Alternative Splicing of the NCI Domain of the Human a3(lV

THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1994 by The American Society for Biochemistry and Molecular Biology, Ine.

Vol. 269, No. 3, Issue of January 21, pp. 2342-2348, 1994 Printed in U S A .

Alternative Splicing of the NCI Domain of the Human a3(lV) Collagen Gene DIFFERENTIAL EXPRESSION OF mRNA TRANSCRIPTS THAT PREDICT THREE PROTEIN VARIANTS WITH DISTINCT CARBOXYL REGIONS*

(Received for publication, June 21, 1993)

Lili Feng, Yiyang Xia, and Curtis B. Wilson$ From the Department of Zmmunology, The Scripps Research Institute, La Jolla, California 92037

Three clones of NC1 of (u3(IV) collagen, named Q1, LS, and V, were isolated from human kidney; these predict three variant arS(IV) NC1 domains of 232-, 60-, and 199- amino acid residues, respectively, with unique COOH- termini. The human collagen IV gene ( C O W ) was isolated and characterized, and it was shown that the cDNA variants arose from alternative splicing by deletion of exon 4 in LS and deletion of exon 2 in V. The mRNA transcripts were differentially expressed in fetal and adult human kidney with Q1 the major species. Exon 4- LS lacked 183 residues from the carboxyl terminus with a frameshift producing a unique 11-amino acid terminal peptide. In exon 2- V a frameshift resulted in a unique V carboxyl terminus of 53 novel peptides with a new glycosylation site. The size of recombinant proteins indicated the frameshifts and new stop codons were as predicted. The multiple forms of the a3(IV) NC1 region may contribute to autoimmune glomerular disease and hereditary nephritis, in which this portion of the collagen lV molecule is thought to play an important role.

Collagen IV is a major structural component of basement membranes and contains at least six types of a-chains, al- 6(IV), which are present in varying amounts in different basement membranes (1-4). Each of the a-chains is a separate gene product. The structure of the individual a-chains is similar, with an approximate 230-residue noncollagenous COOH-terminal region, called the NC1 domain, adjacent to the triple helical collagenous region. The NC1 domain is highly conserved with retention of 12 cysteine residues among the a-chains. Al- teration of the NC1 segment could not only interfere with the normal folding of the globular NC domain, but also could hinder the end-to-end assembly of collagen IV molecules (5,6).

A major glomerular basement membrane (GBM)’ antigenic epitope reactive with human autoantibodies that spontane-

* This work was supported in part by United States Public Health Service Grants Dm0043 and M 0 1 RR00833 (General Clinical Research Center). This is publication No. 7775-1” from the Department of Immunology, The Scripps Research Institute, La Jolla, CA. This work was presented in preliminary form at the American Society of Nephrol- ogy meeting, Baltimore, MD, November 1992 (51). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTMIEMBL Data Bank with accession numbeds) U02519 and U02520

$ To whom correspondence should be addressed: Dept. of Immunol-

Jolla, CA 92037. “el.: 619-554-8056; Fax: 619-554-6705. ogy, The Scripps Research Institute, 10666 North Torrey Pines Rd., La

The abbreviations used are: GBM, glomerular basement membrane; DHFR, dihydrofolate reductase; PCR, polymerase chain reaction; RT, reverse transcription; IPTG, isopropyl-1-thio-P-o-galactopyanoside; PAGE, polyacrylamide gel electrophoresis; nt, nucleotide; bp, base pair;

ously forms in patients with Goodpasture’s syndrome and some other forms of glomerulonephritis is present in the a3(IV) NC1 domain (7-10). The cDNA for the a3(IV) NC1 domain has been reported, and its genomic DNA has been published (11-13). The gene is located on chromosome 2, region q35-37 (11). Expres- sion of cDNA or use of synthetic peptides suggests that the COOH terminus of the a3(IV) NC1 harbors major autoanti- body-reactive epitope(s), although additional reactive sites including other collagen IV a-chains and its NH2-terminal, 7 S region, may be involved in some patients (14-17). In addition, the GBM antigenic epitopes reactive with the human anti- GBM antibodies are not detected in affected patients from some kindreds with hereditary nephritis termed Alport syndrome (18, 191, and recent studies indicate that the a3(IV) and a4(IV) chains of the NC1 region are missing in collagenase digests of renal basement membranes from patients with Alport syndrome (20). Antibodies formed in Alport syndrome patients after transplantation with a normal kidney react with antigens believed to represent the a3(IV) and possibly a5(IV) NC1 regions (21, 22). a5(IV), whose gene maps to the X chromosome (4), has been found to be differently mutated in kindreds of patients with Alport syndrome, with deletions of highly conserved cysteines and disruption of disulfide bridges (23-25). The relationship between mutations in a5(IV) and the absence of a3(IV) or a4(IV) NC1 regions is currently unclear and could represent alterations in synthesis, abnormalities in assembly, or antigenic epitope masking or cleavage.

While cloning the cDNA for the human NC1 domain of a3(IV), different sized clones were observed, and the genomic DNA for the NC1 domain was recovered to understand the introdexon structure and to confirm that the different cDNAs had arisen by alternative splicing. The differential expression pattern of the different mRNAs was determined by RNase protection assay in fetal and adult kidneys to better access the possible contribution of the alternative forms in development.

MATERIALS AND METHODS RTPCR to Generate the cDNAs of NC1 Domain-First strand cDNA

synthesis was performed using human kidney total RNA and murine leukemia virus reverse transcriptase with a random hexanucleotide primer. The 100-pl reaction mixture contained standard enzyme buffer, 5 pg of total RNA, 20 units of RNasin, 500 pmol of hexanucleotide primer, 10 nw dithiothreitol, 1 nw of each dNTP, with 200 units of reverse transcriptase, and was heated to 95 “C for 10 min. Five pl of the mixture were used for PCR with NC1-5’ (B’-CMCCACAG-

CACC-3’), and V-5‘ (5’-GCCC?TGAGCC’ITATATAAGC-3’) and NC1-3‘ for two separate reactions of PCR (60 “C was used for annealing during 35 cycles). The oligonucleotides were synthesized on an AB1 model 380B synthesizer (Applied BioSystems, Foster City, CA).

CAAlTCCTTCA-3’) and NC1-3‘ (5’-TCAGTGTCT”CTTCATGCA-

kb, kilobase.

2342

Differential Expression of Alternatively Spliced a3(N) NC1 2343

E tu 8 s m w x

12.OK -

3.OK - w

2.OK - 1.6K- -

. .

1 .OK- w

0.5K -

FIG. 1. A Southern blot showing the reaction of Q1 cDNA with an EcoRI digested purified human placenta DNA. The reactive 3- and 1.6-kb bands were purified for ligation into EcoRI digested, CIP- treated AZap I1 and packaged in Gigapack I1 Gold packaging extract for isolation of the NC1 genomic DNA of a3(lV).

Construction of a Partial Genomic DNA Library-Five hundred pg of purified DNA from human placenta were digested with EcoRI and 10 pg of digested DNA were used for Southern blot (Fig. 1). The rest of the DNA was recovered by electrophoresis in 0.7% low melting point gel. The DNA bands identified by Southern blot (3 and 1.6 kb) were purified and ligated into EcoRI-digested, alkaline phosphatase from calf intes- tine (CIPktreated AZap 11, and were packaged in Gigapack I1 Gold packaging extract (Stratagene, La Jolla, CA).

Screening and Sequencing of Human Genomic Clones for the NCl Domain of c ~ ~ ( W , T W O kinds of libraries (3 and 1.6 kDa) were screened with riboprobes transcribed from cDNA coding for the NCI domain. Screening of both libraries was performed under stringent hybridization conditions. Approximately 6 x lo6 recombinant phages from the 3- and 1.6-kDa libraries were screened. Hybridization to filters was carried out overnight at 55 "C in Hybrisol (Oncor, Gaithersberg, MD) with 200 pg/ml heat-denatured, sheared salmon sperm DNA, 5 pg/ml Esch- erichia coli DNA, and a concentration of 2 x lofi c p d m l probe. Filters were washed once with 2 x SSC, 0.1% SDS at 37 "C for 30 min, three times at 55 "C for 30 min, and two times at 65 "C with 0.1% SSC and 0.1% SDS. After two rounds of screening, the positive plaques were picked up and the phagemids carried in A Z A P I1 (Stratagene) recombi- nants were rescued with helper phage in accordance with the manufac- turer's instructions. Genomic DNA was subcloned into M13mp19 for single strand sequencing or into pGEMs for double strand sequencing by Sequenase enzymes (U. S. Biochemical Corp.).

Expression of QI, L5, and V in E. coli-All three cDNAs were subcloned into modified PET-lla fused with dihydrofolate reductase (DHFR) with a 6 x His tag at the 5' end and were named pETDHisQ1, pETDHisL5, and pETDHisV. HSM174(DE3) cells transformed with pETDHisQl, pETDHisL5, and pETDHisV were induced by isopropyl- 1-thio-P-D-galactopyanoside (IPTG). The recombinant protein was purified by a Ni-NTA-agarose column (Qiagen, Chatsworth, CA) and examined by SDS-PAGE.

Probe Subcloning-A 301-base pair (bp) fragment from the PCR- cloned Q1 was produced by digestion with AuaII, blunted with T4 DNA polymerase, and subcloned into pGEM 42 (named QlA301). A 248-bp fragment of Q1 from a HincII and EcoRI digest was subcloned into pGEM 42 (named QlB248). L5 was digested with AvaII, blunted, and

Primers: NC1-5' + NC1-3'

Q1 657bp L5 479 bpL (V 484bp) - r Y? 324bp

1 2 3 4 5 6 ~~

Primers: V-5' + NC1-3'

"Q1 394bp "V221bp

FIG. 2. The results of the RT-PCR of human kidney RNA are shown. In lanes 1 3 the products recovered with the NCI-5' and NCI-3' primers show the 657-bp Q1 clone and the overlapping 479-bp L5 and 484-bp V clones. The Y? 324-bp band in lanes 1 3 is caused by mispriming with the upstream NCI-5' primer (see text). In lane 5, the overlapping L5 and V clones are resolved using the V-5' and NCI-3' primers. Lane 6 shows a negative control. The I-kb marker is shown in lane 4.

the 123-bp fragment was subcloned into pGEM 42 (named L5A123). V was digested with AuaII and the 223-bp fragment was subcloned into pGEM 42 (named VA223).

RNA Extraction and RNase Protection Assay-Total RNA was isolated from 12- and 18-week (Advanced Bioscience Resources, Inc. Ala- meda, CA) as well as adult human kidneys by the single step method (26). Five pg of total RNA from each sample were hybridized with 1 x IO5 cpm of the appropriate ["P1UTP-labeled antisense riboprobe a t 55 "C for at least 10 h. The unhybridized RNA was then digested with RNase T1 and RNase A, as described elsewhere (27). The dried blots were scanned and radioactivity was quantitated on the Ambis radio- analytic imaging system (Ambis Systems, San Diego, CA), as previously described (27).

Amino Acid Sequence Comparison-Protein sequences were studied and compared for molecular mimicry using the IG-Suite package (In- telliGenetics, Inc., Mountain View, CA). Sequence hydropathy and structural plots were assessed with the GCG package (Genetics Com- puter Group (1991), Madison, WI).

RESULTS

Zsolation and Characterization of a3(lV,, NCl Domain cDNAs-Three different sizes of clones for a3(IV) NC1 were obtained by RT-PCR of human kidney RNA (Fig. 2). When NC1-5' and NC1-3' primers were used, a 657-bp clone was obtained and named Q1. Two other smaller clones, 479 and 484 bp in length, were also found and were named L5 and V, respectively. The sequence of Q1 was found to correspond exactly to the published sequence of NC1 domain of a3(IV), except that the codon for amino acid 86 was determined to be ACA rather than ATA, as reported (12), and the codon for amino acid 155 was ACC rather than GCC (11). These differences were also confirmed for amino acid 86 in the V clone and later in the genomic DNA. The results of these differences indicated that codons for amino acids 86 and 155 specify threonines rather than isoleucine and alanine, respectively.

Observation of the known introdexon patterns of COL4A1 and COL4A5 suggested that L5 and V could have come from the events of alternative splicing. Sequencing of L5 and V indicated that the deletion in L5 could have been due to "skipping" of exon 4, and the deletion in V could have been caused by "skipping" of exon 2, in both cases with frameshifts and the use of new stop codons. In Fig. 2 (lanes 1-31, the size difference

2344 Differential Expression of Alternatively Spliced a3(N) NC1

between L5 and V was only 5 bp and the amplified L5 and V overlapped, as shown in the second band. For better separation, V-5' and NC1-3' were used for PCR in which 394-bp Q1 and 221-bp exon 4- V were obtained (Fig. 2, lane 5).

The third band (Fig. 2, lanes 1-31 was caused by mispriming with the upstream primer, NC1-5'. This was because the NC1 domain of a3(IV), like that of al(IV) (281, contained a repeat symmetry in which the two halves of the protein had a high degree of homology. The NC1-B'primer, 5"CAAACCACAG- CAATTCCTTCA-3', with a sequence corresponding to the 5' half nucleotides (nt) 64-87 of the NC1 domain, had an 80% homology with 3' half n t 394-428 of the NC1 domain, 5'-

Zsolation of the 3' End of the Human COUA3 Gene-After two rounds of screening the 3- and 1.6-kb EcoRI libraries, two positive clones were obtained from the 3-kb library and one positive clone was obtained from the 1.6-kb library. Selective sequencing of the exodintron junctions indicated that the exon sizes and exodintron patterns of NC1 domains of al(IV), a5(IV), and a3(IV) were in very good alignment (24, 29). The exodintron structure of a2(IV) was different from that of a3(lV) in that two exodintron junctions were missing; however, the remaining exons of both shared the same borders (30). Although there were great similarities in the exon sizes and exon borders, the intron sizes themselves were different among COL4A3, COL4A1, and COL4A5 (13, 24, 31). Intron 2 and intron 4 of COL4A3 were approximately 1500 and 950 bp, respectively. The sequence of the shortest COL4A3 intron, intron 3 (Fig. 31, was only 126 bp, which was smaller than the recent size estimates reported by Quinones et al. (13). Intron 2, intron 3, and intron 4 for COL4A1 are 2.9 kb, greater than 13 kb and 960 bp (31). The corresponding sizes for COMA5 are 345 bp, 2.05 kb, and 5 kb, respectively (24). The sizes of exon 2 and exon 4 which were involved in alternative splicing were 173 and 178 bp, respectively, and both were exons with split codons, which explains the frameshifts and different stop codons found in L5 and V. All of the introns started with gt and ended with ag. The exodintron structure determined for the COMA3 genomic DNA confirmed the initial impression that L5 and V could indeed have arisen through alternative splicing. The unique DNA sequences and predicted amino acid sequences for the L5 and V clones are shown in Fig. 4.

Expression of Three Clones in E. coli-To confirm the pre-

CAAACCACTGACATTCCTCCATGT-3'.

TAT ATA AGC AG gtaaaaatccaatcccctagttttacaatgggaccaagtgaatc a c t t c c c t t g t a a t g g a a t g a a a g g c a g c a c a t g a c a g t g g c g c c atagtctttgtttcatgttacag A TGC ACT GTT

FIG. 3. The sequence of intron 3 is shown with the adjacent sequences from exons 2 and 3.

W begins

dicted splicing, frameshift, and alternate stop codon usage Ql, L5, and V were expressed. The cell lysate from transformed HSM174(DE3) cells with or without induction by IFTG was examined by SDS-PAGE. After Coomassie Blue staining, the expected sizes of recombinant proteins fused with DHFR (26 kDa) were found: 52 kDa for Ql, 50 kDa for V, and 33 kDa for L5 (Fig. 5 ) .

Change in Expression of V and L5 mRNA in the Kidney during Development and Adult Life-Total RNA prepared from human kidneys at different months of age and from adults was analyzed by ribonuclease protection assay using different probes. Hybridization of the QlA301 probe (containing exon 4), followed by ribonuclease digestion, identified a 301-nt band from the exon 4' Q1 and V, and a 106-nt band from the exon 4- L5 (Fig. 6). Hybridization with the exon 4- L5A123 probe yielded a fully protected 123-nt band from the exon 4- L5 and a truncated 106-nt fragment from both the exon 4' Q1 and V mRNAs (Fig. 6). Hybridization with the QlB248 probe, which covered exon 2, yielded a fully protected 248-nt band from the exon 2' Q l , a truncated 184-nt band from the exon2- V, and a truncated 180-nt band from the exon 2- L5 (Fig. 7). There was no separation of 184-nt V and 180-nt L5 when QlB248 was used as a probe. Hybridization with the exon 2- VA223 probe (Fig. 7) yielded a fully protected 223-nt band from the exon 2-

97 kD-

69 kD-

46 kD- W e

30 kD- -0

21 kD- 14 kD-

1 2 3 4 FIG. 5. ACoomassie Blue-stained SDS-PAGE of purified recom-

binant proteins from transformed HSM174(DE3) cells after induction with IFTG. The recombinant proteins fused with the DHFR are Q1 (lane 11, V (lane 21, and L5 (lane 3 ) and DHFR alone (lane 4) .

FIG. 4. Areas of unique DNA sequence and predicted amino acid sequence for L5 and V, the two alternatively spliced products of the COLA43 NC1 gene caused by frameshifts and different stop codons.

~5 exon 5 1

exon 4 ."" exon 3~ exon 2 A e x o n j "- " .""""_

"c---- " " "-

GAT OCA CTG TTT GTC AAG GTC CTG CCA TCG CCA TAG ""

D A L F V K V L R S P .

sm""

V exon5 I\ exon 4 I\ exon 3 ."" ."-""" _"_ ~"~""--------------- . .. AAA GCC TAT TCC ATC AAC TGT GAA AGC TGG GGA ATT AGA AAA AAT AAT AAG TCG K A V S I N C E S W C I R K N N K S

965 9 9 2 1

CTG TCA GOT GTG CAT GAA GOA AAG ACA CTG AAC CTA AAA AAG ACA OCA GAA CTC 1019 1 M 6

L S C V H E E K T L K L K K T A E L

GTA TTT TTC ATC CTA AAC AAC AAA GTA ATG ACA GAA CAT GCT GTT ATT TAG 1073

V F F I L K N K V M T E H A V I .

Differential Expression of Alternatively Spliced a 3 W NCl 2345

results of adult and fetal kidney RNA FIG. 6. The RNase protection assay

are shown for two probes QlA301

gion, left panel) and MA123 (183 nt (361 nt including the polylinker re-

including the polylinker, right panel). The exon regions of 61 , L5, and V covered by the two probes are shown in the schematic at the lower portion. The QlAprobe detects a 301-nt fragment from Q1 and V and a 106-nt fragment in the exon 4- L5. The L5A123 probe detects the expected 123-nt L5 band and a shorter 106-nt band in Q1 and V which contain exon 4. Variations in the relative intensi- ties of the bands at different ages are ap- parent.

kidney 1 Opg ea A

Y Y

LS (106) -

kidney lOpg/line n

- L5A probe (183)

- L5 (1 23)

'Q1,V (106)

i

L5A123 ! I

V, a 138-nt band from the exon 2' Q1, and a 115-nt band from L5. Asecond 85-nt band was also present in both the exon 2' Q1 and the L5 mRNAs. The high density of the 85-nt band was caused by the overlap from both Q1 and L5. Fig. 8 summarizes the ratios of QlN, L5N, and QlL5, as quantitated by the radioactivity detected in the protected bands with the Ambis system, and represents the average of three independent ex- periments (the 18-week values were not included due to a shortage of RNA for replicates). Because different amounts of radiolabeled nucleotide can be present in the protected fragments depending on their length and nucleotide content, this ratio was not canonical if not corrected; however, it could serve as an indicator of the fluctuations of various mRNA concentra- tions. For final values of different mRNAs, the counts were corrected to compensate for the different numbers of [32P]UTP that could be incorporated in the protected fragments. The calculations used the following formula: net counts = LsIA x LplLs, where Ls is the length of the protected fragment (nt), Lp is the length of the longest protected fragment on the gel, and A was the number of adenine nucleotide in the antisense DNA template. When the ratios were determined for the exon 4'1 exon 4- or exon 2+lexon 2- ratios, this formula was not used for calculation because some bands were a mixture of two kinds of mRNAs. The formula was used to calculate the QW, L5N, and Q l L 5 ratios (Fig. 8).

Studies with Q1A or L5A as a probe during development revealed changing exon 4'lexon 4- (Ql, VL5) ratios. A similar fluctuation of exon 4'lexon 4- ratios was found in assays with these two probes. The VA probe was the only probe that could

be used to monitor the QlN, L5N, and QlL5 ratios individu- ally (Fig. 8). When VA was used as a probe, the lowest Q1N ratio occurred in a 12-week fetal kidney, with a slight increase thereafter. In contrast, the highest Q l L 5 ratio was found in the 12-week fetal kidney, with a decrease from 4.0 to 3.4 between the 12-week fetal kidney and the adult kidney. The L5N ratio was found to be up-regulated during development, which cor- related with Q l L 5 ratio. Among the three types of mRNAs, Q1 was the major type, about 13-15 times greater than V and 3-4 times greater than L5. According to the L5N and QlL5 ratios, L5 was up-regulated during development and aging.

Structure Analyses of Novel Peptides of V and L5-Deduced primary sequences of L5 and V were analyzed for hydropathy (Kyte-Doolitle) and acid-base composition by using the Hyd program. The unexpected appearance of an N-linked glycosylation site, "NKS," was found in the deduced primary amino acid sequence of V transcripts. Areas of linear amino acid homology between Q1, L5, V, and other sequences in the various data banks were sought by computer analysis. Numerous examples of 5 and 6 amino acid linear homologies were found. Table I lists examples of 7-amino acid linear homologies which might lead to instances of molecular mimicry possibly associated with induction of the autoimmune anti-GBM antibody response.

DISCUSSION Our COL4A3 genomic DNA confirmed the exodintron re-

ported by Quinones et al. (11). The structure was similar to COL4Al and COL4A5, but with two more exodintron junctions than with COMA2 (24, 29, 30). As with most other collagen

2346 Differential Expression of Alternatively Spliced a3(N) NCl

results for adult and fetal kidney FIG. 7. The RNase protection assay

RNA are shown for two probes QlB248 (252 nt with the polylinker region, left panel) and VA223 (296 n t with the polylinker, right panel ). The exon regions of Q1, L5, and V covered by the two probes are shown schematically in the lower portion of the figure. The fully protected Q1 248-nt band is evident; however, there is no separation of the 184-nt V and 180-nt L5 bands with the QlB248 probe which covers a portion of

The VA233 probe covers a small portion of exon 4, exon 3, and a portion of exon 2.

exon 4, exon 3, and part of exon 1. A fully protected 223-nt band from the exon 2- V is evident with a 138-nt band from the exon 2' Q1 and a 115-nt band from L5. The high density 85-nt band comes from the overlap of Q1 and V.

kidney kidney 10pgIline 1 Opglline - 4

Q1 B probe (252)- Q1 (248)-

- VA probe (296) - V (223)

-Q1 (138) @# JM -L5(115)

v (184)- L5 (180)-

' lp I@ - Q1 ,L5 (85)

HincII EcoRI

Q18248 NCI begins I

L5 exon 5 A exon4 A exon 3 v ""_ """""

VA223

T

= 12 Week Adulf

m VA(Ql/LS)

h ~ . 8. The ratios of Q l N , LSN, and Ql /U for the 12-week and adult kidney RNA are shown. The calculations are described in the text and represent the means 2 S.D. of three different protection assays.

genes, a junctional exon (exon 5) encoded the transition of the 3' end of the Gly-X-Y repeat sequence of the triple-helical collagenous domain and the functionally distinct noncollagenous NC1 domain. Interestingly, an RGDS motif in the collagenous region was adjacent to the NC1 domain and shared exon 5 with the NC1. This could mean that the RGDS motif has some hnc- tional relationship with the NC1 domain.

The normal splicing pattern of exon 2 and exon 4 in human

kidney, as investigated by means of solution hybridization, revealed that three types of transcripts were present and the exon 2+/exon 2- and exon 4+/exon 4- ratios, of potentially great importance, varied during development and aging. The differential expression of these mRNA transcripts suggests that the relative amounts are controlled by some unknown factors and could be related to human disease (see ahead). Inspection of the sequences of the L5 and V alternative splice acceptor sites in the COMA3 NC1 gene indicated that they do not differ signifi- cantly from each other when compared with the consensus splice acceptor sequence. The V type, exon 2- transcripts were slightly higher in the fetal than in the adult kidney when studied with the VA probe, so that the ratios of Q1N and L5N kept increasing from the 12th week of fetal age. In contrast, L5 increased slightly during development in the samples studied to date. The change in V type mRNA suggested that it may play an important role during fetal development, possibly related to the novel peptide of V generated by alternative splicing.

Alternative splicing of exon 2 has been suggested in a5(IV) (32). Even if alternative splicing similar to that noted here for a3(IV) happened in a5(IV), the novel carboxyl-terminal amino acids generated by exon 2 deletion in a3(IV) would not happen in a5(IV) because the reading frameshift that occurs generates an immediate termination codon.

a3(IV), like the other members of the collagen IV family, has a very striking feature of a repeat symmetry in that the NC1 domain has a primary structure in which the first and second halves of the protein have a high degree of homology (28). The degree of homology was sufficient that, during PCR, the Q1

Differential Expression of Alternatively Spliced &(N) NCl 2347 TABLE I

Examples of potential molecular mimicry common regions with d (N) Q1 and its alternatively spliced predicted amino acid sequences

locatlon U3(ly Amino acid Molecular mimicry regions Reference

sequence

Q1 (17-23) Q1 (20-26) Ql (141-147) Q1 (153-159) Ql(159-165) Q1 (159-165) Q1 (207-213) V (11-17) V (2632)

TAIPSCP PSCPEGT GNQRAHG SEGTGQA ALASPGS ALASPGS PIPSTVK GIRKNNK KTLKLKK

Pseudomonas aeruginosa pilin protein (934-940) Pseudomonas denitrificans (165-171) Equine herpesvirus type 1 (26621-26627) Influenza A hemagglutinin (358-364) E! aeruginosa exotoxin (588-594) Mycobacterium tuberculosis aro A gene (321-327) Vaccinia virus (54878-54884) Granule membrane protein-140 (93-99) Mycoplamsa mycoides cluster (53-59)

42 43 44 45 46 47 48 49 50

NC1-5’ primer annealed to a similar sequence in the second half of NC1 domain (Fig. 2). The alternatively spliced products and the associated changes in the COOH termini of the predicted products would have an impact on the structure of the various molecular forms. Some predictions can be made on the basis of the available structural information. The four leaf clo- ver-like structure of the NC1 region of collagen IV proposed by Siebold et al. (33), which appears to be common for all the NC1 a-chain regions based on conservation of cysteine residues, would be greatly disturbed by the alternatively spliced L5 and V transcripts. In L5, 11 of the 12 conserved cysteine residues would be missing, thereby preventing formation of intermo- lecular cross-links via disulfide bridges. In V, only one of the homologous subdomains could form normally since the alternative splicing would remove the five terminal cysteines. The V type mRNA predicts a N-glycosalation site, NKS, would be formed which would be unique among collagen IV NC1 molecules. The introduction of the glycosylation site could also alter the structure of the COOH terminus, thereby changing the ability of the alternatively spliced products to form the expected end-to-end assembly of a(IV) in the GBM.

In normal conditions, the ratio between Q1 and the other two isoforms might serve to control the amount of the mature a3(IV). Since L5 and Q1 may not be functional and could not be incorporated into the mature protein, this could serve as a potential mechanism to control the amount of mature functional a3(IV). Actual odoff regulation of gene expression at the level of splicing is a very common event (34).

The identification of L5 and V alternatively spliced mRNAs for the human NC1 domain of a3(IV) and the observation that they vary in relationship to the predominant form, Q1, during development may add to our understanding of GBM antigenic and possible associated structural variations in certain autoimmune forms of glomerulonephritis and in some forms of hereditary nephritis. The NC1 region of a3(IV) carries epitopes reactive with spontaneously formed human anti-GBM antibodies found in patients with Goodpasture’s syndrome and some forms of rapidly progressive glomerulonephritis. The epitopes in the a 3 W ) NC1 are reported to be near the carboxyl terminus, an area of the predominant Q1 molecule which would be missing in the two alternatively spliced variants, L5 and V. The changes in these alternatively spliced forms during development could possible relate to the reported observations of im- paired reactivity of spontaneously formed human anti-GBM antibodies with human renal tissue from individuals during the first year of life (35).

Electron microscopic defects in the structure of GBM are found in patients with the hereditary nephritis associated with Aport syndrome (36). The GBM in some kindreds with Alport syndrome lack antigens reactive with spontaneously formed human anti-GBM antibodies, suggesting that a defect in pro- duction or assembly of the a3(IV) molecule into the GBM is a part of the abnormality seen in this condition. The relationship of alterations in a3(IV) and the recently reported genetic varia-

tions in a5(IV) in X-linked forms ofAlport syndrome, as well as in some kindreds of autosomal inheritance, remains to be de- fined. Persistence of the developmental splicing patterns in patients with Alport syndrome could contribute to the structural abnormalities in the GBM. Alterations of the relative amounts of the predicted alternatively spliced L5 and V mRNA products could greatly alter the carboxyl-terminal regions of a3(IV), presumably affecting their ability to form dimers and interchain reactions necessary for normal assembly of GBM. The decreased ability to assemble the GBM could, in turn, contribute to the observed structural abnormalities.

The induction of typically transient anti-GBM antibody re- sponses in patients with certain major histocompatibility seg- regations (37,38) is of major interest, but is poorly understood. A flu-like illness is reported by about 50% of patients prior to identification of renal or pulmonary disease. An influenza A2 infection was detected by rising antibody titers in one patient with anti-GBM antibody disease (39). Comparisons of the linear amino acid sequences of the common and unique regions of the three alternatively spliced mRNAs was done to see if any areas of striking homology to exogenous or endogenous proteins were evident which might serve as sights for induction of an immune response via the mechanism of molecular mimicry (40, 41). An area of 7-amino acid linear homology (Table I) was found between the influenza A hemagglutinin and Q1. Of interest, a 7-amino acid sequence at the NH2 termini of GMP-140 (Table I) was found to be homologous with 7 amino acids of the deduced primary sequence of the V transcripts, in which there was a glycosylation site. GMP-140 (P-selectin) is important in recruitment of inflammatory and immune cells.

The demonstration of alternative splicing of the a3(IV) NC1 domain and the differential expression of the three mRNA products during development provides a new way to begin to examine both the possible antigenic implications in autoimmune disease and the structural abnormalities of hereditary nephritis characterized by the inability to detect this antigen.

Acknowledgment- We thank Dr. Billy G. Hudson for his helpful review and suggestions concerning this manuscript.

Note Added in Proof-Apaper (Bernal, D., Quinones, S., and Saus, J. (1993) J. Biol. Chem. 268,12090-12094) describing alternative splicing of the NC1 of a3(IV) with a form identical to L5 has appeared as confirmation of these studies.

REFERENCES 1. Hudson, B. G., Wieslander, J., Wisdom, B. J., Jr., and Noelken, M. E. (1989)

2. Timpl, R. (1989) Eur: J . Biochern. 180,487-502 3. Gunwar, S. , Saus, J., Noelken, M. E., and Hudson, B. G. (1990) J. Biol. Chern.

285,546&5469 4. Hostikka, S . L., Eddy, R. L., Byers, M. G., Hoyhtya, M., Shows, T. B., and

5. Dion, A. S., and Myers, J. C. (1987) J. Mol. Biol. 195, 127-143 Tryggvason, K. (1990) Proc. Nutl. A c d . Sci. U. S. A. 87, 1606-1610

6. Mariyama, M., Kalluri, R., Hudson, B. G., and Reeders, S. T. (1992) J. Biol.

7. Butkowski, R. J., Wieslander, J., Wisdom, B. J., Barr, J. E , Noelken, M. E., and

Lab. Invest. 61, 256-269

Chern. 267, 1253-1258

Hudson, B. G. (1985) J. Biol. Chern. 260,37393747

2348 Differential Expression of Altc 8. Kleppel, M. M., Michael, A. F., and Fish, A. J. (1986) J. Bid. Chem. 261,

9. Butkowski, R. J., Langeveld, J. P. M., Wieslander, J., Hamilton, J., and Hud- 16547-16552

son, B. G. (1987) J. Biol. Chem. 262, 7874-7877 10. Butkowski, R. J., Shen, G-Q., Wieslander, J., Michael, A. F., and Fish, A. J .

(1990) J. Lab. Clin. Med. 116, 365373 11. Momson, K. E., Mariyama, M., Yang-Feng, T. L., and Reeders, S. T. (1991)Am.

J. Hum. Genet. 49,545454 12. %mer, N., Mason, P. J., Brown, R., Fox, M., Povey, S., Rees, A,, and Pusey, C.

D. (1992) J. Clin. Inuest. 89, 592-601 13. Quinones, S., Bernal, D., Garcia-Sogo, M., Elena, S. F., and Saus, J. (1992) J.

Bid. Chem. 267 19780-19784 14. Neilson, E. G., Kalluri, R., Sun, M. J., Gunwar, S., Danoff, T., Mariyama, M.,

Meyers, J. C., Reeders, S. T., and Hudson, B. G. (1993) J. BioZ. Chem. 268, 8402-8405

15. Kalluri, R., Gunwar, S. , Reeders, S. T., Momson, K. C., Mariyama, M., Ebner, K E., Noelken, M. E., and Hudson, B. G. (1991) J. Biol. Chem. 266.2401% 24024

16. Kefalides, N. A,, Ohno, N., and Wilson, C. B. (1993) Kidney Int. 43,85-93 17. Kefalides, N. A,, Ohno, N., Wilson, C. B., Fillit, H., Zabriski, J., and Rosen-

18. McCoy, R. C., Johnson, H. K., Stone, W. J., and Wilson, C. B. (1976) Iab . Inuest. bloom, J. (1993) Kidney Int. 43,9P100

19. McCoy, R. C., Johnson, H. K., Stone, W. J., and Wilson, C. B. (1982) Kidney Int. 34,325

20. Kleppel, M. M., Kashtan, C. E., Butkowski, R. J., Fish, A. J., and Michael, A. 21,642-652

21. Kleppel, M. M., Fan, W. W., Cheong, H. I., Kashtan, C. E., and Michael, A. F. F. (1987) J. Clin. Inuest. 80,263-266

22. Hudson, B. G., Kalluri, R., Gunwar, S . , Weber, M., Ballester, F., Hudson J. K., (1992) Kidney Int. 41, 1629-1637

Noelken, M. E., Sapas, M., Richardson, W. R., Saus, J., Abrahamson, D. R.,

H. R. (1992) Kidney Int. 42, 179-187 Glick, A. D., Haralson, M. A,, Helderman, J. H., Stone, W. J., and Jacobson,

23. Barker, D. F., Hostikka, S. L., Zhou, J . , Chow, L. T., Oliphant,A. R., Gerken, S. C., Gregory, M. C., Skolnick. M. H., Atkin, C. L., and Tryggvason, K. (1990)

24. Zhou, J., Hostikka, S. L., Chow, L. T., and Tryggvason, K. (1991) Genomics 9, Science 248,1224-1227

1-9 25. Zhou, J., Barker, D. F., Hostikka, S . L., Gregory, M. C., Atkin, C. L., and

Tryggvason, K. (1991) Genomics 9, 10-18 26. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159

!?-natively Spliced a3(N) NCl 27. Xia, Y., Feng, L., Yoshimura, T., and Wilson, C. B. (1993)Am. J. Physiol. 264,

28. Brinker, J. M., Gudas, L. J., Loidl, H. R., Wang, S.-Y., Rosenbloom, J. , Ke- F774-F780

falides, N. A., and Myers, J. C. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 3649-3653

29. Tryggvason, K., Soininen, R., Hostikka, S. L., Ganguly, A,, Huotari, M., and

30. Hostikka, S. L., and Tryggvason, K. (1987) FEBS Lett. 224, 297-305 Prockop, D. J. (1990) Ann. N. Y Acad. Sci. 580, 97-111

31. Soininen, R., Huotari, M., Ganguly, A,, Pmckop, D. J., and Tryggvason, K.

32. Saito,A., Sakatsume, M., Kimura, H., Shimada, H., andArakawa, M. (1991) J.

33. Siebold, B., Deutzmann, R., andKuhn, K. (1988)Eu. J. Biochem. 176,617-624 34. Bingham, B. M., Chou, T.-B., Mims, I., and Zachar, Z. (1988) %rids Genet. 4,

35. Anand, S. K, Landing, B. H., Heuser, E. T., Olson, D. L., Grushkin, C. M., and

36. Spear, G. S . (1984) Clin. Nephrol. 21, 3-6 37. Rees,A. J., Peters, D. K., Compston, D. A. S. , and Batchelor, J. R. (1978)Lancet

38. Huey, B., McCormick, K., Capper, J., Ratliff, C., Colombe, B. W., Gamvoy, M.

39. Wilson, C. B., and Smith, R. C. (1972) Ann. Intern. Med. 76.91-94 40. Fujinami, R. S . (1988)Ann. N. YAcad. Sci. 540,210-217 41. Horsfall, A. C. (1992) Mol. Bid. Rep. 16, 139-147 42. Nunn, D., Bergman, S . , and Lory, S. (1990) J. Bacteriol. 172, 2991-2919 43. Crouzet, J . , Cameron, B., Cauchois, L., Rigault, S . , Rouyez, M-C., Blanche, F.,

44. Allen, G. P., and Coogle, L. (1988) J. Virol. 62,2850-2858 Thibaut, D., and Debussche, L. (1990) J. Bacteriol. 172, 598C-5990

45. Kida, H., Shortridge, K. F., and Webster, R. G (1988) Virology 162, 160-166 46. Gary, G. L., Smith, D. H., Baldridge, J. S., Harkins, R. N., Vasil, M. L., Chen,

E. Y., and Heyneker, H. L. (1984) Pmc. Natl. Acad. Sci. U. S. A. 81,2645- 2649

47. Garbe, T., Jones, C., Charles, I., Dougan, G., and Young, D. (1990) J. Bacteriol. 172,6774-6782

48. Goebel, S. J., Johnson, G. P., Perkus, M. E., Davis, S. W., Winslow, J. P., and Paoletti, E. (1990) Virology 179,517-563

49. Johnston, G. I., Cook R. G., and McEver R. P. (1989) Cell 68,1033-1044 50. Taylor, T. K, Bashiruddin, J. B., and Gould, A. R. (1992)Int. J. Syst. Bacteriol.

51. Feng, L., Xia, Y., Tang, W. W., and Wilson, C. B. (1992) J. Am. Soc. Nephrol. 3,

(1989) J. Bid. Chem. 264, 13565-13571

Am. Soc. Nephrol. 2, 560

134-138

Lieberman, E. (1978) J. Pediatr. 92,952-953

1,966-968

R., and Wilson, C. B. (1993) Kidney Int. 44,307-312

42,593-601

629

Documents

Alternative Splicing of the NCI Domain of the Human a3(lV