and a 715 base single strand. Such a heteroduplex will migrate down the gel at a slower rate than might be expected for its actual length.

Shown in the -/- lane is a band that migrates at about 300 bp. This may appear as a single band, or, if the gel is run longer, two bands in this area might appear. These probably result from nonspecific amplification; primers annealing elsewhere on the template and generating a PCR fragment.

In the +/+ lane, a band at 415 bp appears. Since this band is less intense than the 715 bp band (the opposite of what we should expect from preferential amplification), it is an artifact. It can result from spill-over from the lane next to it or from contamination.

!

Alu PCR, 2017 XII

The 100 bp ladder shows bands but no sample bands are present. Reactions failed to produce amplification. This might result from: 1. Inadequate template amounts added to the reaction. 2. Some component of the reaction was not added. 3. The reagents were inactive due to improper storage.

Reagents should be stored frozen or in the refrigerator until use.

4. Master Mix was vortexed violently resulting in loss of AmpliTaq DNA Polymerase activity.

No bands. If no bands are present on the gel, not even for the 100 bp marker lane, then the possibilities are: 1. Samples were not properly loaded into the wells. 2. The staining solution does not have adequate

ethidium bromide stain. Staining solution should contain ethidium bromide at a concentration of 0.5 µg/mL and staining should be allowed to proceed for at least 20 minutes at room temperature.

3. Gel was stored too long in buffer prior to staining and the bands diffused out of the gel.

.

Alu PCR, 2017 XIII

Entering Class Data into Allele Server NOTE: These instructions for entering class data into the Allele Server are not in the Student Guide. When you have collected the student data in the “Class Results for the Alu PV92 Insertion,” you will need to enter it into the Cold Spring Harbor Laboratory DNA Learning Center Allele Server.

1. Open your preferred web browser (i.e: Firefox, Safari, Explorer, Chrome)

2. In the internet address box, type in the following web address: http://www.bioservers.org/bioserver. The Allele Server main page will show up.

3. The BioServers page should appear on the screen. You will want to use the Allele Server. Click on the REGISTER button if you have not previously registered with BioServers. Fill out the required information and then hit SUBMIT. If you are already registered, enter your username and password, then press LOGIN.

4. In the Registration window, fill in the entry boxes and press the Register button. A note to confirm your registration will then appear on the screen. Click the OK button.

5. After registration, the Main Workspace Window will open. In addition, a pop-up window will open entitled

Alu PCR, 2017 XIV

Using Allele Server. This is a great resource if you need a refresher on how to use the Allele Server. The Main Workspace Window is where you will load your own data for comparison and analysis. Click on the MANAGE GROUPS button to bring up the MANAGE GROUPS Window.

6. In the upper right hand corner of the MANAGE GROUPS window, is a self-scroll menu bar. Scroll to Your Groups and click on the ADD GROUP button. This will bring up the Create Group window.

7. Fill in each box of the CREATE GROUP window. In the TYPE box, scroll to choose Public. Do not fill in the lower two boxes that would allow your students to enter data. Click the OK button. You will be returned to the MANAGE GROUPS window.

8. In the MANAGE GROUPS window, press the EDIT GROUP and then the INDIVIDUALS tab (at the top of the window). This will bring up the EDIT GROUP window.

9. Enter the data collected from the class (recorded on the “Class Results for the Alu PV92 Insertion” table). You will need to click the ADD button every time, after information for each person is filled. When all students have been added, click the Done button. This will take you back to the MANAGE GROUPS window. Click the OK button. You may then close the application. Your class data will be saved in the MANAGE GROUPS window under the Classes data.

Alu PCR, 2017 XV

Class Results Table for the Alu PV92 Insertion

Date: _________________________

Class: _________________________

# PIN Genotype (Enter +/+, +/-, or -/-)

Gender (Male or Female) Mother’s Origin* Father’s Origin*

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35

Enter: Native American (North), Native American (South), African, Asian, Australasian, European, or All (origin unknown). NOTE: This genotype grid is not in the Student Manual.

Alu PCR, 2017 1

Ah, Lou! There Really Are Differences Between Us! Teacher Version

We gratefully acknowledge David Micklos of the DNA Learning Center at Cold Spring Harbor Laboratory for his generous help. Some materials for this exercise were adapted, by permission, from the Genomic Biology: Advanced Instructional Technology for High School and College Biology Faculty laboratory manual, Cold Spring Harbor Laboratory, copyright 1999.

Introduction

We are humans. We are bipedal and stand upright. We have hands, feet, fingers, and toes. You can look at the student next to you and easily recognize that person to be human too. What makes us look similar to each other while different from frogs, fish, or fuchsias is the molecule deoxyribonucleic acid (DNA). The basic building block of DNA is the nucleotide comprising a deoxyribose sugar, a phosphate, and one of the four bases A (adenine), C (cytosine), G (guanine), or T (thymine). In the DNA molecule, nucleotides are linked together in a chain. DNA is a double helix; two chains of nucleotides are wound around each other to form a spiral structure. Interactions (hydrogen bonds) between the bases on the opposing strands hold the double helix together. The A's on one strand hydrogen bond with the T's on the other strand. The G's on one strand interact with the C's on the other. Therefore, A’s and T’s are said to be complementary as are G's and C's. Complementary bases, when hydrogen bound in the double helix, are called base pairs (bp). It is the order of the bases along the strands of the DNA molecule that makes each species unique. Our bodies are caldrons for thousands of chemical reactions carried out to support the process of life. We ingest food for energy and for the raw materials needed to build the structures of the cell. We breathe oxygen; it assists in the moving of electrons from one molecule to another. We manufacture protein molecules called enzymes needed for the building or breakdown of still other molecules. We all look like humans because we all share the same cellular makeup. The information for the construction of all the enzymes in the cell and all the proteins giving the cell its shape and function is stored within DNA’s sequence of bases. One particular base sequence may carry the information for the assembly of hemoglobin, a protein that carries oxygen to your cells. Another sequence of bases may direct the manufacture of an actin molecule, a protein found in muscle. The region of bases on DNA that holds the information needed for the construction of a particular protein is called a gene. The average gene is approximately 10,000 base pairs long. There are approximately 23,000 genes in human DNA. The human genome (the total sum of our genetic makeup) is made up of approximately 3 billion base pairs distributed on 23 chromosomes. All cells in your body, except red blood cells, sperm, and eggs, contain these 46 pairs of chromosomes (sperm and egg cells contain only 23 chromosomes). Only 15% of this enormous amount of DNA is used directly to code for the proteins required for supporting cellular metabolism, growth, and reproduction. The protein-encoding regions are scattered throughout the genome. Genes may be separated by several thousand bases. Furthermore, most genes in the human organism are themselves broken into smaller protein-encoding segments called exons, which, in many cases, have hundreds or thousands of base pairs intervening between them. These intervening regions are called introns and they make up between 90–97% of the entire genome. Since these non-coding areas such as introns have no defined role, they were referred to as "Junk DNA". Whatever their function may entail in the genome, closer examination of these intervening DNA regions has revealed the presence of unique genetic elements that are found in a number of different locations. One of the first such repeating elements identified was Alu. Alu repeats are approximately 300 base pairs in length. They got their name from the fact that most carry within them the base sequence AGCT which is the recognition site for the Alu I restriction endonuclease, a type of enzyme that cuts DNA at a specific site. There are over 500,000 Alu repeats scattered throughout the human genome. On average, one can be found every 4,000 base pairs along a human DNA molecule. How they arose is still a matter of speculation but evidence suggests that the first one may have appeared in the genome of higher primates about 60 million years ago. Approximately every 100 years since then, a new Alu repeat has inserted itself in an additional location in the human genome. Alu repeats are inherited in a stable manner and they come intact in

Alu PCR, 2017 2

the DNA your mother and father contributed to your genome at the time you were conceived. Some Alu repeats are fixed in a population, meaning all humans have that particular Alu repeat. Others are said to be dimorphic; different individuals may or may not carry a particular Alu sequence at a particular chromosomal location.

The Polymerase Chain Reaction

Objectives - student should be able to: 1. List and explain the importance of each component of PCR 2. Compare PCR to cellular DNA replication 3. Associate the temperature changes with the cycling steps of PCR

The polymerase chain reaction (PCR) is a method used by scientists to rapidly copy, in vitro, specific segments of DNA. By mimicking some of the DNA replication strategies employed by living cells, PCR has the capacity for churning out millions of copies of a particular DNA region. It has found use in forensic science, in the diagnosis of genetic disease, and in the cloning of rare genes. One of the reasons PCR has become such a popular technique is that it doesn’t require much starting material. It can be used to amplify DNA recovered from a plucked hair, from a small spot of blood, or from the back of a licked postage stamp. There are some essential reaction components and conditions needed to amplify DNA by PCR. First and foremost, it is necessary to have a sample of DNA containing the segment you wish to amplify. This DNA is called the template because it provides the pattern of base sequence to be duplicated during the PCR process. Along with template DNA, PCR requires two short single-stranded pieces of DNA called primers. These are usually about 20 bases in length and are complementary to opposite strands of the template at the ends of the target DNA segment being amplified. Primers attach (anneal) to their complementary sites on the template and are used as initiation sites for synthesis of new DNA strands. Deoxynucleoside triphosphates containing the bases A, C, G, and T (NTPs) are also added to the reaction. The enzyme DNA polymerase binds to one end of each annealed primer and strings the deoxynucleotides together to form new DNA chains complementary to the template. The DNA polymerase enzyme requires the metal ion magnesium (Mg++) for its activity. It is supplied to the reaction in the form of MgCl2 salt. A buffer is used to maintain an optimal pH level for the DNA polymerase reaction. PCR is accomplished by cycling a reaction through several temperature steps. In the first step, the two strands of the template DNA molecule are separated, or denatured, by exposure to a high temperature (usually 94° to 96°C). Once in a single-stranded form, the bases of the template DNA are exposed and are free to interact with the primers. In the second step of PCR, called annealing, the reaction is brought down to a temperature usually between 37˚C to 65˚C. At this lower temperature, stable hydrogen bonds can form between the complementary bases of the primers and template. Although human genomic DNA is billions of base pairs in length, the primers require only seconds to locate and anneal to their complementary sites. In the third step of PCR, called extension, the reaction temperature is raised to an intermediate level (65˚C to 72˚C). During this step, the DNA polymerase starts adding nucleotides to the ends of the annealed primers. These three phases are repeated over and over again, doubling the number of DNA molecules with each cycle. After 25 to 40 cycles, millions of copies of target DNA are produced. The PCR process taken through four cycles is illustrated on the following page (Figure 1). In the following laboratory exercise, you will use PCR to amplify a dimorphic Alu repeat (designated “Alu” PV92). If you have it, will be found on your number 16 chromosome. You will use your own DNA as template for this experiment. DNA is easily obtained from the human body. A simple saltwater mouth rinse will release cheek cells, from which you will extract the DNA. After you amplify the Alu repeat region, you will determine whether or not you carry this particular Alu sequence on one or both or none of your number 16 chromosomes. This will be accomplished by separating the DNA in your PCR sample on an agarose gel via electrophoresis, a process that separates DNA by size. Finally, using a program developed by the DNA Learning Center at Cold Spring Harbor Laboratory, you will determine how rare this Alu sequence is in the human population and make some assessment as to when and where it arose.

Alu PCR, 2017 3

Illustration of the Polymerase Chain Reaction

Figure 1. The First Four Cycles of the Polymerase Chain Reaction.

First Cycle of PCR Second Cycle of PCR

Third Cycle of PCR

Fourth Cycle of PCR

An excellent animated tutorial showing the steps of PCR is available at the DNA Learning Center website: http://www.dnalc.org/ddnalc/resources/pcr.html Note: You will need Macromedia Flash plug-in to view this online and to download the animation files to your computer.

Alu PCR, 2017 4

Laboratory Exercise The protocol outlined below describes a procedure for isolating DNA from cheek cells. In the first step, you will rinse your mouth with a salt solution. This step typically dislodges hundreds of cells from the cheek epithelium. An aliquot of the mouthwash solution is centrifuged to collect the dislodged cells, which are then resuspended in a small volume of saline. The resuspended cells are then added to a solution of Chelex® to remove any metal ions (such as magnesium) which might promote degradation of your genomic DNA. Magnesium (and other metal ions) can act as cofactor for DNA-degrading nucleases present in saliva and the environment. The Chelex®/cell sample is then boiled to break open the cells. Since the sample is heated at a high temperature, the DNA, following this step, will be in a single-stranded form. The sample is then centrifuged briefly to collect the Chelex® and an aliquot of the supernatant containing released DNA is used for PCR. Objectives - student should be able to:

1. Successfully isolate DNA from cheek cells 2. Prepare a PCR reaction for amplification of an Alu insert

Place a check mark in the box as you complete each step.

Important Laboratory Practices a. Add reagents to the bottom of the reaction tube,

not to its side. b. Add each additional reagent directly into

previously added reagent. c. Do not pipet up and down, as this introduces

error. This should only be done only when resuspending the cell pellet and not to mix reagents.

d. Make sure contents are all settled into the bottom of the tube and not on the side or cap of tube. A quick spin may be needed to bring contents down.

a. Pipet slowly to prevent contaminating the pipette barrel.

b. Change pipette tips between each delivery. c. Change the tip even if it is the same reagent

being delivered between tubes. Change tip every time the pipette is used!

Keep reagents on ice.

Check the box next to each step as you complete it.

Alu PCR, 2017 5

DNA Preparation Using a Saline Mouthwash 1. Vigorously swirl 10mL of saline solution in your mouth for 30

seconds. Note: The saline solution is a 0.9% NaCl solution, the salt concentration of your blood plasma. Note to Teachers: Make sure you use sterile containers for storing saline solution.

2. Expel saline into a cup and swirl to mix the cells.

3. Label a 1.5mL microfuge tube with a number (like a PIN) or your initials.

Note to Teachers: Use sign up sheet to designate numbers with corresponding student initials.

4. Transfer 1500µL (1.5mL) of the saline/cell suspension into the labeled microfuge tube. To do this, transfer 750µL twice.

1.5 mL saline

5. In a microcentrifuge, spin your saline cell suspension for 1 minute to pellet the cells. Be sure to use another student’s sample as a balance.

Note: Centrifuge speed should be set to 10,000 x g (10,000 rpm). Note to Teachers: 1. With the small, black microcentrifuges, you may need to spin for 3–5 minutes because they spin at a lower g. 2. It is a very good idea to require students to show you their cell pellet before proceeding to the next step.

#2Your number or initials on the side of tube and on the top of the closed lid.

Alu PCR, 2017 6

6. Observe your cell pellet at the bottom of the tube. Show

your pellet to your teacher to make sure it is sufficient. If your pellet is too small, pour off the supernatant and repeat steps 4-5. This will increase the number of cells in your tube because you will add more saline rinse.

If your pellet is the right size, pour off the supernatant into your cup, being careful NOT to lose your cell pellet.

Note: There will be about 100µL of saline remaining in the tube after you pour.

7. Check to make sure you can see your cell pellet and that there is about 100µL of saline covering it. You may need to add more saline to get up to about 100µL.

Rack or flick tube to mix, which will “resuspend” the cell

and make an evenly mixed solution.

Note: You can also “rack” your sample. Be sure the top of the tube is closed, hold tube firmly at the top, and pull it across a microfuge rack 2–3 times.

Resuspend cells in the remaining saline

8. Obtain a tube of Chelex from your instructor. Label with your number or initials.

9. Withdraw ALL of your cell suspension from step 7 and add it to the tube containing Chelex. Flick tube to mix.

Note: Do not pipet up and down at this step, as it will clog the tip with Chelex beads.

10. Heat block version: If your Chelex (with the cell suspension) is in a normal 1.5mL microfuge tube, take your tube to a heat block station. Slide a cap lock onto the tube lid and place it in the heat block for 10 minutes. Keep track of your tube in the heat block.

Note to Teachers: The temperature of the heat block should be between 95°C and 102°C.

5% Chelex You can see the slightly opaque chelex beads in the tube.

2(Chelex)

2(Cells)

!

Alu PCR, 2017 7

Supernatant (liquid

portion) à

PCR tube version: If your Chelex (with your cell suspension) is in a tiny PCR tube, follow your teacher’s instruction on placing it in a thermal cycler at 99°C for 10 minutes. Record the location of your tube.

11. After heating, gently remove the cap lock and open the tube to release the pressure. Caution: the tube will be hot! Close and then rack or shake the tube well and place it in a centrifuge to spin for 1 minute.

12. Obtain another clean 1.5mL microfuge tube and label it with your number. Also write “DNA” on this tube.

13. Holding your tube at eye level, use a P-200 to withdraw 50µL of supernatant from the Chelex/DNA tube to the newly labeled tube. Be sure NOT to transfer any Chelex beads.

Note: This is your isolated “DNA” sample.

14. Have someone check the “DNA” tube to be sure that no Chelex beads were transferred into it. There should be NO Chelex beads present, as they will interfere with the PCR.

Note to Teachers: This step allows you to ensure that no Chelex beads are transferred into the PCR reaction tube in the next step. If you see beads, have students place the DNA back in the Chelex tube, re-spin, and redo this transfer step into a NEW labeled tube.

15. Place your DNA tube in the class rack. Your teacher will refrigerate your isolated DNA until you are ready to prepare your PCR amplification.

#2DNA

#2DNA

#2DNA

Alu PCR, 2017 8

Polymerase Chain Reaction 1. Obtain a tiny PCR tube. Label it with your PIN number, just

under the lip.

Note: Keep our PCR tube on ice when setting up the reaction.

2. Pipet 20 µL of Master Mix into your PCR tube. Note to Teachers: It is critical that the Master Mix stays on ice before and during experimental setup.

20 µL of Master Mix

3. Change your pipet tip and add 20 µL of Primer Mix into your PCR tube.

Note to Teachers: It is critical that the Primer Mix stays on ice before and during experimental setup.

20 µL of Primer Mix

4. With a new pipet tip, add 10 µL of your extracted DNA into your PCR tube.

What is the total volume in your tube? _________ µL

Note: Make sure that all the liquids are settled into the bottom of the tube and not on the side of the tube or in the cap. If not, you can give the tube a quick spin in the centrifuge. Do not pipette up and down; it introduces error.

10 µL of DNA

5. Setting up the controls:

a. Two students will be asked to set up the positive control reactions (+C) for the class. They will use the positive control DNA provided in the kit. There should be enough +C PCR sample for one lane on each gel.

b. Another two students will set up negative control reactions for the whole class (–C). They will use sterile water. There should be enough –C PCR sample for one lane on each gel.

Control Master

Mix Primer

mix DNA

+ 20 µL 20 µL 10 µL +C DNA

- 20 µL 20 µL 10 µL sterile H20

6. Check the volume of your PCR tube by comparing it to a reference PCR tube with 50 µL in it. It should be near the thermal cycler, set by your teacher.

Note: If the volume of your tube does not match, see your instructor to troubleshoot. You may need to set up the reaction again.

PCR Tube Reference Tube

50 50#μL#

Alu PCR, 2017 9

7. Place your reaction into the thermal cycler and record the location of your tube on the grid provided by your teacher.

8. The cycling protocol for amplification of Alu PV92: 1) 95°C hold for 2 minutes 2) 30 cycles of: 94°C for 30 seconds 60°C for 30 seconds 72°C for 2 minutes 3) 72°C hold for 10 minutes 4) 4°C hold, ∞ infinity Note to Teachers: If possible, store PCR samples in freezer until gel is run. Refrigeration is adequate for short periods of time, but for more than 24 hours, PCR samples should be stored in freezer to prevent degradation.

Thermal cycler Instrument displaying

program parameters

1 2 3 4 5 6 7A 1123 828

B 1027

C 6777 9305

Alu PCR, 2017 10

Agarose Gel Electrophoresis To determine whether or not you carry the Alu repeat, you will need to visualize the products of your amplification. This will be done using a process called gel electrophoresis in which electric current forces the migration of DNA fragments through a special gel material. Since DNA is negatively charged, it will migrate in an electric field towards the positive electrode (Figure 2). When electrophoresed through a gel, shorter fragments of DNA move at a faster rate than longer ones. The Alu repeat adds 300 base pairs of length to a DNA fragment and DNA with Alu will slowly migrate during electrophoresis.

Figure 2. Side view of an agarose gel showing DNA loaded into a well and the direction of DNA fragment migration during electrophoresis.

The gel material to be used for this experiment is called agarose, a gelatinous substance derived from a polysaccharide in red algae. When agarose granules are placed in a buffer solution and heated to boiling temperatures, they dissolve and the solution becomes clear. A comb is placed in the casting tray to provide a mold for the gel. The agarose is allowed to cool slightly and is then poured into the casting tray. Within about 15 minutes, the agarose solidifies into an opaque gel having the look and feel of coconut Jell-O™. The gel, in its casting tray, is placed in a buffer chamber connected to a power supply and running buffer is poured into the chamber until the gel is completely submerged. The comb can then be withdrawn to form the wells into which your PCR sample will be loaded. Loading dye is a colored, viscous liquid containing dyes (making it easy to see) and sucrose, Ficoll, or glycerol (making it dense). To a small volume of your total PCR reaction, you will add loading dye, mix and then pipet an aliquot of the mixture into one of the wells of your agarose gel. When all wells have been loaded with sample, you will switch on the power supply. The samples should be allowed to electrophorese until the dye front (either yellow or blue, depending on the dye used) is 1 to 2 cm from the bottom of the gel. The gel can then be moved, stained and photographed.

Calculations for Preparing 2% Agarose Gel

You will need a 2%, mass/volume agarose gel for electrophoresis of your PCR products. If your agarose gel casting trays holds 50 mL, then how much agarose and buffer would you need? The definition of m/v % in biology is grams (mass) / 100 mL (volume). Therefore, for 2% agarose, it will be 2 g /100 mL buffer. Step 1: Calculate the mass of agarose needed for 50 mL total volume of agarose solution. Step 2: Calculate the amount of buffer needed to bring the agarose solution to 50 mL. By standard definition, 1 gram of H2O = 1 mL of H2O. The amount of buffer for the 2% agarose solution will be 49 mL (50 mL – 1 mL (1 gram of agarose)).

Electrophoresis of Amplified DNA 1. Retrieve your PCR tube and place it in a balanced

configuration in a microcentrifuge. Spin it briefly (10

2 g X g = X = 1 gram

100 ml 50 ml

Alu PCR, 2017 11

seconds) to bring the liquid to the bottom of the reaction tube.

Note: Make sure the centrifuge adapters are in place before putting the tiny PCR tube into the centrifuge rotor.

2. Add 5 µL of loading dye to your PCR tube. Note to Teachers: Make sure that the loading dye mixture contains dyes that do not migrate at the same rate as your Alu amplicons, otherwise they may overlap with your bands of interest and they will be more difficult to see.

3. Carefully load 15 to 20 µL of the DNA/loading dye mixture into a well in your gel. Make sure you keep track of what sample is being loaded into each well.

Note: Avoid poking the pipette tip through the bottom of the gel or spilling sample over the sides of the well. Use a new tip for each sample.

4. One student (or the instructor) should load 5-10 µL of 100 bp ladder (molecular weight marker) into one of the wells of each gel.

Note to Teachers: If you are running double-welled gels, then make sure that you add 100 bp ladders in a well in each row.

5. When all samples are loaded, attach the electrodes from the gel box to the power supply. Have your teacher check your connections and then electrophorese your samples at 150 Volts for 25–40 minutes.

Note to Teachers: Keep an eye on the gels as they may heat up and begin to melt if they are run at too high a voltage. For double-combed gels, about 25 minutes is sufficient. Single-combed gels can be run longer for better resolution. Running time may vary according to gel length and is given in relation to BABEC equipment. Check manufacturer suggestions for your own equipment.

6. After electrophoresis, the gels will be ready to stain and photograph.

Note to Teachers: If gels cannot be immediately photographed or if gel trays are needed for another class, gels can be stored in a tray covered with some buffer and bagged to prevent drying. However, the longer the gels are in buffer, the more diffuse the bands will be.

Alu PCR, 2017 12

Staining and Photographing Agarose Gels

The PCR products separated on your agarose gel are invisible to the naked eye. If you look at your gel in normal room light, you will not be able to see the amplified products of your reaction. In order to “see” them, we must stain the gel with a fluorescent dye called ethidium bromide (EtBr). Molecules of ethidium bromide are flat and can intercalate, or insert, between adjacent base pairs of double stranded DNA (Figure 3). When this interaction occurs, they take on a more ordered and regular configuration causing them to fluoresce under ultraviolet light (UV). Exposing the gel to UV light after staining, allows you to see bright, pinkish-orange bands where there is DNA (figure 4). Figure 3. Ethidium bromide molecules intercalated between DNA base pairs. Your teacher may stain your agarose gel and take a photograph for you so that you may analyze your Alu results. Gel staining is done as follows: 1. Place the agarose gel in a staining tray. 2. Pour enough ethidium bromide (0.5µg/ mL) to cover the gel. 3. Wait 20 minutes. 4. Pour the ethidium bromide solution back into its storage bottle. 5. Pour enough water into the staining tray to cover the gel and wait 5 minutes. 6. Pour the water out of the staining tray into a hazardous waste container and place the stained gel on a UV light box. 7. Place the camera over the gel and take a photograph. 8. Check with your district on how to dispose of hazardous waste liquid and solids. CAUTION: Ethidium bromide is considered a carcinogen and neurotoxin. Always wear gloves and appropriate PPE (personal protective equipment) like safety glasses when handling. Students should NEVER handle EtBr. CAUTION: Ultraviolet light can damage your eyes and skin. Always wear protective clothing and UV safety glasses when using a UV light box. Figure 4. After staining an agarose gel with ethidium bromide, DNA bands are visible upon exposure to UV light.

Alu PCR, 2017 13

Results

By examining the photograph of your agarose gel, you will determine whether or not you carry the Alu repeat on one, both, or neither of your number 16 chromosomes. PCR amplification of this Alu site will generate a 415 bp fragment if the repeat is not present. If the repeat is present, a 715 bp fragment will be made. Figure 5 shows the structure of an individual’s two number 16 chromosomes in a case where one carries the Alu repeat and the other does not.

Figure 5. The chromosomes you inherit from your parents may or may not carry the Alu repeat on Chromosome 16.

When you examine the photograph of your gel, it should be readily apparent that there are differences between people at the level of their DNA. Even though you amplified only one site, a site that every one has in their DNA, you will notice that not all students have the same pattern of bands. Some students will have only one band, while others will have two. We use the term allele to describe different forms of a gene or genetic site. For those who have the Alu repeat (they have at least one 715 bp band), we can say that they are positive for the insertion and denote that allele configuration with a “+” sign. If the Alu repeat is absent (a 415 bp band is generated in the PCR), we assign a “-” allele designation. If a student has a single band, whether it is a single 415 bp band or a single 715 bp band, then both their number 16 chromosomes must be the same in regards to the Alu insertion. They are said to be homozygous and can be designated with the symbols “-/-” or “+/+”, respectively. If a student’s DNA generates a 415 bp band and an 715 bp band during PCR, the student is said to be heterozygous at this site and the designation “+/-” is assigned. A person’s particular combination of alleles is called their genotype. See the table below for a quick summary of the allele designations.

Possible Bands Allele Designation Genotype Alu Insert 1. One band at 415 bp -/- homozygous No Alu insert 2. One band at 715 bp +/+ homozygous Alu insert present on both

chromosomes 3. One band at 415 bp

and a second band at 715 bp.

+/- heterozygous Alu insert on one of the chromosomes

Alu PCR, 2017 14

Figure 6 below, shows a representation of a possible experimental outcome on a gel, where all possible allele combinations have been generated. Figure 6. Agarose gel of homozygous and heterozygous individuals for the PV92 Alu insertion. A 100 base pair ladder is loaded in the first lane and is used as a size marker, where these bands differ by 100 bp in length. The 500 bp band and the 1,000 bp band are purposely spiked to be more intense than are the other bands of the ladder when stained with ethidium bromide. The next 5 lanes contain the results of homozygous and heterozygous individuals. A negative control (-C) does not contain any template DNA and should therefore contain no bands. The positive control (+C) is heterozygous for the Alu insertion; it contains both the 415 bp and 715 bp bands.

Alu PCR, 2017 15

Biostatistics Activity One: Calculating Allele and Genotype Frequencies Objectives - student should be able to: 1. Define allele, genotype, and phenotype 2. Calculate allele frequencies 3. Calculate genotype frequencies 4. Define and calculate Hardy-Weinberg equilibrium

Allele Frequencies

Within your class, how unique is your particular combination of Alu alleles? By calculating an allele frequency, you can begin to answer this question. An allele frequency is the percentage of a particular allele within a population of alleles. It is expressed as a decimal value. You can calculate an allele frequency for the Alu PV92 insertion in your class by combining all your data. For example, imagine that there are 100 students in your class and the genotype distribution within the class is as follows:

Genotype Number of Students having that Genotype

+/+ 20 +/- 50 -/- 30

Since each person in your class has two number 16 chromosomes (they are diploid for chromosome 16), there must be twice as many total alleles as there are people: To calculate allele frequencies for the class, therefore, 200 will be used as the denominator value. To calculate the “+” allele frequency, we must look at all those students who have a “+” in their genotype. There are 20 students who are “+/+”; they are homozygous for the insertion. Since these 20 students have two copies of the Alu insert on their chromosomes, they contribute 40 “+” alleles to the overall frequency: There are 50 students heterozygous (“+/-”) for the Alu insertion. Each heterozygous individual, therefore, contributes one “+” allele to the overall frequency, or 50 “+” alleles. Adding all “+” alleles together gives us: The frequency of the “+” allele in this class, therefore, is:

90 “+” alleles

200 total alleles = 0.45

40 “+” alleles from the homozygotes (+/+) + 50 “+” alleles from the heterozygotes (+/-)

90 “+” alleles total

2 “+” alleles student

x 100 students = 200 alleles

2 “+” alleles homozygous “+/+” student

x 20 homozygous “+/+” students = 40 “+” alleles

Alu PCR, 2017 16

The frequency for the PV92 “-” allele is calculated in a similar manner. There are 30 students homozygous for the “-” allele. This group, then, contributes 60 “-” alleles to the frequency. There are 50 students heterozygous for the Alu insertion. They contribute 50 “-” alleles to the frequency. Adding all “-” alleles together gives us: The frequency of the “-” allele in this class, therefore, is Notice that the sum of the frequencies for the “+” and “-” alleles should always be 1.0. Use the spaces below to calculate the “+” and “-” allele frequencies for your class. Number of total alleles: Number of “+” and “-” Alleles:

Genotype Number of Students Number of “+” Alleles

Number of “-” Alleles

+/+ 0 +/- -/- 0

Total: Allele Frequencies: Do these allele frequencies add up to 1.00? _________

60 “-” alleles from the homozygotes (-/-) + 50 “-” alleles from the heterozygotes (+/-)

110 “+” alleles total

110 “-” alleles

200 total alleles = 0.55

0.45 “+” allele frequency + 0.55 “-” allele frequency

= 1.00

2 alleles student

x students alleles =

“+” allele frequency =

total “+” alleles

total alleles

=!

“-” allele frequency =

total “-” alleles

total alleles

=!

Alu PCR, 2017 17

Genotype Frequencies

How does the distribution of Alu genotypes in your class compare with the distribution in other populations? For this analysis, you need to calculate a genotype frequency, the percentage of individuals within a population having a particular genotype. Remember that the term allele refers to one of several different forms of a particular genetic site whereas the term genotype refers to the specific alleles that an organism carries. You can calculate the frequency of each genotype in your class by counting how many students have a particular genotype and dividing that number by the total number of students. For example, in a class of 100 students, let’s say that there are 20 students who have the “+/+” genotype. The genotype frequency for “+/+”, then, is 20/100 = 0.2. Given the ethnic makeup of your class, might you expect something different? How can you estimate what the expected frequency should be? If within an infinitely large population no mutations are acquired, no genotypes are lost or gained, mating is random, and all genotypes are equally viable, then that population is said to be in Hardy-Weinberg equilibrium. In such populations, the allele frequencies will remain constant generation after generation. Genotype frequencies within this population can then be calculated from allele frequencies by using the equation: p2 + 2pq + q2 = 1.0 where p and q are the allele frequencies for two alternate forms of a genetic site. The genotype frequency of the homozygous condition is either p2 or q2 (depending on which allele you assign to p and which to q). The heterozygous genotype frequency is 2pq. Let’s use our fictitious class again (see page 16) to calculate expected genotype frequencies. We determined the following allele frequencies (we will assign p to the “+” allele and q to the “-” allele): p = 0.45 for “+” allele frequency q = 0.55 for “-“ allele frequency We expect, therefore, that the genotype frequency for “+/+” is equal to p2 which is p2 = (0.45)2 = 0.2025 The frequency for the “+/-” genotype is 2pq = 2(0.45)(0.55) = 0.495 The frequency for the “-/-” homozygous genotype is expected to be q2 = (0.55)2 = 0.3025 To convert these decimal numbers into numbers of students, we multiply each by the total number of students. Since there are 100 students in this fictitious class, the number of students in the class expected to have the “+/+” genotype is 100 x 0.2025 = 20.25 students who should be “+/+” The number of students who should be “+/-” is 100 x 0.495 = 49.5 The number of students who should be “-/-” is 100 x 0.3025 = 30.25 On page 16, you calculated the allele frequencies found in your class. Use these frequencies to determine the expected class genotype frequencies. (Let p represent the “+” allele and q the “-” allele.)

Alu PCR, 2017 18

Expected “+/+” genotype frequency: p2 = _________ = ______ Expected “+/-” genotype frequency: 2pq = _________________ = ______ Expected “-/-” genotype frequency: q2 = _________ = ______ Use the table below to calculate how many students in your class should have each genotype.

Genotype

Expected Genotype Frequency

Total Number of Students in Class

Expected Number of Students with

Specific Genotype +/+ +/- -/-

Now, calculate the actual genotype frequencies for this class (hint: use data on page 16). Actual “+/+” genotype = ______________________________ Actual “+/-” genotype = ______________________________ Actual “-/-” genotype = ______________________________

IsyourclassinHardy-Weinbergequilibrium?

Alu PCR, 2017 19

Name________________________________________

Date _________________ Period_________________

Review Questions: Allele and Genotype Frequencies

1. A class is looking at a dimorphic Alu insert on chromosome number. How many total alleles are there in a class of 34 students for this Alu site? Suggested answer: A class of 32 students will have 64 total alleles. Explanation: If each student has two alleles (one on each chromosome), then the total number of alleles will be twice the number of students: 2. The “-” allele frequency for the class is 0.3. What is the “+” allele frequency? Suggested answer: The “+” allele frequency is 0.7 Explanation: The sum of the frequencies for the “+” and “-” alleles should always be 1.0. p + q = 1 p = “+” alleles q = “-“ alleles 0.3 + 0.7 = 1.0 3. A class in Hardy-Weinberg equilibrium has a “+/+” genotype frequency of 0.64. What is the “+” allele frequency? Suggested answer: The “+” allele frequency is the square root of 0.64, which is 0.8. Explanation: p2 + 2pq + q2 = 1.0 allele frequency = p genotype frequency = p2 plug in 0.64 in for p2and solve: p2= 0.64 4. The “+/+” genotype frequency for a class is 0.49 and the “-/-” genotype frequency is 0.09. What is the “+/-” genotype frequency if the class is in Hardy-Weinberg equilibrium? Suggested answer: 2pq = 2 x 0.7 x 0.3 = 0.42 Explanation: p2 + 2pq + q2 = 1.0 p2 = 0.49 q2 = 0.09 Therefore, 2pq = 2 x 0.7 x 0.3 .49 + (2 x 0.7 x 0.3) + 0.09 = 1.0

2 alleles student

x 34 students = 64 alleles

p = 0.64 = 0.8

p = 0.49 = 0.7 q = 0.09 = 0.3

!!!!!!!!!!!

Alu PCR, 2017 20

Biostatistics Activity Two: Using the Allele Server at the CSHL DNA Learning Center

Objectives - student should be able to:

1. View the class data in the Cold Spring Harbor Laboratory Alu PV92 database 2. Plot the frequency of the Alu PV92 insert for different world populations on a map 3. Formulate a hypothesis describing the origin and spread of the Alu PV92 insert across the globe 4. Use Chi Square analysis to determine differences between your class data and data sets from other human

populations 5. Brainstorm reasons for genetic similarities and differences between populations

The DNA Learning Center at Cold Spring Harbor Laboratory has developed a number of bioinformatics tools for student use. Bioinformatics tools are computer programs used to help scientists make sense of biological data and solve biological problems. You will be using the Allele Server for four different activities to help you learn more about Alu PV92 in human populations. In the first exercise, you will check your calculations for allele and genotype frequencies. Next, you will access data from a database to plot the “+” allele frequency from different world populations. In the third activity you will check to see if your class could be in Hardy-Weinberg equilibrium. The last activity includes computer analysis to find human populations similar to and different from your class.

Part 1: Using the Allele Server to Check Your Allele and Genotype Frequencies Your teacher has added your class results into a database at the Cold Spring Harbor Laboratory using the Allele Server program. In this activity you will also use the Allele Server to access your class data so that you can check your allele and genotype calculations.

Looking at Allele and Genotype Frequencies 1. Open your preferred web browser (i.e: Firefox,

Safari, Explorer, Chrome)

2. In the internet address box, type in the following web address: http://www.bioservers.org/bioserver. The Allele Server main page will show up.

3. The Bioservers page should appear on the screen. You will want to use the Allele Server. Click on the REGISTER button if you have not previously registered with Bioservers. Fill out the required information and then hit SUBMIT. If you are already registered, enter your username and password, then press LOGIN.

Alu PCR, 2017 21

4. Two windows will appear. After registration or login, the Main Workspace Window will open. In addition, a pop-up window will open entitled Using Allele Server. This is a great resource if you need a refresher on how to use the Allele Server. The Main Workspace Window is where you will load your own data for comparison and analysis. Click on the MANAGE GROUPS button to bring up the MANAGE GROUPS Window.

5. In the upper right hand corner of the MANAGE GROUPS window, is a self-scroll menu bar. This will automatically default and load Classes. Otherwise, select Classes from this menu. Once you are in the Classes window, scroll down to find your class. Click the VIEW button on the right-hand side.

6. The GROUP INFORMATION window will show the data for your class.

a. In the spaces provided, fill in the allele and genotype frequencies for your class as displayed in the GROUP INFORMATION window.

b. Do these allele and genotype frequencies match the actual allele and genotype frequencies that you calculated (page ? and 18? in manual)? _________ If you answered “No”, check your calculations again.

Close the window by clicking the small close box at its top.

"+" Allele Frequency: "-" Allele Frequency: “+/+” Genotype Frequency: “+/-“ Genotype Frequency: “-/-“ Genotype Frequency:

Alu PCR, 2017 22

Part 2: Using the Allele Server to Look at Different World Populations Humans, monkeys, mice, canines, and corn have them running rampant through their genomes. They move undetectably from chromosome to chromosome. They are the so-called jumping genes and the Alu element is one of them. Although Alu is found only in primates, there are other related jumping genes that have found their way into the DNA of most eukaryotic organisms on Earth. Alu is classified as a retroposon—a genetic element that uses the enzyme reverse transcriptase to copy itself from one chromosomal location to the next. For this reason, calling Alu a “jumping gene” can be misleading. Alu doesn’t “jump” in the sense that it leaves one location to occupy another. When Alu moves, it leaves a copy of itself behind. The Alu element first appeared tens of millions of years ago. Since that time, it has been increasing within our genome at the rate of about one copy every 100 years. It is difficult to tell how Alu arose. It shows a striking similarity to a gene (called 7SL RNA) that performs a vital function in our metabolism. But Alu, it seems for now, has no specific function. It is self-serving and, like a parasite, takes advantage of us for its own replication without providing us any advantage to our own survival. Most Alu elements are “fixed”; they are found at the same chromosomal site in every person on the planet. Fixed Alu elements must have arisen very early in our evolution, well before Homo sapiens appeared. When modern humans did arise some 200,000 years ago, the vast majority of our Alu insertions came to us already intact in our DNA. The Alu PV92 insertion, however, is not fixed. This insertion may or may not be present on one or both of a person’s number 16 chromosomes. Since not everyone has the Alu PV92 element, it must have arisen after the initial human population began growing. It is a widely held belief that modern humans originated in Africa and then disseminated across the planet. Did the Alu PV92 insert arise in Africa or on some other continent during our spread across the globe? In the following exercise, you will plot the “+” allele frequencies for various populations on a world map and make some determination as to where this Alu arose and how it might have spread across continents.

Plotting the Alu PV92 Insert on the World Map 1. Return to the MANAGE GROUPS window. Wait for the MANAGE GROUPS window to load the classes before going ahead and selecting “Reference” from the popup menu on the upper right corner of the page. Click on the boxes to the left of at least 10 population groups to select representative places around the world. When done, click the OK button. This will place these groups in the Allele Server workspace—the original startup page.

Alu PCR, 2017 23

2. Click on the OPEN button to the right of the population group of interest in this list. This will bring up the window displaying details about the population.

3. Record the “+” allele frequency for that population on the world map provided. Close the window by clicking the close box at the top of the window and open the next population group. Record that ”+” allele frequency on your map. Repeat this process for all the population groups listed on your workspace. When you are finished, clear the workspace by checking each box to the left of each population group and then pressing the CLEAR button.

Alu PCR, 2017 24

Name________________________________________

Date _________________ Period_________________

Exercise: Global Map and Table for Analyzing Alu PV92 Allele Frequencies On page 25 you will find a world map with a variety of different populations highlighted. Follow the directions on pages 22-23 to find the “+” allele frequencies on the Allele Server and write them directly on the map next to the number for each population. In addition, you can use the table provided on page 26 to fill in the allele frequencies for each population. You can then use this table to plot the values on the map. This table also has a column for number of samples tested. Why do you think it is important to consider the number of samples in each data set? Look at the “+” allele frequencies for the various world populations that you entered on your world map and/or table and consider the following questions: 1. Which ethnic groups are most likely to have the Alu insertion? Suggested answer: The +/+ genotype is most common in Asian populations. 2. Do you notice any pattern in the allele frequencies? Explain. You may use the map to diagram with arrows. Suggested answer: The + allele frequency is high in all Asian groups (up to 90%) and generally decreases moving westward through the Middle East, with European and African populations having frequencies of 10-35%. High + allele frequencies are also found in American Indian populations: Yanamamo (96%) and Maya (70%). 3. Where do you think the Alu PV92 insert originated? Formulate an explanation for where you believe the Alu PV92 insert originated and how it spread throughout different world populations. Suggested answer: There will be several interpretations of what the data mean and where Alu first inserted. This is an opportunity to discuss how different explanations can emerge in science when you’re all working from the same data set. Most students conclude that the insertion arose in Asia and was then diluted by gene flow to the west. However, the Alu distribution pattern could also be the product of migration and genetic drift. Calculations suggest that the PV92 insertion occurred about 200,000 years ago. It would have occurred in a population of Homo erectus, which then survived to give rise to modern humans (us). If this jump occurred in Asia, then Homo erectus must have survived in Asia to give rise to modern populations there. This would be consistent with the regional development hypothesis. The accepted replacement hypothesis, also called “Out of Africa”, supports the PV92 insertion occurring in a Homo erectus population in Africa. The worldwide frequencies of approximately 20% suggest that the + allele drifted to approximately this frequency in Africa prior to the migrations that gave rise to European, Asian, and Australian populations. The frequency then drifted much higher among the migrants that founded Asian populations, several of which may have carried a high + allele frequency when they migrated across the Bering Strait to found American Indian populations. 4. Make a prediction about where you think the future directions of Alu will be and why. Suggested answer: Students should draw upon critical thinking skills and interdisciplinary connections to brainstorm why populations increase, decrease, move, and change. For example, students can explore the influence of geographic and economic factors, food availability, disease, natural disasters, invasions, and wars. Time permitting, they can do research to identify which might be the most probable explanation to support their conclusions. Students can work in pairs or small groups and write one set of answers for the group. They can give presentations as a group to the class.

Alu PCR, 2017 25

Name ________________________________________ Date __________________ Period_________________

World Map for Plotting Global Allele Frequencies

Alu PCR, 2017 26

Name_________________________________________ Date __________________ Period_________________

Table for Recording Allele Frequencies # Group Name

"+" frequency

"-" frequency

Sample Size

1 African American 0.2 0.8 692 Alaska Native 0.29 0.71 413 Australia Aborigine 0.15 0.85 994 Breton (France) 0.27 0.73 455 Cajun 0.21 0.79 686 Chinese 0.86 0.14 507 Euro-American 0.18 0.82 458 Filipino 0.8 0.2 309 French 0.23 0.77 4410 German 0.1 0.9 6511 Greek, Cyprus 0.18 0.82 4512 Hispanic American 0.51 0.49 6813 Hungarian 0.12 0.88 6514 India Christian 0.52 0.48 2215 India Hindu 0.52 0.48 2316 Indian Muslim 0.3 0.7 2017 Italian 0.24 0.76 2118 Java 0.84 0.16 3219 !Kung (''Bushmen'') 0.2 0.8 3520 Malay 0.72 0.28 4721 Maya (Central America) 0.7 0.3 2722 Moluccas (Indonesia) 0.69 0.31 4923 Mvskoke (Seminole) 0.53 0.47 3224 Nguni (Southern Africa) 0.24 0.76 4525 Nigerian 0.09 0.91 1126 Pakistani 0.3 0.7 2727 Papua New Guinea 0.14 0.86 7628 Papua New Guinea, Costal 0.19 0.81 8929 Pushtoon (Afgani) 0.33 0.67 5030 Pygmy (Central African Republic) 0.26 0.74 1731 Pygmy (Zaire) 0.35 0.65 1732 Sardinian (Aritzo) 0.17 0.83 1533 Sardinian (Marrubiu) 0 1 1234 Sardinian (Ollolai) 0 1 1435 Sardinian (San Teodoro) 0.27 0.73 1536 Sotho (Southern Africa) 0.29 0.71 4637 South India 0.56 0.44 4738 Swiss 0.2 0.8 4339 Syrian 0.18 0.82 6840 Taiwanese 0.9 0.1 4241 Turkish, Cyprus 0.58 0.42 3342 United Arab Emirates 0.3 0.7 2743 Yanomamo (Amazon) 0.94 0.04 26

Alu PCR, 2017 27

Part 3: Using Allele Server to Test if Your Class is in Hardy-Weinberg Equilibrium On page 16, you calculated the expected genotype frequencies for your class using the Hardy-Weinberg equation. Are the expected genotype frequencies you calculated similar to the actual class frequencies? If they are different, then it may mean that the population in your class is not in Hardy-Weinberg equilibrium. If we do observe differences, how can we account for them? How do we even know when there is actually a significant difference between the observed genotype frequencies and the expected genotype frequencies? You will use the Allele Server program to address these questions.

Chi Square Analysis of Your Class Data 1. In the MANAGE GROUPS “Classes” window,

locate you class and place a check mark in the box to its left. Click the OK button at the bottom of the window. This will bring you back to the ALLELE SERVER workspace window. Your class data will have been placed in the workspace.

2. Click on the box to the left of your class name in the workspace. In the scroll box to the left of the ANALYZE button, make sure it is on “Chi-Square”. Below the ANALYZE button is a circular radio button (a small hand on the right side of the screen points to it). Click on it then click on the ANALYZE button.

3. The CHI SQUARE window that appears displays the observed genotype frequencies for your class and the genotype frequencies that would be expected if your class were in Hardy-Weinberg equilibrium. Do these look similar? Close the CHI SQUARE window when you are finished.

By following the above steps, you have directed Allele Server to use a test called Chi-square, a statistical test used for comparing observed frequencies with expected frequencies. The Allele Server analysis gives you a Chi-square value and a p-value. The larger the chi-square value, the greater is the difference between the observed and the expected values. When using the Chi-square analysis, we test the null hypothesis that there is no difference between samples (observed and expected) and we assume that if there is any difference, then it arose simply by chance and is not real. For this study, our null hypothesis is that your class is in Hardy-Weinberg equilibrium.

Alu PCR, 2017 28

Whether or not we can accept the null hypothesis is given by the p-value. If the calculated p-value is less than 0.05, the null hypothesis is disproved; the population is not in Hardy-Weinberg equilibrium. If the p-value is greater than 0.05, the population may be in Hardy-Weinberg equilibrium; we cannot prove that it is not in Hardy-Weinberg equilibrium. As an example, let’s say that Chi-square analysis of your data gives a p-value of 0.17. This means that there is a 17% probability that the difference between the observed and the expected values is due to chance. It also means that there is an 83% (100% - 17% = 83%) probability that the difference is not due to chance; the difference is real. What is the Chi-square value for your class? ____________ What is the p-value for your class data? ___________

Alu PCR, 2017 29

Name ________________________________________

Date __________________ Period________________

Review Questions: Hardy-Weinberg Equilibrium and Biostatistics

1. What is the probability that the difference between the observed and the expected genotype frequencies calculated for your class is due to chance? Suggested answer: This will vary according to your data. It will be the p-value that is generated. Multiply this value by 100 to determine the difference that is due to chance. Explanation: The probability that an observation is due to chance is called a p-value. If the p-value

calculated for this comparison is less than 0.05, the difference between your class and the other population group is probably real and not due to chance. If the p-value is greater than 0.05, then there is probably no difference between your class and the other population group.

p-value < 0.05 = REAL p-value > 0.05 = CHANCE 2. Based on the Chi-square and p-values, do you believe your class is in Hardy-Weinberg equilibrium? Why or why not? Suggested answer: This is an open-ended question depending on your class data.

Explanation: Hardy-Weinberg equilibrium represents a stable population and is a standard for

comparison or measuring change. A population is said to be in Hardy-Weinberg equilibrium if it meets the following criteria: • sufficiently large population • no migration in or out of the group • no new mutations are acquired • no genotypes are lost or gained • mating is random and there is no reproductive advantage • all genotypes are equally viable whereby the allele frequencies will remain

constant generation after generation.

The variables in the Hardy-Weinberg equation should all add up to 1 for the class to be in equilibrium. If they do not equal 1, then the class is not in equilibrium. The Chi-Square analysis of your data will give you a p-value, which is a measure of confidence that the result you see is not due to random chance alone. If the p-value is greater than 0.05, then there is probably no difference between your class and the other population group.

While the class itself would be a very small population, its members are more or less representative of a larger population in your town or region. There is probably a relatively small amount of migration in and out of your town or region. There is no evidence of very recent, new mutations at the PV92 locus that would influence genotypes. As there is no way of visually determining a PV92 genotype, people mate randomly in relation to this polymorphism. Therefore, perhaps surprisingly, the class may generally fulfill the requirements for Hardy-Weinberg equilibrium.

Alu PCR, 2017 30

Part 4: Using Chi-Square to Compare Two Population Groups In this part of the exercise, you will use chi-square analysis to determine whether or not there is any difference in the genotype distribution between your class and another population group. If the p-value that is calculated for this comparison is less than 0.05, then the difference between your class and the other population group is probably real. If the p-value is greater than 0.05, then there is probably no difference between your class and the other population group.

Chi Square Analysis of Two Populations 1. In the Allele Server workspace, click the MANAGE

GROUPS button. This will take you to the MANAGE GROUPS window. Select CLASSES from the pop-up menu, select your class and then click the OK button.

2. You should now have your class data on your Allele Server workspace.

3. Return to the MANAGE GROUPS window and select Reference from the pop-up menu. This will bring up a list of different populations in the world for which the Alu PV92 insertion has been determined. Click the box to the left of the population group that you believe should most resemble your class and click the OK button at the bottom of the screen. This will import the data for that group onto the Allele Server workspace.

4. Click the boxes to the left of both population groups in your workspace. Make sure the pop-up menu immediately to the right of the COMPARE button displays Chi-Square. Click the COMPARE button. This will bring up the CHI SQUARE window.

Alu PCR, 2017 31

5. The CHI SQUARE window will display the Chi-square and p-value for these two population groups.

The population group you are comparing your class to is ______________________________. What is the p-value for the Chi-square test? ______ Based on the p-value, are the genotype frequencies of your class and the other population most probably identical or significantly different? ________________________

6. When you are finished, close the CHI SQUARE window. Follow the above steps again to identify a human

population that your class data most resembles. Choose at least five populations to compare with your class. Record your p-values below. Population p-value

The population group your class most resembles is _______________. Chi-square analysis gives a p-value of __________ when these two populations are compared. You may want to compare your class with another class in the database. Other classes can be found in the Classes section of the MANAGE GROUPS window.

Alu PCR, 2017 32

Name ________________________________________

Date __________________ Period_________________

Review Question: Studying Populations 1. Two populations on the small island of Sardinia in the Mediterranean Sea have significantly different genotype frequencies for the Alu PV92 insert. Provide a possible explanation for this observation. Suggested answer: There are four Sardinian populations that have genotypes data listed on the Allele Server: There may be several interpretations of what the data mean. It will be important to keep in mind that allele frequencies can change dramatically in small populations. This random fluctuation in allele frequency is termed genetic drift. Recall that Hardy-Weinberg equilibrium represents a stable population and is a standard for comparison or measuring change. A population is said to be in Hardy-Weinberg equilibrium if it meets the following criteria:

• sufficiently large population • no migration in or out of the group • no new mutations are acquired • no genotypes are lost or gained • mating is random and there is no reproductive advantage • all genotypes are equally viable whereby the allele frequencies will remain constant

generation after generation. Applying these criteria to the Sardinian data, it is evident that the population samples were very small. Students may also note that there is no information regarding relationships of individuals tested, and no record of date/type of testing performed. This could also be an opportunity to discuss the unique geography, history, and economics of the island and how these factors affect population numbers and distribution. 2. From the population data, the Yanomamo tribe in the Amazon rainforest has the highest genotype frequency for the PV92 insert. How would you explain this? Suggested answer: This is an opportunity to discuss how humans have migrated and populated the planet. A possible explanation is that the “+” frequency drifted much higher among the migrants out of Africa that founded Asian populations, several of which may have carried a high “+” allele frequency when they migrated across the Bering Strait to found American Indian populations.

ID # Group Name"+" frequency

"-" frequency

Sample Size

32 Sardinian (Aritzo) 0.17 0.83 1533 Sardinian (Marrubiu) 0 1 1234 Sardinian (Ollolai) 0 1 1435 Sardinian (San Teodoro) 0.27 0.73 15

Alu PCR, 2017 33

Life Technologies & Applied Biosystems / BABEC Educational PCR Kits

For Research Use Only. Not for use in diagnostic procedures.

NOTICE TO PURCHASER: LIMITED LICENSE

A license under U.S. Patents 4,683,202, 4,683,195, and 4,965,188 or their foreign counterparts, owned by Roche Molecular Systems, Inc. and F. Hoffmann-La Roche Ltd (Roche), for use in research and development, has an up-front fee component and a running-royalty component. The purchase price of the Lambda PCR, Alu PV92 PCR, PCR Optimization, D1S80 PCR, and Mitochondrial PCR Kits includes limited, non-transferable rights under the running-royalty component to use only this amount of the product to practice the Polymerase Chain Reaction (PCR) and related processes described in said patents solely for the research and development activities of the purchaser when this product is used in conjunction with a thermal cycler whose use is covered by the up-front fee component. Rights to the up-front fee component must be obtained by the end user in order to have a complete license. These rights under the up-front fee component may be purchased from Applied Biosystems or obtained by purchasing an authorized thermal cycler. No right to perform or offer commercial services of any kind using PCR, including without limitation reporting the results of purchaser’s activities for a fee or other commercial consideration, is hereby granted by implication or estoppel. Further information on purchasing licenses to practice the PCR process may be obtained by contacting the Director of Licensing at Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California 94404 or at Roche Molecular Systems, Inc., 1145 Atlantic Avenue, Alameda, California 94501.

Use of this product is covered by US patent claims and corresponding patent claims outside the US. The purchase of this product includes a limited, non-transferable immunity from suit under the foregoing patent claims for using only this amount of product for the purchaser’s own internal research. No right under any other patent claim (such as the patented 5’ Nuclease Process claims) and no right to perform commercial services of any kind, including without limitation reporting the results of purchaser's activities for a fee or other commercial consideration, is conveyed expressly, by implication, or by estoppel. This product is for research use only. Diagnostic uses require a separate license from Roche. Further information on purchasing licenses may be obtained by contacting the Director of Licensing, Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California 94404, USA.

TRADEMARKS:

Applied Biosystems, AB (Design), GeneAmp, and Primer Express are registered trademarks and Veriti and VeriFlex are trademarks of Applied Biosystems Inc. or its subsidiaries in the US and/or certain other countries.

AmpliTaq is a registered trademark of Roche Molecular Systems, Inc. All other trademarks are the sole property of their respective owners.

© Copyright 2001, Applied Biosystems. All rights reserved.