The EMBO Journal vol.15 no.15 pp.3974-3985, 1996

All four core histone N-termini contain sequencesrequired for the repression of basal transcription inyeast

Fran9oise Lenfant, Randall K.Mann,Bo Thomsen, Xuefeng Ling andMichael Grunstein1Department of Biological Chemistry, UCLA School of Medicine andMolecular Biology Institute, University of California, Los Angeles,CA 90095, USA

'Corresponding author

Nucleosomes prevent the recognition of TATA pro-moter elements by the basal transcriptional machineryin the absence of induction. However, while Saccharo-myces cerevisiae histones H3 and H4 contain N-terminalregions involved in the activation and repression ofGAL] and in the repression of heterochromatin-likeregions, the sequences involved in repressing basaltranscription have not yet been identified. Here, wedescribe the mapping of new N-terminal domains, inall four core histones (H2A, H2B, H3 and H4), requiredfor the repression of basal, uninduced transcription.Basal transcription was monitored by the use of a GAL]promoter-URA3 reporter construct whose uninducedactivity can be detected through cellular sensitivity tothe drug, 5-fluoroorotic acid. We have found for eachhistone that the N-terminal sequences repressing basalactivity are in a short region adjacent to the structureda-helical core. Analysis of minichromosome DNA topo-logy demonstrates that the basal domains are requiredfor the proper folding of DNA around the nucleosomalparticle. Deletion of the basal domain at each histonesignificantly decreases plasmid superhelical density,which probably reflects a release of DNA from theconstraints of the nucleosome into the linker region.This provides a means by which basal factors mayrecognize otherwise repressed regulatory elements.Keywords: basal transcription/chromatin/histones/repression/Saccharomyces cerevisiae

IntroductionNucleosomes have been shown to repress transcriptioninitiation (Lorch et al., 1987). This may reduce the activityof the eukaryotic basal transcription apparatuson chromatin templates in the absence of activatorfunction (reviewed by Grunstein, 1990; Felsenfeld, 1992).Engineered loss of nucleosomes in Saccharomyces cere-visiae by genetic means helps to illustrate this phenom-enon, since nucleosome depletion in the absence ofupstream activator sequence (UAS) function leads tothe widespread activation of yeast promoters (Han andGrunstein, 1988; Durrin et al., 1992). A number ofnucleosome alterations can also decrease nucleosomalrepression in vitro. For example, removal of histones H2A

and H2B from nucleosomes prevents full compaction andallows greater access of the transcriptional machinery tounderlying regulatory sequences (Hayes and Wolffe, 1992;Hansen and Wolffe, 1994). In addition, the trypsin-sensitive histone N-terminal tails, which extend from thenucleosomal core, may influence the binding of transcrip-tion factors. Acetylation of the tails enables the recognitionof the 5S RNA gene by TFIIIA in reconstituted chromatin(Lee et al., 1993). These results are complementaryto genetic studies which have demonstrated that theN-termini of histones H3 and H4 have regulatory functionsin transcription and cell cycle progression (Grunstein,1992; Megee et al., 1995). For example, deletion ofresidues 4-23 of the H4 N-terminus, which contain theacetylated lysines (at sites 5, 8, 12 and 16), results in an~20-fold decrease in GAL] mRNA levels during induction(Durrin et al., 1991). This large N-terminal sequence ofH4 has also been shown to be necessary for nucleosomepositioning at the a2 operator in yeast (Roth et al., 1992)and at the GAL] promoter (Fisher-Adams and Grunstein,1995). In contrast, the deletion of the H3 N-terminalresidues (H3A4-15) does not similarly affect nucleosomepositioning (Fisher-Adams and Grunstein, 1995) and leadsto 'hyperactivation' of GAL] at a rate ~3-fold greater thanthat found in wild-type cells (Mann and Grunstein, 1992).While the effect of the H4 N-terminal deletion is mediatedthrough the GALl TATA element, H3-associated hyper-activation has been found to function through the GAL]UAS (Wan et al., 1995).

Additional genetic analyses have shown that domainsin both H4 (residues 16-29) and H3 (residues 4-20) arealso required for repression of the heterochromatin-likeregions adjacent to the telomeres and at the silent (HM)mating loci, HML and HMR (Kayne et al., 1988; Aparicioet al., 1991; Johnson et al., 1992; Thompson et al., 1994).These H3 and H4 effects are specific in that even largedeletions at the H2A and H2B N-terminal tails have beenshown to have little if any effect on telomeric and HMlocus repression and have relatively minor effects on theregulation of the GAL] promoter (Kayne et al., 1988;Durrin et al., 1991; Thompson et al., 1994). We had alsoshown that an H3 N-terminal deletion (H3A4-30) canincrease the level of uninduced basal transcription in vivo.For example, H3A4-30 causes an increase in GALI-lacZ-derived ,3-galactosidase activity from 0.1 to 1.35 units(Mann and Grunstein, 1992). However, it is not clearwhether the genetically determined regulatory functionsare due to a direct or indirect role of the N-termini in theprevention of nucleosome access by the basal transcriptioncomplex.

In this study, we wished to define the histone sequencesrequired for the repression of GAL] basal transcriptionand to determine whether they coincide with or are distinctfrom regulatory N-terminal regions described above. In

34 Oxford University Press3974

Histone domains repress basal transcription

order to measure changes in basal expression rapidly andsensitively in strains with altered core histones, we usedan assay which is based on a fusion of the GAL] promoterto the URA3 coding region. Since the product of the URA3gene helps convert 5-fluoroorotic acid (5-FOA) to thetoxic compound 5-fluorouracil, this reporter constructallows a sensitive measurement of GAL] promoter activityby determining cellular sensitivity to 5-FOA (Boeke et al.,1987). We report here that N-terminal tails of histonesH2A, H2B, H3 and H4 all contain a domain, near thejunction of the hydrophilic N-terminus and the highlycx-helical structured core, that is required for the repressionof basal transcription. Significantly, these regions largelydo not include the sites of acetylation. We also askedwhether these 'basal domains' had unique effects onchromatin structure and DNA topology. We found thatdeletions of the basal domains did not appear to alternucleosomal positioning, as assayed by indirect end-labeling and ectopically synthesized Escherichia coli Dammethyltransferase, but strongly affected plasmid super-helical density. Our data suggest that N-terminal domainsinvolved in repressing basal transcription are distinct fromthose involved in GAL] and heterochromatin regulationand are required for the proper folding of DNA aroundthe nucleosomal particle.

ResultsN-termini of all four core histones are required forrepressing episomal GAL1 basal transcriptionTo examine the effects of deleting portions of the histoneN-termini on GAL] repression, we first developed asensitive and reproducible assay for increases in basaltranscription. It has been shown that changes in transcrip-tion of the URA3 gene can cause changes in viability ofup to seven orders of magnitude in S.cerevisiae in thepresence of 5-FOA (Boeke et al., 1987). To adapt thisassay for measuring derepression of the uninduced GAL]gene, the GAL] promoter was fused to the URA3 codingregion on a centromeric yeast plasmid in strains lackingthe endogenous URA3 gene. In these strains, the nativegenomic histone gene copies (two in each case) weredisrupted with selectable markers HIS3 and LEU2 or withframeshift mutations (fs), while histone gene alleles wereintroduced on centromeric yeast plasmids or by integration,as shown (Figure 1). Sensitivity of the yeast to 5-FOA wasdetermined after cells were grown in glucose (repressiveconditions), raffinose (non-repressive and non-inducingconditions) or galactose (inducing conditions) so as toregulate the GAL]-URA3 construct.

In wild-type strains, the chimeric GAL]-URA3 genebehaves as expected: growth in glucose causes strongrepression and minimal sensitivity to 5-FOA, whereasinduction by growth in galactose results in an increase of-6-7 orders of magnitude in sensitivity (Figure 2A).Galactose induction of the fusion, causing full sensitivity,is also observed in all H4 mutant strains tested. Deletionof residues 4-28 of the histone H4 N-terminus (designatedH4A4-28) caused a striking loss of GAL] repression, asindicated by the increase by 5-6 orders of magnitude in5-FOA sensitivity. Experiments using variant alleles ofthe other core histone genes showed that deletion of theN-termini of these proteins also had similar effects on the

Fig. 1. Strategy for analyzing the effects of histone mutations onGAL] promoter basal expression. Haploid yeast cells contain twocopies each of the histone genes, arranged as unlinked H3-H4 orH2A-H2B gene pairs. Only one of the two histone gene copies isrequired for cell viability. To analyze the effects of H4 deletions andsubstitution mutations on GALI-URA3 expression, one chromosomalhistone gene (HHFI) was disrupted and the second chromosomalhistone gene (HHF2) was replaced by the mutant histone gene (*)tested. In strains used for the analysis of H3, H2A and H2B deletions,both chromosomal histone genes were disrupted and a singlefunctional episomal histone gene (*) was cloned into the vector thatcarries the GALI-URA3 construct.

repression of GAL] basal transcription (Figure 2B-D).The H3, H2B and H2A deletions having the greatesteffects on GAL] repression in glucose and raffinose areH3A4-35, H2BA3-32 and H2AA4-20. In each case,including that of H4, the deletion removes most of thehydrophilic, unstructured N-terminal tail (Kayne et al.,1988; Arents et al., 1991; Mann and Grunstein, 1992). Inall these strains, we also see that 5-FOA sensitivity isconsistently higher in raffinose compared with glucose,which is likely to be due to the absence of glucose-specificrepression mechanisms (see Johnston, 1987; Ronne, 1995).These data demonstrate that, despite their differing effectson GAL] activation and on heterochromatin, all four corehistone N-termini are involved in the repression of basaltranscription.

Histone N-terminal deletions also causederepression of basal transcription at GAL 1 andPH05 genomic lociWe wished to determine if derepression of basal transcrip-tion caused by the histone deletions also takes place atgenomic loci. Therefore, we measured GAL] transcriptlevels directly in the appropriate histone N-terminal dele-tion strains. The very low GAL] basal expression levelsobserved under repressive conditions required that we usenon-repressive raffinose medium and a sensitive RNaseprotection assay for measuring mRNA levels. Endogenouslevels of the unrepressed ura3-52 transcript, a mutantform of URA3 which has been shown to be relativelyinsensitive to histone mutations (Thompson et al., 1994),were used as loading controls. As shown in Figure 3, theGAL] mRNA levels increase 5- to 10-fold in the histoneH4 N-terminal deletion strain (H4A4-28) as comparedwith wild-type when quantitated by densitometry. H3,H2A and H2B N-terminal deletions similarly increasegenomic GAL] basal transcription.

3975

FLenfant et al.

r r.z

.:"I::

IS.4,

1zBt''

i..' !.'.:i .:....:.'''.'r...,....Q4.'

.,:

'^:iSl i:.-. _..X., _. _ .S :.:] _ g ,_..S.' 4 - .!]

e. | x

_ .: -::. $ - .'', ',

:1 - .:

i W.+.[ ',sj;,WJ 14-14 .\- \9 -23. 1-283

. 10 -4

if10 3

UH1C -32

H2 A WT A41-2C1n

B

.1 f.1- 3

0j-

i

H3 WVT A -20 A\.'-30 ;-35

** C\ILA CO S

Raffincse

ciaact os,

cSl -6t2

H1 VV3 2 2

-71E t

Fig. 2. Histone N-terminal deletions derepress the episomal GALI-URA3 gene. Wild-type and mutant histone strains containing the GALJ-URA3fusion were grown on selective synthetic medium containing different carbon sources: glucose (GALl-repressing), raffinose (non-repressing and non-inducing) and galactose (GALl-inducing). When cultures reached mid-log phase, serial dilution samples were plated onto synthetic medium with orwithout 5-FOA. 5-FOA resistance (the ratio of the number of colonies formed on 5-FOA-containing medium to the number formed on plates lackingthe drug) was determined by averaging the results from a minimum of three trials. Resistance ratios for each strain were plotted on a logarithmicscale. See Table I for strain names and complete genotypes.

To investigate the generality of the effects of histonedeletions on the repression of basal expression, the RNaseprotection assay was also used to measure relative levelsof PHOS mRNA in wild-type and histone mutant strains.The yeast PHOS promoter is repressed in media containinghigh inorganic phosphate levels and is activated in low-phosphate media. When strains in which any of thehistone N-termini are deleted are grown under repressiveconditions, the PHOS mRNA levels also increase to levelscomparable with those seen for GAL]. Significantly, thegreatest increase in basal expression levels of GAL] or

PHO5 mRNAs occurs in strains H4A4-28, H3A4-30,H2AA4-20 and H2BA3-32, paralleling the effects seen

in episomal GAL] expression (above). These assaysdemonstrate that the histone H4, H3, H2A and H2BN-termini are required for repressing basal transcriptionin a similar manner at episomal and chromosomal genes.

Histone H4 acetylation sites involved in GAL 1activation are not important in the repression ofGAL 1 basal transcriptionAcetylation of the positively charged lysine residues atthe histone N-termini neutralizes their charge. Nucleo-somes that are associated with transcriptionally active or

potentially active (poised) chromatin at GAL] are more

unfolded and their histone H4 is more highly acetylatedthan those in silenced chromatin at the HM loci andtelomeres (Braunstein et al., 1993; Chen-Cleland et al.,1993). Given that acetylation may weaken interactionsbetween histones and DNA and thereby allow nucleosomalunfolding and gene activity (Lee et al., 1993; see

Grunstein, 1990), we wished to determine whether changes

H4

0. CSCM

t li

H3 H2A H2B

o 0

C'J COI'll

<1 --

('4

j- AL1

; .S! t * _ ,i, tS~~ra3-52

As I I * | S3J - PH051:: R A*1313j- aura3-52

1 2 3 4 5 6 7 8 9 10 11

Fig. 3. Genomic GAL] and PHOS loci are derepressed by histoneN-terminal deletions. Total RNA was isolated after the indicated wild-type and mutant strains were grown in the presence of either raffinose(non-inducing for GALl) or high phosphate (repressive for PH05).Individual transcript levels were determined by hybridization to 32plabeled GALI- and PH05-specific riboprobes (driven from pBluescriptT3 and T7 promoters) and use of the RNase protection assay (seeMaterials and methods). The ura3-52 transcript serves as an internalquantitation control. Data shown are from a 24 h exposure (PH05 or

ura3-52) or a 96 h exposure (GAL]).

in the sites of H4 acetylation result in the derepression ofbasal transcription.

Since acetylation neutralizes the positively chargedlysine residues at H4 sites K5, K8, K12 and K16, thesesites were changed to arginine to mimic the unacetylatedstate, or to an uncharged residue (glutamine) to mimic the

3976

A C

_~I lA - iI

C)(.. 1 0 -6°

-2~-1

0i c-5

,_. 1 -

*-= 1o0 -

r.T;. " D- l

1(-{WTIwoV HA;piasrn id

Histone domains repress basal transcription

A 1 0-7

X 10-6L 10b-5< 10-40J% 1 03-20

1 0-2

100aa58

1 21 6

B

0C

.0

u

GIucoseORaffinose

. r.n-i.r-i -].H4 WTKKKK

R K R QR R R QR R R QK R R 0

1 T-7

10-6 ]

1 0-5

1 0-4

1o-31 0-2

1 o-1

10° F~~~~~Jil% g a a 0 o g 0 L X a. a.

I-Y Y i- a-: 2 9 Da CZ, 8 8

Fig. 4. Mutations at histone H4 acetylation sites and in the H4silencing domain do not strongly derepress GALI. Histone H4substitution mutant alleles (Durrin et al., 1991; Johnson et al., 1992)were integrated into the native H4 gene locus as described in Figure 1and Materials and methods. GALI derepression due to multiple histoneH4 acetylation site mutations (A) and mutations in the H4 HM andtelomeric silencing domain (B) was determined by measuringresistance to 5-FOA as described in Figure 2. See Table I for strainnames and complete genotypes.

acetylated state. We have found that changing three oreven all four lysines to arginine or to glutamine residuessimultaneously has little effect (<10-fold) on the repres-sion of GAL] basal transcription in either glucose orraffinose medium (Figure 4A). These data and the deletionanalysis above (Figure 2) suggest that neither the sitesof histone H4 acetylation nor the residues immediatelysurrounding these sites are very important for the repres-sion of GAL] basal transcription.

The HM and telomeric silencing domain of histoneH4 overlaps with but has different boundariesthan that involved in GAL 1 basal transcriptionWe have shown that deletion of H4 residues 4-19 haslittle effect on the repression of GAL] basal transcription,while deletion of residues 4-28 leads to much strongerderepression of the GAL] promoter (Figure 2). Previously,we had also found that single amino acid substitutionsbetween H4 residues 16 and 29 led to the derepression ofHML silencing and telomeric silencing of URA3, causingan increase in 5-FOA sensitivity of 6-7 orders of magni-tude (Thompson et al., 1994). To determine whether thesesingle substitutions derepress GAL] basal expression in asimilar manner, we analyzed their effects on the episomalGAL]-URA3 construct. We found that none of the singlesite substitutions between H4 residues 16 and 28 has astrong effect on GAL]-URA3 expression in either glucose

or raffinose. The strongest effect seen is a 100-fold increasein 5-FOA sensitivity upon growth in glucose or raffinosedue to a substitution at residue 27 (Figure 4B). Therefore,residues involved in the repression of telomeric regionsmay overlap with those involved in GAL] basal expression,but they do not have the same boundaries.

N-terminal residues close to a-helical structuredregions in all four core histones are responsible forthe repression of basal transcriptionDeletion analysis within the N-terminus of H4 suggestedthat certain residues between amino acids 19 and 28 maybe essential for repression of GAL] basal expression(Figure 2A). The single amino acid substitution analysis(above) suggests that residue 27 may have special signific-ance in this repression. To define the domain involved inrepressing basal transcription more precisely, we haveconstructed additional internal deletions spanning residues15-18, 20-23 and 25-28. Only four amino acids weredeleted in each mutant, corresponding to approximatelyone turn of an a-helix, in order to minimize the disruptionof any potential secondary structure. Also, we have shownpreviously that insertion mutations [alanine at position 19,five amino acids (GALAG) at position 19 and alanine atposition 24] strongly inhibit silent mating locus repression(Johnson et al., 1992). Therefore, we also wished todetermine whether these insertions which increase thedistance of the hydrophilic residues from the hydrophobiccore are critical for the repression of basal transcription.As shown in Figure 5, deletion of H4 residues 25-28

has a near maximal effect on GAL]-URA3 derepressioncausing increased 5-FOA sensitivity of almost six ordersof magnitude in both raffinose and glucose. None of theinsertions between residues 19 and 20 or 24 and 25strongly affect 5-FOA sensitivity. These data demonstratethat the segment defined by residues 25-28, which isclosest to the structured core of H4, is especially importantin repressing GAL] basal transcription. In a similar manner,N-terminal residues close to the hydrophobic core of H3(32-35 and 36-39), H2A (17-20) and H2B (30-37) havethe greatest effect on sensitivity to 5-FOA. These dataargue for the special importance of the residues near thejunction of the histone N-termini and the structured,hydrophobic core in the repression of GAL] basal tran-scription. For purposes of brevity, this region is referredto as the basal domain.

Histone H4 and H3 basal domain deletions causeonly minor changes in chromatin structureadjacent to the GAL1 TATA boxNucleosomes are positioned in a reproducible manner onthe divergent GALJ-GALJO promoter as determined bymicrococcal nuclease cleavage and indirect end-labeling(Lohr, 1984; Fedor and Kornberg, 1989; Axelrod et al.,1993). Previous data showed that H4 N-terminal deletionsaffect nucleosomal positioning adjacent to the cc2 operator(Roth et al., 1992) and at a site adjacent to the GAL]TATA element (Fisher-Adams and Grunstein, 1995). Wewished to determine whether there are changes in micro-coccal nuclease cleavage at the GAL] promoter resultingfrom deletions in the basal domains and whether thesechanges might help explain the increased basal expressionobserved. Therefore, H4, H3, H2A and H2B strains

3977

F.Lenfant et al.

A1 0-7

' 10-6

1io-5o 10-4A10i-30 10-2

H4 wT 19-20 19-20 24-25A GALAG A

B 1 0-7

1 0-5o 0-4

LC' 0-3

1021c .0

uMi .0

C

A1 5-18 A20-23A25-28

nb-

<^ 10o-6u 10-5

o 1-4

*w 1 02-3

9 1 o0-._'0 1 02-16

1oo

(A 1 0-7w 1 0 -6

'4 10-5

0 1 0-4oW

10-3

C 101.2 1 o02

H2A WT A 1 7-20

m.7m47IH3 WT A28-31 A32-35 A36-39 H2BWT A13-17 A13-22 A14-31 A30-37

Fig. 5. Deletion of residues adjacent to the structured helical domains of each histone causes derepression of the GAL] promoter. The smallN-terminal deletion (and insertion) mutations indicated were introduced, and GALI derepression measured, as described in Figures I and 2.(A) Histone H4 alleles; (B) histone H3; (C) histone H2A; (D) histone H2B. See Table I for strain names and complete genotypes.

containing N-terminal and basal domain deletions wereused for indirect end-labeling analysis after micrococcalnuclease digestion. While large N-terminal deletionswithin H4 and H3 (H4A4-28 and H3A4-35) caused ageneralized increased access to nucleosomal DNA by thenuclease (Fisher-Adams and Grunstein, 1995), in none ofthe strains carrying basal domain deletions is there evid-ence for new nucleosomal boundaries suggested by entirelynew cleavage sites (data not shown). Similarly, we havefound that H2A and H2B N-terminal deletions removingthe basal domains do not disrupt nucleosome positioningat GAL] (data not shown). Nucleosome positioning atthe GAL] promoter was also assayed using ectopicallysynthesized E.coli Dam methyltransferase which recog-nizes a site (GATC) 15 bp suptream of the GAL] TATAelement (Singh and Klar, 1992). While a large H4N-terminal deletion (H4A4-23) alters Dam access at thissite very strongly (Fisher-Adams and Grunstein, 1995),we have found that Dam access at this site is not affectedby removal of the basal domains in deletions H4A25-28or H3A32-35 (data not shown), suggesting that the dele-tions of the H4 and H3 basal domains do not preventnucleosome positioning near the TATA promoter element.

Deletion of histone basal domains decreasesplasmid superhelical densitySuperhelical density can be used to quantitate the structuralcontribution of nucleosomes to minichromosomes, sincethe assembly of a nucleosome induces the formation of asingle superhelical turn in a covalently closed circularplasmid (see Wang, 1982; Simpson et al., 1985, andreferences therein). A plasmid pRM701, which consistsof the URA3 gene inserted into the multicopy YRp7 vector(Struhl et al., 1979), was transformed into various yeaststrains containing wild-type and N-terminal deletion-encoding histone gene alleles. Plasmid DNA was extractedand the topoisomers were separated by electrophoresis inagarose gels containing 10 Mtg/ml chloroquine. Under these

conditions, plasmid topoisomers are positively supercoiled(see Lutter, 1989). After Southern blotting, radiolabeledpRM701-specific fragments were used to detect thedistribution of topoisomers in each strain tested (Figure6). The solid dot adjacent to each distribution signifiesthe center of the topoisomer distribution, as determinedby densitometric scanning of the autoradiographs. Thearrowhead in each panel identifies the position of linearizedplasmid DNA, which co-migrates with an individualtopoisomer species (as determined by data not shown).As shown in Figure 6A, H4A4-14 and A4-19 have

little effect on the peak density of DNA superhelicity(Figure 6A, lanes 2 and 3) compared with the wild-typecontrol strain (Figure 6A, lane 1). In contrast, A4-23 andA4-28 strongly decrease plasmid superhelical density (by2 and -3 linking number units, respectively) (Figure 6A,lanes 4 and 5). Therefore, N-terminal deletions H4A4-23 and H4A4-28 not only have the greatest effect onderepressing basal transcription, but they also result in thelargest decrease in superhelical density. To determinewhether the basal domain of H4 closest to the structuredC-terminal domain of the protein is especially importantin maintaining DNA topology, we also analyzed theeffects of its deletion on plasmid superhelical density andcompared its effect with that of neighboring sequences.We found that while H4A15-18 has a minor effect onDNA topology, H4A20-23 causes an intermediate shift inthe center of the distribution (a decrease of -1.5 linkingnumber units; Figure 6A, lanes 6 and 7) and deletion ofthe basal domain (H4A25-28) decreases the superhelicaldensity by an average of two units (Figure 6A, lane 8).Since the largest deletions affect growth rate the most(180 min doubling time for H4A4-28 versus 120 min forthe isogenic control; Durrin et al., 1991), and the effectson superhelical density could possibly reflect differencesin growth rate, we also analyzed plasmid superhelicaldensity in an H4 N-terminal substitution mutant strainthat has a prolonged doubling time. Changing H4

3978

%4

u

Histone domains repress basal transcription

D

H2A H2B

.7- __..- __ ill7 -- - -." '_',

...- - ;7`4'. -.- 1'

i.. _<._ _< _<. .: 'N " R:

- w-w 4040#0

-__ _ e _

4

-4

m_ _ _ _

INg"--..-..

6. .A%. Sh-

1&

lowt s = s

-404w

' * 4e _r

12 3 4 6 7A9 2 3 4 5 67

Fig. 6. Histone N-terminal deletions alter minichromosome topology in vivo. Analysis of superhelical densities of plasmid pRM701 (TRPI ARSIURA3) extracted from: (A) strains bearing the indicated mutations within the histone H4 N-terminus; (B) strains bearing H3 N-terminal deletionalleles; (C) strains with H2A mutations; (D) strains with H2B alleles. Topoisomers of pRM701 were separated by agarose gel electrophoresis in thepresence of 10 ftg/ml chloroquine. Under these conditions. the topoisomers are positively supercoiled. the more rapidly migratina species

representing the least negatively supercoiled isomers in the absence of chloroquine (see Materials and methods). After Southern blotting. radiolabeledpRM701-specific sequences were used to detect the plasmid distributions. The centers of topological density. measured by densitometric scanning ofautoradiographs. are indicated by solid circles adjacent to each distribution. The uppermost band in each sample is due to nicked (i.e. relaxed) formsof pRM701. Arrowheads identify the linearized plasmid species. the density contributions of which are subtracted during quantitation.

acetylation site residues K5, K8, K12 and K16 to arginine,for example, increases the doubling time to 330 min(Durrin et al., 1992). However, no loss of plasmid superhel-ical density was observed in this strain (Figure 6A, lane9). In fact, there is a small but reproducible increase insuperhelical density of -1 linking number unit. Therefore,we conclude that deletion of the basal domain of H4(residues 25-28) has almost as great an effect on decreasingplasmid superhelical density as deletion of the entireN-terminus.

Similar results were observed in analyzing the effectsof H3 N-terminal deletions. Deletion of the basal domainof H3 (H3A36-39) decreased plasmid superhelical densityby -5 linking number units (Figure 6B, lane 7), as

compared with the wild-type control lane (Figure 6B, lane1). This decrease is even greater than that seen whenadjacent H3 residues 4-35 are deleted (-4.5 units). Wedid not evaluate topological shifts caused by deletingresidues 4-40 due to the poor growth of this strain.Deletion of the basal domain at the H2A N-terminus(H2AA17-20) caused a decrease in superhelical density(Figure 6C, lane 3) comparable with that caused bydeletion of most of the hydrophilic N-terminus (H2AA4-20; Figure 6C, lane 2). At H2B, deletion of the basaldomain (H2BA30-37) decreased plasmid superhelicaldensity by -6 linking number units (Figure 6D, lane 5),which is twice the shift observed when residues 3-32 are

deleted. The greater density loss resulting from basaldomain deletion may be the result of deleting residuescloser to the hydrophobic core of H2B.

Given the length ofpRM701 (-7000 bp) and the average

nucleosome repeat length in yeast (- 165 bp; see van Holde,1989), the predicted average number of nucleosomes inthe pRM701 minichromosome would be 42 [7000 bp/(165 bp/nucleosome)]. Therefore, basal domain deletionscause topological density losses of --5% (2/42 for H4) to

~-14% (6/42 for H2B). We conclude that deletion of thebasal domain at each histone has an especially significantrole in decreasing plasmid superhelical density. Sincethese changes may reflect a release of DNA from theconstraints of the nucleosome into the linker region, theyprovide a means by which basal factors may recognize

otherwise repressed regulatory elements.

DiscussionOur previous work has defined a region (between residues4 and 20) at the H3 N-terminus involved in the repressionof GALl and genes adjacent to heterochromatin-likeregions at the telomeres and silent (HM) mating loci. Wehave also shown that regions at the H4 N-terminus(residues 4-23) are required for the activation of GAL] and(residues 16-29) for repression of these heterochromaticregions. There is as yet no strong evidence for an involve-ment of the H2A and H2B N-termini in either GAL]regulation (Durrin et al.. 1991) or heterochromatic silenc-ing (Thompson et al., 1994). In this regard, it is interestingto note that an exhaustive search for histone H2A mutationswhich decrease SUC2 and GAL] expression (Hirschhornet al., 1995) has identified sites only in or very close tothe hydrophobic structured region of that histone (residues20-117). However, using a very sensitive assay for thederepression of basal transcription in which expression ofa GALI-URA3 reporter construct causes sensitivity to thedrug 5-FOA. we now report that core histone N-terminicontain a short region that is required for the repressionof basal, uninduced gene activity. This effect is generalin that episomal GALl-reporter constructs and both nativeGAL] and PHOS chromosomal genes are derepressed bydeletions of the basal domains. The basal domains are

unique in that they are found in all four core histones atthe boundary of the hydrophilic N-terminus and the

3979

A B

H4

C

H3

e- 3

1. 7:..-. il. :.

17r 17.1 .I-j 71:

.--j ,

F.Lenfant et al.

R't-prssion B-1sa1 1'XF~~1)-IR

H~~~tt:'4GK, -:r :; t

AFTKTARS'1GKAOYQL1 'JARKiA TVf (n 7,- w; ;i:-Tp LIxI' IT

\x-vxsXX\X X9X < (.'C-mmonllli4oi cFot(lt'}(d lAc iX;tiVill (X:8/./J

RKpa`ssion HM,TchAlrl.I tC'

Rcpi-essioil RnasalTxn

R

-- -.---:21------:----

;:preonGAl/.1 IIA1 ,ri.o-' 1 x1:

Rqyrc >s ion 13asit] rRx r

_1)1R

Fig. 7. Location of basal domains of histones H4, H3, H2A and H2B. The structural and functional features of each of the core histones areillustrated. Boldface type and schematic portions represent amino acid sequences that contribute to the 'structured' core of the octamer (Arents et al.,1991; Moudrianakis and Arents, 1993; Richmond et al., 1993), whereas plainface type indicates N- and C-terminal sequences not resolved by X-raycrystallography. a-Helical secondary structure is represented by boxes, and heavy hatch marks identify helices involved in the common histone fold.Structures are aligned with respect to the central helices of this motif. Solid and open boxes above the structures span the minimal sequences that arerequired for repression of basal transcription (D, in glucose; R, in raffinose). Hatched and shaded boxes below the structures identify domainscontaining sequences required for regulation of GAL] and heterochromatin-like HM and telomere loci (Kayne et al., 1988; Durrin et al., 1991;Johnson et al., 1992; Mann and Grunstein, 1992; Thompson et al., 1994). Lysine residues subject to acetylation are underlined (see van Holde, 1989;Mann and Grunstein, 1992) and the corresponding and real locations of trypsin cleavage sites, found within calf thymus and chicken erythrocytesequences, are indicated by arrowheads. Sequence divergence within the H2A and H2B amino-termini prevented accurate prediction of acetylationsites and the location of a corresponding trypsin cleavage site in H2A (hatched arrowhead). The histone sequences represented are those ofS.cerevisiae (from HTAJ, HTB2, HHT2 and HHF2). The resolved and secondary structures illustrated were generated by overlaying the knownchicken erythrocyte structure onto aligned yeast primary sequences; indicated numbering follows that of yeast sequences.

a-helical C-terminal domain. Moreover, their boundariesare different from those specifying the previously identifiedH3 and H4 regulatory regions and they are largely distinctfrom these N-terminal regions containing the sites ofacetylation (Figure 7).

At this stage, there are important clues as to whydifferent histone domains have different regulatory func-tions. For example, the effect of the H4 N-terminal deletionin greatly reducing GAL] activation is mediated throughthe nucleosomal region surrounding the GAL] TATAelement (Wan et al., 1995). This is understandable in lightof the observations demonstrating that the H4 N-terminalregion required for GAL] activation is required for nucleo-somal positioning (Roth et al., 1992; Fisher-Adams andGrunstein, 1995). The deletion of this H4 domain causesthe shift in position of a nucleosome adjacent to the GAL]TATA element (Fisher-Adams and Grunstein, 1995) whichmay prevent access of one or more components of thebasal transcription machinery. The involvement of the H3and H4 N-termini in heterochromatic silencing is likelyto stem from an entirely different mechanism of action.The trans-acting repressors Sir3 and Sir4, involved intelomeric and HM silencing of adjacent genes (seeThompson et al., 1993), can interact with histones H3 and

H4 (Hecht et al., 1995) and may form a heterochromaticcomplex required for repression.

Repression of transcription through the histone basaldomains is likely to occur by a mechanism that is furtherdistinct. We have shown that the acetylation site domains,which are thought to interact with DNA and in fact makea structural contribution to the nucleosome (Norton et al.,1989, 1990; Thomsen et al., 1991), are not very importantfor the repression of basal transcription. However, indi-vidual basal domain deletions can strongly decreaseplasmid superhelical density, decreasing the linkingnumber change associated with nucleosome assembly by5-14%. Assuming there is no loss of minichromosomenucleosomes [core particles remain stable even after beingmade 'tail-less' by trypsinization (Ausio et al., 1989;Dong et al., 1990)], this decrease is such that ~7-21 bpof DNA [(2-6/42)x 146 bp per core particle] normallybound in nucleosomes are released into the linker region.This is in agreement with a previous study demonstratingthat trypsinization of nucleosomes, which simultaneouslyremoves all of the histone tails, leads to an unwinding of20 bp of flanking DNA (Garcia-Ramirez et al., 1992).While we cannot exclude the possibility that a change inDNA superhelicity also affects transcription, the simple

3980

Histone domains repress basal transcription

release of 7-21 bp of nucleosomal DNA may allow forincreased access of the basal transcriptional machinery topromoter elements. Since the transcriptional complex mayrequire but a small amount of accessible DNA at thenucleosomal DNA ends to 'invade' the nucleosome (Lorchet al., 1987), this level of unwinding may have a strongeffect on increasing transcription initiation. This is likelyin spite of the fact that tryptic removal of N-terminal tailscauses no change in the structure of core particle DNAin vitro (Hayes et al., 1990) since the basal domains arelocated C-terminal to the trypsin cleavage sites (see Figure7). Why different N-terminal basal domain deletions causesuperhelical density changes of varying magnitudes isunclear at this time. While it is easiest to model a loss ofcontact between H3 and H4 N-termini and entry/exit DNAnear the dyad, such contacts could also be disrupted froma distance by surface deformations caused by H2A andH2B deletions (Moudrianakis and Arents, 1993; Richmondet al., 1993; Pruss et al., 1995).

A sin2 mutation increases basal transcriptionThe finding that certain histone mutations can increasebasal expression from a repressed promoter (lacking UASfunction) has important implications in understanding thegenetic interactions between histones and transcriptionfactors. Previous genetic studies (Prelich and Winston,1993) have identified mutations that cause an increase intranscription from the SUC2 basal promoter (one whoseUAS has been disabled or is inactive). One such mutationis a substitution in histone H3 (T119I). This specific H3mutant was originally identified as a sin2 mutation, whichsuppresses swil, swi2 and swi3 mutations and thus restorestranscription to HO as well as other SNF genes (Steinberget al., 1987; Kruger and Herskowitz, 1991). Such suppres-sion led to the hypothesis that the Swi proteins directlyantagonize chromatin structure to allow activation. How-ever, suppression of swi mutants by histone mutationsmay result from increases in basal expression whenmutations in the nucleosome core destabilize histone-histone or histone-DNA interactions. For example, weassayed the effect of the H3-sin2 mutation on basalexpression using the GALI-URA3 reporter construct. Thismutation (present as a heterozygous mutation in a diploidstrain) increased 5-FOA sensitivity by -2 orders of magni-tude in glucose and 4 orders of magnitude in raffinose(data not shown). We could not analyze the homozygouseffects of this mutation since this mutation is lethal whenhomozygous. The presence of the wild-type HHT2 (H3copy 2 gene) allele in this genetic background may alsoexplain why derepression of basal expression is not evengreater. Therefore, we believe that an increase in basalexpression can suppress mutations in the (Swi) activationapparatus by partially bypassing the need for the activator.A similar result occurs when nucleosome loss is obtainedin the absence of UAS elements for GAL], PHO5, CYC],CUP] and HIS3 promoters (Han and Grunstein, 1988;Durrin et al., 1992). This occurs even though it is unlikelythat nucleosome removal is the direct function of all theseactivators (Tjian and Maniatis, 1994), some or all of whichdo not require Swi activators to function (Winston andCarlson, 1992). Why deletions in core histone basaldomains and sin mutations both affect basal expression ina general manner is not certain. However, it appears likely

from their location in the nucleosome that sin mutationsare in residues that interact with DNA along the nucleo-somal dyad (Kruger et al., 1995). Therefore both sinmutations and basal domain deletions may weakenhistone-DNA interactions, deforming the nucleosome suchthat its DNA is more available to the basal transcriptioncomplex.

Materials and methodsYeast strains and genetic techniquesYeast strains used in this study are listed in Table I and their constructionsare described below. Standard yeast genetic techniques were employedthroughout (Sherman et al., 1986). All transformations were done usinglithium acetate as described by Gietz et al. (1992).

Plasmid constructionsExcept where noted, all plasmid preparation procedures were as described(Sambrook et al., 1989). Histone gene internal deletion alleles wereconstructed using the 'megaprimer' method of site-directed mutagenesis(Sarkar and Sommer, 1990). Oligonucleotides were synthesized on anApplied Biosystems 391 DNA synthesizer. All engineered mutationswere confirmed by dideoxy sequencing using Sequenase (US Bio-chemical Corp.).To measure URA3 derepression as a function of histone H4 alleles,

PCR-based methods were used to fuse the URA3 coding sequence(BamHI-EcoRI fragments generated by the primers CCCAGTATT-CTGGATCCAACTGCACAGAAC and CGGGTAATAACTGATATAG-AATTCAATTGAAGC) to the GAL] promoter. A SalI-EcoRI fragmentcontaining the GAL] promoter-URA3 gene was then cloned intopSEYC58 (ARSI CEN4 URA3; Emr et al., 1986) in which the URA3marker has been previously deleted, using EagI and SalI and replacedwith LEU2 on a HpaI-SalI fragment. This plasmid was named pFLURA3.The pFL plasmids used for integration of mutant histone H4 alleles are allderivatives of pGF400 (G.Fisher-Adams and M.Grunstein, unpublishedconstruct). pGF400 is similar to pLJ438T described in Johnson et al.(1990), except that the TRPI HindIII site was removed by recombinantPCR (Higuchi, 1990) and contains an H4A4-14 allele in place of H4A4-19. Briefly, these plasmids contain HHF2 (histone H4 wild-type ormutant) and a promoterless HHT2 (histone H3 copy II), with TRPIinserted between these two histone genes. The H4A4-14 gene, found onan EcoRI-HindIII fragment, was replaced by corresponding fragmentscontaining the indicated mutant H4 genes described in Kayne et al.(1988), Durrin et al. (1991) and Johnson et al. (1990, 1992) and by theinternal deletion alleles described herein. The names of H4 alleleintegration plasmids match the corresponding strain names found inTable I (e.g. for FLY24P, pFL24P was used). Internal deletion allelesH4A15-18, H4A20-23, H4A25-28 were all cloned directly into eitherpGF400 or, for topology analysis, into pUK499 (CEN4 ARSJ URA3HHF2; Johnson et al., 1990) forming pFL154, pFL204 and pFL254.

For H2A, H2B and H3 strain backgrounds, the pFLURA3 derivativespFL600 and pFL800 were constructed in which the original URA3marker was deleted by EagI-SalI and replaced respectively by HIS3(BamHI fragment from pJWc 102; Wan et al., 1992) or TRPI (SspI-StuIfragment from YRpl7). The wild-type HTAI gene from pJC102, theH2AA4-20 allele from pTS2 (Wallis et al., 1983; Schuster et al., 1986)and the H2AA17-20 internal deletion allele were all inserted into theEcoRI site of pFL600, creating the vectors pFL602, pFL6Z2 and pFL616.For topology analysis, the wild-type and mutant H2A genes were alsosubcloned into pRS413 (ARSH4 CEN6 HIS3; Sikorski and Hieter,1989) forming pFL142 (H2A WT), pFL143 (H2AA4-20) and pFL150(HTA1Al7-20). Wild-type and mutant HTB2 genes (Wallis et al., 1983;Schuster et al., 1986), as well as the HHF2-HHT2 fragments containingthe wild-type HHF2 and the HHT2 alleles from the plasmids pRM200,pRM420, pRM430 and pRM435 (Mann and Grunstein, 1992) weresimilarly subcloned into the EcoRI site of pFL800, resulting in theplasmids pFL8Z4 (H2B WT), pFL8Z7 (H2BA3-32), pFLW8 (H2BA13-17), pFLW9 (H2BA13-22), pFLWO0 (H2BA3-22), pFLWl l (H2BA14-31), pFL33 (H2BA30-37), pFL820 (H3 WT), pFL842 (H3A4-20),pFL830 (H3A4-30) and pFL835 (H3A4-35). H3 internal deletion allelesencoding H3A28-3 1, H3A32-35 and H3A36-39 were introduced intoboth pFL800 (to create pFL828, pFL832 and pFL836) or, for topologyanalysis, pRM200 (pFL328, pFL332 and pFL336).

3981

FLenfant et al.

Table I. Yeast strains used in this study

Strain Genotype Reference

MATa ade2-101 lelt2-3,112 lys2-801 trpl-A901 ura3-52 hhfl::HIS3same as LJY153, plus hhJ2::TRPI-HHF2same as LJY153, plus hhJ2::TRPJ-HHF2-A4-14same as LJY153, plus hhJ2::TRPJ-HHF2-A4-19same as LJY153, plus hhJ2::TRPJ-HHF2-A4-23same as LJY153, plus hhJ2::TRPJ-HHF2-A4-28same as LJY153, plus hhJ2::TRPJ-HHF2-A15-18same as LJY153, plus hhJ2::TRPI-HHF2-A20-23same as LJY153, plus hhJ2::TRPJ-HHF2-A25-28same as LJY153, plus hhJ2::TRPl-HHF2-KJ6Gsame as LJY153, plus hhJ2::TRPl-HHF2-KJ6Qsame as LJY153, plus hhJ2::TRPI-HHF2-RJ7Gsame as LJY153, plus hhJ2::TRPI-HHF2-H18Gsame as LJY153, plus hhJ2::TRPJ-HHF2-RJ9Gsame as LJY153, plus hhJ2::TRPI-HHF2-K20Gsame as LJY153, plus hhJ2::TRPI-HHF2-L22Gsame as LJY153, plus hhJ2::TRPI-HHF2-D24Psame as LJY153, plus hhf2::TRPI-HHF2-N25Psame as LJY153, plus hhJ2::TRPJ-HHF2-I26Psame as LJY153, plus hhJ2::TRPI-HHF2-Q27Psame as LJY153, plus hhJ2::TRPI-HHF2-G28Psame as LJY153, plus hhf2::TRPI-HHF2-K5,8,12Rsame as LJY153, plus hhJ2::TRPI-HHF2-K8,12,16Rsame as LJY153, plus hhj2::TRPJ-HHF2-K5,8,12,16Rsame as LJY153, plus hhf2::TRPI-HHF2-K5,8,12,16Qsame as LJY153, plus hhJ2::TRPJ-HHF2-19N (A insertion after position 19)same as LJY153, plus hhJ2::TRPJ-HHF2-20N (GALAG insertion after position 19)same as LJY153, plus hhJ2::TRPJ-HHF2-24N (A insertion after position 24)MATa ade2-101 his3-A200 leu2-3,112 lys2-801 trpl-A901 ura3-52 hhfl::HIS3 hhJ2::LEU2 pluspPK301 (CEN4 ARSI URA3 HHF2)same background as PKY501, with pPK617 (CEN4 ARSI URA3 HHF2-A4-14)same background as PKY501, with pPK618 (CEN4 ARSJ URA3 HHF2-A4-19)same background as PKY501, with pPK606 (CEN4 ARSI URA3 HHF2-A4-23)same background as PKY501, with pPK613 (CEN4 ARSI URA3 HHF2-A4-28)same background as PKY501, with pFL154 (CEN4 ARS] URA3 HHF2-A15-18)same background as PKY501, with pFL204 (CEN4 ARS] URA3 HHF2-A20-23)same background as PKY501, with pFL254 (CEN4 ARS] URA3 HHF2-A25-28)same background as PKY501, with pLD722 (CEN4 ARSI URA3 HHF2-K5,8,12,16R)MATa ade2-101 his3-A200 lys2-801 trpl-A9Olura3-52 hhtl,hhfl::LEU2 hht2,hhJ2::HIS3 pluspRM102 (CEN4 ARS1 URA3 GAL1O-HHT2 GALI-HHF2)same background as RMY102, with pFL820 (CEN4 ARS] TRPI PGALI-URA3 HHF2 HHT2)same background as RMY102, with pFL842 (=pFL800 with HHT2-A4-20)same background as RMY102, with pFL830 (=pFL800 with HHT2-A4-30)same background as RMY102, with pFL835 (=pFL800 with HHT2-A4-35)same background as RMY102, with pFL828 (=pFL800 with HHT2-A28-31)same background as RMY102, with pFL832 (=pFL800 with HHT2-A32-35)same background as RMY102, with pFL836 (=pFL800 with HHT2-A36-39)MATa ade2-101 his3-A200 lys2-801 trpl-A9OJura3-52 hhtl,hhfl::LEU2 hht2,hhJ2::HIS3 pluspRM200 (CEN4 ARSI TRPI HHF2 HHT2)same background as RMY200, with pRM420 (=pRM200 with HHT2-A4-20)same background as RMY200, with pRM430 (=pRM200 with HHT2-A4-30)same background as RMY200, with pRM435 (=pRM200 with HHT2-A4-35)same background as RMY200, with pFL328 (=pRM200 with HHT2-A28-31)same background as RMY200, with pFL332 (=pRM200 with HHT2-A32-35)same background as RMY200, with pFL336 (=pRM200 with HHT2-A36-39)MATax htal-l hta2-1 his3 ura3-52 plus pTS29 (CEN3 ARSI HIS3 GALJ-HTAI)same background as TSY222, with pFL602 (CEN4 ARS] H153 PGALI-URA3 HTAI)same background as TSY222, with pFL6Z2 (=pFL602 with HTAI-A4-20)same background as TSY222, with pFL616 (=pFL602 with HTAI-A17-20)same background as TSY222, with pFL142 (CEN6 ARSH4 HIS3 HTAI)same background as TSY222, with pFL143 (=pFL142 with HTA-A4-20)same background as TSY222, with pFL150 (=pFL142 with HTA-A17-20)MAToa ade2-101 ura3-52 trpl metl3 htbl-J htb2-1 plus pTS7 (CEN3 ARS] URA3 HTB2-A3-32)same background as TSY155, with pFL8Z4 (CEN4 ARSI TRPI PGALI-URA3 HTB2)same background as TSY155, with pFL8Z7 (=pFL8Z4 with HTB2-A3-32)same background as TSY155, with pFLW8 (=pFL8Z4 with HTB2-A13-17)same background as TSY155, with pFLW9 (=pFL8Z4 with HTB2-A13-22)same background as TSY155, with pFLW1O (=pFL8Z4 with HTB2-A3-22)same background as TSY155, with pFLW11 (=pFL8Z4 with HTB2-A14-31)same background as TSY155, with pFLW33 (=pFL8Z4 with HTB2-A30-37)MATcx ade2-101 ura3-52 trpl metl3 htbl-l htb2-1 plus pJT139 (CEN3 ARS] TRPI HTB2-A3-32)same background as JTY506, with pTS4 (CEN3 ARSI URA3 HTB2)same background as JTY506, with pJW1O (CEN3 ARS] URA3 HTB2-A3-22)same background as JTY506, with pJW1 I (CEN3 ARSI URA3 HTB2-A14-31)same background as JTY506, with pTS7 (CEN3 ARSI URA3 HTB2-A3-32)same background as JTY506, with pTS3-2 (CEN3 ARS] URA3 HTB2-A30-32)

Johnson et al. (1990)this studythis studythis studythis studythis studythis studythis studythis studythis studyThompson et al. (1994)this studythis studythis studythis studythis studythis studythis studythis studythis studythis studythis studythis studythis studythis studythis studythis studythis studyJohnson et al. (1990)

Kayne et al. (1988)Kayne et al. (1988)Kayne et al. (1988)Kayne et al. (1988)this studythis studythis studyDurrin et al. (1991)Mann and Grunstein (1992)

this studythis studythis studythis studythis studythis studythis studyMann et al. (1992)

Mann et al. (1992)Mann et al. (1992)Mann et al. (1992)this studythis studythis studyT.Schuster (unpublished)this studythis studythis studythis studythis studythis studySchuster et al. (1986)this studythis studythis studythis studythis studythis studythis studyThompson et al. (1994)this studythis studythis studythis studythis study

LJY 153LJY 156FLY414YFLY419YFLY423YFLY428YFLYA1518FLYA2023FLYA2528LJY405LJY412ILJY421IFLY933FLY942FLY952FLY22GFLY24PFLY25PFLY26PFLY27PFLY28PFLY821FLY508FLY722FLY1071FLYA19FLYA22FLY444PKY501

PKY817PKY818PKY806PKY813FLY 154FLY204FLY254LDY722RMY 102

FLY800FLY820FLY830FLY835FLY828FLY832FLY836RMY200

RMY420RMY430RMY435FLY328FLY332FLY336TSY222FLY602FLY6Z2FLY616FLY 142FLY143FLY150TSY 155FLY8Z4FLY8Z7FLYW8FLYW9FLYWIOFLYW 1IFLYW33JTY506RMYS4RMYW10RMYW11RMYS7RMYS3-2

3982

Histone domains repress basal transcription

The plasmid pRM701 was constructed by inserting the URA3 markerfrom YEp24 (blunted HiozdIll fragment) into the blunted BamHI siteof YRp7.

Strains for 5-FOA sensitivity analysisH4 mutant strainis. Construction of all isogenic H4 mutant strainsfollowed that of LJY4381 described in Johnson et al. (1990). The yeaststrain LJY153 was transformed with the various newly constructed pFL(H4 mutant) plasmids, including the new internal deletion constructs.that had been digested with EcoRI and Csp45I (releasing a fragmentcontaining TRPI flanked by HHT2 and the HHF2 mutant). Transformantswere selected on synthetic medium lacking tryptophan. The integrationof the TRPI marker adjacent to HHF2 was confirmed by Southernanalysis, and the presence of the correct H4 mutation was verified by PCRamplification and sequencing. Finally, these strains were transformed toleucine prototrophy with pFLURA3. The identity of the transformants wasconfirmed by their uracil prototrophy on galactose-containing medium.H3 mu7litan1t str-ainls. RMY102 (Mann and Grunstein. 1992) was trans-formed, separately. with pFL820, pFL842, pFL830, pFL835. pFL328,pFL332 and pFL336. After growing the transformants non-selectivelyfor several days, cells were plated and screened for those that hadlost pRM102.

H2A and H2B mu1iitanzts strainls. The yeast strain TSY222 (T.Schusterand M.Grunstein. unpublished strain and plasmid) was transformed withpFL602. pFL6Z2 and pFL616, and the transformants were selected onSG-his-ura. pTS29 subsequently was lost by growth on glucose-con-taining medium. Similarly. the yeast strain TSY155 (Schuster et al.,1986) was transformed, separately, with pFL8Z4, pFL8Z7. pFLW9.pFLW 10. pFLW 1I or pFLW33, and the original plasmid pTS7 (CEN3ARSI URA3 HTB2-A3-32) was allowed to be lost by mitotic instability.

Strains for topology analysisThe plasmid pRM701 (ARSJ TRPI URA3) was transformed into the H4and H3 mutant strains already described (Kayne et al., 1988; Durrinet al.. 1991; Mann and Grunstein. 1992) and into the newly constructedinternal deletion strains. Transformants were selected on syntheticmedium lacking both uracil and tryptophan. The pUK499-based H4internal deletion plasmids were transformed into UKY403, after whichthe original GAL]-HHF2 plasmid (pUK42 1) was lost by mitotic instabil-ity. The pRM200-based H3 internal deletion plasmids were transformedinto RMY102. and pRM102 was allowed to be lost.

For analysis of H2A deletions, plasmids pFL142, pFL143 and pFL150were transformed into TSY222. After loss of the original plasmid pTS29.the resulting strains were transformed with the plasmid pRM701.Transformants were selected on synthetic medium lacking uracil andhistidine. The strains RMYS4, RMYW10, RMYWl1. RMYS7 andRMYS3-2 were created by transforming JTY506 with, respectively.pTS4, pJW10, pJWl 1. pTS7 and pTS3-2 (Wallis et al., 1983; Schusteret al.. 1986) and allowing the original pJT139 to be lost by mitoticinstability.

Quantitation of 5-FOA resistanceAfter growth on selective plates for 2-3 days at 30°C, isolated colonieswere inoculated into liquid medium containing different carbon sources(glucose. repressive conditions for GAL] promoter; raffinose, non-inducing and non-repressing conditions: galactose. inducing conditions).When cultures reached mid-log phase, serial dilutions were plated ontosynthetic complete medium or the same medium containing 5-FOA.5-FOA resistance is defined as the average ratio of colonies formed on5-FOA medium to colonies formed on complete medium, from aminimum of three independent trials. The number of colonies on theplates was determined after 3-5 days of growth at 30°C. For H4 mutantstrains, selection for Leu+ was required to maintain the GAL1-URA3plasmid. These strains were grown on synthetic plates lacking leucinefor 3-4 days. and colonies were suspended in H,O, serially diluted, andplated as above on synthetic medium lacking leucine or on 5-FOAmedium lacking leucine. Synthetic medium lacking tryptophan andhistidine were used for H2A, H2B and H3 mutant strains.

Ribonuclease protection assay (RPA)Strains were erown on either YEPR (2% raffinose: for GALI) orYEPD (for PH05). Exponentially growing cultures were collected bycentrifugation, frozen in liquid nitrogen and stored at -80°C. Total RNAwas isolated by the hot phenol extraction technique (Kohrer and Domdey.1991). For the RPAs. 40 pag of total RNA was used with the AmbionRPA II kit following the manufacturer's instructions. Antisense RNA

probes were prepared by inserting probe DNA fragments [EcoRI-EcoRVfragment for GAL], a PCR-generated fragment for PHOS (primers:CCCATTTTTGGTGGATCCGGACC, starting 114 bp from the ATGand CATCGTTCAAGAATTCCAATGAGCCG. ending 334 bp from theATG) and a PstI-EcoRV fragment for iura3-52] into pBluescript( +) andtranscribing with either T3 or T7 polymerase using the Stratagene in iitrotranscription kit and [x-3-P]UTP (800 Ci/mmol. 40 mCi/ml: Amersham).The radiolabeled probes were then purified on 5% polyacrylamide gelsas described in the RPA II kit. mRNA transcript levels were measuredby densitometric scanning using the Apple Color OneScanner andanalyzed with the NIH Image program. version 1.49. The densitometricvalues were normalized to the level of ura3-52 transcript to correct forloading differences.

MNase digestion and indirect end-labelingNuclease digestions were performed as previously described (Fisher-Adams and Grunstein. 1995) using the strains LJY156. FLYA2528.FLY428Y, RMY200, FLY832, RMY435, FLY142, FLY143. FLY150.FLY8Z4, FLY8Z7 and FLYW33. For indirect end-labeling analysis.DNA was digested with restriction enzyme EcoRI. electrophoresed ona 1.5% agarose gel and transferred to a nylon membrane. DNA was UVcross-linked and probed with a GALI EcoRI-BanlII fragment labeled byrandom priming (Sambrook et al.. 1989).

Plasmid isolation and topology analysisPlasmid DNAs were isolated rapidly by breaking the cells with glassbeads (Hoffman and Winston, 1987) and separated on 0.8% agarosegels in the presence of 10 ,ug/ml chloroquine. At this chloroquineconcentration. plasmid topoisomers are positively supercoiled (see Lutter.1989). After transfer to a nylon membrane, plasmid DNAs were detectedby hybridization with either an EcoRI-SalI fragment from the tetracyclineresistance gene of YRp7 or an EcoRI-HinzdIII fragment from TRPI. Inorder to find the center of the topoisomer distribution. autoradiographswere measured by densitometric scanning using the Apple ColorOneScanner and analyzed with NIH Image. version 1.49. [The center ofa given distribution is defined as the midpoint of integrated densityalong the length of the densitometric scan (see Morse and Cantor. 1985).]The band density contributed by linearized plasmid DNA was subtractedduring analysis.

AcknowledgementsWe wish to thank James White and members of the Grunstein lab forhelpful discussions. This work was supported by Public Health Servicegrant GM 23674 from the National Institutes of Health and by post-doctoral fellowship awards to F.L. from the Association pour la Recherchecontre le Cancer. Paris. the Jonsson Comprehensive Cancer Center.UCLA, LA and the Philippe Foundation Inc. NY and to B.T. from theDanish Medical Research Council and the Carlsberg Foundation. R.K.M.was a predoctoral trainee supported by USPHS National InstitutionalResearch Service Award CA-09056.

ReferencesAparicio,O.M.. Billington,B.L. and Gottschling.D.E. (1991) Modifiers

of position effect are shared between telomeric and silent mating-typeloci in S.cerei isiae. Cell. 66. 1279-1287.

Arents.G., Burlingame,R.W., Wang.B.C., Love.W.E. and Moudrianakis.E.N. (1991) The nucleosomal core histone octamer at 3.1 A resolution:a tripartite protein assembly and a left-handed superhelix. Pr-oc. NatlAc-ad. Sci. USA. 88. 10148-10152.

Ausio,J., Dong.F. and van Holde.K.E. (1989) Use of selectivelytrypsinized nucleosome core particles to analyze the role of the histone'tails' in the stabilization of the nucleosome. J. Mol. Biol.. 206.451-463.

Axelrod.J.D.. Reagan,M.S. and Majors,J. (1993) GAL4 disrupts arepressing nucleosome during activation of GAL 1 transcription in livo.Genies Del.. 7. 857-869.

Boeke.J.D.. Trueheart.J.. Natsoulis.G. and Fink.G.R. (1987) 5-Fluoroorotic acid as a selective agent in yeast molecular genetics.Method.s EnzXmol., 154, 164-175.

Braunstein.M.. Rose.A.B.. Holmes.S.G.. Allis.C.D. and Broach.J.R.(1993) Transcriptional silencing in yeast is associated with reducednucleosome acetylation. Genies Dev., 7, 592-604.

3983

FLenfant et aL

Chen-Cleland,T.A., Smith,M.M., Le,S., Sternglanz,R. and Allfrey,V.G.(1993) Nucleosome structural changes during derepression of silentmating-type loci in yeast. J. Biol. Chem., 268, 1118-1124.

Dong,F., Hansen,J.C. and van Holde,K.E. (1990) DNA and proteindeterminants of nucleosome positioning on sea urchin 55 rRNA genesequences in vitro. Proc. Natl Acad. Sci. USA, 87, 5724-5728.

Durrin,L.K., Mann,R.K., Kayne,P.S. and Grunstein,M. (1991) Yeasthistone H4 N-terminal sequence is required for promoter activationin vivo. Cell, 65, 1023-1031.

Durrin,L.K., Mann,R.K. and Grunstein,M. (1992) Nucleosome lossactivates CUP1 and HIS3 promoters to fully induced levels in theyeast Saccharomyces cerevisiae. Mol. Cell. Biol., 12, 1621-1629.

Emr,S.D., Vassarotti,A., Garrett,J., Geller,B.L., Takeda,M. andDouglas,M.G. (1986) The amino terminus of the yeast F1-ATPasebeta-subunit precursor functions as a mitochondrial import signal.J. Cell Biol., 102, 523-353.

Fedor,M.J. and Kornberg,R.D. (1989) Upstream activation sequence-dependent alteration of chromatin structure and transcription activationof the yeast GALJ-GALIO genes. Mol. Cell. Biol., 9, 1721-1732.

Felsenfeld,G. (1992) Chromatin as an essential part of the transcriptionalmechanism. Nature, 355, 219-224.

Fisher-Adams,G. and Grunstein,M. (1995) Yeast histone H4 and H3 N-termini have different effects on the chromatin structure of the GALlpromoter. EMBO J., 14, 1468-1477.

Garcia-Ramirez,M., Dong,F. and Ausio,J. (1992) Role of the histone'tails' in the folding of oligonucleosomes depleted of histone H1. J.Biol. Chem., 267, 19587-19595.

Gietz,D., St John,A., Woods,R.A. and Schiestl,R.H. (1992) Improvedmethod for high efficiency transformation of intact yeast cells. NucleicAcids Res., 20, 1425.

Grunstein,M. (1990) Histone function in transcription. Annu. Rev. CellBiol., 6, 643-678.

Grunstein,M. (1992) Histones as regulators of genes. Sci. Am., 267,68-74B.

Han,M. and Grunstein,M. (1988) Nucleosome loss activates yeastdownstream promoters in vivo. Cell, 55, 1137-1145.

Hansen,J.C. and Wolffe,A.P. (1994) A role for histones H2A/H2B inchromatin folding and transcriptional repression. Proc. Natl Acad. Sci.USA, 91, 2339-2343.

Hayes,J.J. and Wolffe,A.P. (1992) Histones H2A/H2B inhibit theinteraction of transcription factor IIIA with the Xenopus borealissomatic 5S RNA gene in a nucleosome. Proc. Natl Acad. Sci. USA,89, 1229-1233.

Hayes,J.J., Tullius,T.D. and Wolffe,A.P. (1990) The structure of DNAin a nucleosome. Proc. Natl Acad. Sci. USA, 87, 7405-7409.

Hecht,A., Laroche,T., Strahl-Bolsinger,S., Gasser,S.M. and Grunstein,M.(1995) Histone H3 and H4 N-termini interact with SIR3 and SIR4proteins: a molecular model for the formation of heterochromatin inyeast. Cell, 80, 583-592.

Higuchi,R. (1990) Recombinant PCR. In Innis,M.A., Gelfand,D.H.,Shirisky,J.J. and White,T.J. (eds), PCR Protocols: A Guide to Methodsand Applications. Academic Press, San Diego, CA, pp. 177-183.

Hirschhom,J.N., Bortvin,A.L., Ricupero-Hovasse,S.L. and Winston,F.(1995) A new class of histone H2A mutations in Saccharomycescerevisiae causes specific transcriptional defects in vivo. Mol. Cell.Biol., 15, 1999-2009.

Hoffman,C.S. and Winston,F. (1987) A ten-minute DNA preparationfrom yeast efficiently releases autonomous plasmids for transformationof Escherichia coli. Gene, 57, 267-272.

Johnson,L.M., Kayne,P.S., Kahn,E.S. and Grunstein,M. (1990) Geneticevidence for an interaction between SIR3 and histone H4 in therepression of the silent mating loci in Saccharomyces cerevisiae. Proc.Natl Acad. Sci. USA, 87, 6286-6290.

Johnson,L.M., Fisher-Adams,G. and Grunstein,M. (1992) Identificationof a non-basic domain in the histone H4 N-terminus required forrepression of the yeast silent mating loci. EMBO J., 11, 2201-2209.

Johnston,M. (1987) A model fungal gene regulatory mechanism: theGAL genes of Saccharomyces cerevisiae. Microbiol. Rev., 51,458-476.

Kayne,P.S., Kim,U.J., Han,M., Mullen,J.R., Yoshizaki,F. andGrunstein,M. (1988) Extremely conserved histone H4 N terminus isdispensable for growth but essential for repressing the silent matingloci in yeast. Cell, 55, 27-39.

Kohrer,K. and Domdey,H. (1991) Preparation of high molecular weightRNA. Methods Enzymol., 194, 398-405.

Kruger,W. and Herskowitz,I. (1991) A negative regulator of HOtranscription, SINI (SPT2), is a nonspecific DNA-binding proteinrelated to HMG1. Mol. Cell. Biol., 11, 4135-4146.

Kruger,W., Peterson,C.L., Sil,A., Coburn,C., Arents,G., Moudrianakis,E.N. and Herskowitz,I. (1995) Amino acid substitutions in thestructured domains of histones H3 and H4 partially relieve therequirement of the yeast SWI/SNF complex for transcription. GenesDev., 9, 2770-2779.

Lee,D.Y., Hayes,J.J., Pruss,D. and Wolffe,A.P. (1993) A positive rolefor histone acetylation in transcription factor access to nucleosomalDNA. Cell, 72, 73-84.

Lohr,D. (1984) Organization of the GALl-GALIO intergenic controlregion chromatin. Nucleic Acids Res., 12, 8457-8474.

Lorch,Y., LaPointe,J.W. and Komberg,R.D. (1987) Nucleosomes inhibitthe initiation of transcription but allow chain elongation with thedisplacement of histones. Cell, 49, 203-210.

Lutter,L.C. (1989) Thermal unwinding of simian virus 40 transcriptioncomplex DNA. Proc. Natl Acad. Sci. USA, 86, 8712-8716.

Mann,R.K. and Grunstein,M. (1992) Histone H3 N-terminal mutationsallow hyperactivation of the yeast GALl gene in vivo. EMBO J., 11,3297-3306.

Megee,P.C., Morgan,B.A. and Smith,M.M. (1995) Histone H4 and themaintenace of genome integrity. Genes Dev., 9, 1716-1727.

Morse,R.H. and Cantor,C.R. (1985) Nucleosome core particles suppressthe thermal untwisting of core DNA and adjacent linker DNA. Proc.Natl Acad. Sci. USA, 82, 4653-4657.

Moudrianakis,E.N. and Arents,G. (1993) Structure of the histone octamercore of the nucleosome and its potential interactions with DNA. ColdSpring Harbor Symp. Quant. Biol., 58, 273-279.

Norton,V.G., Imai,B.S., Yau,P. and Bradbury,E.M. (1989) Histoneacetylation reduces nucleosome core particle linking number change.Cell, 57, 449-457.

Norton,V.G., Marvin,K.W., Yau,P. and Bradbury,E.M. (1990)Nucleosome linking number change controlled by acetylation ofhistones H3 and H4. J. Biol. Chem., 265, 19848-19852.

Prelich,G. and Winston,F. (1993) Mutations that suppress the deletionof an upstream activating sequence in yeast: involvement of a proteinkinase and histone H3 in repressing transcription in vivo. Genetics,135, 665-676.

Pruss,D., Hayes,J.J. and Wolffe,A.P. (1995) Nucleosomal anatomy-where are the histones? BioEssays, 17, 161-170.

Richmond,T.J., Rechsteiner,T. and Luger,K. (1993) Studies ofnucleosome structure. Cold Spring Harbor Symp. Quant. Biol., 58,265-272.

Ronne,H. (1995) Glucose repression in fungi. Trends Genet., 11, 12-17.Roth,S.Y, Shimizu,M., Johnson,L., Grunstein,M. and Simpson,R.T.

(1992) Stable nucleosome positioning and complete repression by theyeast alpha 2 repressor are disrupted by amino-terminal mutations inhistone H4. Genes Dev., 6, 411-425.

Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: ALaboratory Manual. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY.

Sarkar,G. and Sommer,S.S. (1990) The 'megaprimer' method of site-directed mutagenesis. Biotechniques, 8, 404-407.

Schuster,T., Han,M. and Grunstein,M. (1986) Yeast histone H2A andH2B amino termini have interchangeable functions. Cell, 45, 445-451.

Sherman,F., Fink,G.R. and Hicks,J.B. (1986) Methods in Yeast Genetics.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Sikorski,R.S. and Hieter,P. (1989) A system of shuttle vectors andyeast host strains designed for efficient manipulation of DNA inSaccharomyces cerevisiae. Genetics, 122, 19-27.

Simpson,R.T., Thoma,F. and Brubaker,J.M. (1985) Chromatinreconstituted from tandemly repeated cloned DNA fragments and corehistones: a model system for study of higher order structure. Cell, 42,799-808.

Singh,J. and Klar,A.J. (1992) Active genes in budding yeast displayenhanced in vivo accessibility to foreign DNA methylases: a novelin vivo probe for chromatin structure of yeast. Genes Dev., 6,6186-6196.

Sternberg,P.W., Stern,M.J., Clark,I. and Herskowitz,I. (1987) Activationof the yeast HO gene by release from multiple negative controls. Cell,48, 567-577.

Struhl,K., Stinchcomb,D.T., Scherer,S. and Davis,R.W. (1979) High-frequency transformation of yeast: autonomous replication of hybridDNA molecules. Proc. Natl Acad. Sci. USA, 76, 1035-1039.

Thompson,J.S., Hecht,A. and Grunstein,M. (1993) Histones and theregulation of heterochromatin in yeast. Cold Spring Harbor Symp.Quant. Biol., 58, 247-256.

3984

Histone domains repress basal transcription

Thompson,J.S., Ling,X. and Grunstein,M. (1994) Histone H3 aminoterminus is required for telomeric and silent mating locus repressionin yeast. Nature, 369, 245-247.

Thomsen,B., Bendixen,C. and Westergaard,O. (1991) Histonehyperacetylation is accompanied by changes in DNA topology in vivo.Eur J. Biochem., 201, 107-111.

Tjian,R. and Maniatis,T. (1994) Transcriptional activation: a complexpuzzle with few easy pieces. Cell, 77, 5-8.

van Holde,K.E. (1989) Chromatin. Springer Verlag, Berlin.Wallis,J.W., Rykowski,M. and Grunstein,M. (1983) Yeast histone H2B

containing large amino terminus deletions can function in vivo. Cell,35, 711-719.

Wan,J., Xu,H. and Grunstein,M. (1992) CDC14 of Saccharomycescerevisiae. Cloning, sequence analysis, and transcription during thecell cycle. J. Biol. Chem., 267, 11274-11280.

Wan,J., Mann,R. and Grunstein,M. (1995) Yeast histone H3 and H4 Ntermini function through different GAL1 regulatory elements to repressand activate transcription. Proc. Natl Acad. Sci. USA, 92, 5664-5668.

Wang,J.C. (1982) The path ofDNA in the nucleosome. Cell, 29, 724-726.Winston,F. and Carlson,M. (1992) Yeast SNF/SWI transcriptional

activators and the SPT/SIN chromatin connection. Trends Genet., 8,387-391.

Received on January 3, 1996; revised on April 23, 1996

3985