1

Submission: Applied and Environmental Microbiology (short-form paper) 1

Section: Environmental Microbiology 2

Title: Transfer of Phage T4 Gene into Enterobacteriaceae, Determined at the 3

Single-Cell Level 4

5

Running title: Phage T4 Gene Transfer into Enterobacteriaceae 6

7

Authors: Takehiko KENZAKA 1,2

, Masao NASU 2

, and Katsuji TANI 1,2

* 8

9

Mailing address: 1

Faculty of Pharmacy, Osaka Ohtani University 10

3-11-1, Nishikiori-kita, Tondabayashi, 584 – 8540, Japan 11

2 Graduate School of Pharmaceutical Sciences, 12

Osaka University 13

1–6, Yamada–oka, Suita, 565–0871, Japan 14

15

*Corresponding author: KATSUJI TANI 16

17

E-mail address: tanika@osaka-ohtani.ac.jp 18

19

Telephone number: +81-721-24-9741 20

21

Fax number: +81-721-24-9742 22

Copyright © 2009, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.02219-09 AEM Accepts, published online ahead of print on 18 December 2009

on June 22, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

2

ABSTRACT 1

The transfer range of phage genes was investigated at the single-cell level using an in 2

situ DNA amplification technique. After absorption of phages, the phage T4 gene was 3

maintained in the genomes of non-plaque forming bacteria at frequencies of 10−2

per 4

cell. The gene transfer decreased the mutation frequencies in non-host recipient. 5

6

Keywords: lateral gene transfer, bacteriophage, CPRINS 7

on June 22, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

3

TEXT 1

Recently, whole genome analysis has revealed that many bacterial genomes contain 2

foreign genes, especially phage genes (9). The phage-encoded genes on bacterial 3

genomes include virulence or fitness factors such as extracellular toxins, superantigens, 4

lipopolysaccharide-modifying enzymes, and proteins conferring serum resistance etc. 5

(1). These findings suggest that the horizontal transfer of phage genes has significantly 6

contributed to the acquisition of new genetic traits, and the genetic diversity of bacteria 7

(1, 9, 10). To truly appreciate the mechanisms behind phage-derived evolution, it is 8

important to understand the frequency and range of transfer of phage genes. 9

Most phage genomes consist of many genes derived from different origins (5, 8). 10

Some genes are similar to those of other phages with phylogenetically different hosts, or 11

are found in the genome of bacteria that are not the phage host. The mosaic nature of 12

phage genomes has been known for some time, and a body of molecular genetic studies 13

on phages have been attempted to explain the mechanisms that drive this process (1, 5). 14

More importantly, the horizontal transfer of phage genes has emerged as a major factor 15

in the evolution of the phage genome. Since recombination between phage and 16

phage/prophage can occur when they coexist in the same cell, coinfection of multiple 17

phage species could result in the production of hybrid phage genomes (5). The pathways 18

on June 22, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

4

by which phages exchange genetic material vary dramatically in concert with their host 1

ranges. However, conventional plaque assays have shown that the host range of the 2

phages studied is narrow. We hypothesized that phage genes can be transferred to more 3

diverse species than previously thought. 4

In order to accurately quantify DNA movement, gene-targeting that does not require 5

cultivation or gene expression is necessary (7). In situ DNA amplification methods 6

allow the visualization of specific DNA sequences inside bacterial cells. In this study, 7

we employed cycling primed in situ amplification-fluorescent in situ hybridization 8

(CPRINS-FISH) to examine the possible range and frequency of the transfer of phage 9

genes. CPRINS uses one primer and results in linear amplification of the target DNA 10

inside cells, and multiply-labeled fluorescent probe sets are applied for detection of the 11

amplicons to improve the specificity and sensitivity of CPRINS (3). The CPRINS-FISH 12

did clarify the DNA movement of a specific gene among Escherichia coli cells at the 13

single-cell level (4). 14

Enterobacteria phages P1 and T4 infect E. coli and have been well studied. P1 can 15

exist as circular DNA within the bacterial cell as if it was a plasmid. Phage T4 is only 16

capable of undergoing a lytic lifecycle and not the lysogenic life cycle. Conventional 17

methods using plaque assays have shown that the host of P1 and T4 is E. coli, but 18

on June 22, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

5

orthologous phage genes have been found in bacteria other than E. coli (6, 8). In the 1

present study, Enterobacteriaceae strains were allowed to grow on agar medium after 2

the phage was adsorbed, and the maintenance of the transferred phage gene in the 3

bacterial genome was examined at a community level by quantitative real-time PCR, 4

and at a single cell level by CPRINS-FISH. 5

The following bacterial strains were used for maintenance experiments: Citrobacter 6

freundii IFO 12681, Enterobacter aerogenes BM 2688, Escherichia coli NBRC 12713, 7

Proteus mirabilis clinical isolate, Salmonella enteritidis IID 640, and Yersinia 8

enterocolitica IID 981. The bacterial strains were grown in Luria-Bertani (LB) medium 9

(1% tryptone, 0.5% yeast extract, 0.5% NaCl; Nacalai Tesque Inc., Kyoto, Japan) at 10

37°C overnight. 11

Stationary-phase cultures of 500 µl were incubated with 500 µl of SM buffer (50 mM 12

Tris-HCl [pH7.5], 100 mM NaCl, 8 mM MgSO4, 0.01% gelatin) containing the phage 13

P1kc NBRC 20008 (2) or T4GT7 (11) at 37°C for 10 min at multiplicity of infection of 14

1:1 (plaque forming unit of phage : colony forming unit of recipient bacterium). The 15

concentration of bacterial cells was adjusted to 1 × 109 cells ml

−1. After 10 16

min-incubation, the diluted cell suspension (1 × 105 cells) was filtered through a 17

polycarbonate filter with a pore size of 0.2 µm and a diameter of 25 mm (Advantec,

18

on June 22, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

6

Tokyo, Japan). Cells trapped on the filter were cultured on LB agar medium at 37°C for 1

24 h. The filter was transferred into a microtube, and cells on the filter were suspended 2

in 1 ml of sterile deionized water. The numbers of cells in the suspension and the 3

remained cells on the filter were determined under an epifluorescence microscope (see 4

below) after 1 µg ml−1

of 4′,6-diamidino-2-phenylindole (DAPI)-staining 5

(Sigma-Aldrich Japan, Tokyo, Japan). The recovery of cells from the filter into sterile 6

deionized water was about 99%. The cultured cells were subjected to real-time PCR and 7

CPRINS-FISH. 8

For real-time PCR, bacterial DNAs were extracted using a QIAamp DNA Isolation 9

Kit (Qiagen, Tokyo, Japan). The cell suspension was mixed with 10 mg ml−1

of 10

lysozyme solution and incubated at 37°C for 1 h. DNA extraction was then performed 11

according to the manufacturer’s instructions. Table 1 summarizes oligonucleotide 12

primers for PCR and CPRINS and polynucleotide probes used in the present study. 13

Phage tail fiber genes of P1kc and T4GT7 were quantified by LightCycler real-time 14

PCR (Roche Diagnostics, Tokyo, Japan). LightCycler FastStart DNA Master SYBR 15

Green I (Roche Diagnostics) was used with 5 mM Mg2+

and 0.5 µM of each primer 16

targeting the tail fiber gene of P1kc (P1-tail931f and P1-tail1148r) and T4GT7 17

(T4-tail2770f and T4-tail2983r). After a hot start for 10 min at 95°C, 40 cycles of PCR 18

on June 22, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

7

reaction were run with denaturation at 94°C for 15 s, annealing at 60°C for 10 s, 1

extension at 72°C for 10 s, and fluorescent detection at 83°C for 5 s. The known amount 2

of PCR products of the phage DNAs (1 × 101 – 1 × 10

7 copies per reaction) were used 3

for the standard curves to quantify the target DNA. To confirm the specificity of the 4

reaction after real-time PCR, the PCR mixture in a glass capillary was collected and 5

subjected to agarose gel electrophoresis in addition to a melting curve analysis with 6

LightCycler. The maintenance frequencies determined by real-time PCR were 7

represented as the copy number of the phage tail fiber gene per bacterial genome which 8

was measured by PicoGreen-staining (Invitrogen, Tokyo, Japan) after cultivation on LB 9

agar medium for 24 h as described above. The frequencies were determined in triplicate 10

for each sample. The level of the increased phage gene was determined by comparing 11

the copy number of phage gene on the filter before and after cultivation. The copy 12

number of phage gene on the filter was determined by the following formula; 13

[total number of cells determined by DAPI-staining] × [copy number of phage tail 14

fiber gene determined by real-time PCR] / [copy number of bacterial genome 15

determined by PicoGreen-staining]. 16

CPRINS-FISH targeting the tail fiber gene of phageT4GT7 was performed as 17

described by Kenzaka et al. (3, 4), except for the probe/primer sequences and thermal 18

on June 22, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

8

conditions. After cell wall permeabilization with lysozyme treatment (3), the CPRINS 1

reaction was performed with the following conditions: a hot start at 95°C for 9 min, 2

denaturation at 94°C for 1 min, annealing at 60°C for 30 s, and extension at 72°C for 3

1.5 min for T4-tail2983r primer. Amplification was repeated for 30 cycles using a 4

thermal cycler (PTC-200, Bio-Rad Laboratories, Inc.). After amplification, filters were 5

rinsed with 0.1% Nonidet P40 and sterile deionized water, dehydrated in 99% ethanol, 6

and vacuum dried. Hybridization with Alexa Fluor 546-labeled polynucleotide probes 7

(T4-tail2664, T4-tail2720, T4-tail2769, T4-tail2818, T4-tail2869, and T4-tail2922), 8

washing, and DAPI-staining were performed according to a previous study (4). In order

9

to exclude the possibility of nonspecific probe binding to cell structures other than the 10

target DNA in the target cells, FISH using laboratory strains without amplification of 11

target DNA, and CPRINS-FISH targeting the tail fiber gene using E. coli strains that did 12

not carry the genes, were performed. 13

In order to examine the infection range of phages, plaque assay and direct counting of 14

phages were performed. Plaque assay was performed with LB soft agar (0.8% agar) as 15

described by Kenzaka et al. (4). For the direct counting, phages were stained with ×5 16

SYBR Gold (Invitrogen, Tokyo, Japan), and trapped onto ANODISC filter with a pore 17

size of 0.02 µm and a diameter of 25 mm (Whatman Japan, Tokyo, Japan). 18

on June 22, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

9

The cells or phage particles on the filters were observed under an epifluorescence 1

microscope (E-400; Nikon, Tokyo, Japan) with the Nikon filter sets UV-2A (EX300-350, 2

DM400, BA420) for DAPI, B-2A (Ex450/490, DM505, and BA520) for SYBR Gold, 3

HQ-CY3 (G535/50, FT565, BP610/75) for Alexa Fluor 546, respectively. Images were 4

acquired using a cooled charge-coupled device camera Retiga 2000R (QImaging, Surrey, 5

BC, Canada), and at least 2,000 DAPI- or SYBR Gold stained objects were counted per 6

sample. The maintenance frequencies determined by CPRINS-FISH were represented as 7

the number of CPRINS-FISH positive cells per total direct counts (TDC) of recipient 8

cells after cultivation described above. The frequencies were determined in triplicate for 9

each sample. 10

After cultivation on LB agar medium for 24 h, the total number of cells on the filter 11

determined by DAPI-staining increased by 8.7 × 102 to 1.1 × 10

4-fold (“Increase in total 12

cells” in Table 2). Real-time PCR showed that the phage P1kc gene increased only in 13

the plaque forming strains (E. coli and E. aerogenes), and not in non-plaque forming 14

strains (“Increase in phage gene” in Table 2). In contrast, the phage T4GT7 gene 15

increased in both plaque forming and non-plaque forming strains by 7.6 × 101 to 7.0 × 16

104-fold. The maintenance frequencies were more than 10

−2 per bacterial genome 17

(“Maintenance frequency” in Table 2). Direct observation via epifluorescent microscopy 18

on June 22, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

10

showed that progeny phages were not produced in the non-plaque forming strains 1

(“Progeny” in Table 2), and thus, fragments of phage genes were thought to integrate 2

into the genome of non-plaque forming strains and replicate as the bacterial genome. 3

Real-time PCR provided a copy number of the target phage gene in the whole 4

population, but the location of the target phage gene and frequency of cells carrying the 5

target gene were unclear. In addition, bacterial genomic DNA, which was measured 6

using PicoGreen, included phage DNA, and thus the frequencies that were measured by 7

dividing by the bacterial genomic DNA were probably less accurate. In order to confirm 8

that the phage gene was located inside bacterial cells and determine a more accurate 9

maintenance frequency per total cells, CPRINS-FISH targeting the tail fiber gene of 10

phage T4GT7 was performed. CPRINS-FISH visualized the target phage gene in 11

individual cells under an epifluorescence microscope (Fig. 1A and 1B). It showed that 12

the frequencies of maintenance of tail fiber gene were 2.1 × 10−1

to 4.0 × 10−1

per total 13

cells in plaque forming strains after growth on LB medium for 24 h (Table 2). Since 14

phage T4GT7 is only capable of undergoing a lytic lifecycle, CPRINS-FISH would 15

detect cells in which the phage gene was replicating. In non-plaque forming strains, the 16

maintenance frequencies were 2.2 × 10−2

to 8.8 × 10−2

per total cells (Table 2). If the 17

gene outside bacterial cells was amplified by CPRINS reaction, the amplicon would not 18

on June 22, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

11

accumulate inside bacterial cells and they would not exhibit bright fluorescence. 1

Therefore, CPRINS-FISH proved that a part of the phage T4GT7 gene was located 2

inside cells of non-plaque forming strains. The tail fiber gene is responsible for the 3

phage tail structure. The DNA sequences of the phage genes responsible for phage 4

morphology have been found in many bacterial genomes (1, 5). 5

In order to explore the effect of integration of the phage gene into the bacterial 6

genome on bacterial heredity, we determined the mutation frequency of C. freundii that 7

acquired the phage T4GT7 gene. Two colonies which acquired the phage T4GT7 gene 8

were screened by colony PCR with T4-tail-2770f and T4-tail 2983r primers, and 9

designated as Cik8-1 and Cik8-4. Mutation frequencies were determined with LB 10

medium containing 150 µg ml−1

of rifampicin or 10 µg ml−1

of nalidixic acid. The 11

mutation frequencies in nalidixic acid resistance decreased by 12 to 240-fold and the 12

frequencies in rifampicin resistance by 40 to 83-fold compared to the parent strains (Fig. 13

2). Mutation increases genetic variation. The decreased mutation frequency would 14

contribute to the genetic stability of the genome in individual cells, but not to the 15

genetic variation in the population. Our results show that phage T4GT7 was capable of 16

affecting the genomic properties of C. freundii, which was previously thought not to be 17

the host, although the mechanism by which mutation frequencies decreased remains 18

on June 22, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

12

unknown. Further experiments are required to clarify the molecular mechanism by 1

which mutation frequencies altered after gene transfer. 2

In summary, during growth on agar medium after the phage was allowed to adsorb 3

Enterobacteriaceae strains, the phage P1kc gene was not maintained in non-plaque 4

forming strains, but phage T4GT7 gene was maintained in more diverse species than 5

previously thought. The transfer of foreign DNA molecules (DNA entry) into a 6

bacterium is an important first step in genetic diversification through horizontal gene 7

transfer. A previous study reported that phage P1kc was capable of injecting DNA into 8

non-plaque forming E. coli cells (4), but the phage P1kc gene was not maintained 9

during bacterial growth in the present study. The results showing the difference in 10

maintenance between phage P1kc and T4GT7 genes suggest that the maintenance of 11

transferred phage genes depends on phage gene sequences or other phage factors. When 12

maintained, the phage gene could alter the mutation frequency of bacteria that acquired 13

the gene, affecting the genomic variability at the population level. Conventionally 14

phage–bacteria interaction has been studied with certain models consisting of a phage 15

and bacterium in which the phage can multiply (12, 13). Our results indicate the 16

importance of dynamic of phage genes among diverse bacteria that were previously 17

thought not to be the host, and the heredity impact of phage gene transfer on such 18

on June 22, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

13

bacteria. 1

2

ACKNOWLEDGMENTS 3

This work was supported by the JSPS Grant-in-Aid for Young Scientists (B) 4

(18780055). 5

6

REFERENCES 7

1. Brüssow, H., C. Canchaya, and W. D. Hardt. 2004. Phages and the evolution of 8

bacterial pathogens: from genomic rearrangements to lysogenic conversion. 9

Microbiol. Mol. Biol. Rev. 68:560-602. 10

2. Enomoto, M., and B. A. Stocker. 1974. Transduction by phage P1kc in Salmonella 11

typhimurium. Virology 60:503-514. 12

3. Kenzaka, T., S. Tamaki, N. Yamaguchi, K. Tani, and M. Nasu. 2005. 13

Recognition of individual genes in diverse microorganisms by cycling primed in situ 14

amplification. Appl. Environ. Microbiol. 71:7236-7244. 15

4. Kenzaka T, K. Tani, A. Sakotani, N. Yamaguchi, and M. Nasu. 2007. High 16

frequency phage-mediated gene transfer among Escherichia coli determined at the 17

single cell level. Appl. Environ. Microbiol. 73:3291-3299. 18

on June 22, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

14

5. Lawrence, J. G., G. F. Hatful, and R. W. Hendrix. 2002. Imbroglios of viral 1

taxonomy: genetic exchange and failings of phenetic approaches. J. Bacteriol. 2

184:4891-4905. 3

6. Łobocka, M. B., D.J. Rose, G. Plunkett III, M. Rusin, A. Samojedny, H. 4

Lehnherr, M. B. Yarmolinsky, and F. R. Blattner. 2004. Genome of bacteriophage 5

P1. J. Bacteriol. 186:7032-7068. 6

7. Maruyama, F., T. Kenzaka, N. Yamaguchi, K. Tani, and M. Nasu. 2005. 7

Visualization and enumeration of bacteria carrying a specific gene sequence by in 8

situ rolling circle amplification. Appl. Environ. Microbiol. 71:7933-7940. 9

8. Miller, E. S, E. Kutter, G. Mosig, F. Arisaka, T. Kunisawa, and W. Rüger. 2003. 10

Bacteriophage T4 genome. Microbiol Mol Biol Rev. 67:86-156 11

9. Ochman, H., J. G. Lawrence, and E. A. Groisman. 2000. Lateral gene transfer 12

and the nature of bacterial innovation. Nature 405:299-304. 13

10. Weinbauer, M. G., and F. Rassoulzadegan. 2004. Are viruses driving microbial 14

diversification and diversity? Environ. Microbiol. 6:1-11. 15

11. Wilson, G. G., K. Y. Young, G. J. Edlin, and W. Konigsberg. 1979. 16

High-frequency generalised transduction by bacteriophage T4. Nature 280:80-82. 17

12. Wommack, K. E., and R. R. Colwell. 2000. Virioplankton: Viruses in aquatic 18

on June 22, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

15

ecosystems. Microbiol. Mol. Biol. Rev. 64:69-114. 1

13. Zinder, N. D., and J. Lederberg. 1952. Genetic exchange in Salmonella. J. 2

Bacteriol. 64:679-699. 3

4

on June 22, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

FIGURE LEGENDS

Fig. 1. Visualization of E. coli cells carrying the tail fiber gene transferred by phage

T4GT7. (A) After mixed with phages for 10 min, E. coli NBRC12713 cells were

cultured for 24h and subjected to CPRINS-FISH targeting the phage gene. Only cells

having tail fiber gene-amplified products emitted the fluorescence of the Alexa

Fluor546-labeled probe under green excitation (exposure, 0.5 s). (B) All DAPI-stained

bacterial cells were visualized under UV excitation (exposure time, 0.1 s).

Fig. 2. Mutation frequencies in T4GT7-infected Citrobacter freundii.

Mutation frequencies were determined with LB agar medium containing nalidixic acid

or rifampicin. Cik 8-1 and 8-4 were strains which acquired phage gene transferred by

phage T4GT7. Cik 1 and 2 were the parent strains.

on June 22, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

on June 22, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

Kenzaka et al., Fig.2

10-10

10-9

10-8

10-7

10-6

10-5

Cik

1C

ik2

Cik

8-1

Cik

8-4

Muta

tion f

requency

Nalr Rifr

Cik

1C

ik2

Cik

8-1

Cik

8-4

on June 22, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

TABLE 1. Probes and primers designed in this study.

Name Target Primer/Probe Nucleotide sequence (5’-3’)

P1-tail931f Tail fiber gene of phage P1 Primer aacgacccgaattacagcac

P1-tail1148r Tail fiber gene of phage P1 Primer agtgctgctgcaagctcata

T4-tail2770f Tail fiber gene of phage T4 Primer agcacaaatggtgagcacag

T4-tail2983r Tail fiber gene of phage T4 Primer ttgctaccgtgtgggtatga

T4-tail2664 Tail fiber gene of phage T4 Probe ggcttcaagtactgacttaggtactaaaaccacatcaagctttgactatggtacg

T4-tail2720 Tail fiber gene of phage T4 Probe aagggaactaacagtacgggtggacacactcactctggtagtggttcta

T4-tail2769 Tail fiber gene of phage T4 Probe tagcacaaatggtgagcacagccactacatcgaggcatggaatgg

T4-tail2818 Tail fiber gene of phage T4 Probe ggtgtaggtggtaataagatgtcatcatatgccatatcatacagggcggg

T4-tail2869 Tail fiber gene of phage T4 Probe gggagtaacactaatgcagcagggaaccacagtcacactttctcttttggg

T4-tail2922 Tail fiber gene of phage T4 Probe tagcagtgctggcgaccattcccactctgtaggtattggtgctcata

on June 22, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

TABLE 2. Frequency of maintenance of phage P1kc and T4GT7 genes in Enterobacteriaceae strains.

Infection range Maintenance frequency as

determined by indicated method5 Phage Recipient

Plaque1 Progeny

2

Increase in

total cells3

Increase in

phage gene4

Real time PCR CPRINS

P1kc C. freundii - - 7.0 x 103 No <1.5 x 10-3 ND

E. aerogenes + + 1.7 x 103 7.7 x 103 (6.5) 5.0 x 100 (4.2) ND

E. coli + + 7.2 x 103 5.5 x 103 (2.7) 9.1 x 10-1 (0.5) ND

P. mirabilis - - 7.4 x 103 No <1.5 x 10-3 ND

S. enteritidis - - 8.4 x 103 No <1.7 x 10-4 ND

Y. enterocolitica - - 4.6 x 103 No <1.8 x 10-4 ND

T4GT7 C. freundii - - 1.5 x 103 7.5 x 103 (4.0) 8.3 x 10-1 (4.4) 8.6 x 10-2 (3.4)

E. aerogenes + + 8.7 x 102 1.2 x 103 (0.8) 8.0 x 10-1 (5.0) 4.0 x 10-1 (0.7)

E. coli + + 1.1 x 104 7.0 x 104 (2.7) 8.0 x 10 (3.0) 2.1 x 10-1 (0.4)

P. mirabilis - - 4.0 x 103 5.8 x 103 (4.2) 3.3 x 10-1 (2.4) 3.4 x 10-2 (2.2)

S. enteritidis - - 1.0 x 104 7.6 x 101 (5.0) 1.0 x 10-2 (0.7) 8.8 x 10-2 (2.0)

Y. enterocolitica - - 3.6 x 103 1.6 x 104 (0.4) 6.1 x 10-1 (1.6) 2.2 x 10-2 (2.9)

1 Plaque formation was observed with soft agar. +; positive: -; negative.

2 Production of progeny phage was observed via epifluorescent microscopy. +; positive: -; negative.

3 Increase in total number of cells during bacterial growth for 24 h was determined via epifluorescent microscopy.

4 Increase in copy number of phage tail fiber gene during bacterial growth for 24 h was determined by real-time PCR.

Values in parentheses indicate standard deviations of triplicate samples.

5 Maintenance frequencies were determined by real-time PCR and CPRINS-FISH targeting phage tail fiber gene, and

are shown per bacterial genome, and total cells, respectively. Values in parentheses indicate standard deviations of

triplicate samples. ND, not done.

on June 22, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from