Research ArticleAcute Intermittent Porphyria in Argentina An Update

Gabriela Nora Cerbino1 Esther Noemiacute Gerez1

Laura Sabina Varela1 Viviana Alicia Melito12 Victoria Estela Parera1

Alcira Batlle1 and Mariacutea Victoria Rossetti12

1Centro de Investigaciones sobre Porfirinas y Porfirias (CIPYP) CONICET Hospital de Clınicas Universidad de Buenos Aires (UBA)1120 Buenos Aires Argentina2Departamento de Quımica Biologica Facultad de Ciencias Exactas y Naturales Universidad de Buenos Aires (UBA)Ciudad Universitaria Nunez Universidad de Buenos Aires (UBA) 1120 Buenos Aires Argentina

Correspondence should be addressed to Marıa Victoria Rossetti rossettiqbfcenubaar

Received 9 October 2014 Accepted 20 December 2014

Academic Editor Hao Deng

Copyright copy 2015 Gabriela Nora Cerbino et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

Porphyrias are a group of metabolic diseases that arise from deficiencies in the heme biosynthetic pathway A partial deficiencyin hydroxymethylbilane synthase (HMBS) produces a hepatic disorder named Acute Intermittent Porphyria (AIP) the acuteporphyria is more frequent in Argentina In this paper we review the results obtained for 101 Argentinean AIP families and 6AIP families from foreign neighbour countries studied at molecular level at Centro de Investigaciones sobre Porfirinas y Porfirias(CIPYP) Thirty-five different mutations were found of which 14 were described for the first time in our population The mostprevalent type of mutations was the missense mutations (43) followed by splice defects (26) and small deletions (20) An oddcase of a double heterozygous presentation of AIP in a foreign family from Paraguay is discussed Moreover it can be noted that 38new families were found carrying the most frequent mutation in Argentina (pG111R) increasing to 5566 the prevalence of thisgenetic change in our population and adding further support to our previous hypothesis of a founder effect for this mutation inArgentina Identification of patients with an overt AIP is important because treatment depends on an accurate diagnosis but morecritical is the identification of asymptomatic relatives to avoid acute attacks which may progress to death

1 Introduction

The porphyrias are a heterogeneous group of metabolicdisorders that result from the decreased activity of a specificenzyme of the heme pathway and are characterized by theoverproduction and excretion of heme intermediates in urineandor stool and their accumulation in certain tissues [1ndash3]

Acute Intermittent Porphyria (AIP OMIM 176000) isthe most common of the acute hepatic porphyrias It is anautosomal dominant disorder caused by a deficient activ-ity of hydroxymethylbilane synthase (HMBS EC 4318)also referred to as porphobilinogen deaminase producinga markedly increase in the urinary excretion of ALA andPBG The symptoms may frequently appear at any timeafter puberty and are characterized by acute neurovisceralsigns which include intermittent attacks of abdominal pain

constipation vomiting hypertension tachycardia fever andvarious peripheral and central nervous system manifesta-tions Acute attacks may frequently result from exposure todiverse porphyrinogenic drugs alcohol ingestion reducedcalories intake due to fasting or dieting infections andhormones which stimulate heme synthesis by ALA-synthaseinduction thereby increasing the production of the por-phyrin precursors ALA and PBG [4 5]

HMBS is the third enzyme involved in heme pathway andcatalyzes the head to tail condensation of four molecules ofPBG to form the lineal tetrapyrrole HMB It is encoded by asingle gene localized at the chromosomal region 11q233 ThecDNA and the entire 10 kb gene have been sequenced includ-ing the 51015840 regulatory 31015840 regulatory and intronic regions Thegene contains 15 exons and 2 distinct promoters that gen-erate housekeeping and erythroid transcripts by alternative

Hindawi Publishing CorporationBioMed Research InternationalVolume 2015 Article ID 946387 8 pageshttpdxdoiorg1011552015946387

2 BioMed Research International

splicing and cDNAs encoding the 44-kD housekeeping andthe 42-kD erythroid-specific isoenzymes which have beenisolated and characterized [6]

AIP is the most common acute porphyria in our country[7] It is an autosomal dominant disorder with incompletepenetrance although some cases of homozygosity or doubleheterozygosity have been described in most cases associatedwith childhood and more severe manifestations [8ndash21] Theidentification of asymptomatic heterozygotes in families withaffected individuals is essential for their counselling to avoidspecific precipitating factors but as the enzyme assay is onlyabout 80 accurate [1] the use of molecular techniques toidentify specific mutations in the HMBS gene is essential foraccurate diagnosis of affected members in AIP families [7]

To date about 390 different mutations have been identi-fied in the HMBS gene causing AIP (Human Gene MutationDatabase HGMD httpwwwhgmdcfacukacindexphp)most of them were either private or found in a few unrelatedfamilies showing the molecular heterogeneity of AIP

We review here all the mutations found in 101 Argen-tinean and 6 foreign AIP families and studied during thelast 20 years at CIPYP Four new mutations and 31 alreadydescribed genetic changes were found some of them weredetected for the first time in our population It must be high-lighted that 59 unrelated families carry the same mutationpG111R (5566) increasing its number with respect to thatpreviously found [22] suggesting a founder effect for thisgenetic change as has been described for different mutationsin other populations [23ndash25]

2 Materials and Methods

21 Patients Informed consent was obtained from allpatients following the standards of UNESCO Declarations-DDHH Genome and Genetic Data (httpwwwunescoorgshsethics) Declaration of Helsinki was taken into consid-eration and the study was approved by the InstitutionalResearch Ethics Committee of the CIPYP National Scientificand Technical Research Council (CONICET) University ofBuenos Aires (UBA)

FromMarch 1994 to July 2014 106 unrelated Argentineanfamilies were studied at biochemical and molecular level Allpatients had current symptoms of AIP and the diagnosis wasmade on the basis of their clinical history of at least one acuteattack associated with increased excretion of ALA and PBGin urine and reduced HMBS activity in red blood cells [1]The final diagnosis of the patients was established by geneticstudies Unrelatedness was determined by family inquiries

22 Identification of Mutations

221 DNA Isolation and HMBS Amplification GenomicDNAwas extracted from peripheral blood collected in EDTAusing the commercial kit illustraTM blood genomicPrepMiniSpin Kit (GEHealthcare)Mutational analysis was performedamplifying the promoters all exons and the intronexonboundaries of the HMBS gene by PCR using the specificprimers shown in Table 1 Promoter regions and genomic

sequence from exon 3 to noncoding exon 15 were amplifiedin only two fragments using Platinum Taq DNA PolymeraseHigh Fidelity enzyme (Invitrogen by Life Technologies)Alternatively exons 3 to 15 and their flanking intron regionswere amplified in 5 fragments as indicated (see Supple-mentaryMaterial available online at httpdxdoiorg1011552015946387) employing recombinant Taq DNA Polymerase(Invitrogen by Life Technologies)

222 RT PCR RNA was isolated from the leukocytes usingthe commercial kit Ribo PurendashBlood (Ambion) and reversetranscribed with M-MLV Reverse Transcriptase and Oligo(dT)12ndash18 primers (Invitrogen) according to manufacturerrsquos

instructions The HMBS cDNA was amplified with theprimers Fc (51015840 aaagcctgtttaccaaggagc 31015840)ndashRc (51015840 caccaccagctc-caagatgt 31015840)

All PCR products were checked in 15 agarose gel

223 Sequencing Analysis The amplified products werepurified with the Bioneer Accuprep PCR Purification Kit(Bioneer) or QIAquick PCRGel Purification Kit (QIAGEN)and were automatically sequenced by Macrogen (MacrogenInc Gangseo-gu Seoul Korea ABI3730XL Macrogen) Thesequencing primers are listed in Supplementary MaterialAll mutations were confirmed by sequencing both DNAstrands of at least two different PCR products To validate thenew mutations their absence in 50 control individuals hasbeen performed Nucleotides were numbered according tothe cDNA sequence for the housekeeping isoform of HMBStranscript variant 1 (GenBank Accession NM 0001903) inwhich the A of the ATG initiation codon was numbered as1

224 Databases The Human Gene Mutation Database(httpwwwhgmdcfacuk) was used for information aboutreported mutations in the HMBS gene

3 Results

At present 177 AIP families (299 affected individuals) werediagnosed at CIPYP Of them 107 were also studied atmolecular level and results for 48 families were alreadydescribed [7 28 29 34] In the last 10 years 58 new familieswere also biochemically diagnosed as AIP and molecularanalysis revealed 19 mutations 4 new and 15 already reportedof which 7 were described for the first time in our population(Table 1)

From the novel mutations two were splice site mutationsat acceptor splice sites One was an A to G transition in thepenultimate base of intron 8 leading to the in-frame deletionof 15 bp with the loss of the first 5 amino acids of exon 9(c423-2AgtG) by the use of a cryptic site (Figure 1)The otherwas also an A to G transition in the last base of intron 14(c913-1GgtA) predicting the skipping of exon 15

In another family an out of frame new duplication of 7 bpin exon 7 which generates a stop codon 17 bp upstream (c301 307dupCCCACTG) was found (Figure 2)

BioMed Research International 3

Table1All106families

studied

atbiochemicalandmolecular

levelinthelast20yearsa

tCIPYP

Exon

intro

nMutation

Nucleotidec

hang

eEff

ect

Num

bero

ffam

ilies

(affected

individu

als)

Firstreported

E3pR2

6Cc7

6CgtT

26ArggtCy

s2(9)

[26]

I3IV

S3ds+1GgtA

c87+

1GgtA

51015840splices

itemutation

exon

3deletio

n1(4)

[27]

E4

pQ34P

c101AgtC

34GlngtPro

6(12)

[28]

pQ34X

c100Cgt

T34

GlngtStop

1(2)

[26]

pT35M

c104Cgt

T35

Thrgt

Met

1(1)

[29]

pY46

Xc138Cgt

A46

Tyrgt

Stop

1(1)

[30]

E5pL6

8fsX

69c2

02203delC

TOut

offram

edele

tionof

2bp

1(1)

[31]

E6pL8

1Pc2

42Tgt

C81

LeugtPro

1(3)

[14]

E7pG111R

c331GgtA

111GlygtArg

59(171)

[32]

pV103fsX

120

c298

304d

upCC

CACT

GOut

offram

edup

licationof

7bpwith

asto

pcodo

nat+17

1(3)

Thisrepo

rt

I7IV

S7+1GgtC

c344

+1GgtC

51015840splices

itemutation

deletio

nexon

71(3)

[33]

E8pR116W

c346

CgtT

116ArggtTrp

1(1)

[32]

I8IV

S8as-2AgtG

c423-2AgtG

31015840splices

itemutation

deletio

n15bp

1(5)

Thisrepo

rtIV

S8as-1GgtT

c423-1GgtT

31015840splices

itemutation

deletio

nof

15bp

2(8)

[34]

E9pR149Q

c446

GgtA

149ArggtGln

1(1)

[35]

pA152del

c453

455delA

GC

DelAla152

1(1)

[29]

E10

pR173Q

c518GgtA

173ArggtGln

1(4)

[36]

pR173W

c517Cgt

T173ArggtTrp

3(4)

[37]

pR2

01W

c601Cgt

T201A

rggtTrp

1(1)

[38]

pQ204X

c610Cgt

T204GlngtStop

1(3)

[37]

I10IV

S10d

s-1GgtT

c612GgtT

Dele

tionof

3aa

inexon

103(8)

[35]

E12

pV221fs

X242

c665insA

Out

offram

einsertio

nof

Aat665

1(3)

[28]

pT243fsX

249

c728

729d

elCT

Out

offram

edele

tionof

2bpat728-729

1(5)

[28]

I12

IVS12ds+1GgtA

c771+1GgtA

51015840splices

itemutation

deletio

nof

exon

121(1)

[28]

IVS12as-1GgtA

c772-1GgtA

31015840splices

itemutation

deletio

nof

exon

131(3)

[39]

E13

pK2

72fsX2

87c8

15818delAG

GA

Out

offram

edele

tionof

4bpat815

1(3)

[28]

E14

pG281del

c841

843delGGA

In-fr

amed

eletio

nof

GGAat841

2(7)

[28]

I14IV

S14-2AgtG

c913-2AgtG

31015840splices

itemutation

deletio

nexon

151(1)

[40]

IVS14as-1GgtA

c913-1GgtA

31015840splices

itemutation

deletio

nof

exon

151(1)

Thisrepo

rt

E15

pH301fs

X306

c913insC

Out

offram

einsertio

nof

Cat913

2(5)

[41]

pV315fsX

328

c948delA

Out

offram

edele

tionof

Aat948

1(2)

[28]

pL329fsX3

41c9

85delTTG

GCT

GCC

CAG

In-fr

amed

eletio

nof

329LA

AQ1(5)

[28]

pR3

21H

c962GgtA

321A

rggtHis

1(4)

[22]

pG335S

c1003GgtA

335GlygtSer

1(4)

[28]

g3078

8306del5228bp

Dele

tionof

5228

bpfro

mintro

n2to

intro

n15

2(7)

Thisrepo

rt

4 BioMed Research International

Table 2 Biochemical data and mutation status of the family from Paraguay

Patient Age ALAmg24 h

PBGmg24 h

Porph120583g24 h

PPI120582619 nm HMBS activity Mutation status

Proband 38 27 87 188 180 4472 c772-1 GgtAMother 67 mdash mdash mdash 185 4624 c772-1 GgtAHusband 62 mdash mdash mdash 100 6120 pR321HDaughter 23 66 325 589 123 5806 c772-1 GgtApR321HDaughter 26 61 247 782 129 3175 c772-1 GgtApR321HDaughter 30 10 12 37 100 4477 pR321HAge in years at diagnosis Porph porphyrinsNormal values ALAle4mg24 h PBGle2mg24 h porphyrins 2ndash250120583g24 h Plasma Porphyrin Index (PPI)le130 (120582 619) HMBS activity 8451plusmn 1196UmlGR (F) 7313 plusmn 1362Uml GR (M)

TGCCAGAGAAGAGCTCCCTGCGAACAGCATCCCAGCTGCAAAG

Exon 8 Exon 9Exon 9ndash15bp

15bp

Figure 1 Electropherogram showing c423-2AgtG mutation RT-PCR product

In another two families 2 bands were found whenHMBSgene was amplified one of the expected size and another of300 bp (Figure 3(a)) The sequencing of the small purifiedband revealed a large deletion of 5228 bp spanning fromintron 2 to noncoding exon 15 (Figures 3(c) and 3(d))

The other 15 mutations were previously described point-ing that 7 of them were identified for the first time in ourpopulation (Table 1)

Of note are the results obtained for a foreign family fromParaguay Two female symptomatic members carried twoalready described mutations One was a splice site mutationin the last base of intron 12 inherited from the mother (c772-1GgtA) which leads to exon 13 skipping [39] The other wasa point mutation (c962GgtA) in exon 15 which produces anamino acid change (pR321H) and was inherited from thefather [22] Another asymptomatic sister carried only this lastmutation The biochemical values and molecular results forthis family are shown in Table 2

In addition 38 new families carry the pG111R mutationpreviously described for another 21 unrelated families [7]ascending the number of unrelated Argentinean families thatcarry this mutation to 59 (5566) adding further support toour previous hypothesis of a founder effect [28]

4 Discussion

During the last 20 years 35 different mutations were found14 described in Argentina for the first time and 21 alreadyreported for other populations These 35 genetic changes

include 15 missense mutations 9 splice defects 7 small dele-tions 2 small insertions one gross deletion and 1duplication

One of the splice site mutations is located in the minus2position of the acceptor splice site of intron 8 (c423-2AgtGGENBANK HM856802) leading to the in-frame deletion of15 bp (Figure 1) The same result has been found for a pointmutation in the last base of intron 8 already described foranother Argentinean family [34]

The other novel splice site mutation was an A to Gtransition in the last base of intron 14 (c913-1GgtA) Althoughno sample was available to carry out RT-PCR studies as thisbase is 100 conserved in the consensus splice site it is verylikely that this substitution leads to exon 15 skipping as it hasbeen described by Puy et al for a different mutation affectingthe same acceptor splice site [39]

The novel frameshift mutation (Figure 2) c301 307dup-CCCACTG (GENBANK HQ7315521) introduces a prema-ture stop codon at exon 8 so the transcript codified by thisallele is most likely to be degraded by the nonsense-mediatedmRNA decay (NMD) [42] This mutation has been found intwo unrelated Argentinean families (Table 1)

In two families two bandswere foundwhen PCRproductwas run in an agarose gel one of the expected size andanother of 300 bp (Figure 3(a)) When these were sequencedthe large one did not show any genetic change but it showedan apparent homozygosis of the 6 variable SNPs in the studiedpopulation (g3119TgtG g3581AgtG g3982TgtC g6479TgtGg7064CgtA g7539CgtT) Cerbino [43] However as it isshown in Figure 3(b) for two of these SNPs (g6479TgtGand g7539CgtT) the proband and her sister carry the sameallelic variant (6479 G and 7539 C) but the symptomaticdaughter of one of them carries another allelic variant (6479T and 7539 T) inherited from her father The analysis ofthe smaller band indicated that this corresponded to theother allele with a large deletion of 5228 bp spanning fromintron 2 to noncoding exon 15 As indicated in Figures 3(c)and 3(d) positions g3078 g3081 and g8306 g8309 sharedthe same region (CCCC) so it was impossible to determinethe breakpoint of the deletion Only another gross deletionof 4620 bp but including promoter and exon 1 has beendescribed by Di Pierro et al [44]

In the family from Paraguay two double heterozygotesrelatives were found The proband of this family has been

BioMed Research International 5

GAAGGACCTGCCCATCCTTGAAGGACCTGCCCACTGTGCTTCCTCCTGGCT

(a)

GAAGGACCTGCCCACTGTGCTTCCTCCTGGCTTCACCATCGGAGCCATCTGCAAG

CCCACTGTGCTTCCTCCTGGCTTCACCATCGGAGCCAT

TTGAAGGACCTGCCCACTGTGCTTCCTCCTGGCTTCTGCATCCGAGCCATCAGCCATTTACAATCTTGAAAC

Control sequence

Mutated sequence

(b)

Figure 2 Electropherograms showing (a) control sequence (b) c301 307dupCCCACTG mutation the duplicated sequence is underlined

M P C

5kb

300pb

(a)

del Gdel Gdel Cdel Gdel del C

del Gdel Gdel Cdel Gdel Cdel C

G GA GT CG TC CC T

del Gdel Gdel Cdel Tdel Cdel T

G GG GC CG TC CC T

T GA GT CG T C C T

1 2 3

4 5

6

g3119TgtGg3581AgtGg3982TgtCg6479TgtGg7064CgtAg7539CgtT

(b)

CCCC

A T GAGGAGGCAAGGCAGTCATCAAGGCCCCAAGGTGAGGCAAATCCCTGGAAGGCTTGAACCCTGCAGTTCAGTCTCCCGGGGTAATCACTCCCCAGATAGCAGTGAGAGTGGGGAAATA

Shared regionEx15 NC-g8310

CTCCAAGG

10 20 30 40 50 60 70 80 90 100 110 120

130 140 150GCTGGTCCCTACGAAGAAATTAA

g3077ndashg3055

(c)

Ex10Ex1 Ex7 Ex9 Ex12Ex6 Ex8 Ex11Ex2 Ex3 Ex4 Ex5

Ex1 Ex2 NCEx15

Ex14 Ex15Ex13 NCEx15

(d)

Figure 3 Gross deletion of 5228 bp (a) PCR product of patient (P) control individual (C) M 1 kb marker (b) family SNPs analysis (c)electropherogram of the 300 bp band showing the shared region between intron 2 and noncodifying exon 15 (d) scheme showing the deletedregion

6 BioMed Research International

diagnosed as AIP 15 years ago carrying one reported muta-tion c772-1GgtA a splice site mutation which leads to exon13 skipping [39] When three of her daughters came fordiagnosis it was found that one of them asymptomatic butwith aHMBS activity reduced to 50of control value did notcarry the family mutation A reexamination of mother DNAconfirmed only the previous mutation but a more extensivestudy of her daughters indicated that two of them carry twomutations the maternal mutation and another previouslydescribed missense mutation pR321H [22] inherited fromtheir father The asymptomatic daughter carries this lastgenetic change It is interesting to note that these patientsdeveloped the symptomatology recently (23 and 26 yearsold) and only one of them occasionally suffered from someabdominal pain In most of homozygous or double heterozy-gous AIP reported cases the enzyme activity was severelyreduced and the symptomatology was developed at an earlyage with severe neurological manifestations [13 15 16 18ndash21]In several of these cases essential arginine residues for enzymeactivity are affected [45ndash47] In these new cases themutationsfound do not seem to be essential for enzyme expression oractivity This is likely true for the missense mutation whichaffects a nonconserved arginine residue in exon 15 locatedin the 29-residue insert between strands 1205733 and 1205722 in thedomain 3 only present in the human enzyme sequence [47]However the splice site mutation leads to exon 13 skipping[39] an exon where the residue Cys261 is located to whichthe essential DPM (dipyrromethane) cofactor is bound [47]Nevertheless this combined heterozygous genotype does notseem to have amore serious impact onHMBS activity than inthe heterozygous form since the activity of the three sistersis approximately the same These results highlighted theimportance of carrying out a complete genotype investigationof family members of a known carrier

Finally 38 new families carrying the frequent pG111Rmutation have been characterized leading to 59 (5566)the number of Argentinean families carrying this geneticchange The other mutations were found in one or in afew families Efforts were made to know if the AIP patientsshowing this mutation have a common ancestral originDetailed pedigrees were unavailable because either relativesof many of the patients were dead or the relatives themselveshad limited knowledge of their families ancestry Since thepG111R mutation occurs at a hot spot CpG dinucleotide itcan be possible that the mutation had been originated severaltimes independently However a preliminary analysis of fourintragenic and four flanking DNA polymorphic markersindicated that all tested patients with pG111Rmutation (721)had at least one common allele for all intragenic and flankingmarkers Argentinean AIP patients with other mutationshad different alleles for the markers [28] These previousresults had suggested that individuals carrying this mutationwere most likely related Extended haplotype analysis on alarge group of families with the pG111R mutation and theirrelatives add further evidence to our previous hypothesisabout a founder effect for this mutation in the Argentineanpopulation [43] Microsatellite studies in these families arebeing carried out

5 Conclusions

This study emphasizes the molecular heterogeneity of AIPand the importance of molecular techniques as the mostappropriate tools for detecting and identifying specific muta-tions in carriers of affected families to avoid the contact withprecipitating agents

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

Gabriela Nora Cerbino is a postgraduate student from theUniversity of Buenos Aires Alcira Batlle Marıa VictoriaRossetti Victoria Estela Parera and Esther Noemı Gerezare Superior Independent and Associated Researchers fromCONICET Viviana Alicia Melito and Laura Sabina Varelaare Principal and Associated Members at the TechnicalCareer from CONICET The authors would like to thankH Muramatsu MD Dr MN Guolo Lic LM Oliveri andMrs VI Castillo for their technical assistance This work wassupported by Grants X253 (2004ndash2007) X304 (2004ndash2007)EX195 (2008ndash2010) EX165 (2008ndash2010) and W542 (2011ndash2014) from UBA PICT 0268 (2009ndash2012) from ANPCYTand PIP 049 (2012ndash2014) from CONICET

References

[1] A M C Batlle ldquoPorfirias y Porfirinas Aspectos clınicosbioquımicos y biologıa molecularrdquo Acta Bioquımica ClınicaLatinoamericana Serie Actualizaciones Medico-Bioquımicassupplement 3 pp 145ndash171 1997

[2] A Pietrangelo ldquoTheporphyrias pathophysiologyrdquo Internal andEmergency Medicine supplement 1 pp S65ndashS71 2010

[3] H Puy L Gouya and J-C Deybach ldquoPorphyriasrdquoThe Lancetvol 375 no 9718 pp 924ndash937 2010

[4] K E Anderson S Sassa D F Bishop and R J Desnick ldquoDis-orders of heme biosynthesis X-linked sideroblasticanemia andthe porphyriasrdquo in The Metabolic and Molecular Basis ofInherited Disease C R Scriver A L Beaudet D Valle and WS Sly Eds vol 2 pp 2991ndash3062 McGraw-Hill New York NYUSA 2001

[5] R Kauppinen ldquoPorphyriasrdquo The Lancet vol 365 no 9455 pp241ndash252 2005

[6] R J Desnick M Balwani and K E Anderson ldquoInheritedPorphyriasrdquo in Emery and Rimoinrsquos Principles and Practice ofMedical Genetics D L Rimoin R E Pyeritz and B Korf Edschapter 99 pp 1ndash32 Elsevier SanDiego Calif USA 6th edition2013

[7] V E Parera A de Siervi L Varela M V Rossetti and A MD C Batlle ldquoAcute porphyrias in the Argentinean populationa reviewrdquoCellular andMolecular Biology vol 49 no 4 pp 493ndash500 2003

[8] C Picat M H Delfau F W M de Rooij et al ldquoIdentificationof the mutations in the parents of a patient with a putativecompound heterozygosity for acute intermittent porphyriardquo

BioMed Research International 7

Journal of Inherited Metabolic Disease vol 13 no 5 pp 684ndash686 1990

[9] G J J Beukeveld B G Wolthers Y Nordmann J C DeybachB Grandchamp and S K Wadman ldquoA retrospective study of apatient with homozygous formof acute intermittent porphyriardquoJournal of InheritedMetabolic Disease vol 13 no 5 pp 673ndash6831990

[10] D H Llewellyn S J Smyth G H Elder A C Hutchesson J MRattenbury and M F Smith ldquoHomozygous acute intermittentporphyria compound heterozygosity for adjacent base tran-sitions in the same codon of the porphobilinogen deaminasegenerdquo Human Genetics vol 89 no 1 pp 97ndash98 1992

[11] R J Hift P N Meissner G Todd et al ldquoHomozygous variegateporphyria an evolving clinical syndromerdquo Postgraduate Medi-cal Journal vol 69 no 816 pp 781ndash786 1993

[12] A Edixhoven-Bosdijk F W de Rooij E de Baar-Heesakkersand J H Wilson ldquoResidual activity of human porphobilinogendeaminase with R167Q or R167W mutations an explanationfor survival of homozygous and compound heterozygous acuteintermittent porphyricsrdquo Cellular and Molecular Biology vol48 no 8 pp 861ndash866 2002

[13] C Solis A Martinez-Bermejo T P Naidich et al ldquoAcute inter-mittent porphyria studies of the severe homozygous dominantdisease provides insights into the neurologic attacks in acuteporphyriasrdquoArchives of Neurology vol 61 no 11 pp 1764ndash17702004

[14] J Hessels G Voortman A van der Wagen C van derElzen H Scheffer and F M J Zuijderhoudt ldquoHomozygousacute intermittent porphyria in a 7-years-old boy with massiveexcretions of porphyrins and porphyrin precursorsrdquo Journal ofInherited Metabolic Disease vol 27 no 1 pp 19ndash27 2004

[15] L Sheppard and T Dorman ldquoAnesthesia in a child withhomozygous porphobilinogen deaminase deficiency a severeform of acute intermittent porphyriardquo Paediatric Anaesthesiavol 15 no 5 pp 426ndash428 2005

[16] E McGovern P Fleming and A OrsquoMarcaigh ldquoThe dentalmanagement of five paediatric patients with a history ofacute intermittent porphyriardquo European Archives of PaediatricDentistry vol 8 no 4 pp 215ndash218 2007

[17] V AMelitoM V Rossetti V E Parera and A Batlle ldquoPorfiriaspoco frecuentes Casos detectados en la poblacion argentinardquoRevista Argentina de Dermatologıa vol 87 pp 248ndash263 2006

[18] A Dibi H Aitouamar and A Bentahila ldquoRecurrent flaccidparalysis indicative of acute intermittent porphyria in a childrdquoArchives de Pediatrie vol 17 no 12 pp 1670ndash1672 2010

[19] J I Bhat U A Qureeshi and M A Bhat ldquoAcute intermittentporphyria with transient cortical blindnessrdquo Indian Pediatricsvol 47 no 11 pp 977ndash978 2010

[20] E Anyaegbu M Goodman S-Y Ahn M Thangarajh MWong and M Shinawi ldquoAcute intermittent porphyria a diag-nostic challengerdquo Journal of Child Neurology vol 27 no 7 pp917ndash921 2012

[21] B Zhao Q Wei Y Wang Y Chen and H Shang ldquoPosteriorreversible encephalopathy syndrome in acute intermittent por-phyriardquo Pediatric Neurology vol 51 no 3 pp 457ndash460 2014

[22] M M Schuurmans X Schneider-Yin U B Rufenacht et alldquoInfluence of age and gender on the clinical expression ofacute intermittent porphyria based on molecular study of por-phobilinogen deaminase gene among Swiss patientrdquoMolecularMedicine vol 7 no 8 pp 535ndash542 2001

[23] J-S Lee and M Anvret ldquoIdentification of the most com-mon mutation within the porphobilinogen deaminase gene in

Swedish patients with acute intermittent porphyriardquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 88 no 23 pp 10912ndash10915 1991

[24] X-F Gu F de Rooij J S Lee et al ldquoHigh prevalence of a pointmutation in the porphobilinogen deaminase gene in Dutchpatients with acute intermittent porphyriardquo Human Geneticsvol 91 no 2 pp 128ndash130 1993

[25] X Schneider-Yin M Hergersberg D E Goldgar et alldquoAncestral founder of mutationW283X in the porphobilinogendeaminase gene among acute intermittent porphyria patientsrdquoHuman Heredity vol 54 no 2 pp 69ndash81 2002

[26] R Kauppinen S Mustajoki H Pihlaja L Peltonen and PMus-tajoki ldquoAcute intermittent porphyria in Finland 19 mutationsin the porphobilinogen deaminase generdquo Human MolecularGenetics vol 4 no 2 pp 215ndash222 1995

[27] G Lundin J Hashemi Y Floderus et al ldquoFour mutations inthe porphobilinogen deaminase gene in patients with acuteintermittent porphyriardquo Journal of Medical Genetics vol 32 no12 pp 979ndash981 1995

[28] A de SierviM V Rossetti V E Parera et al ldquoIdentification andcharacterization of hydroxymethylbilane synthase mutationscausing acute intermittent porphyria evidence for an ancestralfounder of the common G111R mutationrdquo American Journal ofMedical Genetics vol 86 no 4 pp 366ndash375 1999

[29] A de Siervi D E W Cadiz V E Parera A M D C Batlle andM V Rossetti ldquoIdentification and characterization of two novelmutations that produce acute intermittent porphyria a 3-basedeletion (841-843delGGA) and a missense mutation (T35M)rdquoHuman Mutation vol 16 no 4 p 373 2000

[30] A Gregor X Schneider-Yin U Szlendak et al ldquoMolecu-lar study of the hydroxymethylbilane synthase gene (HMBS)among Polish patients with acute intermittent porphyriardquoHuman Mutation vol 19 no 3 p 310 2002

[31] Y A Luchinina V L Surin A V Lukrsquoyanenko I V KarpovaY S Pustovoit and S K Kravchenko ldquoMolecular diagnosticsof acute intermittent porphyria in Russiardquo European Journal ofHumanGenetics vol 13 supplement 1 p 134 2005 Proceedingsof the European Society of Human Genetics InternationalConference

[32] X-F Gu F de Rooij E de Baar et al ldquoTwo novel mutationsof the porphobilinogen deaminase gene in acute intermittentporphyriardquo Human Molecular Genetics vol 2 no 10 pp 1735ndash1736 1993

[33] M D Cappellini F M di Montemuros E di Pierro and GFiorelli ldquoHematologically important mutations acute intermit-tent porphyriardquo Blood Cells Molecules and Diseases vol 28 no1 pp 5ndash12 2002

[34] A de SierviMMendez V E Parera L Varela AM Batlle andM V Rossetti ldquoAcute intermittent porphyria characterizationof two novelmutations in the porphobilinogen deaminase geneone amino acid deletion (453-455delAGC) and one splicingaceptor site mutation (IVS8-1GgtT)rdquo Human Mutation vol 14no 4 article 355 1999

[35] M H Delfau C Picat F de Rooij et al ldquoMolecular hetero-geneity of acute intermittent porphyria identification of fouradditional mutations resulting in the CRIM-negative subtypeof the diseaserdquo The American Journal of Human Genetics vol49 no 2 pp 421ndash428 1991

[36] M H Delfau C Picat F W M de Rooij et al ldquoTwo differentpointG toAmutations in exon 10 of the porphobilinogendeam-inase gene are responsible for acute intermittent porphyriardquoTheJournal of Clinical Investigation vol 86 no 5 pp 1511ndash1516 1990

8 BioMed Research International

[37] C S Mgone W G Lanyon M R Moore G V Louie andJ M Connor ldquoIdentification of five novel mutations in theporphobilinogen deaminase generdquo Human Molecular Geneticsvol 3 no 5 pp 809ndash811 1994

[38] C-H Chen K H Astrin G Lee K E Anderson and RJ Desnick ldquoAcute intermittent porphyria identification andexpression of exonic mutations in the hydroxymethylbilanesynthase gene An initiation codon missense mutation inthe housekeeping transcript causes ldquovariant acute intermittentporphyriardquo with normal expression of the erythroid-specificenzymerdquoThe Journal of Clinical Investigation vol 94 no 5 pp1927ndash1937 1994

[39] H Puy J CDeybach J Lamoril et al ldquoMolecular epidemiologyand diagnosis of PBG deaminase gene defects in acute intermit-tent porphyriardquo The American Journal of Human Genetics vol60 no 6 pp 1373ndash1383 1997

[40] Y Floderus P M Shoolingin-Jordan and P Harper ldquoAcuteintermittent porphyria in Sweden Molecular functional andclinical consequences of some new mutations found in theporphobilinogen deaminase generdquoClinical Genetics vol 62 no4 pp 288ndash297 2002

[41] H Puy J C Deybach J Lamoril A M Robreau and YNordmann ldquoDetection of four novel mutations in the porpho-bilinogen deaminase gene in French Caucasian patients withacute intermittent porphyriardquo Human Heredity vol 46 no 3pp 177ndash180 1996

[42] L E Maquat ldquoNonsense-mediated mRNA decay splicingtranslation and mRNP dynamicsrdquo Nature Reviews MolecularCell Biology vol 5 no 2 pp 89ndash99 2004

[43] G N CerbinoHigh prevalence of pG111R mutation in Argentinepatients with acute intermittent Porphyria Newmutations foundin PBGD gene [Pre Graduate thesis] 2011

[44] E Di Pierro V Brancaleoni F Stanzial F Benedicenti CCastellan and M D Cappellini ldquoNovel human pathologicalmutations Gene symbol HMBS Disease porphyria acuteintermittentrdquo Human Genetics vol 126 no 2 p 339 2009

[45] P D Brownlie R Lambert G V Louie et al ldquoThe three-dimensional structures of mutants of porphobilinogen deam-inase toward an understanding of the structural basis of acuteintermittent porphyriardquo Protein Science vol 3 no 10 pp 1644ndash1650 1994

[46] G Song Y Li C Cheng et al ldquoStructural insight into acuteintermittent porphyriardquo The FASEB Journal vol 23 no 2 pp396ndash404 2009

[47] R Gill S E Kolstoe F Mohammed et al ldquoStructure of humanporphobilinogen deaminase at 28 A the molecular basis ofacute intermittent porphyriardquo Biochemical Journal vol 420 no1 pp 17ndash25 2009

BioMed Research International 3

Table1All106families

studied

atbiochemicalandmolecular

levelinthelast20yearsa

tCIPYP

Exon

intro

nMutation

Nucleotidec

hang

eEff

ect

Num

bero

ffam

ilies

(affected

individu

als)

Firstreported

E3pR2

6Cc7

6CgtT

26ArggtCy

s2(9)

[26]

I3IV

S3ds+1GgtA

c87+

1GgtA

51015840splices

itemutation

exon

3deletio

n1(4)

[27]

E4

pQ34P

c101AgtC

34GlngtPro

6(12)

[28]

pQ34X

c100Cgt

T34

GlngtStop

1(2)

[26]

pT35M

c104Cgt

T35

Thrgt

Met

1(1)

[29]

pY46

Xc138Cgt

A46

Tyrgt

Stop

1(1)

[30]

E5pL6

8fsX

69c2

02203delC

TOut

offram

edele

tionof

2bp

1(1)

[31]

E6pL8

1Pc2

42Tgt

C81

LeugtPro

1(3)

[14]

E7pG111R

c331GgtA

111GlygtArg

59(171)

[32]

pV103fsX

120

c298

304d

upCC

CACT

GOut

offram

edup

licationof

7bpwith

asto

pcodo

nat+17

1(3)

Thisrepo

rt

I7IV

S7+1GgtC

c344

+1GgtC

51015840splices

itemutation

deletio

nexon

71(3)

[33]

E8pR116W

c346

CgtT

116ArggtTrp

1(1)

[32]

I8IV

S8as-2AgtG

c423-2AgtG

31015840splices

itemutation

deletio

n15bp

1(5)

Thisrepo

rtIV

S8as-1GgtT

c423-1GgtT

31015840splices

itemutation

deletio

nof

15bp

2(8)

[34]

E9pR149Q

c446

GgtA

149ArggtGln

1(1)

[35]

pA152del

c453

455delA

GC

DelAla152

1(1)

[29]

E10

pR173Q

c518GgtA

173ArggtGln

1(4)

[36]

pR173W

c517Cgt

T173ArggtTrp

3(4)

[37]

pR2

01W

c601Cgt

T201A

rggtTrp

1(1)

[38]

pQ204X

c610Cgt

T204GlngtStop

1(3)

[37]

I10IV

S10d

s-1GgtT

c612GgtT

Dele

tionof

3aa

inexon

103(8)

[35]

E12

pV221fs

X242

c665insA

Out

offram

einsertio

nof

Aat665

1(3)

[28]

pT243fsX

249

c728

729d

elCT

Out

offram

edele

tionof

2bpat728-729

1(5)

[28]

I12

IVS12ds+1GgtA

c771+1GgtA

51015840splices

itemutation

deletio

nof

exon

121(1)

[28]

IVS12as-1GgtA

c772-1GgtA

31015840splices

itemutation

deletio

nof

exon

131(3)

[39]

E13

pK2

72fsX2

87c8

15818delAG

GA

Out

offram

edele

tionof

4bpat815

1(3)

[28]

E14

pG281del

c841

843delGGA

In-fr

amed

eletio

nof

GGAat841

2(7)

[28]

I14IV

S14-2AgtG

c913-2AgtG

31015840splices

itemutation

deletio

nexon

151(1)

[40]

IVS14as-1GgtA

c913-1GgtA

31015840splices

itemutation

deletio

nof

exon

151(1)

Thisrepo

rt

E15

pH301fs

X306

c913insC

Out

offram

einsertio

nof

Cat913

2(5)

[41]

pV315fsX

328

c948delA

Out

offram

edele

tionof

Aat948

1(2)

[28]

pL329fsX3

41c9

85delTTG

GCT

GCC

CAG

In-fr

amed

eletio

nof

329LA

AQ1(5)

[28]

pR3

21H

c962GgtA

321A

rggtHis

1(4)

[22]

pG335S

c1003GgtA

335GlygtSer

1(4)

[28]

g3078

8306del5228bp

Dele

tionof

5228

bpfro

mintro

n2to

intro

n15

2(7)

Thisrepo

rt

4 BioMed Research International

Table 2 Biochemical data and mutation status of the family from Paraguay

Patient Age ALAmg24 h

PBGmg24 h

Porph120583g24 h

PPI120582619 nm HMBS activity Mutation status

Proband 38 27 87 188 180 4472 c772-1 GgtAMother 67 mdash mdash mdash 185 4624 c772-1 GgtAHusband 62 mdash mdash mdash 100 6120 pR321HDaughter 23 66 325 589 123 5806 c772-1 GgtApR321HDaughter 26 61 247 782 129 3175 c772-1 GgtApR321HDaughter 30 10 12 37 100 4477 pR321HAge in years at diagnosis Porph porphyrinsNormal values ALAle4mg24 h PBGle2mg24 h porphyrins 2ndash250120583g24 h Plasma Porphyrin Index (PPI)le130 (120582 619) HMBS activity 8451plusmn 1196UmlGR (F) 7313 plusmn 1362Uml GR (M)

TGCCAGAGAAGAGCTCCCTGCGAACAGCATCCCAGCTGCAAAG

Exon 8 Exon 9Exon 9ndash15bp

15bp

Figure 1 Electropherogram showing c423-2AgtG mutation RT-PCR product

In another two families 2 bands were found whenHMBSgene was amplified one of the expected size and another of300 bp (Figure 3(a)) The sequencing of the small purifiedband revealed a large deletion of 5228 bp spanning fromintron 2 to noncoding exon 15 (Figures 3(c) and 3(d))

The other 15 mutations were previously described point-ing that 7 of them were identified for the first time in ourpopulation (Table 1)

Of note are the results obtained for a foreign family fromParaguay Two female symptomatic members carried twoalready described mutations One was a splice site mutationin the last base of intron 12 inherited from the mother (c772-1GgtA) which leads to exon 13 skipping [39] The other wasa point mutation (c962GgtA) in exon 15 which produces anamino acid change (pR321H) and was inherited from thefather [22] Another asymptomatic sister carried only this lastmutation The biochemical values and molecular results forthis family are shown in Table 2

In addition 38 new families carry the pG111R mutationpreviously described for another 21 unrelated families [7]ascending the number of unrelated Argentinean families thatcarry this mutation to 59 (5566) adding further support toour previous hypothesis of a founder effect [28]

4 Discussion

During the last 20 years 35 different mutations were found14 described in Argentina for the first time and 21 alreadyreported for other populations These 35 genetic changes

include 15 missense mutations 9 splice defects 7 small dele-tions 2 small insertions one gross deletion and 1duplication

One of the splice site mutations is located in the minus2position of the acceptor splice site of intron 8 (c423-2AgtGGENBANK HM856802) leading to the in-frame deletion of15 bp (Figure 1) The same result has been found for a pointmutation in the last base of intron 8 already described foranother Argentinean family [34]

The other novel splice site mutation was an A to Gtransition in the last base of intron 14 (c913-1GgtA) Althoughno sample was available to carry out RT-PCR studies as thisbase is 100 conserved in the consensus splice site it is verylikely that this substitution leads to exon 15 skipping as it hasbeen described by Puy et al for a different mutation affectingthe same acceptor splice site [39]

The novel frameshift mutation (Figure 2) c301 307dup-CCCACTG (GENBANK HQ7315521) introduces a prema-ture stop codon at exon 8 so the transcript codified by thisallele is most likely to be degraded by the nonsense-mediatedmRNA decay (NMD) [42] This mutation has been found intwo unrelated Argentinean families (Table 1)

In two families two bandswere foundwhen PCRproductwas run in an agarose gel one of the expected size andanother of 300 bp (Figure 3(a)) When these were sequencedthe large one did not show any genetic change but it showedan apparent homozygosis of the 6 variable SNPs in the studiedpopulation (g3119TgtG g3581AgtG g3982TgtC g6479TgtGg7064CgtA g7539CgtT) Cerbino [43] However as it isshown in Figure 3(b) for two of these SNPs (g6479TgtGand g7539CgtT) the proband and her sister carry the sameallelic variant (6479 G and 7539 C) but the symptomaticdaughter of one of them carries another allelic variant (6479T and 7539 T) inherited from her father The analysis ofthe smaller band indicated that this corresponded to theother allele with a large deletion of 5228 bp spanning fromintron 2 to noncoding exon 15 As indicated in Figures 3(c)and 3(d) positions g3078 g3081 and g8306 g8309 sharedthe same region (CCCC) so it was impossible to determinethe breakpoint of the deletion Only another gross deletionof 4620 bp but including promoter and exon 1 has beendescribed by Di Pierro et al [44]

In the family from Paraguay two double heterozygotesrelatives were found The proband of this family has been

BioMed Research International 5

GAAGGACCTGCCCATCCTTGAAGGACCTGCCCACTGTGCTTCCTCCTGGCT

(a)

GAAGGACCTGCCCACTGTGCTTCCTCCTGGCTTCACCATCGGAGCCATCTGCAAG

CCCACTGTGCTTCCTCCTGGCTTCACCATCGGAGCCAT

TTGAAGGACCTGCCCACTGTGCTTCCTCCTGGCTTCTGCATCCGAGCCATCAGCCATTTACAATCTTGAAAC

Control sequence

Mutated sequence

(b)

Figure 2 Electropherograms showing (a) control sequence (b) c301 307dupCCCACTG mutation the duplicated sequence is underlined

M P C

5kb

300pb

(a)

del Gdel Gdel Cdel Gdel del C

del Gdel Gdel Cdel Gdel Cdel C

G GA GT CG TC CC T

del Gdel Gdel Cdel Tdel Cdel T

G GG GC CG TC CC T

T GA GT CG T C C T

1 2 3

4 5

6

g3119TgtGg3581AgtGg3982TgtCg6479TgtGg7064CgtAg7539CgtT

(b)

CCCC

A T GAGGAGGCAAGGCAGTCATCAAGGCCCCAAGGTGAGGCAAATCCCTGGAAGGCTTGAACCCTGCAGTTCAGTCTCCCGGGGTAATCACTCCCCAGATAGCAGTGAGAGTGGGGAAATA

Shared regionEx15 NC-g8310

CTCCAAGG

10 20 30 40 50 60 70 80 90 100 110 120

130 140 150GCTGGTCCCTACGAAGAAATTAA

g3077ndashg3055

(c)

Ex10Ex1 Ex7 Ex9 Ex12Ex6 Ex8 Ex11Ex2 Ex3 Ex4 Ex5

Ex1 Ex2 NCEx15

Ex14 Ex15Ex13 NCEx15

(d)

Figure 3 Gross deletion of 5228 bp (a) PCR product of patient (P) control individual (C) M 1 kb marker (b) family SNPs analysis (c)electropherogram of the 300 bp band showing the shared region between intron 2 and noncodifying exon 15 (d) scheme showing the deletedregion

6 BioMed Research International

diagnosed as AIP 15 years ago carrying one reported muta-tion c772-1GgtA a splice site mutation which leads to exon13 skipping [39] When three of her daughters came fordiagnosis it was found that one of them asymptomatic butwith aHMBS activity reduced to 50of control value did notcarry the family mutation A reexamination of mother DNAconfirmed only the previous mutation but a more extensivestudy of her daughters indicated that two of them carry twomutations the maternal mutation and another previouslydescribed missense mutation pR321H [22] inherited fromtheir father The asymptomatic daughter carries this lastgenetic change It is interesting to note that these patientsdeveloped the symptomatology recently (23 and 26 yearsold) and only one of them occasionally suffered from someabdominal pain In most of homozygous or double heterozy-gous AIP reported cases the enzyme activity was severelyreduced and the symptomatology was developed at an earlyage with severe neurological manifestations [13 15 16 18ndash21]In several of these cases essential arginine residues for enzymeactivity are affected [45ndash47] In these new cases themutationsfound do not seem to be essential for enzyme expression oractivity This is likely true for the missense mutation whichaffects a nonconserved arginine residue in exon 15 locatedin the 29-residue insert between strands 1205733 and 1205722 in thedomain 3 only present in the human enzyme sequence [47]However the splice site mutation leads to exon 13 skipping[39] an exon where the residue Cys261 is located to whichthe essential DPM (dipyrromethane) cofactor is bound [47]Nevertheless this combined heterozygous genotype does notseem to have amore serious impact onHMBS activity than inthe heterozygous form since the activity of the three sistersis approximately the same These results highlighted theimportance of carrying out a complete genotype investigationof family members of a known carrier

Finally 38 new families carrying the frequent pG111Rmutation have been characterized leading to 59 (5566)the number of Argentinean families carrying this geneticchange The other mutations were found in one or in afew families Efforts were made to know if the AIP patientsshowing this mutation have a common ancestral originDetailed pedigrees were unavailable because either relativesof many of the patients were dead or the relatives themselveshad limited knowledge of their families ancestry Since thepG111R mutation occurs at a hot spot CpG dinucleotide itcan be possible that the mutation had been originated severaltimes independently However a preliminary analysis of fourintragenic and four flanking DNA polymorphic markersindicated that all tested patients with pG111Rmutation (721)had at least one common allele for all intragenic and flankingmarkers Argentinean AIP patients with other mutationshad different alleles for the markers [28] These previousresults had suggested that individuals carrying this mutationwere most likely related Extended haplotype analysis on alarge group of families with the pG111R mutation and theirrelatives add further evidence to our previous hypothesisabout a founder effect for this mutation in the Argentineanpopulation [43] Microsatellite studies in these families arebeing carried out

5 Conclusions

This study emphasizes the molecular heterogeneity of AIPand the importance of molecular techniques as the mostappropriate tools for detecting and identifying specific muta-tions in carriers of affected families to avoid the contact withprecipitating agents

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

Gabriela Nora Cerbino is a postgraduate student from theUniversity of Buenos Aires Alcira Batlle Marıa VictoriaRossetti Victoria Estela Parera and Esther Noemı Gerezare Superior Independent and Associated Researchers fromCONICET Viviana Alicia Melito and Laura Sabina Varelaare Principal and Associated Members at the TechnicalCareer from CONICET The authors would like to thankH Muramatsu MD Dr MN Guolo Lic LM Oliveri andMrs VI Castillo for their technical assistance This work wassupported by Grants X253 (2004ndash2007) X304 (2004ndash2007)EX195 (2008ndash2010) EX165 (2008ndash2010) and W542 (2011ndash2014) from UBA PICT 0268 (2009ndash2012) from ANPCYTand PIP 049 (2012ndash2014) from CONICET

References

[1] A M C Batlle ldquoPorfirias y Porfirinas Aspectos clınicosbioquımicos y biologıa molecularrdquo Acta Bioquımica ClınicaLatinoamericana Serie Actualizaciones Medico-Bioquımicassupplement 3 pp 145ndash171 1997

[2] A Pietrangelo ldquoTheporphyrias pathophysiologyrdquo Internal andEmergency Medicine supplement 1 pp S65ndashS71 2010

[3] H Puy L Gouya and J-C Deybach ldquoPorphyriasrdquoThe Lancetvol 375 no 9718 pp 924ndash937 2010

[4] K E Anderson S Sassa D F Bishop and R J Desnick ldquoDis-orders of heme biosynthesis X-linked sideroblasticanemia andthe porphyriasrdquo in The Metabolic and Molecular Basis ofInherited Disease C R Scriver A L Beaudet D Valle and WS Sly Eds vol 2 pp 2991ndash3062 McGraw-Hill New York NYUSA 2001

[5] R Kauppinen ldquoPorphyriasrdquo The Lancet vol 365 no 9455 pp241ndash252 2005

[6] R J Desnick M Balwani and K E Anderson ldquoInheritedPorphyriasrdquo in Emery and Rimoinrsquos Principles and Practice ofMedical Genetics D L Rimoin R E Pyeritz and B Korf Edschapter 99 pp 1ndash32 Elsevier SanDiego Calif USA 6th edition2013

[7] V E Parera A de Siervi L Varela M V Rossetti and A MD C Batlle ldquoAcute porphyrias in the Argentinean populationa reviewrdquoCellular andMolecular Biology vol 49 no 4 pp 493ndash500 2003

[8] C Picat M H Delfau F W M de Rooij et al ldquoIdentificationof the mutations in the parents of a patient with a putativecompound heterozygosity for acute intermittent porphyriardquo

BioMed Research International 7

Journal of Inherited Metabolic Disease vol 13 no 5 pp 684ndash686 1990

[9] G J J Beukeveld B G Wolthers Y Nordmann J C DeybachB Grandchamp and S K Wadman ldquoA retrospective study of apatient with homozygous formof acute intermittent porphyriardquoJournal of InheritedMetabolic Disease vol 13 no 5 pp 673ndash6831990

[10] D H Llewellyn S J Smyth G H Elder A C Hutchesson J MRattenbury and M F Smith ldquoHomozygous acute intermittentporphyria compound heterozygosity for adjacent base tran-sitions in the same codon of the porphobilinogen deaminasegenerdquo Human Genetics vol 89 no 1 pp 97ndash98 1992

[11] R J Hift P N Meissner G Todd et al ldquoHomozygous variegateporphyria an evolving clinical syndromerdquo Postgraduate Medi-cal Journal vol 69 no 816 pp 781ndash786 1993

[12] A Edixhoven-Bosdijk F W de Rooij E de Baar-Heesakkersand J H Wilson ldquoResidual activity of human porphobilinogendeaminase with R167Q or R167W mutations an explanationfor survival of homozygous and compound heterozygous acuteintermittent porphyricsrdquo Cellular and Molecular Biology vol48 no 8 pp 861ndash866 2002

[13] C Solis A Martinez-Bermejo T P Naidich et al ldquoAcute inter-mittent porphyria studies of the severe homozygous dominantdisease provides insights into the neurologic attacks in acuteporphyriasrdquoArchives of Neurology vol 61 no 11 pp 1764ndash17702004

[14] J Hessels G Voortman A van der Wagen C van derElzen H Scheffer and F M J Zuijderhoudt ldquoHomozygousacute intermittent porphyria in a 7-years-old boy with massiveexcretions of porphyrins and porphyrin precursorsrdquo Journal ofInherited Metabolic Disease vol 27 no 1 pp 19ndash27 2004

[15] L Sheppard and T Dorman ldquoAnesthesia in a child withhomozygous porphobilinogen deaminase deficiency a severeform of acute intermittent porphyriardquo Paediatric Anaesthesiavol 15 no 5 pp 426ndash428 2005

[16] E McGovern P Fleming and A OrsquoMarcaigh ldquoThe dentalmanagement of five paediatric patients with a history ofacute intermittent porphyriardquo European Archives of PaediatricDentistry vol 8 no 4 pp 215ndash218 2007

[17] V AMelitoM V Rossetti V E Parera and A Batlle ldquoPorfiriaspoco frecuentes Casos detectados en la poblacion argentinardquoRevista Argentina de Dermatologıa vol 87 pp 248ndash263 2006

[18] A Dibi H Aitouamar and A Bentahila ldquoRecurrent flaccidparalysis indicative of acute intermittent porphyria in a childrdquoArchives de Pediatrie vol 17 no 12 pp 1670ndash1672 2010

[19] J I Bhat U A Qureeshi and M A Bhat ldquoAcute intermittentporphyria with transient cortical blindnessrdquo Indian Pediatricsvol 47 no 11 pp 977ndash978 2010

[20] E Anyaegbu M Goodman S-Y Ahn M Thangarajh MWong and M Shinawi ldquoAcute intermittent porphyria a diag-nostic challengerdquo Journal of Child Neurology vol 27 no 7 pp917ndash921 2012

[21] B Zhao Q Wei Y Wang Y Chen and H Shang ldquoPosteriorreversible encephalopathy syndrome in acute intermittent por-phyriardquo Pediatric Neurology vol 51 no 3 pp 457ndash460 2014

[22] M M Schuurmans X Schneider-Yin U B Rufenacht et alldquoInfluence of age and gender on the clinical expression ofacute intermittent porphyria based on molecular study of por-phobilinogen deaminase gene among Swiss patientrdquoMolecularMedicine vol 7 no 8 pp 535ndash542 2001

[23] J-S Lee and M Anvret ldquoIdentification of the most com-mon mutation within the porphobilinogen deaminase gene in

Swedish patients with acute intermittent porphyriardquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 88 no 23 pp 10912ndash10915 1991

[24] X-F Gu F de Rooij J S Lee et al ldquoHigh prevalence of a pointmutation in the porphobilinogen deaminase gene in Dutchpatients with acute intermittent porphyriardquo Human Geneticsvol 91 no 2 pp 128ndash130 1993

[25] X Schneider-Yin M Hergersberg D E Goldgar et alldquoAncestral founder of mutationW283X in the porphobilinogendeaminase gene among acute intermittent porphyria patientsrdquoHuman Heredity vol 54 no 2 pp 69ndash81 2002

[26] R Kauppinen S Mustajoki H Pihlaja L Peltonen and PMus-tajoki ldquoAcute intermittent porphyria in Finland 19 mutationsin the porphobilinogen deaminase generdquo Human MolecularGenetics vol 4 no 2 pp 215ndash222 1995

[27] G Lundin J Hashemi Y Floderus et al ldquoFour mutations inthe porphobilinogen deaminase gene in patients with acuteintermittent porphyriardquo Journal of Medical Genetics vol 32 no12 pp 979ndash981 1995

[28] A de SierviM V Rossetti V E Parera et al ldquoIdentification andcharacterization of hydroxymethylbilane synthase mutationscausing acute intermittent porphyria evidence for an ancestralfounder of the common G111R mutationrdquo American Journal ofMedical Genetics vol 86 no 4 pp 366ndash375 1999

[29] A de Siervi D E W Cadiz V E Parera A M D C Batlle andM V Rossetti ldquoIdentification and characterization of two novelmutations that produce acute intermittent porphyria a 3-basedeletion (841-843delGGA) and a missense mutation (T35M)rdquoHuman Mutation vol 16 no 4 p 373 2000

[30] A Gregor X Schneider-Yin U Szlendak et al ldquoMolecu-lar study of the hydroxymethylbilane synthase gene (HMBS)among Polish patients with acute intermittent porphyriardquoHuman Mutation vol 19 no 3 p 310 2002

[31] Y A Luchinina V L Surin A V Lukrsquoyanenko I V KarpovaY S Pustovoit and S K Kravchenko ldquoMolecular diagnosticsof acute intermittent porphyria in Russiardquo European Journal ofHumanGenetics vol 13 supplement 1 p 134 2005 Proceedingsof the European Society of Human Genetics InternationalConference

[32] X-F Gu F de Rooij E de Baar et al ldquoTwo novel mutationsof the porphobilinogen deaminase gene in acute intermittentporphyriardquo Human Molecular Genetics vol 2 no 10 pp 1735ndash1736 1993

[33] M D Cappellini F M di Montemuros E di Pierro and GFiorelli ldquoHematologically important mutations acute intermit-tent porphyriardquo Blood Cells Molecules and Diseases vol 28 no1 pp 5ndash12 2002

[34] A de SierviMMendez V E Parera L Varela AM Batlle andM V Rossetti ldquoAcute intermittent porphyria characterizationof two novelmutations in the porphobilinogen deaminase geneone amino acid deletion (453-455delAGC) and one splicingaceptor site mutation (IVS8-1GgtT)rdquo Human Mutation vol 14no 4 article 355 1999

[35] M H Delfau C Picat F de Rooij et al ldquoMolecular hetero-geneity of acute intermittent porphyria identification of fouradditional mutations resulting in the CRIM-negative subtypeof the diseaserdquo The American Journal of Human Genetics vol49 no 2 pp 421ndash428 1991

[36] M H Delfau C Picat F W M de Rooij et al ldquoTwo differentpointG toAmutations in exon 10 of the porphobilinogendeam-inase gene are responsible for acute intermittent porphyriardquoTheJournal of Clinical Investigation vol 86 no 5 pp 1511ndash1516 1990

8 BioMed Research International

[37] C S Mgone W G Lanyon M R Moore G V Louie andJ M Connor ldquoIdentification of five novel mutations in theporphobilinogen deaminase generdquo Human Molecular Geneticsvol 3 no 5 pp 809ndash811 1994

[38] C-H Chen K H Astrin G Lee K E Anderson and RJ Desnick ldquoAcute intermittent porphyria identification andexpression of exonic mutations in the hydroxymethylbilanesynthase gene An initiation codon missense mutation inthe housekeeping transcript causes ldquovariant acute intermittentporphyriardquo with normal expression of the erythroid-specificenzymerdquoThe Journal of Clinical Investigation vol 94 no 5 pp1927ndash1937 1994

[39] H Puy J CDeybach J Lamoril et al ldquoMolecular epidemiologyand diagnosis of PBG deaminase gene defects in acute intermit-tent porphyriardquo The American Journal of Human Genetics vol60 no 6 pp 1373ndash1383 1997

[40] Y Floderus P M Shoolingin-Jordan and P Harper ldquoAcuteintermittent porphyria in Sweden Molecular functional andclinical consequences of some new mutations found in theporphobilinogen deaminase generdquoClinical Genetics vol 62 no4 pp 288ndash297 2002

[41] H Puy J C Deybach J Lamoril A M Robreau and YNordmann ldquoDetection of four novel mutations in the porpho-bilinogen deaminase gene in French Caucasian patients withacute intermittent porphyriardquo Human Heredity vol 46 no 3pp 177ndash180 1996

[42] L E Maquat ldquoNonsense-mediated mRNA decay splicingtranslation and mRNP dynamicsrdquo Nature Reviews MolecularCell Biology vol 5 no 2 pp 89ndash99 2004

[43] G N CerbinoHigh prevalence of pG111R mutation in Argentinepatients with acute intermittent Porphyria Newmutations foundin PBGD gene [Pre Graduate thesis] 2011

[44] E Di Pierro V Brancaleoni F Stanzial F Benedicenti CCastellan and M D Cappellini ldquoNovel human pathologicalmutations Gene symbol HMBS Disease porphyria acuteintermittentrdquo Human Genetics vol 126 no 2 p 339 2009

[45] P D Brownlie R Lambert G V Louie et al ldquoThe three-dimensional structures of mutants of porphobilinogen deam-inase toward an understanding of the structural basis of acuteintermittent porphyriardquo Protein Science vol 3 no 10 pp 1644ndash1650 1994

[46] G Song Y Li C Cheng et al ldquoStructural insight into acuteintermittent porphyriardquo The FASEB Journal vol 23 no 2 pp396ndash404 2009

[47] R Gill S E Kolstoe F Mohammed et al ldquoStructure of humanporphobilinogen deaminase at 28 A the molecular basis ofacute intermittent porphyriardquo Biochemical Journal vol 420 no1 pp 17ndash25 2009

4 BioMed Research International

Table 2 Biochemical data and mutation status of the family from Paraguay

Patient Age ALAmg24 h

PBGmg24 h

Porph120583g24 h

PPI120582619 nm HMBS activity Mutation status

Proband 38 27 87 188 180 4472 c772-1 GgtAMother 67 mdash mdash mdash 185 4624 c772-1 GgtAHusband 62 mdash mdash mdash 100 6120 pR321HDaughter 23 66 325 589 123 5806 c772-1 GgtApR321HDaughter 26 61 247 782 129 3175 c772-1 GgtApR321HDaughter 30 10 12 37 100 4477 pR321HAge in years at diagnosis Porph porphyrinsNormal values ALAle4mg24 h PBGle2mg24 h porphyrins 2ndash250120583g24 h Plasma Porphyrin Index (PPI)le130 (120582 619) HMBS activity 8451plusmn 1196UmlGR (F) 7313 plusmn 1362Uml GR (M)

TGCCAGAGAAGAGCTCCCTGCGAACAGCATCCCAGCTGCAAAG

Exon 8 Exon 9Exon 9ndash15bp

15bp

Figure 1 Electropherogram showing c423-2AgtG mutation RT-PCR product

In another two families 2 bands were found whenHMBSgene was amplified one of the expected size and another of300 bp (Figure 3(a)) The sequencing of the small purifiedband revealed a large deletion of 5228 bp spanning fromintron 2 to noncoding exon 15 (Figures 3(c) and 3(d))

The other 15 mutations were previously described point-ing that 7 of them were identified for the first time in ourpopulation (Table 1)

Of note are the results obtained for a foreign family fromParaguay Two female symptomatic members carried twoalready described mutations One was a splice site mutationin the last base of intron 12 inherited from the mother (c772-1GgtA) which leads to exon 13 skipping [39] The other wasa point mutation (c962GgtA) in exon 15 which produces anamino acid change (pR321H) and was inherited from thefather [22] Another asymptomatic sister carried only this lastmutation The biochemical values and molecular results forthis family are shown in Table 2

In addition 38 new families carry the pG111R mutationpreviously described for another 21 unrelated families [7]ascending the number of unrelated Argentinean families thatcarry this mutation to 59 (5566) adding further support toour previous hypothesis of a founder effect [28]

4 Discussion

During the last 20 years 35 different mutations were found14 described in Argentina for the first time and 21 alreadyreported for other populations These 35 genetic changes

include 15 missense mutations 9 splice defects 7 small dele-tions 2 small insertions one gross deletion and 1duplication

One of the splice site mutations is located in the minus2position of the acceptor splice site of intron 8 (c423-2AgtGGENBANK HM856802) leading to the in-frame deletion of15 bp (Figure 1) The same result has been found for a pointmutation in the last base of intron 8 already described foranother Argentinean family [34]

The other novel splice site mutation was an A to Gtransition in the last base of intron 14 (c913-1GgtA) Althoughno sample was available to carry out RT-PCR studies as thisbase is 100 conserved in the consensus splice site it is verylikely that this substitution leads to exon 15 skipping as it hasbeen described by Puy et al for a different mutation affectingthe same acceptor splice site [39]

The novel frameshift mutation (Figure 2) c301 307dup-CCCACTG (GENBANK HQ7315521) introduces a prema-ture stop codon at exon 8 so the transcript codified by thisallele is most likely to be degraded by the nonsense-mediatedmRNA decay (NMD) [42] This mutation has been found intwo unrelated Argentinean families (Table 1)

In two families two bandswere foundwhen PCRproductwas run in an agarose gel one of the expected size andanother of 300 bp (Figure 3(a)) When these were sequencedthe large one did not show any genetic change but it showedan apparent homozygosis of the 6 variable SNPs in the studiedpopulation (g3119TgtG g3581AgtG g3982TgtC g6479TgtGg7064CgtA g7539CgtT) Cerbino [43] However as it isshown in Figure 3(b) for two of these SNPs (g6479TgtGand g7539CgtT) the proband and her sister carry the sameallelic variant (6479 G and 7539 C) but the symptomaticdaughter of one of them carries another allelic variant (6479T and 7539 T) inherited from her father The analysis ofthe smaller band indicated that this corresponded to theother allele with a large deletion of 5228 bp spanning fromintron 2 to noncoding exon 15 As indicated in Figures 3(c)and 3(d) positions g3078 g3081 and g8306 g8309 sharedthe same region (CCCC) so it was impossible to determinethe breakpoint of the deletion Only another gross deletionof 4620 bp but including promoter and exon 1 has beendescribed by Di Pierro et al [44]

In the family from Paraguay two double heterozygotesrelatives were found The proband of this family has been

BioMed Research International 5

GAAGGACCTGCCCATCCTTGAAGGACCTGCCCACTGTGCTTCCTCCTGGCT

(a)

GAAGGACCTGCCCACTGTGCTTCCTCCTGGCTTCACCATCGGAGCCATCTGCAAG

CCCACTGTGCTTCCTCCTGGCTTCACCATCGGAGCCAT

TTGAAGGACCTGCCCACTGTGCTTCCTCCTGGCTTCTGCATCCGAGCCATCAGCCATTTACAATCTTGAAAC

Control sequence

Mutated sequence

(b)

Figure 2 Electropherograms showing (a) control sequence (b) c301 307dupCCCACTG mutation the duplicated sequence is underlined

M P C

5kb

300pb

(a)

del Gdel Gdel Cdel Gdel del C

del Gdel Gdel Cdel Gdel Cdel C

G GA GT CG TC CC T

del Gdel Gdel Cdel Tdel Cdel T

G GG GC CG TC CC T

T GA GT CG T C C T

1 2 3

4 5

6

g3119TgtGg3581AgtGg3982TgtCg6479TgtGg7064CgtAg7539CgtT

(b)

CCCC

A T GAGGAGGCAAGGCAGTCATCAAGGCCCCAAGGTGAGGCAAATCCCTGGAAGGCTTGAACCCTGCAGTTCAGTCTCCCGGGGTAATCACTCCCCAGATAGCAGTGAGAGTGGGGAAATA

Shared regionEx15 NC-g8310

CTCCAAGG

10 20 30 40 50 60 70 80 90 100 110 120

130 140 150GCTGGTCCCTACGAAGAAATTAA

g3077ndashg3055

(c)

Ex10Ex1 Ex7 Ex9 Ex12Ex6 Ex8 Ex11Ex2 Ex3 Ex4 Ex5

Ex1 Ex2 NCEx15

Ex14 Ex15Ex13 NCEx15

(d)

Figure 3 Gross deletion of 5228 bp (a) PCR product of patient (P) control individual (C) M 1 kb marker (b) family SNPs analysis (c)electropherogram of the 300 bp band showing the shared region between intron 2 and noncodifying exon 15 (d) scheme showing the deletedregion

6 BioMed Research International

diagnosed as AIP 15 years ago carrying one reported muta-tion c772-1GgtA a splice site mutation which leads to exon13 skipping [39] When three of her daughters came fordiagnosis it was found that one of them asymptomatic butwith aHMBS activity reduced to 50of control value did notcarry the family mutation A reexamination of mother DNAconfirmed only the previous mutation but a more extensivestudy of her daughters indicated that two of them carry twomutations the maternal mutation and another previouslydescribed missense mutation pR321H [22] inherited fromtheir father The asymptomatic daughter carries this lastgenetic change It is interesting to note that these patientsdeveloped the symptomatology recently (23 and 26 yearsold) and only one of them occasionally suffered from someabdominal pain In most of homozygous or double heterozy-gous AIP reported cases the enzyme activity was severelyreduced and the symptomatology was developed at an earlyage with severe neurological manifestations [13 15 16 18ndash21]In several of these cases essential arginine residues for enzymeactivity are affected [45ndash47] In these new cases themutationsfound do not seem to be essential for enzyme expression oractivity This is likely true for the missense mutation whichaffects a nonconserved arginine residue in exon 15 locatedin the 29-residue insert between strands 1205733 and 1205722 in thedomain 3 only present in the human enzyme sequence [47]However the splice site mutation leads to exon 13 skipping[39] an exon where the residue Cys261 is located to whichthe essential DPM (dipyrromethane) cofactor is bound [47]Nevertheless this combined heterozygous genotype does notseem to have amore serious impact onHMBS activity than inthe heterozygous form since the activity of the three sistersis approximately the same These results highlighted theimportance of carrying out a complete genotype investigationof family members of a known carrier

Finally 38 new families carrying the frequent pG111Rmutation have been characterized leading to 59 (5566)the number of Argentinean families carrying this geneticchange The other mutations were found in one or in afew families Efforts were made to know if the AIP patientsshowing this mutation have a common ancestral originDetailed pedigrees were unavailable because either relativesof many of the patients were dead or the relatives themselveshad limited knowledge of their families ancestry Since thepG111R mutation occurs at a hot spot CpG dinucleotide itcan be possible that the mutation had been originated severaltimes independently However a preliminary analysis of fourintragenic and four flanking DNA polymorphic markersindicated that all tested patients with pG111Rmutation (721)had at least one common allele for all intragenic and flankingmarkers Argentinean AIP patients with other mutationshad different alleles for the markers [28] These previousresults had suggested that individuals carrying this mutationwere most likely related Extended haplotype analysis on alarge group of families with the pG111R mutation and theirrelatives add further evidence to our previous hypothesisabout a founder effect for this mutation in the Argentineanpopulation [43] Microsatellite studies in these families arebeing carried out

5 Conclusions

This study emphasizes the molecular heterogeneity of AIPand the importance of molecular techniques as the mostappropriate tools for detecting and identifying specific muta-tions in carriers of affected families to avoid the contact withprecipitating agents

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

Gabriela Nora Cerbino is a postgraduate student from theUniversity of Buenos Aires Alcira Batlle Marıa VictoriaRossetti Victoria Estela Parera and Esther Noemı Gerezare Superior Independent and Associated Researchers fromCONICET Viviana Alicia Melito and Laura Sabina Varelaare Principal and Associated Members at the TechnicalCareer from CONICET The authors would like to thankH Muramatsu MD Dr MN Guolo Lic LM Oliveri andMrs VI Castillo for their technical assistance This work wassupported by Grants X253 (2004ndash2007) X304 (2004ndash2007)EX195 (2008ndash2010) EX165 (2008ndash2010) and W542 (2011ndash2014) from UBA PICT 0268 (2009ndash2012) from ANPCYTand PIP 049 (2012ndash2014) from CONICET

References

[1] A M C Batlle ldquoPorfirias y Porfirinas Aspectos clınicosbioquımicos y biologıa molecularrdquo Acta Bioquımica ClınicaLatinoamericana Serie Actualizaciones Medico-Bioquımicassupplement 3 pp 145ndash171 1997

[2] A Pietrangelo ldquoTheporphyrias pathophysiologyrdquo Internal andEmergency Medicine supplement 1 pp S65ndashS71 2010

[3] H Puy L Gouya and J-C Deybach ldquoPorphyriasrdquoThe Lancetvol 375 no 9718 pp 924ndash937 2010

[4] K E Anderson S Sassa D F Bishop and R J Desnick ldquoDis-orders of heme biosynthesis X-linked sideroblasticanemia andthe porphyriasrdquo in The Metabolic and Molecular Basis ofInherited Disease C R Scriver A L Beaudet D Valle and WS Sly Eds vol 2 pp 2991ndash3062 McGraw-Hill New York NYUSA 2001

[5] R Kauppinen ldquoPorphyriasrdquo The Lancet vol 365 no 9455 pp241ndash252 2005

[6] R J Desnick M Balwani and K E Anderson ldquoInheritedPorphyriasrdquo in Emery and Rimoinrsquos Principles and Practice ofMedical Genetics D L Rimoin R E Pyeritz and B Korf Edschapter 99 pp 1ndash32 Elsevier SanDiego Calif USA 6th edition2013

[7] V E Parera A de Siervi L Varela M V Rossetti and A MD C Batlle ldquoAcute porphyrias in the Argentinean populationa reviewrdquoCellular andMolecular Biology vol 49 no 4 pp 493ndash500 2003

[8] C Picat M H Delfau F W M de Rooij et al ldquoIdentificationof the mutations in the parents of a patient with a putativecompound heterozygosity for acute intermittent porphyriardquo

BioMed Research International 7

Journal of Inherited Metabolic Disease vol 13 no 5 pp 684ndash686 1990

[9] G J J Beukeveld B G Wolthers Y Nordmann J C DeybachB Grandchamp and S K Wadman ldquoA retrospective study of apatient with homozygous formof acute intermittent porphyriardquoJournal of InheritedMetabolic Disease vol 13 no 5 pp 673ndash6831990

[10] D H Llewellyn S J Smyth G H Elder A C Hutchesson J MRattenbury and M F Smith ldquoHomozygous acute intermittentporphyria compound heterozygosity for adjacent base tran-sitions in the same codon of the porphobilinogen deaminasegenerdquo Human Genetics vol 89 no 1 pp 97ndash98 1992

[11] R J Hift P N Meissner G Todd et al ldquoHomozygous variegateporphyria an evolving clinical syndromerdquo Postgraduate Medi-cal Journal vol 69 no 816 pp 781ndash786 1993

[12] A Edixhoven-Bosdijk F W de Rooij E de Baar-Heesakkersand J H Wilson ldquoResidual activity of human porphobilinogendeaminase with R167Q or R167W mutations an explanationfor survival of homozygous and compound heterozygous acuteintermittent porphyricsrdquo Cellular and Molecular Biology vol48 no 8 pp 861ndash866 2002

[13] C Solis A Martinez-Bermejo T P Naidich et al ldquoAcute inter-mittent porphyria studies of the severe homozygous dominantdisease provides insights into the neurologic attacks in acuteporphyriasrdquoArchives of Neurology vol 61 no 11 pp 1764ndash17702004

[14] J Hessels G Voortman A van der Wagen C van derElzen H Scheffer and F M J Zuijderhoudt ldquoHomozygousacute intermittent porphyria in a 7-years-old boy with massiveexcretions of porphyrins and porphyrin precursorsrdquo Journal ofInherited Metabolic Disease vol 27 no 1 pp 19ndash27 2004

[15] L Sheppard and T Dorman ldquoAnesthesia in a child withhomozygous porphobilinogen deaminase deficiency a severeform of acute intermittent porphyriardquo Paediatric Anaesthesiavol 15 no 5 pp 426ndash428 2005

[16] E McGovern P Fleming and A OrsquoMarcaigh ldquoThe dentalmanagement of five paediatric patients with a history ofacute intermittent porphyriardquo European Archives of PaediatricDentistry vol 8 no 4 pp 215ndash218 2007

[17] V AMelitoM V Rossetti V E Parera and A Batlle ldquoPorfiriaspoco frecuentes Casos detectados en la poblacion argentinardquoRevista Argentina de Dermatologıa vol 87 pp 248ndash263 2006

[18] A Dibi H Aitouamar and A Bentahila ldquoRecurrent flaccidparalysis indicative of acute intermittent porphyria in a childrdquoArchives de Pediatrie vol 17 no 12 pp 1670ndash1672 2010

[19] J I Bhat U A Qureeshi and M A Bhat ldquoAcute intermittentporphyria with transient cortical blindnessrdquo Indian Pediatricsvol 47 no 11 pp 977ndash978 2010

[20] E Anyaegbu M Goodman S-Y Ahn M Thangarajh MWong and M Shinawi ldquoAcute intermittent porphyria a diag-nostic challengerdquo Journal of Child Neurology vol 27 no 7 pp917ndash921 2012

[21] B Zhao Q Wei Y Wang Y Chen and H Shang ldquoPosteriorreversible encephalopathy syndrome in acute intermittent por-phyriardquo Pediatric Neurology vol 51 no 3 pp 457ndash460 2014

[22] M M Schuurmans X Schneider-Yin U B Rufenacht et alldquoInfluence of age and gender on the clinical expression ofacute intermittent porphyria based on molecular study of por-phobilinogen deaminase gene among Swiss patientrdquoMolecularMedicine vol 7 no 8 pp 535ndash542 2001

[23] J-S Lee and M Anvret ldquoIdentification of the most com-mon mutation within the porphobilinogen deaminase gene in

Swedish patients with acute intermittent porphyriardquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 88 no 23 pp 10912ndash10915 1991

[24] X-F Gu F de Rooij J S Lee et al ldquoHigh prevalence of a pointmutation in the porphobilinogen deaminase gene in Dutchpatients with acute intermittent porphyriardquo Human Geneticsvol 91 no 2 pp 128ndash130 1993

[25] X Schneider-Yin M Hergersberg D E Goldgar et alldquoAncestral founder of mutationW283X in the porphobilinogendeaminase gene among acute intermittent porphyria patientsrdquoHuman Heredity vol 54 no 2 pp 69ndash81 2002

[26] R Kauppinen S Mustajoki H Pihlaja L Peltonen and PMus-tajoki ldquoAcute intermittent porphyria in Finland 19 mutationsin the porphobilinogen deaminase generdquo Human MolecularGenetics vol 4 no 2 pp 215ndash222 1995

[27] G Lundin J Hashemi Y Floderus et al ldquoFour mutations inthe porphobilinogen deaminase gene in patients with acuteintermittent porphyriardquo Journal of Medical Genetics vol 32 no12 pp 979ndash981 1995

[28] A de SierviM V Rossetti V E Parera et al ldquoIdentification andcharacterization of hydroxymethylbilane synthase mutationscausing acute intermittent porphyria evidence for an ancestralfounder of the common G111R mutationrdquo American Journal ofMedical Genetics vol 86 no 4 pp 366ndash375 1999

[29] A de Siervi D E W Cadiz V E Parera A M D C Batlle andM V Rossetti ldquoIdentification and characterization of two novelmutations that produce acute intermittent porphyria a 3-basedeletion (841-843delGGA) and a missense mutation (T35M)rdquoHuman Mutation vol 16 no 4 p 373 2000

[30] A Gregor X Schneider-Yin U Szlendak et al ldquoMolecu-lar study of the hydroxymethylbilane synthase gene (HMBS)among Polish patients with acute intermittent porphyriardquoHuman Mutation vol 19 no 3 p 310 2002

[31] Y A Luchinina V L Surin A V Lukrsquoyanenko I V KarpovaY S Pustovoit and S K Kravchenko ldquoMolecular diagnosticsof acute intermittent porphyria in Russiardquo European Journal ofHumanGenetics vol 13 supplement 1 p 134 2005 Proceedingsof the European Society of Human Genetics InternationalConference

[32] X-F Gu F de Rooij E de Baar et al ldquoTwo novel mutationsof the porphobilinogen deaminase gene in acute intermittentporphyriardquo Human Molecular Genetics vol 2 no 10 pp 1735ndash1736 1993

[33] M D Cappellini F M di Montemuros E di Pierro and GFiorelli ldquoHematologically important mutations acute intermit-tent porphyriardquo Blood Cells Molecules and Diseases vol 28 no1 pp 5ndash12 2002

[34] A de SierviMMendez V E Parera L Varela AM Batlle andM V Rossetti ldquoAcute intermittent porphyria characterizationof two novelmutations in the porphobilinogen deaminase geneone amino acid deletion (453-455delAGC) and one splicingaceptor site mutation (IVS8-1GgtT)rdquo Human Mutation vol 14no 4 article 355 1999

[35] M H Delfau C Picat F de Rooij et al ldquoMolecular hetero-geneity of acute intermittent porphyria identification of fouradditional mutations resulting in the CRIM-negative subtypeof the diseaserdquo The American Journal of Human Genetics vol49 no 2 pp 421ndash428 1991

[36] M H Delfau C Picat F W M de Rooij et al ldquoTwo differentpointG toAmutations in exon 10 of the porphobilinogendeam-inase gene are responsible for acute intermittent porphyriardquoTheJournal of Clinical Investigation vol 86 no 5 pp 1511ndash1516 1990

8 BioMed Research International

[37] C S Mgone W G Lanyon M R Moore G V Louie andJ M Connor ldquoIdentification of five novel mutations in theporphobilinogen deaminase generdquo Human Molecular Geneticsvol 3 no 5 pp 809ndash811 1994

[38] C-H Chen K H Astrin G Lee K E Anderson and RJ Desnick ldquoAcute intermittent porphyria identification andexpression of exonic mutations in the hydroxymethylbilanesynthase gene An initiation codon missense mutation inthe housekeeping transcript causes ldquovariant acute intermittentporphyriardquo with normal expression of the erythroid-specificenzymerdquoThe Journal of Clinical Investigation vol 94 no 5 pp1927ndash1937 1994

[39] H Puy J CDeybach J Lamoril et al ldquoMolecular epidemiologyand diagnosis of PBG deaminase gene defects in acute intermit-tent porphyriardquo The American Journal of Human Genetics vol60 no 6 pp 1373ndash1383 1997

[40] Y Floderus P M Shoolingin-Jordan and P Harper ldquoAcuteintermittent porphyria in Sweden Molecular functional andclinical consequences of some new mutations found in theporphobilinogen deaminase generdquoClinical Genetics vol 62 no4 pp 288ndash297 2002

[41] H Puy J C Deybach J Lamoril A M Robreau and YNordmann ldquoDetection of four novel mutations in the porpho-bilinogen deaminase gene in French Caucasian patients withacute intermittent porphyriardquo Human Heredity vol 46 no 3pp 177ndash180 1996

[42] L E Maquat ldquoNonsense-mediated mRNA decay splicingtranslation and mRNP dynamicsrdquo Nature Reviews MolecularCell Biology vol 5 no 2 pp 89ndash99 2004

[43] G N CerbinoHigh prevalence of pG111R mutation in Argentinepatients with acute intermittent Porphyria Newmutations foundin PBGD gene [Pre Graduate thesis] 2011

[44] E Di Pierro V Brancaleoni F Stanzial F Benedicenti CCastellan and M D Cappellini ldquoNovel human pathologicalmutations Gene symbol HMBS Disease porphyria acuteintermittentrdquo Human Genetics vol 126 no 2 p 339 2009

[45] P D Brownlie R Lambert G V Louie et al ldquoThe three-dimensional structures of mutants of porphobilinogen deam-inase toward an understanding of the structural basis of acuteintermittent porphyriardquo Protein Science vol 3 no 10 pp 1644ndash1650 1994

[46] G Song Y Li C Cheng et al ldquoStructural insight into acuteintermittent porphyriardquo The FASEB Journal vol 23 no 2 pp396ndash404 2009

[47] R Gill S E Kolstoe F Mohammed et al ldquoStructure of humanporphobilinogen deaminase at 28 A the molecular basis ofacute intermittent porphyriardquo Biochemical Journal vol 420 no1 pp 17ndash25 2009

BioMed Research International 5

GAAGGACCTGCCCATCCTTGAAGGACCTGCCCACTGTGCTTCCTCCTGGCT

(a)

GAAGGACCTGCCCACTGTGCTTCCTCCTGGCTTCACCATCGGAGCCATCTGCAAG

CCCACTGTGCTTCCTCCTGGCTTCACCATCGGAGCCAT

TTGAAGGACCTGCCCACTGTGCTTCCTCCTGGCTTCTGCATCCGAGCCATCAGCCATTTACAATCTTGAAAC

Control sequence

Mutated sequence

(b)

Figure 2 Electropherograms showing (a) control sequence (b) c301 307dupCCCACTG mutation the duplicated sequence is underlined

M P C

5kb

300pb

(a)

del Gdel Gdel Cdel Gdel del C

del Gdel Gdel Cdel Gdel Cdel C

G GA GT CG TC CC T

del Gdel Gdel Cdel Tdel Cdel T

G GG GC CG TC CC T

T GA GT CG T C C T

1 2 3

4 5

6

g3119TgtGg3581AgtGg3982TgtCg6479TgtGg7064CgtAg7539CgtT

(b)

CCCC

A T GAGGAGGCAAGGCAGTCATCAAGGCCCCAAGGTGAGGCAAATCCCTGGAAGGCTTGAACCCTGCAGTTCAGTCTCCCGGGGTAATCACTCCCCAGATAGCAGTGAGAGTGGGGAAATA

Shared regionEx15 NC-g8310

CTCCAAGG

10 20 30 40 50 60 70 80 90 100 110 120

130 140 150GCTGGTCCCTACGAAGAAATTAA

g3077ndashg3055

(c)

Ex10Ex1 Ex7 Ex9 Ex12Ex6 Ex8 Ex11Ex2 Ex3 Ex4 Ex5

Ex1 Ex2 NCEx15

Ex14 Ex15Ex13 NCEx15

(d)

Figure 3 Gross deletion of 5228 bp (a) PCR product of patient (P) control individual (C) M 1 kb marker (b) family SNPs analysis (c)electropherogram of the 300 bp band showing the shared region between intron 2 and noncodifying exon 15 (d) scheme showing the deletedregion

6 BioMed Research International

diagnosed as AIP 15 years ago carrying one reported muta-tion c772-1GgtA a splice site mutation which leads to exon13 skipping [39] When three of her daughters came fordiagnosis it was found that one of them asymptomatic butwith aHMBS activity reduced to 50of control value did notcarry the family mutation A reexamination of mother DNAconfirmed only the previous mutation but a more extensivestudy of her daughters indicated that two of them carry twomutations the maternal mutation and another previouslydescribed missense mutation pR321H [22] inherited fromtheir father The asymptomatic daughter carries this lastgenetic change It is interesting to note that these patientsdeveloped the symptomatology recently (23 and 26 yearsold) and only one of them occasionally suffered from someabdominal pain In most of homozygous or double heterozy-gous AIP reported cases the enzyme activity was severelyreduced and the symptomatology was developed at an earlyage with severe neurological manifestations [13 15 16 18ndash21]In several of these cases essential arginine residues for enzymeactivity are affected [45ndash47] In these new cases themutationsfound do not seem to be essential for enzyme expression oractivity This is likely true for the missense mutation whichaffects a nonconserved arginine residue in exon 15 locatedin the 29-residue insert between strands 1205733 and 1205722 in thedomain 3 only present in the human enzyme sequence [47]However the splice site mutation leads to exon 13 skipping[39] an exon where the residue Cys261 is located to whichthe essential DPM (dipyrromethane) cofactor is bound [47]Nevertheless this combined heterozygous genotype does notseem to have amore serious impact onHMBS activity than inthe heterozygous form since the activity of the three sistersis approximately the same These results highlighted theimportance of carrying out a complete genotype investigationof family members of a known carrier

Finally 38 new families carrying the frequent pG111Rmutation have been characterized leading to 59 (5566)the number of Argentinean families carrying this geneticchange The other mutations were found in one or in afew families Efforts were made to know if the AIP patientsshowing this mutation have a common ancestral originDetailed pedigrees were unavailable because either relativesof many of the patients were dead or the relatives themselveshad limited knowledge of their families ancestry Since thepG111R mutation occurs at a hot spot CpG dinucleotide itcan be possible that the mutation had been originated severaltimes independently However a preliminary analysis of fourintragenic and four flanking DNA polymorphic markersindicated that all tested patients with pG111Rmutation (721)had at least one common allele for all intragenic and flankingmarkers Argentinean AIP patients with other mutationshad different alleles for the markers [28] These previousresults had suggested that individuals carrying this mutationwere most likely related Extended haplotype analysis on alarge group of families with the pG111R mutation and theirrelatives add further evidence to our previous hypothesisabout a founder effect for this mutation in the Argentineanpopulation [43] Microsatellite studies in these families arebeing carried out

5 Conclusions

This study emphasizes the molecular heterogeneity of AIPand the importance of molecular techniques as the mostappropriate tools for detecting and identifying specific muta-tions in carriers of affected families to avoid the contact withprecipitating agents

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

Gabriela Nora Cerbino is a postgraduate student from theUniversity of Buenos Aires Alcira Batlle Marıa VictoriaRossetti Victoria Estela Parera and Esther Noemı Gerezare Superior Independent and Associated Researchers fromCONICET Viviana Alicia Melito and Laura Sabina Varelaare Principal and Associated Members at the TechnicalCareer from CONICET The authors would like to thankH Muramatsu MD Dr MN Guolo Lic LM Oliveri andMrs VI Castillo for their technical assistance This work wassupported by Grants X253 (2004ndash2007) X304 (2004ndash2007)EX195 (2008ndash2010) EX165 (2008ndash2010) and W542 (2011ndash2014) from UBA PICT 0268 (2009ndash2012) from ANPCYTand PIP 049 (2012ndash2014) from CONICET

References

[1] A M C Batlle ldquoPorfirias y Porfirinas Aspectos clınicosbioquımicos y biologıa molecularrdquo Acta Bioquımica ClınicaLatinoamericana Serie Actualizaciones Medico-Bioquımicassupplement 3 pp 145ndash171 1997

[2] A Pietrangelo ldquoTheporphyrias pathophysiologyrdquo Internal andEmergency Medicine supplement 1 pp S65ndashS71 2010

[3] H Puy L Gouya and J-C Deybach ldquoPorphyriasrdquoThe Lancetvol 375 no 9718 pp 924ndash937 2010

[4] K E Anderson S Sassa D F Bishop and R J Desnick ldquoDis-orders of heme biosynthesis X-linked sideroblasticanemia andthe porphyriasrdquo in The Metabolic and Molecular Basis ofInherited Disease C R Scriver A L Beaudet D Valle and WS Sly Eds vol 2 pp 2991ndash3062 McGraw-Hill New York NYUSA 2001

[5] R Kauppinen ldquoPorphyriasrdquo The Lancet vol 365 no 9455 pp241ndash252 2005

[6] R J Desnick M Balwani and K E Anderson ldquoInheritedPorphyriasrdquo in Emery and Rimoinrsquos Principles and Practice ofMedical Genetics D L Rimoin R E Pyeritz and B Korf Edschapter 99 pp 1ndash32 Elsevier SanDiego Calif USA 6th edition2013

[7] V E Parera A de Siervi L Varela M V Rossetti and A MD C Batlle ldquoAcute porphyrias in the Argentinean populationa reviewrdquoCellular andMolecular Biology vol 49 no 4 pp 493ndash500 2003

[8] C Picat M H Delfau F W M de Rooij et al ldquoIdentificationof the mutations in the parents of a patient with a putativecompound heterozygosity for acute intermittent porphyriardquo

BioMed Research International 7

Journal of Inherited Metabolic Disease vol 13 no 5 pp 684ndash686 1990

[9] G J J Beukeveld B G Wolthers Y Nordmann J C DeybachB Grandchamp and S K Wadman ldquoA retrospective study of apatient with homozygous formof acute intermittent porphyriardquoJournal of InheritedMetabolic Disease vol 13 no 5 pp 673ndash6831990

[10] D H Llewellyn S J Smyth G H Elder A C Hutchesson J MRattenbury and M F Smith ldquoHomozygous acute intermittentporphyria compound heterozygosity for adjacent base tran-sitions in the same codon of the porphobilinogen deaminasegenerdquo Human Genetics vol 89 no 1 pp 97ndash98 1992

[11] R J Hift P N Meissner G Todd et al ldquoHomozygous variegateporphyria an evolving clinical syndromerdquo Postgraduate Medi-cal Journal vol 69 no 816 pp 781ndash786 1993

[12] A Edixhoven-Bosdijk F W de Rooij E de Baar-Heesakkersand J H Wilson ldquoResidual activity of human porphobilinogendeaminase with R167Q or R167W mutations an explanationfor survival of homozygous and compound heterozygous acuteintermittent porphyricsrdquo Cellular and Molecular Biology vol48 no 8 pp 861ndash866 2002

[13] C Solis A Martinez-Bermejo T P Naidich et al ldquoAcute inter-mittent porphyria studies of the severe homozygous dominantdisease provides insights into the neurologic attacks in acuteporphyriasrdquoArchives of Neurology vol 61 no 11 pp 1764ndash17702004

[14] J Hessels G Voortman A van der Wagen C van derElzen H Scheffer and F M J Zuijderhoudt ldquoHomozygousacute intermittent porphyria in a 7-years-old boy with massiveexcretions of porphyrins and porphyrin precursorsrdquo Journal ofInherited Metabolic Disease vol 27 no 1 pp 19ndash27 2004

[15] L Sheppard and T Dorman ldquoAnesthesia in a child withhomozygous porphobilinogen deaminase deficiency a severeform of acute intermittent porphyriardquo Paediatric Anaesthesiavol 15 no 5 pp 426ndash428 2005

[16] E McGovern P Fleming and A OrsquoMarcaigh ldquoThe dentalmanagement of five paediatric patients with a history ofacute intermittent porphyriardquo European Archives of PaediatricDentistry vol 8 no 4 pp 215ndash218 2007

[17] V AMelitoM V Rossetti V E Parera and A Batlle ldquoPorfiriaspoco frecuentes Casos detectados en la poblacion argentinardquoRevista Argentina de Dermatologıa vol 87 pp 248ndash263 2006

[18] A Dibi H Aitouamar and A Bentahila ldquoRecurrent flaccidparalysis indicative of acute intermittent porphyria in a childrdquoArchives de Pediatrie vol 17 no 12 pp 1670ndash1672 2010

[19] J I Bhat U A Qureeshi and M A Bhat ldquoAcute intermittentporphyria with transient cortical blindnessrdquo Indian Pediatricsvol 47 no 11 pp 977ndash978 2010

[20] E Anyaegbu M Goodman S-Y Ahn M Thangarajh MWong and M Shinawi ldquoAcute intermittent porphyria a diag-nostic challengerdquo Journal of Child Neurology vol 27 no 7 pp917ndash921 2012

[21] B Zhao Q Wei Y Wang Y Chen and H Shang ldquoPosteriorreversible encephalopathy syndrome in acute intermittent por-phyriardquo Pediatric Neurology vol 51 no 3 pp 457ndash460 2014

[22] M M Schuurmans X Schneider-Yin U B Rufenacht et alldquoInfluence of age and gender on the clinical expression ofacute intermittent porphyria based on molecular study of por-phobilinogen deaminase gene among Swiss patientrdquoMolecularMedicine vol 7 no 8 pp 535ndash542 2001

[23] J-S Lee and M Anvret ldquoIdentification of the most com-mon mutation within the porphobilinogen deaminase gene in

Swedish patients with acute intermittent porphyriardquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 88 no 23 pp 10912ndash10915 1991

[24] X-F Gu F de Rooij J S Lee et al ldquoHigh prevalence of a pointmutation in the porphobilinogen deaminase gene in Dutchpatients with acute intermittent porphyriardquo Human Geneticsvol 91 no 2 pp 128ndash130 1993

[25] X Schneider-Yin M Hergersberg D E Goldgar et alldquoAncestral founder of mutationW283X in the porphobilinogendeaminase gene among acute intermittent porphyria patientsrdquoHuman Heredity vol 54 no 2 pp 69ndash81 2002

[26] R Kauppinen S Mustajoki H Pihlaja L Peltonen and PMus-tajoki ldquoAcute intermittent porphyria in Finland 19 mutationsin the porphobilinogen deaminase generdquo Human MolecularGenetics vol 4 no 2 pp 215ndash222 1995

[27] G Lundin J Hashemi Y Floderus et al ldquoFour mutations inthe porphobilinogen deaminase gene in patients with acuteintermittent porphyriardquo Journal of Medical Genetics vol 32 no12 pp 979ndash981 1995

[28] A de SierviM V Rossetti V E Parera et al ldquoIdentification andcharacterization of hydroxymethylbilane synthase mutationscausing acute intermittent porphyria evidence for an ancestralfounder of the common G111R mutationrdquo American Journal ofMedical Genetics vol 86 no 4 pp 366ndash375 1999

[29] A de Siervi D E W Cadiz V E Parera A M D C Batlle andM V Rossetti ldquoIdentification and characterization of two novelmutations that produce acute intermittent porphyria a 3-basedeletion (841-843delGGA) and a missense mutation (T35M)rdquoHuman Mutation vol 16 no 4 p 373 2000

[30] A Gregor X Schneider-Yin U Szlendak et al ldquoMolecu-lar study of the hydroxymethylbilane synthase gene (HMBS)among Polish patients with acute intermittent porphyriardquoHuman Mutation vol 19 no 3 p 310 2002

[31] Y A Luchinina V L Surin A V Lukrsquoyanenko I V KarpovaY S Pustovoit and S K Kravchenko ldquoMolecular diagnosticsof acute intermittent porphyria in Russiardquo European Journal ofHumanGenetics vol 13 supplement 1 p 134 2005 Proceedingsof the European Society of Human Genetics InternationalConference

[32] X-F Gu F de Rooij E de Baar et al ldquoTwo novel mutationsof the porphobilinogen deaminase gene in acute intermittentporphyriardquo Human Molecular Genetics vol 2 no 10 pp 1735ndash1736 1993

[33] M D Cappellini F M di Montemuros E di Pierro and GFiorelli ldquoHematologically important mutations acute intermit-tent porphyriardquo Blood Cells Molecules and Diseases vol 28 no1 pp 5ndash12 2002

[34] A de SierviMMendez V E Parera L Varela AM Batlle andM V Rossetti ldquoAcute intermittent porphyria characterizationof two novelmutations in the porphobilinogen deaminase geneone amino acid deletion (453-455delAGC) and one splicingaceptor site mutation (IVS8-1GgtT)rdquo Human Mutation vol 14no 4 article 355 1999

[35] M H Delfau C Picat F de Rooij et al ldquoMolecular hetero-geneity of acute intermittent porphyria identification of fouradditional mutations resulting in the CRIM-negative subtypeof the diseaserdquo The American Journal of Human Genetics vol49 no 2 pp 421ndash428 1991

[36] M H Delfau C Picat F W M de Rooij et al ldquoTwo differentpointG toAmutations in exon 10 of the porphobilinogendeam-inase gene are responsible for acute intermittent porphyriardquoTheJournal of Clinical Investigation vol 86 no 5 pp 1511ndash1516 1990

8 BioMed Research International

[37] C S Mgone W G Lanyon M R Moore G V Louie andJ M Connor ldquoIdentification of five novel mutations in theporphobilinogen deaminase generdquo Human Molecular Geneticsvol 3 no 5 pp 809ndash811 1994

[38] C-H Chen K H Astrin G Lee K E Anderson and RJ Desnick ldquoAcute intermittent porphyria identification andexpression of exonic mutations in the hydroxymethylbilanesynthase gene An initiation codon missense mutation inthe housekeeping transcript causes ldquovariant acute intermittentporphyriardquo with normal expression of the erythroid-specificenzymerdquoThe Journal of Clinical Investigation vol 94 no 5 pp1927ndash1937 1994

[39] H Puy J CDeybach J Lamoril et al ldquoMolecular epidemiologyand diagnosis of PBG deaminase gene defects in acute intermit-tent porphyriardquo The American Journal of Human Genetics vol60 no 6 pp 1373ndash1383 1997

[40] Y Floderus P M Shoolingin-Jordan and P Harper ldquoAcuteintermittent porphyria in Sweden Molecular functional andclinical consequences of some new mutations found in theporphobilinogen deaminase generdquoClinical Genetics vol 62 no4 pp 288ndash297 2002

[41] H Puy J C Deybach J Lamoril A M Robreau and YNordmann ldquoDetection of four novel mutations in the porpho-bilinogen deaminase gene in French Caucasian patients withacute intermittent porphyriardquo Human Heredity vol 46 no 3pp 177ndash180 1996

[42] L E Maquat ldquoNonsense-mediated mRNA decay splicingtranslation and mRNP dynamicsrdquo Nature Reviews MolecularCell Biology vol 5 no 2 pp 89ndash99 2004

[43] G N CerbinoHigh prevalence of pG111R mutation in Argentinepatients with acute intermittent Porphyria Newmutations foundin PBGD gene [Pre Graduate thesis] 2011

[44] E Di Pierro V Brancaleoni F Stanzial F Benedicenti CCastellan and M D Cappellini ldquoNovel human pathologicalmutations Gene symbol HMBS Disease porphyria acuteintermittentrdquo Human Genetics vol 126 no 2 p 339 2009

[45] P D Brownlie R Lambert G V Louie et al ldquoThe three-dimensional structures of mutants of porphobilinogen deam-inase toward an understanding of the structural basis of acuteintermittent porphyriardquo Protein Science vol 3 no 10 pp 1644ndash1650 1994

[46] G Song Y Li C Cheng et al ldquoStructural insight into acuteintermittent porphyriardquo The FASEB Journal vol 23 no 2 pp396ndash404 2009

[47] R Gill S E Kolstoe F Mohammed et al ldquoStructure of humanporphobilinogen deaminase at 28 A the molecular basis ofacute intermittent porphyriardquo Biochemical Journal vol 420 no1 pp 17ndash25 2009

6 BioMed Research International

diagnosed as AIP 15 years ago carrying one reported muta-tion c772-1GgtA a splice site mutation which leads to exon13 skipping [39] When three of her daughters came fordiagnosis it was found that one of them asymptomatic butwith aHMBS activity reduced to 50of control value did notcarry the family mutation A reexamination of mother DNAconfirmed only the previous mutation but a more extensivestudy of her daughters indicated that two of them carry twomutations the maternal mutation and another previouslydescribed missense mutation pR321H [22] inherited fromtheir father The asymptomatic daughter carries this lastgenetic change It is interesting to note that these patientsdeveloped the symptomatology recently (23 and 26 yearsold) and only one of them occasionally suffered from someabdominal pain In most of homozygous or double heterozy-gous AIP reported cases the enzyme activity was severelyreduced and the symptomatology was developed at an earlyage with severe neurological manifestations [13 15 16 18ndash21]In several of these cases essential arginine residues for enzymeactivity are affected [45ndash47] In these new cases themutationsfound do not seem to be essential for enzyme expression oractivity This is likely true for the missense mutation whichaffects a nonconserved arginine residue in exon 15 locatedin the 29-residue insert between strands 1205733 and 1205722 in thedomain 3 only present in the human enzyme sequence [47]However the splice site mutation leads to exon 13 skipping[39] an exon where the residue Cys261 is located to whichthe essential DPM (dipyrromethane) cofactor is bound [47]Nevertheless this combined heterozygous genotype does notseem to have amore serious impact onHMBS activity than inthe heterozygous form since the activity of the three sistersis approximately the same These results highlighted theimportance of carrying out a complete genotype investigationof family members of a known carrier

Finally 38 new families carrying the frequent pG111Rmutation have been characterized leading to 59 (5566)the number of Argentinean families carrying this geneticchange The other mutations were found in one or in afew families Efforts were made to know if the AIP patientsshowing this mutation have a common ancestral originDetailed pedigrees were unavailable because either relativesof many of the patients were dead or the relatives themselveshad limited knowledge of their families ancestry Since thepG111R mutation occurs at a hot spot CpG dinucleotide itcan be possible that the mutation had been originated severaltimes independently However a preliminary analysis of fourintragenic and four flanking DNA polymorphic markersindicated that all tested patients with pG111Rmutation (721)had at least one common allele for all intragenic and flankingmarkers Argentinean AIP patients with other mutationshad different alleles for the markers [28] These previousresults had suggested that individuals carrying this mutationwere most likely related Extended haplotype analysis on alarge group of families with the pG111R mutation and theirrelatives add further evidence to our previous hypothesisabout a founder effect for this mutation in the Argentineanpopulation [43] Microsatellite studies in these families arebeing carried out

5 Conclusions

This study emphasizes the molecular heterogeneity of AIPand the importance of molecular techniques as the mostappropriate tools for detecting and identifying specific muta-tions in carriers of affected families to avoid the contact withprecipitating agents

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

Gabriela Nora Cerbino is a postgraduate student from theUniversity of Buenos Aires Alcira Batlle Marıa VictoriaRossetti Victoria Estela Parera and Esther Noemı Gerezare Superior Independent and Associated Researchers fromCONICET Viviana Alicia Melito and Laura Sabina Varelaare Principal and Associated Members at the TechnicalCareer from CONICET The authors would like to thankH Muramatsu MD Dr MN Guolo Lic LM Oliveri andMrs VI Castillo for their technical assistance This work wassupported by Grants X253 (2004ndash2007) X304 (2004ndash2007)EX195 (2008ndash2010) EX165 (2008ndash2010) and W542 (2011ndash2014) from UBA PICT 0268 (2009ndash2012) from ANPCYTand PIP 049 (2012ndash2014) from CONICET

References

[1] A M C Batlle ldquoPorfirias y Porfirinas Aspectos clınicosbioquımicos y biologıa molecularrdquo Acta Bioquımica ClınicaLatinoamericana Serie Actualizaciones Medico-Bioquımicassupplement 3 pp 145ndash171 1997

[2] A Pietrangelo ldquoTheporphyrias pathophysiologyrdquo Internal andEmergency Medicine supplement 1 pp S65ndashS71 2010

[3] H Puy L Gouya and J-C Deybach ldquoPorphyriasrdquoThe Lancetvol 375 no 9718 pp 924ndash937 2010

[4] K E Anderson S Sassa D F Bishop and R J Desnick ldquoDis-orders of heme biosynthesis X-linked sideroblasticanemia andthe porphyriasrdquo in The Metabolic and Molecular Basis ofInherited Disease C R Scriver A L Beaudet D Valle and WS Sly Eds vol 2 pp 2991ndash3062 McGraw-Hill New York NYUSA 2001

[5] R Kauppinen ldquoPorphyriasrdquo The Lancet vol 365 no 9455 pp241ndash252 2005

[6] R J Desnick M Balwani and K E Anderson ldquoInheritedPorphyriasrdquo in Emery and Rimoinrsquos Principles and Practice ofMedical Genetics D L Rimoin R E Pyeritz and B Korf Edschapter 99 pp 1ndash32 Elsevier SanDiego Calif USA 6th edition2013

[7] V E Parera A de Siervi L Varela M V Rossetti and A MD C Batlle ldquoAcute porphyrias in the Argentinean populationa reviewrdquoCellular andMolecular Biology vol 49 no 4 pp 493ndash500 2003

[8] C Picat M H Delfau F W M de Rooij et al ldquoIdentificationof the mutations in the parents of a patient with a putativecompound heterozygosity for acute intermittent porphyriardquo

BioMed Research International 7

Journal of Inherited Metabolic Disease vol 13 no 5 pp 684ndash686 1990

[9] G J J Beukeveld B G Wolthers Y Nordmann J C DeybachB Grandchamp and S K Wadman ldquoA retrospective study of apatient with homozygous formof acute intermittent porphyriardquoJournal of InheritedMetabolic Disease vol 13 no 5 pp 673ndash6831990

[10] D H Llewellyn S J Smyth G H Elder A C Hutchesson J MRattenbury and M F Smith ldquoHomozygous acute intermittentporphyria compound heterozygosity for adjacent base tran-sitions in the same codon of the porphobilinogen deaminasegenerdquo Human Genetics vol 89 no 1 pp 97ndash98 1992

[11] R J Hift P N Meissner G Todd et al ldquoHomozygous variegateporphyria an evolving clinical syndromerdquo Postgraduate Medi-cal Journal vol 69 no 816 pp 781ndash786 1993

[12] A Edixhoven-Bosdijk F W de Rooij E de Baar-Heesakkersand J H Wilson ldquoResidual activity of human porphobilinogendeaminase with R167Q or R167W mutations an explanationfor survival of homozygous and compound heterozygous acuteintermittent porphyricsrdquo Cellular and Molecular Biology vol48 no 8 pp 861ndash866 2002

[13] C Solis A Martinez-Bermejo T P Naidich et al ldquoAcute inter-mittent porphyria studies of the severe homozygous dominantdisease provides insights into the neurologic attacks in acuteporphyriasrdquoArchives of Neurology vol 61 no 11 pp 1764ndash17702004

[14] J Hessels G Voortman A van der Wagen C van derElzen H Scheffer and F M J Zuijderhoudt ldquoHomozygousacute intermittent porphyria in a 7-years-old boy with massiveexcretions of porphyrins and porphyrin precursorsrdquo Journal ofInherited Metabolic Disease vol 27 no 1 pp 19ndash27 2004

[15] L Sheppard and T Dorman ldquoAnesthesia in a child withhomozygous porphobilinogen deaminase deficiency a severeform of acute intermittent porphyriardquo Paediatric Anaesthesiavol 15 no 5 pp 426ndash428 2005

[16] E McGovern P Fleming and A OrsquoMarcaigh ldquoThe dentalmanagement of five paediatric patients with a history ofacute intermittent porphyriardquo European Archives of PaediatricDentistry vol 8 no 4 pp 215ndash218 2007

[17] V AMelitoM V Rossetti V E Parera and A Batlle ldquoPorfiriaspoco frecuentes Casos detectados en la poblacion argentinardquoRevista Argentina de Dermatologıa vol 87 pp 248ndash263 2006

[18] A Dibi H Aitouamar and A Bentahila ldquoRecurrent flaccidparalysis indicative of acute intermittent porphyria in a childrdquoArchives de Pediatrie vol 17 no 12 pp 1670ndash1672 2010

[19] J I Bhat U A Qureeshi and M A Bhat ldquoAcute intermittentporphyria with transient cortical blindnessrdquo Indian Pediatricsvol 47 no 11 pp 977ndash978 2010

[20] E Anyaegbu M Goodman S-Y Ahn M Thangarajh MWong and M Shinawi ldquoAcute intermittent porphyria a diag-nostic challengerdquo Journal of Child Neurology vol 27 no 7 pp917ndash921 2012

[21] B Zhao Q Wei Y Wang Y Chen and H Shang ldquoPosteriorreversible encephalopathy syndrome in acute intermittent por-phyriardquo Pediatric Neurology vol 51 no 3 pp 457ndash460 2014

[22] M M Schuurmans X Schneider-Yin U B Rufenacht et alldquoInfluence of age and gender on the clinical expression ofacute intermittent porphyria based on molecular study of por-phobilinogen deaminase gene among Swiss patientrdquoMolecularMedicine vol 7 no 8 pp 535ndash542 2001

[23] J-S Lee and M Anvret ldquoIdentification of the most com-mon mutation within the porphobilinogen deaminase gene in

Swedish patients with acute intermittent porphyriardquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 88 no 23 pp 10912ndash10915 1991

[24] X-F Gu F de Rooij J S Lee et al ldquoHigh prevalence of a pointmutation in the porphobilinogen deaminase gene in Dutchpatients with acute intermittent porphyriardquo Human Geneticsvol 91 no 2 pp 128ndash130 1993

[25] X Schneider-Yin M Hergersberg D E Goldgar et alldquoAncestral founder of mutationW283X in the porphobilinogendeaminase gene among acute intermittent porphyria patientsrdquoHuman Heredity vol 54 no 2 pp 69ndash81 2002

[26] R Kauppinen S Mustajoki H Pihlaja L Peltonen and PMus-tajoki ldquoAcute intermittent porphyria in Finland 19 mutationsin the porphobilinogen deaminase generdquo Human MolecularGenetics vol 4 no 2 pp 215ndash222 1995

[27] G Lundin J Hashemi Y Floderus et al ldquoFour mutations inthe porphobilinogen deaminase gene in patients with acuteintermittent porphyriardquo Journal of Medical Genetics vol 32 no12 pp 979ndash981 1995

[28] A de SierviM V Rossetti V E Parera et al ldquoIdentification andcharacterization of hydroxymethylbilane synthase mutationscausing acute intermittent porphyria evidence for an ancestralfounder of the common G111R mutationrdquo American Journal ofMedical Genetics vol 86 no 4 pp 366ndash375 1999

[29] A de Siervi D E W Cadiz V E Parera A M D C Batlle andM V Rossetti ldquoIdentification and characterization of two novelmutations that produce acute intermittent porphyria a 3-basedeletion (841-843delGGA) and a missense mutation (T35M)rdquoHuman Mutation vol 16 no 4 p 373 2000

[30] A Gregor X Schneider-Yin U Szlendak et al ldquoMolecu-lar study of the hydroxymethylbilane synthase gene (HMBS)among Polish patients with acute intermittent porphyriardquoHuman Mutation vol 19 no 3 p 310 2002

[31] Y A Luchinina V L Surin A V Lukrsquoyanenko I V KarpovaY S Pustovoit and S K Kravchenko ldquoMolecular diagnosticsof acute intermittent porphyria in Russiardquo European Journal ofHumanGenetics vol 13 supplement 1 p 134 2005 Proceedingsof the European Society of Human Genetics InternationalConference

[32] X-F Gu F de Rooij E de Baar et al ldquoTwo novel mutationsof the porphobilinogen deaminase gene in acute intermittentporphyriardquo Human Molecular Genetics vol 2 no 10 pp 1735ndash1736 1993

[33] M D Cappellini F M di Montemuros E di Pierro and GFiorelli ldquoHematologically important mutations acute intermit-tent porphyriardquo Blood Cells Molecules and Diseases vol 28 no1 pp 5ndash12 2002

[34] A de SierviMMendez V E Parera L Varela AM Batlle andM V Rossetti ldquoAcute intermittent porphyria characterizationof two novelmutations in the porphobilinogen deaminase geneone amino acid deletion (453-455delAGC) and one splicingaceptor site mutation (IVS8-1GgtT)rdquo Human Mutation vol 14no 4 article 355 1999

[35] M H Delfau C Picat F de Rooij et al ldquoMolecular hetero-geneity of acute intermittent porphyria identification of fouradditional mutations resulting in the CRIM-negative subtypeof the diseaserdquo The American Journal of Human Genetics vol49 no 2 pp 421ndash428 1991

[36] M H Delfau C Picat F W M de Rooij et al ldquoTwo differentpointG toAmutations in exon 10 of the porphobilinogendeam-inase gene are responsible for acute intermittent porphyriardquoTheJournal of Clinical Investigation vol 86 no 5 pp 1511ndash1516 1990

8 BioMed Research International

[37] C S Mgone W G Lanyon M R Moore G V Louie andJ M Connor ldquoIdentification of five novel mutations in theporphobilinogen deaminase generdquo Human Molecular Geneticsvol 3 no 5 pp 809ndash811 1994

[38] C-H Chen K H Astrin G Lee K E Anderson and RJ Desnick ldquoAcute intermittent porphyria identification andexpression of exonic mutations in the hydroxymethylbilanesynthase gene An initiation codon missense mutation inthe housekeeping transcript causes ldquovariant acute intermittentporphyriardquo with normal expression of the erythroid-specificenzymerdquoThe Journal of Clinical Investigation vol 94 no 5 pp1927ndash1937 1994

[39] H Puy J CDeybach J Lamoril et al ldquoMolecular epidemiologyand diagnosis of PBG deaminase gene defects in acute intermit-tent porphyriardquo The American Journal of Human Genetics vol60 no 6 pp 1373ndash1383 1997

[40] Y Floderus P M Shoolingin-Jordan and P Harper ldquoAcuteintermittent porphyria in Sweden Molecular functional andclinical consequences of some new mutations found in theporphobilinogen deaminase generdquoClinical Genetics vol 62 no4 pp 288ndash297 2002

[41] H Puy J C Deybach J Lamoril A M Robreau and YNordmann ldquoDetection of four novel mutations in the porpho-bilinogen deaminase gene in French Caucasian patients withacute intermittent porphyriardquo Human Heredity vol 46 no 3pp 177ndash180 1996

[42] L E Maquat ldquoNonsense-mediated mRNA decay splicingtranslation and mRNP dynamicsrdquo Nature Reviews MolecularCell Biology vol 5 no 2 pp 89ndash99 2004

[43] G N CerbinoHigh prevalence of pG111R mutation in Argentinepatients with acute intermittent Porphyria Newmutations foundin PBGD gene [Pre Graduate thesis] 2011

[44] E Di Pierro V Brancaleoni F Stanzial F Benedicenti CCastellan and M D Cappellini ldquoNovel human pathologicalmutations Gene symbol HMBS Disease porphyria acuteintermittentrdquo Human Genetics vol 126 no 2 p 339 2009

[45] P D Brownlie R Lambert G V Louie et al ldquoThe three-dimensional structures of mutants of porphobilinogen deam-inase toward an understanding of the structural basis of acuteintermittent porphyriardquo Protein Science vol 3 no 10 pp 1644ndash1650 1994

[46] G Song Y Li C Cheng et al ldquoStructural insight into acuteintermittent porphyriardquo The FASEB Journal vol 23 no 2 pp396ndash404 2009

[47] R Gill S E Kolstoe F Mohammed et al ldquoStructure of humanporphobilinogen deaminase at 28 A the molecular basis ofacute intermittent porphyriardquo Biochemical Journal vol 420 no1 pp 17ndash25 2009

BioMed Research International 7

Journal of Inherited Metabolic Disease vol 13 no 5 pp 684ndash686 1990

[9] G J J Beukeveld B G Wolthers Y Nordmann J C DeybachB Grandchamp and S K Wadman ldquoA retrospective study of apatient with homozygous formof acute intermittent porphyriardquoJournal of InheritedMetabolic Disease vol 13 no 5 pp 673ndash6831990

[10] D H Llewellyn S J Smyth G H Elder A C Hutchesson J MRattenbury and M F Smith ldquoHomozygous acute intermittentporphyria compound heterozygosity for adjacent base tran-sitions in the same codon of the porphobilinogen deaminasegenerdquo Human Genetics vol 89 no 1 pp 97ndash98 1992

[11] R J Hift P N Meissner G Todd et al ldquoHomozygous variegateporphyria an evolving clinical syndromerdquo Postgraduate Medi-cal Journal vol 69 no 816 pp 781ndash786 1993

[12] A Edixhoven-Bosdijk F W de Rooij E de Baar-Heesakkersand J H Wilson ldquoResidual activity of human porphobilinogendeaminase with R167Q or R167W mutations an explanationfor survival of homozygous and compound heterozygous acuteintermittent porphyricsrdquo Cellular and Molecular Biology vol48 no 8 pp 861ndash866 2002

[13] C Solis A Martinez-Bermejo T P Naidich et al ldquoAcute inter-mittent porphyria studies of the severe homozygous dominantdisease provides insights into the neurologic attacks in acuteporphyriasrdquoArchives of Neurology vol 61 no 11 pp 1764ndash17702004

[14] J Hessels G Voortman A van der Wagen C van derElzen H Scheffer and F M J Zuijderhoudt ldquoHomozygousacute intermittent porphyria in a 7-years-old boy with massiveexcretions of porphyrins and porphyrin precursorsrdquo Journal ofInherited Metabolic Disease vol 27 no 1 pp 19ndash27 2004

[15] L Sheppard and T Dorman ldquoAnesthesia in a child withhomozygous porphobilinogen deaminase deficiency a severeform of acute intermittent porphyriardquo Paediatric Anaesthesiavol 15 no 5 pp 426ndash428 2005

[16] E McGovern P Fleming and A OrsquoMarcaigh ldquoThe dentalmanagement of five paediatric patients with a history ofacute intermittent porphyriardquo European Archives of PaediatricDentistry vol 8 no 4 pp 215ndash218 2007

[17] V AMelitoM V Rossetti V E Parera and A Batlle ldquoPorfiriaspoco frecuentes Casos detectados en la poblacion argentinardquoRevista Argentina de Dermatologıa vol 87 pp 248ndash263 2006

[18] A Dibi H Aitouamar and A Bentahila ldquoRecurrent flaccidparalysis indicative of acute intermittent porphyria in a childrdquoArchives de Pediatrie vol 17 no 12 pp 1670ndash1672 2010

[19] J I Bhat U A Qureeshi and M A Bhat ldquoAcute intermittentporphyria with transient cortical blindnessrdquo Indian Pediatricsvol 47 no 11 pp 977ndash978 2010

[20] E Anyaegbu M Goodman S-Y Ahn M Thangarajh MWong and M Shinawi ldquoAcute intermittent porphyria a diag-nostic challengerdquo Journal of Child Neurology vol 27 no 7 pp917ndash921 2012

[21] B Zhao Q Wei Y Wang Y Chen and H Shang ldquoPosteriorreversible encephalopathy syndrome in acute intermittent por-phyriardquo Pediatric Neurology vol 51 no 3 pp 457ndash460 2014

[22] M M Schuurmans X Schneider-Yin U B Rufenacht et alldquoInfluence of age and gender on the clinical expression ofacute intermittent porphyria based on molecular study of por-phobilinogen deaminase gene among Swiss patientrdquoMolecularMedicine vol 7 no 8 pp 535ndash542 2001

[23] J-S Lee and M Anvret ldquoIdentification of the most com-mon mutation within the porphobilinogen deaminase gene in

Swedish patients with acute intermittent porphyriardquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 88 no 23 pp 10912ndash10915 1991

[24] X-F Gu F de Rooij J S Lee et al ldquoHigh prevalence of a pointmutation in the porphobilinogen deaminase gene in Dutchpatients with acute intermittent porphyriardquo Human Geneticsvol 91 no 2 pp 128ndash130 1993

[25] X Schneider-Yin M Hergersberg D E Goldgar et alldquoAncestral founder of mutationW283X in the porphobilinogendeaminase gene among acute intermittent porphyria patientsrdquoHuman Heredity vol 54 no 2 pp 69ndash81 2002

[26] R Kauppinen S Mustajoki H Pihlaja L Peltonen and PMus-tajoki ldquoAcute intermittent porphyria in Finland 19 mutationsin the porphobilinogen deaminase generdquo Human MolecularGenetics vol 4 no 2 pp 215ndash222 1995

[27] G Lundin J Hashemi Y Floderus et al ldquoFour mutations inthe porphobilinogen deaminase gene in patients with acuteintermittent porphyriardquo Journal of Medical Genetics vol 32 no12 pp 979ndash981 1995

[28] A de SierviM V Rossetti V E Parera et al ldquoIdentification andcharacterization of hydroxymethylbilane synthase mutationscausing acute intermittent porphyria evidence for an ancestralfounder of the common G111R mutationrdquo American Journal ofMedical Genetics vol 86 no 4 pp 366ndash375 1999

[29] A de Siervi D E W Cadiz V E Parera A M D C Batlle andM V Rossetti ldquoIdentification and characterization of two novelmutations that produce acute intermittent porphyria a 3-basedeletion (841-843delGGA) and a missense mutation (T35M)rdquoHuman Mutation vol 16 no 4 p 373 2000

[30] A Gregor X Schneider-Yin U Szlendak et al ldquoMolecu-lar study of the hydroxymethylbilane synthase gene (HMBS)among Polish patients with acute intermittent porphyriardquoHuman Mutation vol 19 no 3 p 310 2002

[31] Y A Luchinina V L Surin A V Lukrsquoyanenko I V KarpovaY S Pustovoit and S K Kravchenko ldquoMolecular diagnosticsof acute intermittent porphyria in Russiardquo European Journal ofHumanGenetics vol 13 supplement 1 p 134 2005 Proceedingsof the European Society of Human Genetics InternationalConference

[32] X-F Gu F de Rooij E de Baar et al ldquoTwo novel mutationsof the porphobilinogen deaminase gene in acute intermittentporphyriardquo Human Molecular Genetics vol 2 no 10 pp 1735ndash1736 1993

[33] M D Cappellini F M di Montemuros E di Pierro and GFiorelli ldquoHematologically important mutations acute intermit-tent porphyriardquo Blood Cells Molecules and Diseases vol 28 no1 pp 5ndash12 2002

[34] A de SierviMMendez V E Parera L Varela AM Batlle andM V Rossetti ldquoAcute intermittent porphyria characterizationof two novelmutations in the porphobilinogen deaminase geneone amino acid deletion (453-455delAGC) and one splicingaceptor site mutation (IVS8-1GgtT)rdquo Human Mutation vol 14no 4 article 355 1999

[35] M H Delfau C Picat F de Rooij et al ldquoMolecular hetero-geneity of acute intermittent porphyria identification of fouradditional mutations resulting in the CRIM-negative subtypeof the diseaserdquo The American Journal of Human Genetics vol49 no 2 pp 421ndash428 1991

[36] M H Delfau C Picat F W M de Rooij et al ldquoTwo differentpointG toAmutations in exon 10 of the porphobilinogendeam-inase gene are responsible for acute intermittent porphyriardquoTheJournal of Clinical Investigation vol 86 no 5 pp 1511ndash1516 1990

8 BioMed Research International

[37] C S Mgone W G Lanyon M R Moore G V Louie andJ M Connor ldquoIdentification of five novel mutations in theporphobilinogen deaminase generdquo Human Molecular Geneticsvol 3 no 5 pp 809ndash811 1994

[38] C-H Chen K H Astrin G Lee K E Anderson and RJ Desnick ldquoAcute intermittent porphyria identification andexpression of exonic mutations in the hydroxymethylbilanesynthase gene An initiation codon missense mutation inthe housekeeping transcript causes ldquovariant acute intermittentporphyriardquo with normal expression of the erythroid-specificenzymerdquoThe Journal of Clinical Investigation vol 94 no 5 pp1927ndash1937 1994

[39] H Puy J CDeybach J Lamoril et al ldquoMolecular epidemiologyand diagnosis of PBG deaminase gene defects in acute intermit-tent porphyriardquo The American Journal of Human Genetics vol60 no 6 pp 1373ndash1383 1997

[40] Y Floderus P M Shoolingin-Jordan and P Harper ldquoAcuteintermittent porphyria in Sweden Molecular functional andclinical consequences of some new mutations found in theporphobilinogen deaminase generdquoClinical Genetics vol 62 no4 pp 288ndash297 2002

[41] H Puy J C Deybach J Lamoril A M Robreau and YNordmann ldquoDetection of four novel mutations in the porpho-bilinogen deaminase gene in French Caucasian patients withacute intermittent porphyriardquo Human Heredity vol 46 no 3pp 177ndash180 1996

[42] L E Maquat ldquoNonsense-mediated mRNA decay splicingtranslation and mRNP dynamicsrdquo Nature Reviews MolecularCell Biology vol 5 no 2 pp 89ndash99 2004

[43] G N CerbinoHigh prevalence of pG111R mutation in Argentinepatients with acute intermittent Porphyria Newmutations foundin PBGD gene [Pre Graduate thesis] 2011

[44] E Di Pierro V Brancaleoni F Stanzial F Benedicenti CCastellan and M D Cappellini ldquoNovel human pathologicalmutations Gene symbol HMBS Disease porphyria acuteintermittentrdquo Human Genetics vol 126 no 2 p 339 2009

[45] P D Brownlie R Lambert G V Louie et al ldquoThe three-dimensional structures of mutants of porphobilinogen deam-inase toward an understanding of the structural basis of acuteintermittent porphyriardquo Protein Science vol 3 no 10 pp 1644ndash1650 1994

[46] G Song Y Li C Cheng et al ldquoStructural insight into acuteintermittent porphyriardquo The FASEB Journal vol 23 no 2 pp396ndash404 2009

[47] R Gill S E Kolstoe F Mohammed et al ldquoStructure of humanporphobilinogen deaminase at 28 A the molecular basis ofacute intermittent porphyriardquo Biochemical Journal vol 420 no1 pp 17ndash25 2009

8 BioMed Research International

[37] C S Mgone W G Lanyon M R Moore G V Louie andJ M Connor ldquoIdentification of five novel mutations in theporphobilinogen deaminase generdquo Human Molecular Geneticsvol 3 no 5 pp 809ndash811 1994

[38] C-H Chen K H Astrin G Lee K E Anderson and RJ Desnick ldquoAcute intermittent porphyria identification andexpression of exonic mutations in the hydroxymethylbilanesynthase gene An initiation codon missense mutation inthe housekeeping transcript causes ldquovariant acute intermittentporphyriardquo with normal expression of the erythroid-specificenzymerdquoThe Journal of Clinical Investigation vol 94 no 5 pp1927ndash1937 1994

[39] H Puy J CDeybach J Lamoril et al ldquoMolecular epidemiologyand diagnosis of PBG deaminase gene defects in acute intermit-tent porphyriardquo The American Journal of Human Genetics vol60 no 6 pp 1373ndash1383 1997

[40] Y Floderus P M Shoolingin-Jordan and P Harper ldquoAcuteintermittent porphyria in Sweden Molecular functional andclinical consequences of some new mutations found in theporphobilinogen deaminase generdquoClinical Genetics vol 62 no4 pp 288ndash297 2002

[41] H Puy J C Deybach J Lamoril A M Robreau and YNordmann ldquoDetection of four novel mutations in the porpho-bilinogen deaminase gene in French Caucasian patients withacute intermittent porphyriardquo Human Heredity vol 46 no 3pp 177ndash180 1996

[42] L E Maquat ldquoNonsense-mediated mRNA decay splicingtranslation and mRNP dynamicsrdquo Nature Reviews MolecularCell Biology vol 5 no 2 pp 89ndash99 2004

[43] G N CerbinoHigh prevalence of pG111R mutation in Argentinepatients with acute intermittent Porphyria Newmutations foundin PBGD gene [Pre Graduate thesis] 2011

[44] E Di Pierro V Brancaleoni F Stanzial F Benedicenti CCastellan and M D Cappellini ldquoNovel human pathologicalmutations Gene symbol HMBS Disease porphyria acuteintermittentrdquo Human Genetics vol 126 no 2 p 339 2009

[45] P D Brownlie R Lambert G V Louie et al ldquoThe three-dimensional structures of mutants of porphobilinogen deam-inase toward an understanding of the structural basis of acuteintermittent porphyriardquo Protein Science vol 3 no 10 pp 1644ndash1650 1994

[46] G Song Y Li C Cheng et al ldquoStructural insight into acuteintermittent porphyriardquo The FASEB Journal vol 23 no 2 pp396ndash404 2009

[47] R Gill S E Kolstoe F Mohammed et al ldquoStructure of humanporphobilinogen deaminase at 28 A the molecular basis ofacute intermittent porphyriardquo Biochemical Journal vol 420 no1 pp 17ndash25 2009