Acquired Resistance ofER-Positive BreastCancer to ......Marco Piva8, Maria dM.Vivanco8, Robert B. Clarke2, Julia Gee9, and Richard Clarkson1 Abstract Purpose:One third of ER-positive

Biology of Human Tumors

Acquired Resistance of ER-Positive Breast Cancerto Endocrine Treatment Confers an AdaptiveSensitivity to TRAIL through PosttranslationalDownregulation of c-FLIPLuke Piggott1, Andreia Silva1, Timothy Robinson1, Angelica Santiago-G�omez2,Bruno M. Sim~oes2, Michael Becker3, Iduna Fichtner3, Ladislav Andera4,Philippa Young5, Christine Morris5, Peter Barrett-Lee6, Fouad Alchami7,Marco Piva8, Maria dM. Vivanco8, Robert B. Clarke2, Julia Gee9,and Richard Clarkson1

Abstract

Purpose:One third of ER-positive breast cancer patients whoinitially respond to endocrine therapy become resistant totreatment. Such treatment failure is associated with poor prog-nosis and remains an area of unmet clinical need. Here, weidentify a specific posttranslational modification that occursduring endocrine resistance and which results in tumor sus-ceptibility to the apoptosis-inducer TRAIL. This potentiallyoffers a novel stratified approach to targeting endocrine-resis-tant breast cancer.

Experimental Design: Cell line and primary-derived xeno-graft models of endocrine resistance were investigated forsusceptibility to TRAIL. Tumor viability, cancer stem cell (CSC)viability (tumorspheres), tumor growth kinetics, and metastaticburden were assessed. Western blots for the TRAIL-pathwayinhibitor, c-FLIP, and upstream regulators were performed.Results were confirmed in primary culture of 26 endocrine-resistant and endocrine-na€�ve breast tumors.

Results: Breast cancer cell lines with acquired resistanceto tamoxifen (TAMR) or faslodex were more sensitive toTRAIL than their endocrine-sensitive controls. Moreover,TRAIL eliminated CSC-like activity in TAMR cells, resultingin prolonged remission of xenografts in vivo. In primary cul-ture, TRAIL significantly depleted CSCs in 85% endocrine-resistant, compared with 8% endocrine-na€�ve, tumors, where-as systemic administration of TRAIL in endocrine-resistantpatient-derived xenografts reduced tumor growth, CSC-likeactivity, and metastases. Acquired TRAIL sensitivity correlatedwith a reduction in intracellular levels of c-FLIP, and anincrease in Jnk-mediated phosphorylation of E3-ligase, ITCH,which degrades c-FLIP.

Conclusions: These results identify a novel mechanism ofacquired vulnerability to an extrinsic cell death stimulus, in endo-crine-resistant breast cancers, which has both therapeutic andprognostic potential. Clin Cancer Res; 24(10); 2452–63. �2018 AACR.

IntroductionOver 70% of breast tumors express estrogen receptor (ER),

and it is clear that estrogen itself plays a vital role in tumordevelopment and progression (1). As a result, the nonsteroidalantiestrogen tamoxifen has provided improved survival andquality of life for many early and advanced ERþve diseasesufferers (2, 3).

Since the introduction of tamoxifen to the clinic nearly30 years ago, further endocrine agents have been developed,notably the steroidal antiestrogen fulvestrant (Faslodex) thatalso promotes ER degradation (4), and aromatase inhibitors(AI) that suppress estrogen production in the body (5, 6).Although AIs are now the gold-standard endocrine strategy inthe ERþve postmenopausal setting (7), tamoxifen remains apivotal treatment option in ERþve premenopausal breast can-cer patients with 67% of patients responding to tamoxifen asfirst-line therapy (8–10). Fulvestrant in turn can prove valuableunder conditions where tamoxifen or AIs fail (11).

1European Cancer Stem Cell Research Institute, School of Biosciences, CardiffUniversity, Cardiff, United Kingdom. 2Breast Biology Group, Breast Cancer NowResearch Unit, Division of Cancer Sciences, Manchester Cancer Research Centre,University of Manchester, Manchester, United Kingdom. 3Experimental Phar-macology and Oncology Berlin-Buch GmbH, Berlin-Buch, Germany. 4Depart-ment of Molecular Therapy, Institute of Biotechnology, Academy of Sciences ofthe Czech Republic, Vestec, Prague, Czech Republic. 5Cardiff and Vale UHBBreast Centre, University Hospital of Llandough, Llandough, United Kingdom.6Velindre NHS Trust, Cardiff, United Kingdom. 7Cardiff and Vale UHB, Histopa-thology, University Hospital Wales, Heath Park, Cardiff, United Kingdom. 8CICbioGUNE, Technological Park of Bizkaia, Derio, Spain. 9School of Pharmacologyand Pharmaceutical Sciences, King Edward VII Avenue, Cardiff University,Cardiff, United Kingdom.

Note: Supplementary data for this article are available at Clinical CancerResearch Online (http://clincancerres.aacrjournals.org/).

Corresponding Author: L. Piggott, School of Biosciences, Maindy Road, CardiffUniversity, Cardiff CF24 4HQ, United Kingdom. Phone: 44-2920870249; Fax:44-2920876328; E-mail: [email protected]

doi: 10.1158/1078-0432.CCR-17-1381

�2018 American Association for Cancer Research.

ClinicalCancerResearch

Clin Cancer Res; 24(10) May 15, 20182452

on November 28, 2020. © 2018 American Association for Cancer Research.clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst January 23, 2018; DOI: 10.1158/1078-0432.CCR-17-1381

http://crossmark.crossref.org/dialog/?doi=10.1158/1078-0432.CCR-17-1381&domain=pdf&date_stamp=2018-4-26

http://clincancerres.aacrjournals.org/

Unfortunately, a large proportion of patients acquire resis-tance to endocrine treatment following initial responsiveness,and this is associated with reinstigation of tumor growth anddisease progression (12, 13). Thus, the majority of patients withadvanced disease and up to 30% of ERþve patients in theadjuvant setting will acquire resistance to the inhibitory effectsof their endocrine treatment (12, 13). The acquisition of resis-tance manifests with a partial epithelial–mesenchymal transi-tion (EMT) and increased migratory and invasive activity bothin anti–estrogen-resistant cell line models (14) and in clinicalsamples (14–17). Furthermore, a subset of tumor-initiating cellswith stem-like characteristics (cancer stem cells: CSCs) isenriched in tamoxifen-resistant breast cancers and may dem-onstrate resistance to endocrine therapies, thus contributing todisease recurrence and metastatic progression (18–21).

It has been suggested that ER expression remains a stablephenotype for many acquired resistance tumors that initiallyrespond to endocrine agents (22) which is corroborated by datashowing that a significant proportion of acquired resistancetumors remain sensitive to alternative endocrine treatment.However, as a therapeutic avenue this too has its limitations,as response to additional endocrine therapies declines overtime while some patients also lose ER expression during endo-crine treatment (23–25). In vitro and xenograft model studieshave elucidated that endocrine agents upregulate various "com-pensatory" growth factor signaling pathways that sustain cellsurvival and residual proliferative activity, culminating in resis-tant growth (26, 27). A number of approaches have beenexamined in patients targeting such signaling mechanisms toovercome endocrine resistance (28); however, responses tosuch targeted approaches are short-lived for many patients(29, 30). Of these agents, CDK4/6 (palbociclib, ribociclib) andmTOR inhibitors (everolimus) have shown particular promise;however, toxicities associated with these therapies must bemanaged carefully and predictive biomarkers for response arecurrently being investigated to help in patient selection (31–33). There thus remains a critical need for superior treatmentsguided by predictive biomarkers with greater long-term benefitsin the management of endocrine resistance in the clinic. TRAIL

is an immune-related apoptotic protein that has been shownto specifically target cancer cells while sparing normal cells.Unfortunately, several studies have now shown that despitethis cancer specificity, many tumor cell subtypes are inherentlyresistant to treatment with TRAIL agonists, with no improve-ment in overall survival rates in clinical trials (34). In breastcancer for example, epithelial-like ER-positive tumor cells areresistant to the proapoptotic effects of TRAIL, whereas cells witha mesenchymal phenotype, including CSCs within epithelial-like tumors, exhibit some sensitivity to TRAIL (35–37). Yetdespite these observations, TRAIL agonists have not progressedwell in the clinical setting (34, 38). Although tumor resistancehas been largely attributed to poor agonist potency, it isprobable that a scarcity of adequately stratified patient popula-tions also partly contributes to resistance through a lack ofunderstanding of the underlying mechanisms of resistance(39). The intrinsic TRAIL-mediated apoptosis inhibitor c-FLIPis believed to be one contributing factor behind TRAIL resis-tance of breast cancer cells as mesenchymal CSC and non-CSCsexhibit redistribution of c-FLIP (37), and removal of c-FLIPblockade hypersensitized both the bulk tumor cell population(40, 41) and breast CSCs to TRAIL in vitro and significantlyreduced metastasis in in vivo models (36).

Given the evidence above that endocrine resistance was alsoassociated with mesenchymal-like traits (including CSCs), wepostulated that endocrine-resistant breast tumors may respondbetter to TRAIL therapy than their endocrine-na€�ve counterparts. Ifthis were the case, we proposed that the increased TRAIL sensi-tivitymaybemediatedby c-FLIP.Here,we tested thesehypothesesusing in vitro and in vivo cell line models and clinical samples ofacquired endocrine-resistant breast cancer. We showed thatacquired endocrine-resistant breast cancer cell lines and theirconstituent CSC subpopulation were indeed sensitive to TRAILtreatment, and that this sensitivity correlatedwith the reduction ofc-FLIP levels through a posttranslational mechanism. Further-more, the TRAIL-mediated reduction in endocrine-resistant CSCsin vitrowas replicated in vivowith amarked reduction inmetastaticdisease. These findings were supported by patient-derived breastcancer tissue models leading to the conclusion that the selectiveuse of TRAIL agonists to target the CSC compartment in breasttumors that have acquired endocrine resistance may improveclinical outcome with potential long-term benefits to patients.

Materials and MethodsCell culture

Parental breast cancer cell lines MCF-7ERþHER2- andT47DERþHER2- (obtained from the ATCC) were maintained inRPMI 1640medium supplemented with 5%FBS, 1%penicillin—streptomycin, and 0.5% L-glutamine. Tamoxifen- and Faslodex-resistant subclones of these cell lines were derived as described(22, 42, 43) and maintained in phenol red–free RPMI 1640supplemented with 5% FBS (charcoal stripped for MCF-7 deri-vatives), 1% penicillin–streptomycin, 0.5% L-glutamine, and 100nmol/L of 4-OH-tamoxifen (Sigma) or fulvestrant (AstraZeneca).

siRNASmall-interfering RNAs (siRNA) targeting two unique

sequences in human c-FLIP (FLIPi—sense: GGAUAAAUCU-GAUGUGUCCUCAUUA, antisense: UAAUGAGGACACAUC-AGAUUUAUCC) and a nonspecific scrambled control (SCi—

Translational Relevance

Current options for breast cancer patients who relapse onendocrine therapy are limited and mostly rely on retargetingof endocrine pathways or nonspecific chemotherapy, nei-ther of which addresses the molecular changes that occurduring transition to drug resistance. Here, we identified onesuch acquired change, which resulted in endocrine-resistanttumors becoming sensitive to the proapoptotic effects of thetargeted agent, TRAIL. Moreover, this acquired sensitivitywas particularly acute in the cancer stem–like cell popula-tion, leading to long-term regression of tumors in vivo.Identification of the mechanism underlying this acquiredsensitivity provides a companion predictive biomarker ofthis response. These data support future clinical investiga-tion into the stratified use of TRAIL agonists for patients whodevelop resistance to endocrine therapy, a key area ofclinical unmet need that affects more than 8 million breastcancer patients worldwide.

Endocrine-Resistant Breast Cancer Sensitivity to TRAIL

www.aacrjournals.org Clin Cancer Res; 24(10) May 15, 2018 2453




sense: GGACUAAUAGUUGUGCUCCAAUUUA, antisense: UA-AAUUGGAGCACAACUAUUAGUCC) RNA were used in reversetransfections (Invitrogen). Cells were trypsinized and resus-pended at a density of 1 � 105 and seeded into wells containing20 mL of 100 nmol/L siRNA in serum-free Optimem (GIBCO) ina volume of 100 mL per well together with 0.3 mL of Lipofecta-mine (Invitrogen). Cells were cultured in the presence of siRNAfor 48 hours prior to subsequent assay.

TRAIL treatment of target cellsCells were treated with soluble human recombinant TRAIL

(SuperKillerTRAIL; Enzo Life Sciences) at a concentration of20 or 100 ng/mL for 18 hours at 37�C in 5% CO2.

Western blot assaysWestern blots of cell lysates were performed as described

(44). The following antibodies were used: c-FLIP (Enzo LifeSciences—7F10, ALX-8040428; Santa Cruz Biotechnology—5D8, sc-136160), ER-alpha (Santa Cruz Biotechnology; sc-7207), ErbB2 (Abcam; ab2428), GAPDH (Santa Cruz Bio-technology; sc365062), ITCH (AbCam; 99087), and pITCH(Millipore; 10050).

Cell viability and cell death assaysCellTiter blue cell viability assay (CTB; Promega) was per-

formed according to the manufacturer's instructions in a 96-wellplate format and fluorescence assessed using a ClarioStar (BMGLabtech) plate reader, whereas Invitrogen live/dead-labeled cellswere stained for 15 minutes at 4�C in the dark and subsequentlyanalyzed by flow cytometry (BD Accuri).

Primary-derived tumor cell processing and xenograftsPrimary and local relapse human breast tumor pathologic

and postsurgical core biopsies were obtained following consentfrom the Cardiff and Vale Breast Cancer Centre, LlandoughHospital under National Institute for Social Care and HealthResearch (NISCHR) ethical approval (12/WA/0252), and pleu-ral effusions/ascitic fluid metastatic samples obtained throughManchester Cancer Research Center Biobank and The ChristieNHS Foundation Trust (studies 12/ROCL/01, 05/Q1402/25,respectively). Cells were processed, maintained, and storedaccording to the Human Tissue Act with local (Cardiff Univer-sity) research ethics approval. All animal xenograft procedureswere performed in accordance with the Animals (ScientificProcedures) Act 1986 and approved by the UK Home Office(PPL 30/2849). Tumors excised from mice or received frompatients were finely minced and then processed in a MACstissue dissociator using a MACs tissue dissociation kit accordingto the manufacturer's protocol (Miltenyi Biotec). Primary cellswere maintained in 5% CO2 and 5% O2 at 37�C. The patient-derived xenograft (PDX) models were generated either as pre-viously described (45) or for the PDX 151 model, and 3 mmchunks of primary tumor material from a 72-year-old patientwith local relapse previously receiving endocrine treatment(see Supplementary Fig. S4A) were serially passaged by subcu-taneous implantation in JAXTM NOD.Cg-PrkdcscidIl2rgtm1Wj(NSG) mice.

Tumorsphere cultureCell lines and primary tumor samples were initially treated in

adherent culture conditions as described and then dissociated

into single-cell suspensions and plated (P1) in ultralow attach-ment 96-well plates (Corning) at a density of 20,000 cells/mLin a serum-free epithelial growth medium (DMEM/F12;Gibco), supplemented with 2% B27 (Invitrogen), 55 mmol/Lb-mercaptoethanol, 20 ng/mL EGF (Sigma), 5 mg/mL insulin(Sigma), and 1 mg/mL hydrocortisone. After 7 days, tumorsphereswere collected by gentle centrifugation (300 x g), dissociatedin 0.05% trypsin and 0.25% EDTA, and reseeded (P2) at20,000 cells/mL for subsequent passages. %TFU was calculatedby dividing the number of spheres formed by the total numberof single cells seeded.

Fluorescent-activated cell sortingThe directly conjugated mouse FITC anti-CD24 antibody (BD;

555427), mouse allophycocyanin (APC) anti-CD44 antibody(BD; 559942), mouse APC anti-DR5 (biolegend; DjR2-4), andmouse FITC anti-DR4 (AbCam; ab59047) were used to stainsingle-cell suspensions at 4�C in the dark for 30minutes. Controlsamples were stained with isotype-matched control antibodies,and samples were analyzed using BD Accuri flow cytometer.

Aldefluor assayTo measure ALDH activity, Aldefluor assay (Stem Cell Tech-

nologies) was performed on surviving cell populations as previ-ously described (46). Briefly, dissociated single cells were sus-pended in assay buffer containing ALDH substrate, bodipyami-noacetaldehyde (BAAA), at 1.5 mmol/L and incubated for 45minutes at 37�C. To distinguish between ALDHþve and –ve cells,cells were also incubated under identical conditions in the pres-ence of a 2-fold molar excess of the ALDH inhibitor, diethylami-nobenzaldehyde (DEAB).

Xenograft assays of MCF-7-TAMR cellsTumor initiation and growth were assessed by orthotopic

mammary fat pad transplantation of dissociated MCF-7 andMCF-7-TAMR cells. Cells were harvested using 1 mmol/L EDTA,washed, and resuspended at a density of 5 � 106 in serum-freeL15 media. A 1.5 mg, 90-day slow release 17-b estradiol orTamoxifen pellet (Innovative Research of America) for parentaland TAMR cells respectively was inserted subcutaneously abovethe right scapula of anesthetized NOD-SCID mice (Harlan). Atotal of 1� 106 cells were orthotopically injected directly into theabdominalmammary fat pad, andwhen tumors reached 5mm indiameter, themicewere treatedwith 16mg/kg TRAIL (IP) daily for4 days twice, separated by a 6-day treatment holiday. Mice werethen monitored, and tumor volume was measured twice weekly.Metastatic tumor burden within lung tissue was then assessedhistologically in serial hematoxylin and eosin sections.

RNA extraction and cDNA synthesisCultured cells were pelleted via centrifuge at 300 rcf for 5

minutes before being resuspended in 350 mL RLT buffer (Qiagen)and placed on ice for immediate extraction or frozen at –80�C forfuture extraction. RNA extractionwas performed using theQiagenRNEasy Kit following the manufacturer's instructions. The con-centration and quality of RNA were analyzed using a nanodrop3000 spectrophotometer (Thermo Scientific). Previously isolatedRNA was synthesized into cDNA using the QuantiTect ReverseTranscription Kit (Qiagen) according to the manufacturer'sinstructions.

Piggott et al.

Clin Cancer Res; 24(10) May 15, 2018 Clinical Cancer Research2454




Quantitative PCRAll qRT-PCR experiments were designed to include

both target gene probe and ACTB control probe. For eachexperiment, TaqMan Universal Master Mix II, with UNG(ThermoFischer Scientific), was used. TaqMan master mixwas added to target and ACTB control probes together withRNase free H2O to make individual target master mixes con-taining all reaction components and plated in 384-wellqPCR plates (Applied Biosystems). Plates were then run ona QuantStudio 7 Real-Time PCR machine (Applied Biosys-tems) set to the following protocol: initial denaturationat 95�C for 10 minutes, followed by 40 cycles of 95�C for15 seconds (denaturation), and 60�C for 1 minute (annealing/elongation). Relative quantity was determined using DDCt

values calculated from the reference sample.

Statistical methodsData are represented as mean � SEM for a minimum of three

independent experiments, unless otherwise stated. Statistical sig-nificance between means was measured using parametric testing,assuming equal variance, by standard t test for two paired sam-ples. The c2 test was used to determine the significance ofdeviation from expected ratios of responders to nonrespondersin the clinical cohort.

ResultsAcquired endocrine-resistant breast cancer cell lines develophypersensitivity to TRAIL-induced cell death

The development of endocrine therapy resistance in primarybreast cancer is associated with poor prognosis and, in cell linemodels and clinical samples of endocrine resistance, a transitionto more aggressive tumor phenotypes that have undergonepartial EMT (14–17). The cancer therapeutic TRAIL has been

shown to preferentially induce cell death in breast cancer celllines that exhibit a more mesenchymal phenotype (35). Wewished to investigate therefore whether the adaptation to endo-crine treatment also increased the sensitivity of breast cancercells to TRAIL. Initially, four models of acquired endocrineresistance, derived from continuous endocrine treatment withtamoxifen or Faslodex of the luminal ERþve breast cancer celllines MCF-7 (42) and T47D (43), were investigated. Acquiredtamoxifen-resistant (TAMR) and acquired Faslodex-resistant(FASR) cell lines were significantly more sensitive to the cyto-toxic effects of TRAIL than their parental controls. (Fig. 1A and B;Supplementary Fig. S1A). Sensitivity was particularly prominentin the TAMR derivatives. The gain in TRAIL sensitivity was thenconfirmed in an independent MCF-7–derived tamoxifen-resis-tant model (ref. 20; Supplementary Fig. S1B). This markedsusceptibility to TRAIL could not be explained by the combi-natorial effect of TRAIL with either endocrine agent and was afeature confined to the resistant state, as the combination oftamoxifen or Faslodex with TRAIL treatment on the previouslyuntreated MCF-7 cells (cotreated) or on cells pretreated withthese endocrine agents for up to 7 days (pretreatment) did notconfer TRAIL sensitivity (Fig. 1C). Furthermore, tamoxifenwithdrawal (TAMR-W) for 7 days prior to TRAIL treatmentalso had no effect on the sensitivity of TAMR cells to TRAIL(Fig. 1D). Combined, these results suggested that the substan-tially increased TAMR sensitivity to TRAIL was due to a stableadaptation resulting from acquired resistance to tamoxifen.

TRAIL treatment of acquired endocrine-resistant cells targetsCSC-like traits in vitro

According to the CSC hypothesis, a drug-resistant subpop-ulation of stem/progenitor-like tumor cells is likely to contrib-ute to promotion of resistance to conventional therapies(18, 21, 47, 48). To determine if these cells demonstrated a

Figure 1.

Acquisition of endocrine resistance inbreast cancer lines confers sensitivityto TRAIL. Acquired endocrine(faslodex or tamoxifen)-resistantMCF-7 (A) and T47D (B) cell linestogether with their parental endocrineresponsive lines were treated with20 ng/mL TRAIL for 18 hours andviability assessed by CTB assayrelative to their respective untreatedcontrol (� , P < 0.01). C, MCF-7 cellswere either cotreated with endocrinetreatment (100 nmol/L tamoxifen orfaslodex) plus 20 ng/mL TRAIL for 18hours or pretreated for 7 days withendocrine agent and TRAIL for 18hours, and viability was assessed byCTB assay (� , P < 0.01). D, MCF-7TAMR cells were cultured as normal orwith tamoxifen withdrawn for 7 days(TAMR-W) prior to 20 or 50 ng/mLTRAIL treatment for 18 hours andviability assessed by CTB assay(� , P < 0.01).






comparable sensitivity to TRAIL to the bulk cell cultures inthe acquired endocrine-resistant lines, the effect of TRAIL onstem-like activity was assessed by tumorsphere assay, whereascancer stem/progenitor cell numbers were measured using cellsurface markers and ALDEFLUOR assay. Both the MCF-7–derived TAMR and FASR cell lines exhibited an increasedcapacity to form tumorspheres, which were similar in mor-phology and size to their parental MCF-7 cell line. However, incontrast to the parental line, these self-renewing tumorsphere-forming cells were significantly more sensitive to TRAIL, with acomplete ablation of tumorsphere-forming units (TFU) andcolony-forming units in the TAMR cells following treatmentwith TRAIL (Fig. 2A and B; Supplementary Fig. S2C). Further-more, this TRAIL sensitivity was independent of the presenceof tamoxifen in the media (Fig. 2C), implying that the hyper-sensitization to TRAIL was inherent to the acquired endocrine(tamoxifen) resistance phenotype. The effect of TRAIL on theCSC compartment in the TAMR line was further supported byflow cytometry using surrogate markers of stem/progenitorcells. Both CD44HiCD24Lo and ALDHþve subpopulationswere significantly elevated in tamoxifen-resistant cell lines andyet remained sensitive to TRAIL-mediated apoptosis (Fig. 2D),although TRAIL failed to further deplete the CD44 populationin TAMR cells. A significant reduction in CSC-like activitywas also observed in a second cell line model of acquiredtamoxifen resistance (T47D-derived). Although the sensitivityto TRAIL was not as profound, TRAIL-treated TAMR cells werestill significantly reduced compared with their TRAIL-treatedparental counterparts (Supplementary Fig. S2A and S2B) witha 50% reduction in tumorsphere-forming capacity and a 4-foldreduction in CD44þve cells in T47D-TAMR cells followingTRAIL treatment. In summary, these data suggest that sensitiv-ity of breast cancer stem–like cells to TRAIL develops followingthe acquisition of resistance to antiestrogens, most acutelywith tamoxifen resistance.

Systemic TRAIL administration results in long-term regressionof TAMR tumors in vivo

In order to determine if the TRAIL-mediated reduction inoverall cell viability and CSC-like properties in vitro wasreflected in tumor growth in vivo, mice bearing establishedMCF-7 parental or TAMR orthotopic tumors of approximately5 mm in diameter were subjected to eight i.p. injections ofTRAIL over a period of 2 weeks and then monitored for tumorresponse. Along with the previously observed elevation in CSC-like and proliferative activity of TAMR cells in vitro (Fig. 2B),orthotopic TAMR tumors were found to be more aggressivethan parental MCF-7 controls under vehicle control conditions,with an elevated growth rate and appearance of spontaneousmetastases to the lung (Fig. 2E and F). MCF-7 tumorsresponded transiently to TRAIL treatment (20% reduction intumor volume) but, within 2 weeks of treatment, had regainedsimilar growth kinetics to the vehicle-treated cohort (Fig. 2E).Treatment of TAMR tumors with TRAIL on the other handresulted in a complete (100%) and sustained regression of alltumors (n ¼ 8) for up to 15 weeks (Fig. 2E). Furthermore,following TRAIL treatment, both the number and size of TAMRmetastatic lesions in the lungs were decreased by more than95% (Fig. 2F), correlating with the profound decrease in CSC-like activity observed in vitro (Fig. 2B). Taken together, thesedata suggested that tamoxifen-resistant cell response to TRAIL

in vivo correlated with the observed in vitro responses wherebytumor regression occurred by debulking tumor mass, and inturn, metastatic tumor burden and tumor relapse were signif-icantly reduced through the elimination of the cancer stem/progenitor pool.

Clinical samples from multiple endocrine drug-resistantpatients exhibit TRAIL sensitivity

Having seen clear benefits of TRAIL treatment in cell linemodels of antiestrogen resistance in vitro and in vivo, the efficacyof TRAIL on endocrine-resistant breast cancer was determinedin clinical samples ex vivo. Primary cell cultures were derivedfrom pleural effusions or ascites of 13 patients with advancedERþve breast cancer, 11 having received endocrine treatmentand 2 endocrine-na€�ve samples (Supplementary Fig. S3A). Cellswere plated into tumorsphere culture prior to treatment withTRAIL ex vivo (Fig. 3A). Nine of 11 (82%) of the clinical samplesfrom the advanced metastatic endocrine-resistant patientsexhibited a significant reduction in TFUs following treatmentwith TRAIL (Fig. 3A), whereas neither of the endocrine-na€�vemetastatic patient samples (90 and 94) responded to TRAIL.Similarly, 7 of 8 (88%) of the endocrine-resistant patientsamples cultured as an adherent monolayer were also sensitiveto TRAIL, with only 1 of the 2 endocrine-na€�ve samples exhibit-ing a significant response to TRAIL (Supplementary Fig. S3B).

A similar relationship was observed in primary cell culturesderived from 13 fresh core biopsies of local relapse ER-positivebreast cancer (Fig. 3A). Of two tumor biopsies originating frompatients who had relapsed following treatment with tamoxifen(samples 127 and 188), both demonstrated a significant reduc-tion in tumorsphere-forming capacity, whereas only 1 of 11 (9%)of endocrine treatment-na€�ve primary tumors exhibited such aresponse to TRAIL.

Overall, 11 of 13 samples (85%) from all clinical groups thathad relapsed following endocrine treatment responded to TRAILex vivo, compared with just 1 of 13 tumors that had not previ-ously seen endocrine therapy (Fig. 3A–C). Taken together, thefindings from these ex vivo models provide preclinical evidencethat TRAIL may be valuable in controlling endocrine-resistantbreast cancers and potentially provide long-term benefits bytargeting the CSC subset.

In vivo PDX models of endocrine-resistant breast cancerdemonstrate sensitivity to TRAIL administration

The potential for TRAIL as a further therapeutic optionfollowing acquisition of endocrine resistance was subsequentlytested in vivo using two distinct PDX models of endocrine-resistant breast cancer.

For the first PDX model, a primary ER-positive tumor wasmaintained orthotopically by serially passaging in immuno-compromised mice receiving either estradiol (MaCa 3366) ortamoxifen (MaCa 3366 TAMR) for up to 3 years, generatingestradiol-dependent and tamoxifen-resistant models, respective-ly, from the same parental tumor tissue (45). Mice were sub-jected to systemic administration of 8 i.p. injections of TRAILover 2 weeks (treatment windows highlighted in pink, Fig. 4)and tumor growth kinetics monitored from the beginning oftreatment (100 mm3). In the tamoxifen-sensitive estrogen-dependent control tumors, systemic in vivo TRAIL treatmentfailed to elicit a significant growth-inhibitory response com-pared with vehicle only (Fig. 4A). There was also no alteration in

Piggott et al.





the CSC compartment within the tumors (Fig. 4A). In contrast, atransient (10 day) yet significant regression of MaCa 3366 TAMRtumors was observed following first TRAIL administration,compared with a doubling in tumor volume in the vehicle

control arm over the same time period, which after a seconddose of TRAIL culminated in a sustained and significant reduc-tion in tumor size at 4 weeks compared with untreated controls(P ¼ 0.0045; Fig. 4B). Thus, although TRAIL-treated na€�ve 3,366

Figure 2.

CSCs in MCF-7–derived endocrine-resistant lines demonstratehypersensitivity to TRAIL. A,Representative tumorspheres formedfrom surviving cell population following20 ng/mL TRAIL treatment for 18 hours.B, MCF-7 cells and their derivedendocrine-resistant lines were treatedwith TRAIL or vehicle for 18 hours inadherent culture, before transferring totumorsphere culture conditions for 1week, and colonies counted as apercentage of viable cells seeded(� , P < 0.03; �� , P < 0.01). C,MCF-7 TAMRcells previously maintained in adherentculture with tamoxifen or TAMR-W for1 week and then treated with 20 ng/mLTRAIL for 18 hours were transferred totumorsphere assay as above(� , P < 0.01). D, Expression of CSCsurrogate markers (CD44, CD24, andALDH) in the MCF-7 parental and TAMRcell lines following 18-hour TRAILtreatment compared withtheir respective untreated control(� , P < 0.01). E, 107 MCF-7 parental orTAMR cells were transplanted into the4th inguinal mammary gland and16 mg/kg TRAIL administered 8 timesover 2 weeks (4x daily, 6-day treatmentholiday and then 4x daily) once tumorshad reached a volume of 100 mm3 andgrowth kinetics monitored followingfinal treatment by caliper measurementrelative to starting tumor volume(� , P < 0.03; �� , P < 0.001; n ¼ 8 pergroup). F, Lung metastatic burden invehicle- or TRAIL-treated TAMR-transplanted animals following sacrificeat week 16 (� , P < 0.03; ��, P < 0.01).






tumors exhibited a 4-fold increase in tumor volume over 4weeks, TRAIL-treated endocrine-resistant tumors exhibited a1.8-fold increase over the same time period (Fig. 4A and B).Furthermore, consistent with observations in our cell line mod-els of tamoxifen resistance, there was a significantly higher basallevel of CSC-like cells in MaCa 3366 TAMR tumors comparedwith its endocrine-responsive, estrogen-dependent, counterpart,and TRAIL treatment in vivo significantly depleted the CSC-likeactivity in the tamoxifen-resistant model (Fig. 4B), whereas nosignificant difference was observed in the endocrine-sensitivemodel. In addition, tumorspheres generated from the TRAIL-treated MaCa 3366-TAMR tumors also maintained their sensi-tivity to TRAIL when treated ex vivo, demonstrating that thetumorsphere-forming subset surviving in vivo TRAIL adminis-tration was not a consequence of acquired TRAIL resistance(Supplementary Fig. S4B).

For the second PDX model, a core biopsy (CUbbs 151)obtained from a locally relapsed ER-negative tumor from anER-positive (original status prior to endocrine treatment)breast cancer patient who had relapsed on the AI anastrazolewas used to propagate tumors in recipient immunocompro-mised mice to model AI-resistant breast cancer (histopatho-logically characterized in Supplementary Fig. S4A). AIs havebecome the gold-standard first-line therapy for the majority ofpostmenopausal ER-positive breast cancer patients, and manyof the endocrine-resistant clinical samples used in this study(Fig. 3) had at some point in their treatment received an AI(Supplementary Fig. S3A). In order to determine AI-resistantbreast cancer sensitivity to TRAIL, mice bearing CUbbs 151tumors (PDX 151) were administrated 8 i.p. injections ofTRAIL over 2 weeks. This resulted in a significant reductionin AI-resistant tumor growth compared with vehicle control(Fig. 4C), and ex vivo control PDX 151 tumor cells also

demonstrated significant sensitivity of CSC-like cells to treat-ment with TRAIL (Fig. 4D). Furthermore, the sensitivity ofPDX 151 CSCs ex vivo was consistent with the sensitivity ofthe patient biopsy (CUbbs 151) treated ex vivo prior to trans-plantation (i.e., original biopsy straight from the patient;Supplementary Fig. S4C). This was paralleled by a profoundreduction in both the number and size of spontaneous lungmetastases in vivo (Fig. 4E), adding additional confirmationthat the CSC-like compartment within these tumors was par-ticularly sensitive to TRAIL treatment.

c-FLIP degradation via Jnk activation leads to the observedsensitivity of tamoxifen-resistant breast cancer cells

In order to elucidate the underlying cause of the TRAILhypersensitivity gained both in endocrine-resistant breast can-cer cell lines and clinical tumors, key cellular components ofTRAIL-mediated cytotoxicity were assessed by Western blotand fluorescent-activated cell sorting analysis in the TAMRand FASR cell lines. These included the TRAIL receptors DR4and DR5 and the endogenous TRAIL-receptor complex inhib-itor c-FLIP, all of which have been shown to influence TRAILsensitivity in other cancer cell types (49–52). Comparativelevels of DR4 and DR5 cell surface receptor expression did notreflect the relative sensitivity of each cell line to TRAIL (Sup-plementary Fig. S5A). The relative protein levels of the TRAILpathway inhibitor, c-FLIP (55 kDa isoform identified with twoindependent antibodies), however, were found to be lower inTAMR cells compared with parental MCF-7 cells (Fig. 5A).Similarly, c-FLIP protein levels were also significantly reducedin TAMR and FASR derivatives of the T47D cell line (Fig. 5A).This reduction in c-FLIP protein levels is attributed to post-transcription regulation of c-FLIP, as no correlation betweenc-FLIP mRNA levels in either the cell lines or the primary

Figure 3.

Endocrine-resistant clinical relapse tumor samples display increased tumorsphere sensitivity to TRAIL compared with endocrine-na€�ve samples. A,Tumorspheres isolated from anti–estrogen (AE)-resistant metastatic BC (red hashed), endocrine-resistant local BC (red), endocrine-na€�ve metastaticBC (white hashed), and endocrine-na€�ve local BC were treated with 100 ng/mL TRAIL for 18 hours and fold change in %TFU from paired untreatedcontrol calculated for each sample 2 weeks later; �, P < 0.05 vs. paired control. B, Mean endocrine-na€�ve BC sample (metastatic and local combined)and endocrine-resistant (metastatic and local combined) %TFU following TRAIL treatment compared with their untreated controls (�, P < 0.01, n ¼ 13).C, Comparison of mean TRAIL response in endocrine-na€�ve and -resistant samples (� , P < 0.03, n ¼ 13).

Piggott et al.





samples tested correlated with TRAIL response (Supplemen-tary Fig. S5B).

Previously, a Jnk-mediated degradation of c-FLIP via the E3ubiquitin ligase ITCH has been described to explain regulationof c-FLIP protein in primary mouse cells (ref. 53; Supplemen-tary Fig. S5C). Accordingly, phosphorylated ITCH (pITCH) wasupregulated in MCF-7– and T47D-derived TAMR and FASRcells (Fig. 5A) compared with parental controls with no parallelincrease in total ITCH levels. The proposed link between Jnkand suppressed c-FLIP levels was confirmed by pretreatment ofthe MCF-7–derived TAMR cells with the Jnk inhibitorSP600125, which after 4-hour exposure partially rescued TAMRcell and endocrine-resistant primary sample viability in thepresence of TRAIL (Fig. 5B; Supplementary Fig. S5D; Supple-mentary Fig. S5E). Furthermore, Jnk inhibition decreased ITCHactivation (reduced phospho-ITCH levels) and subsequentlyrestored c-FLIP protein expression of TAMR cells to parentalMCF-7 levels (Fig. 5C).

Similarly, untreated MaCa 3366-TAMR tumors exhibited asignificantly lower level of c-FLIP protein expression andincreased ITCH and pITCH expression compared with itsendocrine-sensitive, estrogen-dependent control (Fig. 5D).Western blot analysis of 8 of the advanced metastatic endo-crine-resistant clinical samples ex vivo with varying TRAILresponse was performed in order to determine if the mecha-nism of sensitivity in these primary cells was consistent withthat of the endocrine-resistant cell lines (Fig. 5E). The activa-tion (phosphorylation) of ITCH and relative c-FLIP levels weresubsequently determined by densitometry normalized toGAPDH controls. The activation of ITCH and c-FLIP proteinlevels were inversely correlated such that increased activationof ITCH in endocrine-resistant samples correlated with areduction in c-FLIP levels, and, when averaged, cells sensitiveto TRAIL had significantly lower levels of c-FLIP and higherlevels of ITCH activation (Fig. 5F; Supplementary Fig. S5F). Inaddition, reduction of c-FLIP protein levels and increasedITCH activation correlated with response to TRAIL (Fig. 5F;Supplementary Fig. S3B). Furthermore, the advanced meta-static endocrine-resistant clinical sample with the lowest acti-vation of ITCH (sample 81, Fig. 5E) and the sample with thehighest level of c-FLIP protein (sample 29, Fig. 5E), both ofwhich demonstrated no significant response to TRAIL underadherent conditions, could be substantially sensitized toTRAIL by siRNA inhibition of c-FLIP, supporting the role forc-FLIP in TRAIL sensitivity (Fig. 5G; Supplementary Fig. S5Gand S5H). Finally, the endocrine-na€�ve, TRAIL-resistant, clin-ical sample 90 could also be sensitized to TRAIL by siRNAsuppression of c-FLIP (Fig. 5H; Supplementary Fig. S5I). Thesedata demonstrate that the activation of ITCH and reduction of

Figure 4.

Endocrine-resistant PDX models of BC demonstrate sensitivity to TRAIL.Established tamoxifen-sensitive (A) and acquired tamoxifen-resistant(B) MaCa 3366 PDX tumors (n ¼ 8 each) were treated 8 times in 2 weekswith 16 mg/kg of TRAIL I.P (pink ¼ 4 x daily treatment windows) andgrowth kinetics monitored weekly by caliper measurement compared withvehicle control (� , P < 0.03, n ¼ 8). Vehicle- and TRAIL-treated tumorsexcised 24 hours following the final TRAIL administration were dissociated,and tumorsphere-forming capacity was assessed (P1). TFUs were then

disaggregated and passaged to assess self-renewal capacity (P2; � , P < 0.03,n ¼ 3). C, AI-resistant PDX model of BC (PDX 151) was treated andmonitored as in A, and tumor growth kinetics was monitored by calipermeasurement (P < 0.03, n ¼ 3). D, Vehicle control PDX 151 AI-resistanttumors were excised, dissociated, and %TFU assessed followingtreatment with 100 ng/mL TRAIL for 18 hours ex vivo (� , P < 0.03).E, Assessment of lung metastatic burden (mean number and size ofmetastasis � SEM) in haematoxylin and eosin (HþE) serial sections fromvehicle control- and TRAIL-treated PDX 151 tumors 2 weeks following lastTRAIL treatment (� , P < 0.03).






Figure 5.

Endocrine-resistant breast cancer cell sensitivity to TRAIL correlates with inherent increased ITCH activation (via Jnk activation) and c-FLIP protein reduction.A, Pan-ITCH, pITCH, and c-FLIP (long, 55 kDa) protein levels in endocrine-resistant MCF-7 and T47D cell lines as assessed by Western blot versus parentalcontrol. Two antibodies to the long form of c-FLIP are used in MCF-7 cells to confirm specificity.B,MCF-7 TAMR cells and primary endocrine-resistant BB3RC46 cellswere incubated with or without 10 mmol/L SP600125 Jnk inhibitor (JNKi) for 4 hours and then treated with or without 20 ng/mL (TAMR)/100 ng/mL(BB3RC46) TRAIL for 18 hours, and mean cell viability/cell death was assessed by CTB (� , P < 0.03, n ¼ 3). C, MCF-7 TAMR cells were incubated with or withoutJNKi for up to 4 hours, and ITCH, pITCH, and c-FLIP protein levels assessed by Western blot. D, Levels of ITCH expression/activation and c-FLIP protein wereassessedbyWestern blotting protein extracted fromMaCa 3366 (A6andA7) andMaCa3366TAMR tumors (A1 andA6).E, ITCHactivation and c-FLIP protein levels inendocrine-resistant metastatic tumor samples as determined by Western blot. F, Correlation of c-FLIP protein level and ITCH activation to each other and tosample response to TRAIL (from Supplementary Fig. S3B). G, A TRAIL-resistant, endocrine-resistant, clinical sample from a metastatic breast cancer patient,BB3RC81, was incubated with either scrambled control (SCi) or FLIP-targeted (FTi) siRNA and then treated with 100 ng/mL TRAIL for 18 hours, and cell viability wasassessed by CTB (��, P < 0.01). H, A TRAIL-resistant, endocrine-na€�ve, clinical sample from a metastatic breast cancer patient, BB3RC90, was incubated with eitherscrambled control (SCi) or FLIP-targeted (FTi) siRNA and then treated with 100 ng/mL TRAIL for 18 hours, and cell viability was assessed by CTB (�� , P < 0.01).

Piggott et al.





c-FLIP is one potential mechanism of hypersensitivity ofendocrine-resistant clinical samples ex vivo.

DiscussionThere is a clear unmet need for alternative treatments for

patients who relapse on endocrine therapy. Relapse rates are high,and following multiple lines of endocrine therapy, there is higherrisk of metastasis and poorer overall survival with limited treat-ment options.

Here, we demonstrate that acquired endocrine-resistant breastcancer cells gain sensitivity to TRAIL treatment compared withtheir endocrine-responsive parental counterparts. This appears tomanifest following the acquisition of resistance and is a stablesensitivity, as administration of endocrine agents in ER-respon-sive cells does not increase response to TRAIL.

Although other changes in signaling pathways have beenidentified as a consequence of endocrine resistance—such asEGFR/HER2, MAPK, CDK4/6, mTOR, and Src (54–59)—thedata reported here represent to our knowledge the first dem-onstration of a sensitization to a single agent targeting aproapoptotic pathway. Previous studies have demonstratedincreased Jnk signaling following the long-term acquisition ofresistance to endocrine therapies (12, 60). Here, we demon-strate that one consequence of this Jnk activation is the ITCH-dependent destabilization of c-FLIP protein, which correlateswith TRAIL sensitivity both in cell line models in vitro and inclinical samples ex vivo.

Previously, modest outcomes in phase II clinical trials ofTRAIL agonists in terms of overall survival have been partlyattributed to the lack of potency of existing TRAIL receptoragonists (34); however, it could also be postulated that a lack ofstratification and suitable biomarkers for response also con-tributes to the poor results seen to date. The data presented heresuggest that acquired resistance to endocrine therapy couldrepresent a key subgroup of patients that might exhibitimproved responses to TRAIL agonists and that monitoring ofc-FLIP, pITCH, and/or p-Jnk levels in tumors could furtherpotentiate the selection process by identifying at least a pro-portion of TRAIL-responsive tumors. Further exploration ofthese molecular markers by immunohistochemical analysis ofpathologic samples with access to fresh tissue material wouldbe required to determine if these could be used as predictivebiomarkers of TRAIL response.

We recently reported that TRAIL can selectively target theCSC-like cells in breast cancer cell lines in vitro followingsuppression of c-FLIP. Here, we demonstrate that acquiredendocrine resistance potentiates sensitivity of the CSC-likecompartment to TRAIL in primary-derived breast cancer sam-ples, and that this significantly correlates with a reduction in c-FLIP levels. These observations are particularly significant giventhat CSCs have been demonstrated to evade conventionalchemotherapy agents and potentially endocrine agents, eitherdue to cell quiescence, through the prevention of drug uptakeor modulation of intracellular signaling (18, 21, 61–63). Tar-geted therapies that initiate cell death through cell surfacereceptors circumvent these resistance mechanisms and there-fore may prove to be a more effective strategy for targeting CSCs(64–66). Indeed, this was confirmed in xenograft models ofendocrine-resistant tumors, whereby systemic TRAIL treatmentresulted in a profound suppression of tumor recurrence (Figs. 2

and 4) and a marked decrease in spontaneous metastasis(Figs. 2F and 4E). Interestingly, response to TRAIL was observedregardless of cellular ER status. In vitro models of TAMR main-tain ER positivity following acquisition of resistance, and activeER signaling remains important in cell proliferation. Similarly,MaCa 3366 also maintains ER positivity following acquisitionof resistance; however, FASR cell lines and PDX 151 do notmaintain their ER positivity. Despite these important differ-ences in cellular signaling, all these models demonstratedsensitivity to TRAIL treatment in vitro and in vivo. Taken togeth-er, these data have important implications for potential long-term survival benefit patients who ultimately relapse on anyform of endocrine therapy.

Previous studies have proposed that the acquisition of endo-crine resistance is accompanied by the appearance of mesen-chymal-like properties, which might also explain the increasedrisk of metastatic disease. This was the premise on which weinitially tested for TRAIL sensitivity in endocrine-resistantbreast cancer cells, as TRAIL had previously been shown toselectively target breast cancer cell types with a mesenchymal-like phenotype (35). The question still remains as to whether apartial EMT sufficiently explains the strong correlation betweenendocrine resistance and TRAIL sensitivity in clinical samplesobserved here. Further studies into the mechanism of Jnkactivation and the role of EMT-like processes in TRAIL sensi-tivity will help elucidate its relationship with acquired endo-crine resistance.

In summary, we have shown that acquired endocrine resistanceconfers sensitivity of breast cancer cells and particularly breastCSCs to TRAIL-mediated apoptosis. These data support furtherinvestigation into the selective use of TRAIL agonists as a subse-quent treatment for ERþve patients who relapse on endocrinetherapy regardless of their ER status following relapse.

Disclosure of Potential Conflicts of InterestP. Barrett-Lee reports receiving remuneration fromRoche Products Ltd. J. Gee

reports receiving commercial research grants from AstraZeneca. No potentialconflicts of interest were disclosed by the other authors.

Authors' ContributionsConception and design: L. Piggott, T. Robinson, C. Morris, R. ClarksonDevelopment of methodology: L. Piggott, I. Fichtner, L. Andera, C. Morris,P. Barrett-Lee, R. ClarksonAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): L. Piggott, A. Silva, T. Robinson, A. Santiago-G�omez,B.M. Sim~oes, M. Becker, P. Young, C. Morris, P. Barrett-Lee, F. Alchami, M. Piva,M.dM. Vivanco, R.B. Clarke, J. GeeAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): L. Piggott, A. Silva, T. Robinson, A. Santiago-G�omez,B.M. Sim~oes, M. Becker, M. Piva, M.dM. Vivanco, R. ClarksonWriting, review, and/or revision of the manuscript: L. Piggott, A. Silva,T. Robinson, A. Santiago-G�omez, B.M. Sim~oes, L. Andera, C. Morris,P. Barrett-Lee, F. Alchami, R.B. Clarke, J. Gee, R. ClarksonAdministrative, technical, or material support (i.e., reporting or organiz-ing data, constructing databases): L. Piggott, A. Silva, I. Fichtner, C. Morris,F. AlchamiStudy supervision: L. Piggott, P. Barrett-Lee, R. Clarkson

AcknowledgmentsThe authors acknowledge the patients and their families for their participa-

tion in this study. We acknowledge the infrastructure support from WalesCancer Bank (www.walescancerbank.com) for the collection of patient samplesand Professor Sacha Howell (The Christie NHS Foundation Trust) for access topleural effusion patient samples.





www.walescancerbank.com


This study was funded by Breast Cancer Now (charity no. 1160558). A. Silvawas supported by Tenovus Cancer Care funding (charity no. 1054015).

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby marked

advertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received July 18, 2017; revisedDecember 6, 2017; accepted January 16, 2018;published first January 23, 2018.

References1. Anderson E. Progesterone receptors – animal models and cell signaling in

breast cancer: the role of oestrogen and progesterone receptors in humanmammary development and tumorigenesis. Breast Cancer Res 2002;4:197–201.

2. Early Breast Cancer Trialists' Collaborative Group (EBCTCG). Effects ofchemotherapy and hormonal therapy for early breast cancer on recurrenceand 15-year survival: an overview of the randomised trials. Lancet LondEngl 2005;365:1687–717.

3. Jaiyesimi IA, Buzdar AU, Decker DA, Hortobagyi GN. Use of tamoxifen forbreast cancer: twenty-eight years later. J Clin Oncol 1995;13:513–29.

4. Wakeling AE, Dukes M, Bowler J. A potent specific pure antiestrogenwith clinical potential. Cancer Res 1991;51:3867–73.

5. Osborne CK. Aromatase inhibitors in relation to other forms of endocrinetherapy for breast cancer. Endocr Relat Cancer 1999;6:271–6.

6. Johnston SJ, Cheung KL. Fulvestrant - a novel endocrine therapy for breastcancer. Curr Med Chem 2010;17:902–14.

7. Buzdar AU. Aromatase inhibitors in breast cancer therapy. Clin BreastCancer 2003;4:S84–8.

8. Arpino G, Weiss H, Lee AV, Schiff R, De Placido S, Osborne CK, et al.Estrogen receptor-positive, progesterone receptor-negative breast cancer:association with growth factor receptor expression and tamoxifen resis-tance. J Natl Cancer Inst 2005;97:1254–61.

9. Rakha EA, El-SayedME, Green AR, Paish EC, PoweDG,Gee J, et al. Biologicand clinical characteristics of breast cancer with single hormone receptor–positive phenotype. J Clin Oncol 2007;25:4772–8.

10. Osborne CK, Schiff R, Arpino G, Lee AS, Hilsenbeck VG. Endocrineresponsiveness: understanding how progesterone receptor can be used toselect endocrine therapy. Breast Edinb Scotl 2005;14:458–65.

11. Johnston S. Fulvestrant and the sequential endocrine cascade for advancedbreast cancer. Br J Cancer 2004;90:S15–8.

12. Musgrove EA, Sutherland RL. Biological determinants of endocrine resis-tance in breast cancer. Nat Rev Cancer 2009;9:631–43.

13. Schiff R, Massarweh S, Shou J, Osborne CK. Breast cancer endocrineresistance: how growth factor signaling and estrogen receptor coregulatorsmodulate response. Clin Cancer Res 2003;9:447S–54S.

14. Hiscox S, Jiang WG, Obermeier K, Taylor K, Morgan L, Burmi R, et al.Tamoxifen resistance in MCF7 cells promotes EMT-like behaviour andinvolves modulation of beta-catenin phosphorylation. Int J Cancer2006;118:290–301.

15. Yuan J, LiuM, Yang L, TuG, ZhuQ, ChenM, et al. Acquisition of epithelial-mesenchymal transition phenotype in the tamoxifen-resistant breast can-cer cell: a new role for G protein-coupled estrogen receptor in mediatingtamoxifen resistance through cancer-associated fibroblast-derived fibro-nectin and b1-integrin signaling pathway in tumor cells. Breast Cancer Res2015;17:69.

16. Iseri OD, Kars MD, Arpaci F, Atalay C, Pak I, G€und€uz U. Drug resistantMCF-7 cells exhibit epithelial-mesenchymal transition gene expressionpattern. Biomed Pharmacother 2011;65:40–5.

17. Al Saleh S, Al Mulla F, Luqmani YA. Estrogen receptor silencing inducesepithelial to mesenchymal transition in human breast cancer cells. PLoSOne 2011;6:e20610.

18. O'Brien CS, Farnie G, Howell SJ, Clarke RB. Breast cancer stem cells andtheir role in resistance to endocrine therapy. HormCancer 2011;2:91–103.

19. Sansone P, Ceccarelli C, BerishajM, ChangQ, Rajasekhar VK, Perna F, et al.Self-renewal of CD133(hi) cells by IL6/Notch3 signalling regulates endo-crine resistance in metastatic breast cancer. Nat Commun 2016;7:10442.

20. Piva M, Domenici G, Iriondo O, R�abano M, Sim~oes BM, Comaills V, et al.Sox2 promotes tamoxifen resistance in breast cancer cells. EMBOMolMed2014;6:66–79.

21. Sim~oesBM,O'BrienCS, EyreR, SilvaA, YuL, Sarmiento-CastroA, et al. anti-estrogen resistance in human breast tumors is driven by JAG1-NOTCH4-dependent cancer stem cell activity. Cell Rep 2015;12:1968–77.

22. Staka CM, Nicholson RI, Gee JMW. Acquired resistance to oestrogendeprivation: role for growth factor signalling kinases/oestrogen receptorcross-talk revealed in new MCF-7X model. Endocr Relat Cancer 2005;12:S85–97.

23. Johnston SR, Saccani-Jotti G, Smith IE, Salter J, Newby J, Coppen M, et al.Changes in estrogen receptor, progesterone receptor, and pS2 expression intamoxifen-resistant human breast cancer. Cancer Res 1995;55:3331–8.

24. Kuukasj€arvi T, Kononen J,HelinH,Holli K, Isola J. Loss of estrogen receptorin recurrent breast cancer is associated with poor response to endocrinetherapy. J Clin Oncol 1996;14:2584–9.

25. Osborne CK, Fuqua SAW. Mechanisms of tamoxifen resistance. BreastCancer Res Treat 1994;32:49–55.

26. Zhao M, Ramaswamy B. Mechanisms and therapeutic advances in themanagement of endocrine-resistant breast cancer. World J Clin Oncol2014;5:248–62.

27. OsborneCK, Schiff R.Mechanisms of endocrine resistance in breast cancer.Annu Rev Med 2011;62:233–47.

28. Johnston SRD. Enhancing the efficacy of hormonal agents with selectedtargeted agents. Clin Breast Cancer 2009;9:S28–36.

29. Baselga J, Campone M, Piccart M, Burris HA, Rugo HS, Sahmoud T, et al.Everolimus in postmenopausal hormone-receptor-positive advancedbreast cancer. N Engl J Med 2012;366:520–9.

30. Piccart M, Hortobagyi GN, CamponeM, Pritchard KI, Lebrun F, Ito Y, et al.Everolimus plus exemestane for hormone-receptor-positive, human epi-dermal growth factor receptor-2-negative advanced breast cancer: overallsurvival results from BOLERO-2†. Ann Oncol 2014;25:2357–62.

31. Almstedt K, Schmidt M. Targeted therapies overcoming endocrine resis-tance in hormone receptor-positive breast cancer. Breast Care 2015;10:168–72.

32. Finn RS, Crown JP, Lang I, Boer K, Bondarenko IM, Kulyk SO, et al. Thecyclin-dependent kinase 4/6 inhibitor palbociclib in combinationwith letrozole versus letrozole alone as first-line treatment of oestrogenreceptor-positive, HER2-negative, advanced breast cancer (PALOMA-1/TRIO-18): a randomised phase 2 study. Lancet Oncol 2015;16:25–35.

33. Liu C-Y, Wu C-Y, Petrossian K, Huang T-T, Tseng L-M, Chen S. Treatmentfor the endocrine resistant breast cancer: current options and futureperspectives. J Steroid Biochem Mol Biol 2017;172:166–75.

34. Holland PM. Death receptor agonist therapies for cancer, which is the rightTRAIL? Cytokine Growth Factor Rev 2014;25:185–93.

35. Rahman M, Davis SR, Pumphrey JG, Bao J, Nau MM, Meltzer PS, et al.TRAIL induces apoptosis in triple-negative breast cancer cells with amesenchymal phenotype. Breast Cancer Res Treat 2009;113:217–30.

36. Piggott L, Omidvar N, Martí P�erez S, French R, Eberl M, Clarkson RWE.Suppression of apoptosis inhibitor c-FLIP selectively eliminates breastcancer stem cell activity in response to the anti-cancer agent, TRAIL. BreastCancer Res 2011;13:R88.

37. French R, Hayward O, Jones S, Yang W, Clarkson R. Cytoplasmic levels ofcFLIP determine a broad susceptibility of breast cancer stem/progenitor-like cells to TRAIL. Mol Cancer 2015;14:209.

38. de Miguel D, Lemke J, Anel A, Walczak H, Martinez-Lostao L. Onto betterTRAILs for cancer treatment. Cell Death Differ 2016;23:733–47.

39. Lemke J, von Karstedt S, Zinngrebe J, Walczak H. Getting TRAIL back ontrack for cancer therapy. Cell Death Differ 2014;21:1350–64.

40. Palacios C, Yerbes R, L�opez-Rivas A. Flavopiridol induces cellular FLI-CE-inhibitory protein degradation by the proteasome and promotesTRAIL-induced early signaling and apoptosis in breast tumor cells. CancerRes 2006;66:8858–69.

41. Day TW,Huang S, Safa AR. c-FLIP knockdown induces ligand-independentDR5-, FADD-, caspase-8-, and caspase-9-dependent apoptosis in breastcancer cells. Biochem Pharmacol 2008;76:1694–704.

42. Knowlden JM, Hutcheson IR, Jones HE, Madden T, Gee JMW, Harper ME,et al. Elevated levels of epidermal growth factor receptor/c-erbB2

Piggott et al.





heterodimers mediate an autocrine growth regulatory pathway in tamox-ifen-resistant MCF-7 cells. Endocrinology 2003;144:1032–44.

43. Jordan NJ, Dutkowski CM, Barrow D, Mottram HJ, Hutcheson IR, Nichol-son RI, et al. Impact of dual mTORC1/2 mTOR kinase inhibitor AZD8055on acquired endocrine resistance in breast cancer in vitro. Breast Cancer Res2014;16:R12.

44. Tiffen PG, Omidvar N, Marquez-Almuina N, Croston D, Watson CJ,Clarkson RWE. A dual role for oncostatin M signaling in the differen-tiation and death of mammary epithelial cells in vivo. Mol Endocrinol2008;22:2677–88.

45. Naundorf H, Becker M, Lykkesfeldt AE, Elbe B, Neumann C, B€uttner B,et al. Development and characterization of a tamoxifen-resistantbreast carcinoma xenograft. Br J Cancer 2000;82:1844–50.

46. Korkaya H, Paulson A, Iovino F, Wicha MS. HER2 regulates the mammarystem/progenitor cell population driving tumorigenesis and invasion.Oncogene 2008;27:6120–30.

47. MeachamCE,Morrison SJ. Tumour heterogeneity and cancer cell plasticity.Nature 2013;501:328–37.

48. Chen J, Li Y, Yu T-S, McKay RM, Burns DK, Kernie SG, et al. A restrictedcell population propagates glioblastoma growth after chemotherapy.Nature 2012;488:522–6.

49. MitsiadesCS, Treon SP,MitsiadesN, ShimaY, Richardson P, SchlossmanR,et al. TRAIL/Apo2L ligand selectively induces apoptosis and overcomesdrug resistance in multiple myeloma: therapeutic applications. Blood2001;98:795–804.

50. van Geelen CM, Pennarun B, Le PT, de Vries EG, de Jong S. Modulationof TRAIL resistance in colon carcinoma cells: different contributions ofDR4 and DR5. BMC Cancer 2011;11:39.

51. Wu GS. TRAIL as a target in anti-cancer therapy. Cancer Lett 2009;285:1–5.52. Ashkenazi A, Herbst RS. To kill a tumor cell: the potential of proapoptotic

receptor agonists. J Clin Invest 2008;118:1979–90.53. ChangL, KamataH, SolinasG, Luo J-L,Maeda S, VenuprasadK, et al. TheE3

ubiquitin ligase itch couples JNK activation to TNFalpha-induced celldeath by inducing c-FLIP(L) turnover. Cell 2006;124:601–13.

54. Gee JMW, Nicholson RI, Barrow D, Dutkowski CM, Goddard L, Jordan NJ,et al. Antihormone induced compensatory signalling in breast cancer: anadverse event in the development of endocrine resistance. Horm Mol BiolClin Investig 2011;5:67–77.

55. Morgan L, Gee J, Pumford S, Farrow L, Finlay P, Robertson J, et al. ElevatedSrc kinase activity attenuates tamoxifen response in vitro and is associatedwith poor prognosis clinically. Cancer Biol Ther 2009;8:1550–8.

56. Drury SC,Detre S, Leary A, Salter J, Reis-Filho J, Barbashina V, et al. Changesin breast cancer biomarkers in the IGF1R/PI3K pathway in recurrent breastcancer after tamoxifen treatment. Endocr Relat Cancer 2011;18:565–77.

57. Shou J, Massarweh S, Osborne CK, Wakeling AE, Ali S, Weiss H, et al.Mechanisms of tamoxifen resistance: increased estrogen receptor-HER2/neu cross-talk in ER/HER2-positive breast cancer. J Natl Cancer Inst2004;96:926–35.

58. Miller TW, Balko JM, Arteaga CL. Phosphatidylinositol 3-kinase andantiestrogen resistance in breast cancer. J Clin Oncol 2011;29:4452–61.

59. Kato S, Endoh H, Masuhiro Y, Kitamoto T, Uchiyama S, Sasaki H, et al.Activation of the estrogen receptor through phosphorylation by mitogen-activated protein kinase. Science 1995;270:1491–4.

60. Shou J, Wong J, Weigel N, Osborne CK, Schiff R. JNK and p38 MAPkinases potentially contribute to tamoxifen resistance of breast cancervia direct phosphorylation of both estrogen receptor and AIB1 coactivator.Eur J Cancer 2002;38:S159.

61. Patel P, Chen E. Cancer stem cells, tumor dormancy, and metastasis.Front Endocrinol 2012;3.

62. Cojoc M, M€abert K, Muders MH, Dubrovska A. A role for cancer stem cellsin therapy resistance: cellular and molecular mechanisms. Semin CancerBiol 2015;31:16–27.

63. Huang R, Wang G, Song Y, Tang Q, You Q, Liu Z, et al. Colorectal cancerstem cell and chemoresistant colorectal cancer cell phenotypes andincreased sensitivity to Notch pathway inhibitor. Mol Med Rep 2015;12:2417–24.

64. Marangoni E, Lecomte N, Durand L, de Pinieux G, Decaudin D, Chomi-enne C, et al. CD44 targeting reduces tumour growth and prevents post-chemotherapy relapse of human breast cancers xenografts. Br J Cancer2009;100:918–22.

65. Harrison H, Farnie G, Howell SJ, Rock RE, Stylianou S, Brennan KR, et al.Regulation of breast cancer stem cell activity by signaling through theNotch4 receptor. Cancer Res 2010;70:709–18.

66. Li Y, Maitah MY, Ahmad A, Kong D, Bao B, Sarkar FH. Targeting theHedgehog signaling pathway for cancer therapy. Expert Opin Ther Targets2012;16:49–66.






2018;24:2452-2463. Published OnlineFirst January 23, 2018.Clin Cancer Res Luke Piggott, Andreia Silva, Timothy Robinson, et al. Posttranslational Downregulation of c-FLIPTreatment Confers an Adaptive Sensitivity to TRAIL through Acquired Resistance of ER-Positive Breast Cancer to Endocrine

Updated version

10.1158/1078-0432.CCR-17-1381doi:

Access the most recent version of this article at:

Material

Supplementary

http://clincancerres.aacrjournals.org/content/suppl/2018/01/20/1078-0432.CCR-17-1381.DC1

Access the most recent supplemental material at:

Cited articles

http://clincancerres.aacrjournals.org/content/24/10/2452.full#ref-list-1

This article cites 65 articles, 14 of which you can access for free at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://clincancerres.aacrjournals.org/content/24/10/2452To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-17-1381

http://clincancerres.aacrjournals.org/content/suppl/2018/01/20/1078-0432.CCR-17-1381.DC1

http://clincancerres.aacrjournals.org/content/24/10/2452.full#ref-list-1

http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://clincancerres.aacrjournals.org/content/24/10/2452


Documents

Acquired Resistance ofER-Positive BreastCancer to ......Marco Piva8, Maria dM.Vivanco8, Robert B. Clarke2, Julia Gee9, and Richard Clarkson1 Abstract Purpose:One third of ER-positive