Page 1 of 99

Table of Contents

Verbal Presentations

Verbal Presentations – Monday………………………………………………………...................... Page 2 Verbal Presentations – Tuesday……………………………………………………………………… Page 17 Verbal Presentations – Wednesday………………………………………………………..…….….. Page 32 Verbal Presentations – Thursday……………………….……………………………….………..…. Page 46

Poster Presentations Poster Presentations – Monday…………………………………………………………………..…. Page 52 Poster Presentations – Tuesday……………………………………………………………..……… Page 64 Poster Presentations – Wednesday……………………………………………………….……….. Page 77 Poster Presentations – Thursday……………………………………….………………….……….. Page 90

Page 2 of 99

Verbal Presentations

Monday, May 15th 8:30 – 10 AM Grumman A Microsimulation Approach to Estimating Annual Risk in QMRA. Coping with Non-Random Variation in Risk Amongst Populations Paul Hunter, The Norwich Medical School, University of East Anglia Additional Author: James Maas Most QMRA studies have focused on refining the estimation of the daily risk comparatively little thought has been given to estimating the annual risk. As pointed out by Karavarsamis and Hamilton most studies have used a relatively simple method of estimating annual risk from the distribution of daily risks, namely 1-(1-Pd)^365 (1). This approach essentially assumes that the daily risk is constant through the year and Karavarsamis and Hamilton, with justification, refer to this approach as "Naϊve". Instead they propose a stochastic approach that essentially samples the distribution of daily risks and then calculates the annual risk as 1-the product of (1-365 randomly sampled daily risk), calling this the "Gold Standard Approach". We argue that Karavarsamis and Hamilton's gold standard approach is also naϊve. Daily risks in any one individual are neither constant through a year nor are they entirely random. For example, across a population some people drink a lot of water each day and others drink very little. Other factors like the concentration of pathogen in a supply may vary much more randomly. We propose a microsimulation approach to QMRA that allows both random and non-random drivers of risk to be incorporated into the analysis. Microsimulation models as applied to QMRA essentially simulate risk at the individual level over the course of one year and then combine the results of the individual analysis into a population level risk assessment. To illustrate the microsimulation approach we conducted a QMRA analysis of cryptosporidium concentrations in six private water supplies (2). Cryptosporidium concentrations were taken from the original dataset. Water consumption data for the UK was obtained from the Drinking Water Inspectorate. Initial analyses were done in @Risk using the exponential dose response model with k = 5.72E-02. The mean annual risk using Karavarsamis and Hamilton's "Naϊve" approach was 44 infections/1000person years whilst their "Gold Standard" approach gave 64. When water consumption was assumed to be constant this fell to 53 infections/1000person years. The two original approaches represent extremes with full and no autocorrelation of daily risks over the year. A microsimulation approach gives a closer estimate of real population risk. Microsimulation would also enable easier estimates of risk when there are multiple sources of infection. QMRA is also being used to estimate disease burden across nations and in such circumstances current methods are likely to be biased unless a microsimulation process is used. 1. Karavarsamis N, Hamilton AJ. Estimators of annual probability of infection for quantitative microbial risk assessment. Journal of Water and Health. 2010 Jun 1;8(2):365-73. 2. Kay D, Watkins J, Francis CA, Wyn-Jones AP, Stapleton CM, Fewtrell L, Wyer MD, Drury D. The microbiological quality of seven large commercial private water supplies in the United Kingdom. Journal of Water and Health, 2007; 5:523-538. The QMRAcatch Modelling Approach: Using Best Available Pathogen, Indicator and Source Tracking Data to Support Catchment Protection & Water Safety Management Julia Derx, TU Wien, ICC Water & Health Additional Authors: Jack Schijven; Regina Sommer; Christa Zoufal-Hruza; Georg Reischer; Alexander Kirschner; Christina Frick; Alfred Paul Blaschke; Andreas Farnleitner Motivated by recent progresses in water and sanitation safety planning (e.g. WHO water- and sanitation safety plans) the model QMRAcatch was recently developed to support sustainable decision making (Schijven et al. 2015). QMRAcatch allows the simulation of pathogen concentrations in a river and a river/floodplain environment including infection risk assessment by QMRA. Best available data on fecal indicator bacteria, genetic microbial source tracking (MST) markers, and reference pathogens can be combined to support source-targeted calibration of the model. Additional reference pathogens can be selected based on assumed source concentrations to support cross-comparison of infection risks. The hydrological situation and the importance of animal and human pollution sources can be considered by scenario analysis. Results inform about sustainable catchment protection measures and required log-reductions of pathogens during treatment and disinfection to meet a maximum tolerable infection risk. Both, drinking water safety management and infection risks associated during bathing activities can be considered. The scientific model software was recently launched at the World Water Congress in Brisbane and can be downloaded at www.waterandhealth.at. The aim of the presentation is to demonstrate the model application at the River Danube and associated river/floodplain area in Austria used for drinking water production and recreation focusing on the impact of human sources. The model was calibrated by the use of human-associated MST markers (qPCR data). In this regard it was proven that the required quantitative sensitivity and specificity of the selected human-associated genetic fecal qPCR markers were successfully supported by the assay characteristics (i.e. simulations showed that MST marker concentrations due to false positive signals from animal sources had negligible effects on the calibration

Page 3 of 99

efforts for the human-specific emission patterns). Based on the calibrated model, low and high fecal contamination scenarios (e.g. wastewater treatment with and without disinfection, variable percentage of visitors that practice open defecation, low to high viral prevalence of pathogens) could be compared to evaluate sustainable water safety management scenarios for the considered catchment. Using human enteric viruses (i.e. entero- and noroviruses) required log-reduction during river bank filtration and final disinfection could also be calculated to support safe drinking water production in respect to the different scenarios. Further strategies and challenges to include also animal MST markers for multiple-source calibration will be discussed. This is a joint publication within the Interuniversity Cooperation Centre for Water and Health. Schijven, J, Derx, J., De Roda Husman, A.M., Blaschke, A.P. & Farnleitner AH (2015) QMRAcatch - Microbial quality simulation of water resources including infection risk assessment. J. Environ. Qual. 44(5): 1491-1502 QMRA (Quantitative Microbial Risk Assessment) of a Wastewater System Undergoing a Novel Treatment Process for Rural Environments in a Developing Country Bettina Genthe, CSIR Impartially treated wastewater may pose a public health risk due to the presence of pathogenic bacteria, enteric viruses, and protozoa into receiving waters causing potential health risks to surrounding communities through unintentional exposure. Conventional treatment processes such as activated sludge and biofilms are seldom used in rural South Africa due to lack of electricity and financial resources. Therefore, it is important to search for possible alternative options to improve the effluent of WWTPs in Southern Africa since classic ponds (waste stabilization ponds) have been used as wastewater treatment option in most of the rural areas of Southern Africa. Phyco-remediation is an environmentally friendly and cost effective alternative treatment option for rural areas. There are several ways in which an individual can acquire disease from wastewater: direct ingestion of the wastewater or aerosols created during spray irrigation may result in infection. In addition, infection may occur from ingestion There are several ways in which an individual can acquire disease from wastewater: direct ingestion of the wastewater or aerosols created during spray irrigation may result in infection. In addition, infection may occur from ingestion of pathogens on contaminated vegetation, oysters or other surfaces. Both fecal indicator organisms and specific pathogens were tested for in the ponds of the wastewater treatment works. To calculate microbial risk, the density of pathogens (number of micro-organisms per liter) in the source water were quantified and entered into the risk model. The sources of information for quantifying pathogen density in source waters were water samples collected from the site and analyzed for the presence of pathogens as well as modelling scenarios based on presence of indicator organisms. In this study surrogate pathogenic viruses and parasites were initially analyzed followed by indicator organisms to model changes. Doses were calculated based on a few hypothetical volumes of ingestion (accidental or deliberate) and frequency of exposure to provide a range of probabilities of infection. The probability of infection is reduced from almost certain (95% or 0.95) in wastewater that enters the pond system to a probability of infection of ~6 in 10,000 from exposure to pathogenic E. coli in treated effluent assuming a single exposure event of 1 ml. For Giardia, the probability of infection was reduced from 2% at the start of the wastewater treatment process to 0.08% in the final effluent. Risks for exposure to viruses were not as effectively reduced where where the probability of infection from untreated wastewater was almost definite - starting at 64% and reduced to 55% in final effluent. This study has shown how QMRA can be used to identify where additional processes will need to focus to reduce viral concentrations as well as illustrating the effectiveness of the phyco-remediation. Separating Uncertainty from Variability in QMRA to Support Management Decisions Patrick Smeets, KWR Watercycle Research Institute The WHO report 'Quantitative microbial risk assessment: application for water safety management' discusses the need to separate variability and uncertainty in QMRA for risk management decisions. This study demonstrates how quantifying statistical uncertainty separately from variability helps to answer risk manager questions such as: - How many samples are needed for 95% certainty about annual and maximum daily risk? - Can I reduce the number of samples by increasing the sample volume? - What is the predicted 1/20 year maximum annual and daily risk? Monitoring data of pathogens and indicator organisms in source water and treatment, collected for the statutory QMRA in the Netherlands, was obtained from the water utilities. A Gamma distribution was assumed for pathogens in source water and a Beta distribution for treatment efficacy. Using a Markov Chain Monte Carlo (MCMC) model the Maximum Likelihood Estimates (MLE) of distribution parameters and their uncertainty were calculated. Annual and daily pathogen concentrations were predicted with a second order Monte Carlo simulation to include parameter uncertainty. The source water concentrations of Cryptosporidium, Giardia, enterovirus and Campylobacter were assessed for 51 datasets from 6 water supply systems. The uncertainty about the mean and peak concentrations was strongly correlated to the number of positive samples. With four positive samples the uncertainty (95% interval) was less than 1 log unit and the maximum (95% quantile) exceeded the MLE less than 0.7 log unit, regardless of the total number of samples. With 25 or more positive samples, the uncertainty is reduced to less than 0.5 log. The required sampling program to obtain sufficient positive samples can be designed based on the distribution. When only one (or no) sample is positive the uncertainty reaches 7 log and parameter estimation can become unstable. However, uncertainty mainly concerns the concentrations below the MLE. The estimated maximum (95%) is less than 1 log above the MLE which may provide sufficient certainty that the risk target isn’t exceeded, despite the low number of positive results. The same relation between uncertainty and positive samples after treatment was observed, but this needs to be confirmed with more data. We recommend several years of monitoring since observed variation between years was larger than predictions based on one year. Differentiating between variation and uncertainty resulting from data limitations allows a clear discussion between risk managers and regulators on required monitoring. While daily

Page 4 of 99

concentrations may be highly variable over the year, only a limited number of positive samples is needed to obtain sufficient certainty in QMRA. The approach provides a basis for risk based monitoring with efficient use of resources. Other sources of uncertainty in QMRA and data from other geographical regions with more variation will be included in the same risk model at a later stage. 10:30 AM – 12 PM Grumman Evaluation of Digital Droplet PCR (ddPCR) for Improved Microbial Source Tracking Jean Pierre Nshimyimana, Nanyang Technological University & Singapore MIT Alliance for Research and Technology Additional Authors: Mercedes Cecilia Cruz; Stefan Wuertz; R. Janelle Thompson This study addressed whether digital droplet PCR (ddPCR) could improve sensitivity and specificity of human-associated Bacteroidales genetic markers and their quantification in environmental and fecal composite samples. BacHum and B. thetaiotaomicron α-1-6, mannanase (B. theta), previously validated for microbial source tracking in Singapore and Southeast Asia, were tested in 180 samples and quantified by qPCR and ddPCR (n = 35 human stool, n = 70 domestic and wild animal feces, n = 20 sewage, n = 20 environmental and n = 35 composite samples). Quantification of BacHum by ddPCR increased specificity (from 0.70 to 0.90) and accuracy (from 0.80 to 0.94) relative to qPCR, while the B. theta marker performed similarly on both platforms (specificity = 0.98 for qPCR and ddPCR). DdPCR and qPCR quantification of environmental and fecal composite samples were highly correlated (R > 0.87, p<0.0001, n = 110) where concentrations measured by ddPCR were consistently lower than those measured by qPCR, by a factor of 3.3±1.6 for B. theta and by a factor of 14.4±8.5 for BacHum. High differences between quantifications by qPCR and ddPCR for BacHum concentrations were associated with a systematic error in the qPCR standard curve, while similar errors were not observed in the quantification by ddPCR. Hence ddPCR was the preferred method by removing systematic errors associated with the standard curve and improving quantification of samples with low target concentrations (n=41for BacHum & B. theta) that were not reliably assessed by qPCR. The BacHum and B.theta assays, once adapted for ddPCR, achieved similar or improved performance relative to previously established qPCR assays. We conclude that ddPCR is a suitable tool for microbial source tracking; however, other factors such as cost-effectiveness should be considered Key words: Digital droplet PCR, Human-associated Bacteroidales genetic markers, real-time PCR (qPCR), microbial sources tracking, standard curve, sensitivity and specificity. Rapid in Situ Physico-Chemical Disinfection of Hospital Sewage and Human Fecal Waste Emanuele Sozzi, University of North Carolina at Chapel Hill Additional Authors: Joseph Strasser; Grace Allen; Noor Baloch; Juan Carlos Camacho; Sam Fait Elmes; Gregory D. Gadai; Nadia Mishal; Alexis Valenti; Lisa Casanova; Mark Sobsey Background Feces and other body fluids from Ebola cases in healthcare facilities in the U.S. can be discharged directly to local sewage systems, according to CDC guidance. However, this may put sewer workers and their community at risk. Therefore, research is needed to define protocols to inactivate Ebola virus and surrogates in human fecal wastes in situ and before discharge. Research aim The major goals of the project are to provide critical and timely quantitative information on the rapid on-site chemical disinfection of Ebola virus through a detailed study performed using several candidate indicator/surrogate viruses in feces and raw sewage and a mutant Ebola virus (ΔVP30). Material and methods After preliminary studies, a complex and realistic fecal hospital waste matrix was made by mixing 25% fresh fecal sample collected from volunteers with 75% fresh unpasteurized raw hospital sewage. Then four different viral surrogates (MS2, Φx174 and Φ6 bacteriophages, TGEV) were spiked at different concentrations. At each experiment repetition one of the tested disinfectants (chlorine, lime, benzalkonium chloride etc.) was spiked at one of the many tested concentrations, mixed and neutralized after the selected contact time (1, 3, 10 and 30 min). The kinetics and extent of inactivation of the infectivity of surrogate viruses was then quantified. Results CHLORINE Only an incredibly high concentration of added chlorine would allow a 1log10 MS-2 reduction over 10 minutes. PhiX-174 showed a lower resistance, but still required incredibly high chlorine concentrations. Enveloped Phi-6 bacteriophage experienced greater inactivation, but only very high concentrations of added chlorine allowed a 5Log10 reduction. TGEV proved to be very resistant to chlorine and never reached the 5Log10 reduction threshold not even at the highest chlorine concentration. HYDRATED LIME Reasonable concentrations of added lime would allow a 5log10 MS-2, PhiX-174 and Phi-6 reduction over 10 minutes. TGEV proved to be more resistant to lime, which is a very interesting finding and never fully reached the 5Log10 reduction threshold, but came close to that at the highest lime concentrations. BENZALKONIUM CHLORIDE MS2 and PhiX-174 proved to be incredibly resistant to this disinfectant with almost no decay at any tested concentration. Phi6 proved to be less resistant, but never reached the 5Log10 reduction threshold. TGEV also proved to be more resistant to benzalkonium chloride, which is very interesting and never went beyond the 1.5Log10 reduction. Disinfection experiments performed through other disinfectants are also in progress and the results will be reported in the presentation. Conclusions The results from this study are currently informing the design of effective on-site management systems and protocols in healthcare and other settings to reduce the risks of the spread of Ebola and other high risk viruses fecally shed by people sick with the diseases they cause.

Page 5 of 99

On Rapid Assessment Methods Using Statistical Modeling: Multiple Least Squares Regression vs. Logistic Regression Jay Fleisher, NOVA Southeastern University BACKGROUND: There is a need to develop rapid assessment of bacterial water quality. To this end many statistical models have been published mostly using-environmental variables to predict concentrations of a particular FIO. The majority of these statistical models have used Multiple Least squares regression in which the major indicator of the goodness of fit of these models have largely depended on the R2 value, which to date have been quite low. Since Beach management decisions have to be dichotomous in nature (Open/Close Beach) we explored the use of the multiple logistic model in relation to the Multiple Lease Squares approach. METHODS: 668 samples were utilized in this analysis. 10 major environmental variables and several FIO's were collected on each sample date. Both types of models were run on these data. RESULTS: Our Best Multiple Least Squares Regression was computed with a R Square value of 0.26, while the Multiple Logistic Regression Model yielded a maximum Sensitivity of 72.9% and a maximum Specificity of 65.9% at a cut point = 0.1. A backward selection routine was used in both the Logistic and Least Squares Model. CONCLUSIONS: Since the Logistic regression yields a much less nebulous goodness of fit statistic coupled with the fact that the Beach Managers decision is a dichotomous one, more attention should be paid to research using the Multiple Logistic Model. Electrochemical and Colorimetric DNA Aptasensor Technologies for Rapid Norovirus Masaaki Kitajima, Hokkaido University Additional Authors: Seiya Hirano; Akihiro Okamoto; Daisuke Sano; Hisashi Satoh; Satoshi Okabe Recently, aptasensor (aptamer-based biosensor) technology has been attracting much attention as a new method in the field of environmental sensing as well as clinical virology. This is primarily because aptamers, synthetic nucleic acids that fold into unique three-dimensional conformations capable of binding a specific target, have shown advantages over other molecules as a recognition element for biosensing: low production cost, high thermostability, etc. In this study, we aimed to develop aptasensor platforms based on two different transduction principles, namely, electrochemistry and gold nanoparticle (AuNP)-based colorimetric measurement, and evaluated their performance with respect to sensor response to murine norovirus (MNV), an experimental model of human norovirus. An electrochemical aptasensor was prepared by immobilizing a thiol-modified MNV-specific aptamer on a working electrode through the affinity between thiol and gold. Cyclic voltammetry examining [Fe(CN)6]3-/4- redox couple demonstrated that the redox current obtained from the electrode after aptamer immobilization showed significant decrease of current magnitude in comparison with the bare electrode, indicating the formation of aptamer monolayer on the electrode surface. To evaluate the potential ability of the electrochemical aptasensor for virus particle detection and quantification, square wave voltammetry measurements were performed for a series of dilutions of MNV. The magnitude of [Fe(CN)6]3-/4- redox peak current relative to a baseline decreased in a titer-dependent manner, demonstrating good linearity of the electrochemical aptasensor response against different titers of MNV. The other aptasensor platform, AuNP-based competitive colorimetric sensor, consists of the MNV-specific aptamer, AuNPs, and UV/Vis absorbance measurement. Its sensing mechanism is based on the aggregation of AuNPs induced by NaCl in the presence of target owing to the formation of aptamer-target complex. The AuNPs-aptamer mixture in the presence of target displays blue-shifted optical absorbance spectra as compared to the spectra in the absence of target where the NaCl-induced aggregation of AuNPs is inhibited by the electrostatic repulsion between aptamer-coated AuNPs. The absorbance ratio at 650 and 520 nm, which represents the degree of AuNP aggregation, increased with increasing titers of MNV spiked in pure water as well as in environmental water. In summary, we exploited electrochemical and AuNP-based colorimetric aptasensor technologies for rapid norovirus detection, both of which could detect input MNV of as low as 1 plaque-forming unit or lower, and demonstrated their potential capability for virus quantification. These aptasensor technologies are simple enough to allow for designing a portable device for on-site norovirus detection in environmental and clinical samples without specialized training, which offers great potential to contribute to improved public and environmental safety. 2:30 – 3:30 PM Grumman A Decision Support System (DSS) for Recreational Water Use - Revision of the South African Water Quality Guidelines Bettina Genthe, CSIR Additional Authors: Maronel Steyn; Marius Claassen The South African Water Research Commission and Department of Water and Sanitation (DWS) embarked on revising the 1996 South African Water Quality Guidelines. The guidelines will be primarily a software-based decision support system (DSS) and "risk-based" to indicate the suitability of water, in terms of risk of specific adverse effects. The overall DWS initiative aims to develop a DSS for all significant water users, with this project addressing guidelines for recreational water use. The guidelines, in addition to being risk-based, will also be activity- and site-specific recreational water quality guidelines to enable a tiered approach to improve water resource management. Public health risks associated with recreational water activities are predominantly due to microbial microorganisms, however, chemical and physical hazards are

Page 6 of 99

also considered. Exposure assessment is the most important factor, as different levels, frequency of contact and events will determine the possible risk. Considerations that are essential but cannot be included in a DSS risk-based guideline should be dealt with through water safety plans and IWRM approaches. As a tiered approach is used, the DSS will allow the end-user to alter certain parameters under specific conditions requiring a detailed motivation why this is warranted. For example, in one section of the country, natural surface water pH values are in the range of 4 - 5. Cultural and religious activities such as baptisms, initiation ceremonies and rituals to name a few, are included in the revision of the recreational guidelines, necessitating a better understanding of the potential exposure/s. Acceptable risk will not be prescribed in the revised guidelines but will be put into perspective by comparing to international recreational water quality guidelines and swimming associated illness rates. The current US-EPA Recreational Water Quality Criteria (2012) allows between 32 and 36 gastro-intestinal illnesses per 1000 primary contact users (U.S. EPA, 2012). The DSS is a risk-based software tool developed to present human health risks based on different exposure scenarios, likely levels of contact and likely exposure to different volumes of water (ingested) reported in international literature and likely associations with health impacts. All routes of exposure are addressed which is specifically relevant in the case of cyanobacterial toxins which can lead to adverse health effects through inhalation, ingestion or dermal contact. This data is built into the DSS to allow for water resource managers to assess likely risk or fitness for use at specific sites based on different recreational activities. Algorithms for individual parameters have been developed for the DSS and will demonstrate uncertainties where possible. Use of Somatic Coliphages Measured in Real Time (4 hours) in the Prediction of Fecal Contamination in Recreational Mediterranean Waters Anicet Blanch, University of Barcelona Additional Authors: Francisco Lucena; Xavier Varela; Anna Llopart-Mascaró; M.José Chesa; Juan Jofre Rapid testing of either pathogens or indicators is of paramount importance in water management. Too often, with the present methods the results of microbial analyses are available long after the management decisions have been taken. Somatic coliphages (SOMCPH) are gaining ground as valuable indicators of fecal contamination, being appropriate viral surrogates, and are being gradually included in water quality guidelines. This study aims to evaluate an early reading, 4 hours, of the plaques determined by the double agar layer methods of somatic coliphages according to the ISO standardized method (ISO 10705-2). The results of the early reading of plaques was compared to the plaques determined by the ISO standardized quantification at 18 hours. First, plaques in hundreds of tests were counted at 4 and 18 hours. With these results, two linear models were defined when the numbers of bacteriophages determined at 4 hours were greater than 4 plaques per plate. Regression models were developed to predict the numbers at 18 hours. For counts at 4 hours ≤ 26 PFU, the model gives that the N. of PFUs at 18 hours = 1.48 x N. of PFUs at 4h+1.97 and for higher plaque counts the linear model gives that the N. of PFUs at 18 hours = 1.18 x N. of PFUs at 4h+2.95, in both cases with a CI of 95%. This approach was applied for predicting in 4 hours the recreational water quality during the bathing season. Samples were taken in different beaches of the Barcelona shoreline, in situations of drought and after heavy rain events that are frequent at the end of the summer in the area. E. coli and enterococci in 100 ml and SOMCPH (at 4 and 18 hours) in 10 ml were determined. The output of these determinations shows that the results of coliphages at 4 hours allow constructing models to predict the numbers of E.coli and enterococci. Thus, the equations describing the relationships between E. coli and enterococci with somatic coliphages determined at 4 hours are Log. E.coli (CFU/100ml) = sqrt (1,2446+4,5806 x Log.SOMCPH PFU/10ml) and Log. enterococci (CFU/100 ml) = sqrt (0,84354+4,4389 x Log.SOMCPH 4h (PFU/10ml)), respectively. The adjusted model explains 79.21% and 84.03 of the variability of E. coli and enterococci numbers respectively. The non-fitting values correspond either to values of SOMCPH < 1 per 10 ml or to values of SOMCPH after heavy rain that persist high for longer (36-48 hours) than the values of bacterial indicators. These observations indicate that coliphages determined at four hours, by any method, can be used to build prediction of numbers of bacterial indicators facilitating the real-time decision-making on beaches with objective knowledge on water quality, both in drought periods but especially after heavy rain episodes or under suspicion of sewer discharges. Results also reinforces the convenience of including phages as additional indicators of water quality of bathing waters and open the door to rethinking regulations of bathing water management. A Fast Method for the Detection of Somatic Coliphages, Used as Indicators of Viral Fecal Pollution in Water Maite Muniesa, University of Barcelona Additional Authors: Elisenda Ballesté; Lejla Imamovic; Miriam Pascual-Benito; Anicet Blanch; Francisco Lucena; Juan Jofre Coliphages have been proposed as indicators of fecal and viral pollution in water and food as one of the most suitable methods in terms of reliability, reproducibility, and cost effectiveness. Several countries propose to include or have already included them in their water management policies. Standardized methods (ISO, EPA) for their enumeration are available, but their implementation in routine laboratories will be definitely easier if user-friendly commercial kits become available. This study presents a newly developed method for the evaluation of somatic coliphages. The method based in the use of a tailored Escherichia coli host strain that allows detection of less than 10 somatic coliphages in less than 3:30 h, well below the ordinary working hours in a day. The genetically engineered host strain WG5 presents a replacement of uidB and uidC genes encoding the transport of the glucuronic acid inside the cell, and overexpression of uidA, encoding the enzyme β-glucoronidase. Because of the inability of the strain to incorporate the substrate inside the cell, the substrate only reaches the enzyme after the lysis of the bacterial cells caused by phages. After phage-mediated lysis, the intracellular accumulated enzyme is released to

Page 7 of 99

the medium producing a change of color from yellow to dark blue. The sensitivity and rapidness of the method has been tested using laboratory phage isolates and fecal polluted water with different impact. The occurrence of phages in these samples was also tested by double layer plaque assay. Positive results were obtained after 1:30 h of incubation for river water and sewage samples with 500 and 50 phages. Assays with 5 phages still showed positive results after only 2:15 h of incubation. Controls without phages did not turned blue during the assay. Incubation temperatures ranging from 30ºC to 44ºC provided results at the same times. At 20ºC and 25ºC results can be also obtained although they require some more time to come out. The modified host strain detected the same number of phages than the wild type strain when using the standard ISO. The method is applicable to different types of liquid and solid samples (evaluated using sludge and mussels); it is adaptable to different volumes (from 50 or 100 ml of water sample to a down-scaled approach by applying microtiter plates), and provides a qualitative positive/negative results that can be used for quantitative analysis applying the Most Probable Number (MPN). Comparison of somatic coliphages densities by MPN calculation based on results of the method, by MPN calculation based on spot test results and phage enumeration following the standard ISO method did not show significant differences. Here we present the fastest microbiological method detecting culturable microorganisms for the determination of fecal pollution reported so far. Windflower Bacterial Community Profiling of Shellfish and Waters in a Shellfish-Harvesting Area and its Catchment in France Mohamed Amine Boukerb, IFREMER Additional Authors: Michele Gourmelon; Emmanuelle Quenot; Balamuralikrishna Jayaprakash; Tarja Pitkänen The microbiological quality of coastal environments can be affected by pollution from catchments. In fact, by their filter-feeding activity, bivalve shellfish may accumulate microorganisms from the surrounding waters. This study aims to evaluate the bacterial diversity in shellfish, marine and river waters. A total of 61 shellfish (oysters, Crassostrea gigas; mussels, Mytilus edulis; cockles, Cerastoderma edule), 46 river and eight marine water samples were collected from February 2013 to September 2014 in La Fresnaye bay (France). Bacterial DNA was extracted from water and shellfish (intravalvular liquid named IL, digestive tissues named DT) samples. The bacterial community was characterized by generating sequence reads of the V3-V4 16S ribosomal region by using Illumina MiSeq PE300 platform. The sequences were processed using QIIME and assigned to family level of taxonomy using an open reference approach for OTU picking. A high level of bacterial diversity was observed; 170 and 102 bacterial families were identified in shellfish, respectively, and 200 and 270 in marine and river waters, respectively. A high proportion of unassigned reads was observed in some samples (i.e., mean sequence abundance of 48.2% in oysters and cockles, and 29.5% in DT of mussels). Interestingly, a lower share of unassigned reads was observed in IL of mussels (only 4.2% of the total flora), indicating a probable concentration of well characterized bacterial communities from the surrounding waters. Diversity analyses indicated that the oyster and cockle microflora were comparable and dominated by sequences belonging to the Mycoplasmataceae (mean sequence abundance of 16%). Fewer Campylobacteraceae and Legionellaceae were present in cockles, whereas Vibrionaceae and Helicobacteraceae were detected in oysters. The principal families recorded in the DT of mussels were Flavobacteriaceae (15.25%), followed by Cardiobacteriaceae (12.7%) and Mycoplasmataceae (6.1%). Interestingly, the IL microflora of mussels seem to be distant and well characterized with 15.9% of Flavobacteriaceae, 10.9% of Mycoplasmataceae and 10.8% of Rhodobacteriaceae. In seawater, Rhodobacterraceae (25.1%), Flavobacteriaceae (20.3%) and Oceanospirillaceae (5.7%) were the most abundant suggesting a shared core-community with the shellfish. In addition, dominance of Flavobacteriaceae in river waters (19.4%) suggests a continuum from river waters from the upstream catchment to shellfish through coastal waters. This study is to our knowledge the first time that the MiSeq NGS platform is used to explore the microflora of various shellfish (in both IL and DT) in relation with surrounding waters and upstream river waters. While high diversity was observed in shellfish and water samples, Flavobacteriaceae were ubiquitous in all samples. To identify the potential sources of shellfish contamination, the future work will focus on source tracking of bacterial communities of human and animal fecal origin. Diversity of Campylobacter Lari, the Most Frequent Campylobacter Species in Shellfish and Marine Waters, in a Shellfish-Harvesting Area and its Catchment in France Michele Gourmelon, IFREMER Additional Authors: Joelle Cozien; Cécile Walczak; Céline Hubert; Mohamed Amine Boukerb; Alain Rincé; Ragimbeau Catherine; Joel Mossong; Henry-Michel Cauchie; Christian Penny The microbiological quality of coastal environments can be affected by faecal pollution from urban and agricultural sources and by wildlife. Campylobacter is the most common causative agent of human bacterial gastroenteritis and is frequently disseminated through surface water. The aims of this study were to evaluate the occurrence of Campylobacter spp. in a shellfish-harvesting area and its catchment, and to specifically evaluate the diversity and distribution of a selection of C. lari isolates from surface water and shellfish. Methods The site is located in the Brittany region in France, characterized by intensive livestock farming (cattle, pigs, and poultry). The shellfish-harvesting area is classified as B-category for mussels and oysters and as C-category for burrowing shellfish according to European regulations. Shellfish (n=120), river water (n=96), marine water (n=12) and sediment (n=14) samples were collected from February 2013 to January 2015. The detection of Campylobacter spp. was investigated using qPCR, the EN.ISO.10272 culture method and a selective passive-filtration approach (water samples only). Among the Campylobacter spp. collection, a total of 192 C. lari isolates were analysed by Whole Genome Sequencing

Page 8 of 99

(WGS). Genomic DNA was extracted using GenElute (Sigma). Sequencing libraries were prepared with the Nextera kit (Illumina) and sequenced on an Illumina MiSeq instrument. Genome assembly and genotyping based on MLST profiles (http://pubmlst.org/campylobacter) were performed with the SeqSphere+ bioinformatics toolkit (Ridom). Results Campylobacter spp. were isolated in 87.5% of river water, 58.3% of marine water, 37.5% of shellfish, and 28.6% of sediment samples. Among the 1,100 Campylobacter isolates, C. jejuni (n = 296) and C. coli (n = 448) were the most frequently isolated species in river waters (35.5% and 55.7%, respectively), whereas C. lari (n = 348) was predominantly observed in shellfish and marine waters (87.7% and 52.1%, respectively). A high genetic diversity of C. lari was observed with 81 different Sequence Types (STs), among which 78 newly described STs. Only 10 STs were found in multiple locations and three were detected on multiple occasions in the same location. Only part of the STs from shellfish were close to STs isolated from the upstream catchment, with only a single ST isolated both in water and shellfish. These findings suggest different sources and/or ecological characteristics that might be at the origin of the presence of specific C. lari types in shellfish. Conclusions This is the first study describing the high diversity of C. lari in a shellfish-harvesting area using WGS data, and highlights the high prevalence and dominance of C. lari in shellfish. Within the next steps, the WGS data will undergo further analyses, by considering e.g. cgMLST and the detection of virulence genes. Furthermore, the collection will be compared to C. lari isolates from humans and from wild birds in Brittany. Fecal Pollution and Microbial Source Tracking in Shellfish Harvesting Waters in the Gulf of Nicoya, Costa Rica Erin M. Symonds, University of South Florida Additional Authors: Suzanne Young; Matthew Verbyla; Shannon McQuaig-Ulrich; Erick Ross; Jorge Jimenez; Valerie Harwood; Mya Breitbart Microbial water quality monitoring is based upon culturable fecal indicator bacteria (FIB; specifically, fecal coliforms) in Costa Rica, where as little as 5% of the domestic wastewater receives treatment prior to surface water discharge. Additionally, the feces of livestock and other domesticated animals receives little to no treatment. Since there are variety of animals that can contribute to poor water quality in a watershed, it is imperative to identify the principal source of fecal pollution to manage water quality and public health risks. The main objective of this study was to determine the microbial water quality as well as the sources of fecal pollution in oyster harvesting waters in the Gulf of Nicoya, a medium-sized, tropical estuary located along the Pacific coast of Costa Rica. Since no previous investigations have incorporated a microbial source tracking (MST) toolbox approach to characterize microbial water quality in Costa Rica, the specificity and sensitivity of a suite of established MST markers for cows, dogs, birds, horses, pigs, and humans were determined using feces and domestic wastewater collected in the watershed. For the animal-associated assays (BacCow, BacCan, DogBac, GFD, Gull2, HorseBac, HoF, PF), the sensitivity ranged from 13 to 100% and the specificity ranged from 38 to 100%. For human and domestic wastewater-associated assays, pepper mild mottle virus (PMMoV) and human polyomavirus (HPyV) had 100% specificity; the HF183 Bacteroidales marker had 94% sensitivity. Since PMMoV was always detected in domestic wastewater and was quantified in concentrations up to 1.1 × 105 copies/ml, this virus was identified as an important component of the Costa Rican MST toolbox. The surface water quality of four oyster harvesting waters was characterized monthly during 2015 using culture-based methods for Escherichia coli and (RT)-qPCR for E. coli, Enterococcus spp. (Entero1A), HF183, PMMoV, and HPyV. Even though high concentrations of culturable E.coli (>100 MPN/100 ml) were detected, particularly in the rainy season, all human/domestic wastewater-associated markers were negative and low E.coli and Entero1A qPCR target concentrations were measured. Consequently, all sites were considered safe for oyster harvesting. The results of non-parametric multivariate analysis of variance did not identify significant differences (α = 0.05, p = 0.3700) in FIB concentrations among the four sites; however, FIB concentrations were significantly different between the dry and rainy seasons (α = 0.05, p = 0.0200). While future research is needed to expand the sample size of this study, this investigation is the first of its kind in Costa Rica and demonstrates the importance of a MST toolbox approach to effectively manage microbial water quality in tropical regions that lack wastewater treatment. Dogwood Selective Grazing by Free-Living Amoebae May Modify the Bacterial Community and Select Opportunistic Pathogens like Legionella in Drinking Water Systems Mohamed Shaheen, University of Alberta Additional Author: Nicholas Ashbolt Most bacteria present in drinking water grow in biofilms within drinking water distribution systems and premise plumbing. Free living amoebae (FLA) are also a part of the drinking water biofilm community. As food, bacteria provide selections for their FLA predators, which along with bacteriophages provide dynamics to the ecology of the drinking water biofilm community. Using fluorescent microscopy we examined the interactions between the amoeba, Willaertia magna and three water-related bacterial species, Legionella pneumophila (with green fluorescent protein), an opportunistic water-based respiratory pathogen, Vibrio cholerae (with red fluorescent protein), an enteric pathogen and Escherichia coli (with blue fluorescent protein), as a representative of water quality indicator to have an initial understanding of the microbial selection processes through amoebae-bacteria interactions within drinking water. W. magna exhibited a variable preference for the three bacterial species, depending on which were present. With all three bacterial species present in a homogenous equal-ratio suspension, W. magna preferred and selectively phagocytosed E. coli first, then V. cholerae, but no L. pneumophila. E. coli was digested very rapidly (in 6-24 h) within

Page 9 of 99

W. magna's food vacuole, whereas V. cholerae showed initial resistance to the digestion process but eventually was digested by the amoeba after 48-72 h of inoculation. Although L. pneumophila appeared to be the least preferred prey for W. magna, when internalized, L. pneumophila exhibited resistance to digestion and grew intracellularly and eventually lysed the amoeba trophozoites. Most interestingly, trophozoites that had recently acquired L. pneumophila (i.e. prior to visual infection) also phagocytosed E. coli and V. cholerae when subsequently were added to the amoeba culture, but their digestion was inhibited. Thus L. pneumophila seemed to interfere with the overall digestion process of the amoeba not only within the L. pneumophila containing food vacuoles. To the best of our knowledge this is the first visual evidence illustrating the complex interactions between a FLA and bacterial populations in a drinking water environment. This work demonstrates the need to better understand the range of ecological interactions and associated effects on microbial population dynamics within engineered water systems when considering control options for various Legionella spp. and other similar saprozoic, water-based opportunistic pathogens. Moreover, current culture-based monitoring method for L. pneumophila is unable to identify true health risk due to the usual occurrence of viable but non-culturable forms in response to nutrient limitation and residual disinfectants. Thus a more nuanced understanding of drinking water microbial ecology may also help to develop better water quality monitoring tools by identifying surrogate organisms or population shifts reflective of conditions for opportunistic pathogen growth. Free-Living Amoebae and Persistence of Internalized Human Enteroviruses Nikki Atanasova, University of Alberta, School of Public Health Additional Authors: Qiaozhi Li; Rafik Dey; Candis Scott; Xiao-Li (Lily) Pang; Nicholas Ashbolt Free-living amoebae (FLA) are phagocytic eukaryotes ubiquitous to natural and engineered aquatic environments. They have two life forms - an actively feeding trophozoite and a dormant cyst. The trophozoites feed on organic particles and smaller microorganisms, including amoeba-resistant human pathogens, which may also persist in amoebic cysts. The cysts not only provide shelter from environmental stresses (biocides, desiccation etc.) and a subsequent niche for growth post-excystation, but can also aerosolize from water systems together with the internalized pathogens. An important example is Legionella pneumophila, the major cause of Legionnaires' Disease through aerosol infection via lung macrophages. Other common human pathogens, such as waterborne viruses, are important agents via recreation and engineered water systems exposures; environments where FLA graze on organic particles and biofilms. When adsorbed to organic particles, viruses may withstand UV and chlorine treatment of waters for long enough to become potential FLA prey. Our knowledge on amoeba-virus interactions, however, is very limited. Among reported instances (i.e. Adenoviruses, Noroviruses, Coxsackieviruses, and Mimiviruses), combined evidence of viral localization in FLA, replication, and retention of infectivity is minimal. Enteroviruses (such as Coxsackieviruses) are important waterborne pathogens, which can infect all epithelial cells (including the airway epithelia) as well as cardiac muscles, and in some cases lung macrophages. These human viruses pose a threat especially to children and immunocompromised individuals. To explore virus-amoebae interactions, we co-cultured the commonly found FLA Acanthamoeba polyphaga with a trypsin-resistant clinical isolate of Coxsackievirus B5 (Enterovirus B5). Virus copy number was quantified by qPCR during co-culture, while a combination of Tissue-Culture Infectious Dose-50 (TCID50) and qPCR provided data on viral specific infectivity. In addition, immune-fluorescence microscopy confirmed that the virus was internalized by the feeding trophozoites. A measureable fraction of internalized Enterovirus B5 resisted digestion by A. polyphaga and remained infectious for the duration of the experiments, while the growth and encystment rate of the amoebae appeared unaffected. However, additional experiments showed that in non-nutrient media some of the FLA appeared to use the virus as a source of nutrition. Understanding FLA-virus interactions could be important in explaining 'over-wintering' of these pathogens during non-outbreak periods for waterborne viruses. Etiologic Agents of Symptomatic and Asymptomatic Enteric Infections Among Children in Maputo, Mozambique: Baseline Data from the MapSan Study Jacqueline Knee, Georgia Institute of Technology Additional Authors: Trent Sumner; Oliver Cumming; Joseph Brown Persistent asymptomatic enteric infection can have long term and far-reaching effects on child health and well-being. Both symptomatic and asymptomatic infection can contribute to the development of environmental enteric dysfunction (EED), a disorder associated with stunting, impaired cognitive development, and increased childhood morbidity and mortality. Risk of exposure to enteropathogens can be greater in low-income, informal settlements where high population density, poor sanitary conditions, and low-level access to safe sanitation coexist. The MapSan Trial examines the effect of providing new, urban shared sanitation on the risks of enteric infections in children <5. Here we report baseline data from MapSan, with a focus on the etiologies associated with both symptomatic and asymptomatic enteric infection. Stools from children aged <4 were assayed using a multiplex, molecular-based, diagnostic assay to identify current infections of Campylobacter jejuni, Salmonella spp., Shigella spp., enterotoxigenic Escherichia coli [ETEC], Shiga toxin-producing E. coli, E. coli O157:H7, Vibrio cholerae, Yersinia enterocolitica, toxigenic Clostridium difficile, Giardia lamblia, Cryptosporidium spp., Entamoeba histolytica, Rotavirus A, Norovirus GI/GII, and Adenovirus 40/4. Stools were also assessed for the presence of soil-transmitted helminths (STH) using Kato-Katz. Self-reported diarrhea data were available for each child providing a stool. 89% of stools (n=395) were positive for ≥1 viral, bacterial, or protozoan target, and 46% were positive for ≥1 STH; only 13% of caregivers reported diarrheal symptoms in the 7 days prior to enrollment. The most frequently detected pathogens among both symptomatic and asymptomatic children included Giardia (54%), Shigella (47%), Trichuris (38%), and ETEC

Page 10 of 99

(34%); pathogen prevalence increased with age with the exception of ETEC, for which prevalence was similar across age groups. Co-infection with ≥1 enteric pathogen was common and increased with age from 44% in infants to 63% in children aged 12-23 months and 75% in children older than 2 years. 87% of detected infections were asymptomatic and the prevalence did not vary with age. Norovirus GI/GII was the only pathogen significantly associated with reported diarrheal symptoms (OR=3.22 (1.22 - 8.51)): it was detected in 22% and 10% of symptomatic and asymptomatic children, respectively. While symptomatic enteric infection is a common metric for assessing child health in low-income settings, this work highlights the importance of also surveying for asymptomatic infections. Chronic exposure of the gut to enteropathogens, regardless of clinical symptomology, may result in EED and subsequent impairment of growth and cognitive development in children. When available, additional baseline data from the MapSan study, including for markers of EED, will be used to more fully assess the implications of both symptomatic and asymptomatic enteric infection on child health. Redbud Human-Associated Escherichia Coli Marker Genes Are Useful for Microbial Source Tracking in Florida Jacob Senkbeil, University of South Florida Additional Author: Valerie Harwood Genetic markers for human-associated Escherichia coli are novel tools for assessing human fecal contamination. Their potential is particularly compelling, as they can provide direct linkage of contamination source to the regulatory indicator organism E. coli. In this study two E. coli gene markers, H8 (sodium-hydrogen exchanger precursor gene) and H14 (ATP/GTP binding protein gene), were assessed for their performance characteristics (host-specificity and host-sensitivity) in microbial source tracking (MST), with additional assessment of marker suitability for environmental applications. Three hundred E. coli isolates from 10 target (human sewage) samples and 900 E. coli colonies isolated from 30 non-target (1 Cat, 3 Cow, 6 Dog, 10 Duck, 3 Feral Pig, 1 Gator, and 6 Horse) fecal samples were tested for marker presence by conventional PCR. Host-sensitivity values, or the percentage of target samples PCR positive for marker presence, were 100% for both H8 and H14. Host-specificity values, or the percentage of target and non-target samples PCR negative for these markers, were 90% and 83% for H8 and H14, respectively. Three non-target colonies (0.33%) tested false-positive for H8 (isolated from 2 horse and 1 gator sample), while 9 non-target colonies (1.00%) were detected as false-positive for H14 (isolated from 1 dog, 1 duck, 1 feral pig, and 2 horse samples). Field testing of the suitability of the H8 and H14 markers for microbial source tracking (MST) was conducted in water samples from water bodies that are not contaminated with human sewage. E. coli were isolated from water samples collected at six sampling sites within Reedy Creek Improvement District (RCID) in central Florida, and from a pond on the campus of the University of South Florida. H8 was not detected in any of the water samples tested, while H14 was detected in 43% of samples (comprising approximately 5% of isolates at three sites). These results indicate that H8 is most suitable for MST testing for human fecal contamination in Florida. Development of a quantitative PCR assay for the H8 marker for use in tandem with well-established markers for human contamination like HF183 may allow for a direct connection between microbial source tracking data and culturable bacterial data allowing for improved water quality assessment. A Meta-Analysis for Estimating the Persistence of HF183 Marker in Environmental Waters Jade Mitchell, Michigan State University Additional Authors: Sina Akram, Austin Wissler; Kara Dean; Yiseul Kim; Joan Rose Fecal indicator bacteria (FIB) have long been used by regulatory agencies for monitoring microbial water quality. FIB-based assays provide limited information about the origin of fecal pollution. In consequence, research efforts in the field of microbial source tracking (MST) have been made to develop host-specific markers. In recent years, methods to detect the 16S rRNA gene of members of the order Bacteroidales have emerged as an alternative assessment strategy for recent fecal contamination. The exponential decay model is typically used to evaluate all markers without consideration of fit. Results from seven different studies on the inactivation of FIB and HF183 in freshwater and seawater were collected for this study. Overall, the experiments were carried out with and without different treatments of ambient sunlight, dark environment, sediment exposure, reduced temperature, reduced predation, indigenous microbiota, and ambient sunlight and indigenous microbiota. Using maximum likelihood estimation and Bayesian Information Criterion (BIC) values as the basis for determining goodness of fit, 17 different persistence models were fit to each data set. The number of models fitting each data set was then narrowed down to a subset of good fitting models by comparing the visual and quantitative fit and by optimizing the parameters of each model. Overall, the JM2, JM1, and Gamma models were the best fitted models for all microcosms and treatments respectively. JM2, JM1, and Gamma models best fitted 32%, 18% and 13% of the experimental data respectively. Significant difference in the best fitted models was not observed between experiments with certain treatments and experiments without any treatments. Again, JM2, JM1, and Gamma were the most prevalently best fitted models for both with and without treatments data. The one-way ANOVA test (p<0.05) was used to determine differences between the BIC and fitting parameters between with and without treatment best fitted models. The BIC of the best fitted models for experiments with treatments for all markers and environments were significantly higher than that of the experimental data with no treatments. Therefore, the models used in this study perform better in describing the microbial persistence in environmental waters without any treatments than conditions where certain treatments are applied. However, no significant differences were found between the fitting parameters in with and without treatments best fitted models. The

Page 11 of 99

one-way ANOVA results showed no significant difference between the BIC of the fitted models between cultivation and qPCR methods. T90 values were significantly different when estimated conventionally with the exponential model. Therefore, such conventional decay models can be highly misleading in predicting the decay rate of markers. Based on the T90s estimated with the exponential model and the best fitted models herein, FIB persist longer than human Bacteroidales in the environment. Defining Novel Molecular Marker Candidates for Fecal Indication and Source Tracking Using a Metagenomic Vertebrate Fecal Source Database Georg Reischer, TU Wien, ICC Water&Health Additional Authors: Ruth Ley; Andreas Farnleitner Molecular detection methods for microbial pollution offer numerous advantages to culture-based microbiological approaches. Nucleic acid based approaches can be used to detect bacterial and viral pathogens, fecal indicators and source-associated microbial targets. They are highly versatile, can be applied on stored environmental samples and translated into high-throughput or rapid on-site formats. The basis for the development of molecular methods is detailed information on the composition of the target population, on the one hand, and a broad insight into the composition of the general microbial background population associated with the sampled environment on the other hand. Microbial source tracking for instance often aims at defining and detecting host-associated viral or bacterial target populations that are present in target sources but ideally absent in all other potential fecal sources. We established a fecal source database comprising 16S rRNA gene amplicon sequencing data from more than 450 fecal samples. These samples were collected from 190 species of wild vertebrate animals spanning fish, amphibians, reptiles, birds and mammals. Special care was taken to make certain of the origin of the samples and collect corresponding metadata on samples and sample sites. A total of more than 23 million sequence reads were used to find operational taxonomic units that are highly abundant and prevalent in characteristic groups of host and absent in other hosts. The hypothesis for this study was that host phylogeny and diet are the main drivers for the composition of the fecal community composition. Therefore, differential components of these communities (i.e. host-associated populations) might be used for the differentiation of fecal sources on various levels of host phylogeny. Data analysis showed that host phylogeny was reflected in community composition on many levels especially in the class Mammalia. Ruminantia showed intestinal microbiota clearly distinct from other vertebrates. However, host phylogeny was certainly not the only driver for the differentiation of intestinal microbiota. We could also find populations that differentiated the host animals according to diet (e.g. carnivores or insectivores vs. other vertebrates). Others were characteristic for the habitat the host is living in e.g. populations occurring in fish and birds sharing the aquatic habitat but absent in hosts from terrestrial habitats. The analysis of this large dataset including highly diverse groups of vertebrate animals showed that the fecal community composition is no mere reflection of host phylogeny but the results of complex interaction of host and environmental factors. Without in depth sample metadata on the host and its habitat these types of patterns could not be unveiled. The populations defined in the course of this study are promising new targets for molecular detection and characterization of fecal pollution in the environment. 4:00 – 5:00 PM Grumman Comparison of Tolerable Risk Benchmarks Used in Water Safety Dan Deere, Water Futures Pty Ltd Additional Authors: Arran Canning; Duncan Middleton; Barton Maher Purpose: This paper reports a comparison of risk benchmarks used for the following endpoints: Dam safety risks to the general public, Drinking water safety risks to the general public, Recreational water safety risks to the general public. Methodology: Evidence-based estimates were made using a common metric for broad comparative purposes. The common metric was the disability-adjusted life year (DALY) disease burden metric of impact to human health that captures risks arising from injury, health effects and fatalities. The DALY metric sums years of life lived with injury and disability along with years of life lost through premature death to provide a universal metric of human health and harm impact. The tolerable risk benchmarks were estimated in DALY for: fatality from the failure dams based on estimates of the ratio of beneficiaries from a dam to those impacted by its failure. Illness and fatality from the consumption of drinking water based on estimates of the impacts of drinking water just complying with guideline values for a selection of limiting hazards. Illness and fatality posed by recreation in water storages based on estimates of the impacts of recreational water just complying with guideline values. For each of these three risk categories the assessment described and compared the agreed industry benchmarks with one another using the common DALY metric. Results: The best estimated impacts of delivering services that were just compliant with the most contemporary guidance were as follows (in units of annual µDALY disease burden per person): Dam safety risks to the general public: 4.5 Drinking water safety risks to consumers: 4.0 Recreational water safety risks to participants: 235 Discussion: Estimated tolerable risks associated with dam safety and drinking water are potentially within the same order of magnitude when expressed using a common metric. In contrast, the tolerable risk benchmark for primary contact recreation was close to two orders of magnitude greater. However, the recreational risk is considered a 'voluntary' risk whilst the others

Page 12 of 99

are considered 'involuntary' such that this discrepancy is not concerning. A number of assumptions and estimates were made in conducting this study and whilst some values and assumptions are relatively robust, others are relatively uncertain. Further work to reduce these uncertainties may be warranted. In the meantime, the estimates of risk provided in this study should be considered approximate to within an order of magnitude but no better. In addition, it should be noted that there is irreducible variability in risks over time, location and circumstances and the estimates given here should be considered broadly typical rather than precise and specific to any particular site or situation. Acknowledgements: This study was conceived, overseen & contributed to by key Seqwater personnel including Arran Canning, Duncan Middleton and Barton Maher. Microbiological Quality in Small Water Supplies: Are the Traditional Indicators Enough? Silvia Monteiro, Laboratorio Analises, Instituto Superior Tecnico Additional Authors: Mario Freire; Lara Silva; Greice Carvalho; Ricardo Santos Small water supplies are sometimes overlooked because they are often in remote locations and are in some cases from private ownership. Although remote, a considerable number of people rely on small water supplies, communal or private, for their everyday basic needs. In Portugal, small water supplies microbiological safety is determined through one-off analysis, and the number of analysis per year is determined by water consumption of a given system. Routine analysis is based only on traditional indicators of faecal contamination such as Escherichia coli (EC), intestinal enterococci (IE) or clostridia spores. However, it is now agreed in the scientifc community that the presence or absence of these organisms may not represent the reality of pathogens such as enteric viruses and protozoa. The aim of this study was to determine the microbiological quality of seven small water supplies in Portugal, in the course of the Aquavalens project, not only in terms of traditional indicators, but also through the analysis of enteric viruses (Norovirus GI and GII, Hepatitis A and E viruses, and Enteroviruses), protozoa (Cryptosporidium spp. and Giardia spp.) and Campylobacter (C.) coli and jejuni. Three of the chosen sites were equipped with disinfection measures, such as UV light or chlorine. Twenty-liter water were collected and samples were tested for EC and IE through MPN techniques. Clostridia spores were determined on viande-fois medium. Samples were concentrated by ultracentrifugation and PEG precipitation for detection of microorganisms by qPCR. Prior amplification, samples were extracted for the detection of bacteria, viruses, and protozoa. The results obtained with traditional indicators using culture techniques, such as EC and IE, were most of the times in accordance with the results obtained during the one-off analysis. Clostridia spores were found often in high concentration in most systems, ranging from 800 to 4.2E +05 CFU/20L. As expected EC detected by qPCR was the organism with the highest prevalence in concentrations ranging from 7.97E +03 to 3.38E +04 GC/20L. Giardia spp., C. jejuni and C. coli were not detected in any of the sampling campaigns. Enterovirus, Norovirus GI and GII, Hepatitis A and E viruses and Cryptosporidium were detected during this on-going investigation. Results for enteric viruses ranged between 6.29E +02 GC/20L for Norovirus GII and 1.68E +05 GC/20L for Hepatitis E viruses. Data from Cryptosporidium showed levels as high as 9.00E +05 GC/20L. No correlation was found so far between traditional indicators of fecal contamination and pathogens. Systems displaying disinfection procedures were mostly clean of traditional indicators presenting nonetheless some positive results for these organisms and also for pathogens. This is an on-going study, but the results so far have shown a great potential for microbial contamination and thereafter a high risk for the health of the communities that rely on these systems. Water Quality, Compliance, and Health Outcomes Among Utilities Implementing Water Safety Plans in France and Spain Karen Setty, UNC Water Institute Additional Authors: Georgia Kayser; Jean-Francois Loret; Jerome Enault; Claudia Puigdomenech Serra; Jordi Martin Alonso; Arnau Pla Mateu; Jamie Bartram Water Safety Plans (WSPs), recommended by the World Health Organization since 2004, seek to proactively identify potential risks to drinking water supplies and implement preventive barriers that improve safety. To evaluate the outcomes of WSP application in large drinking water systems in France and Spain, we undertook analysis of water quality and compliance indicators between 2003 and 2015, in conjunction with an observational retrospective cohort study of acute gastroenteritis incidence, before and after WSPs were implemented at five locations. Measured water quality indicators included bacteria (E. coli, fecal streptococci, total coliform, heterotrophic plate count), disinfectants (residual free and total chlorine), disinfection by-products (trihalomethanes, bromate), aluminum, pH, turbidity, and total organic carbon, comprising about 240K manual samples and 1.2M automated sensor readings. We used multiple, Poisson, or Tobit regression models to evaluate water quality before and after the WSP intervention. The compliance assessment analyzed exceedances of regulated, recommended, or operational water quality thresholds using Fisher's exact or chi-square tests. Poisson regression was used to examine acute gastroenteritis incidence rates in WSP-affected drinking water service areas relative to a comparison area. Implementation of a WSP generally resulted in unchanged or improved water quality, while compliance improved at most locations. Evidence for reduced acute gastroenteritis incidence following WSP implementation was found at only one of the three locations examined. Outcomes of WSPs should be expected to vary across large water utilities in developed nations, as the intervention itself is adapted to the needs of each location. The approach may translate to diverse water quality, compliance, and health outcomes.

Page 13 of 99

Dogwood The Survival of Different F+ Coliphage Strains Under Direct Sunlight Exposure Yvonne Yuen, University of North Carolina at Chapel Hill Additional Authors: Rebekah Yu; Mark Sobsey For indicators to be reliable surrogates, its survival and transport in the environment have to be similar to that of pathogens. One of the most important factors that affect the survival of microorganisms in water is sunlight radiation. Better understanding of microorganisms inactivation due to sunlight exposure for different indicators and pathogens can provide insight into which indicators are appropriate surrogates for which pathogens. F+ coliphages are often used as virus indicators. There are five distinct groups of F+ coliphages, the Inoviridae are single strained DNA viruses and the Leviviridae are single strained RNA viruses, the Leviviridae are further divided into 4 genogroups (GGI, GGII, GGIII and GGIV). Most sunlight inactivation studies that examined F+ coliphages used MS2, which is a F+RNA GGI phage, and little is known about the survival of other groups of F+ coliphages. The purpose of this study is to better understand the survival of different groups of F+ coliphages under direct natural sunlight exposure. A total of 11 different F+ coliphage strains were used in this study: 5 known laboratory prototype strains from each group (F+DNA f1 and F+RNA GGI MS2, GGII GA, GGIII QB and GGIV SP), 4 known field F+RNA strains (GI fr, GII DL10, GIII MX1 and GIV HB-P22), 1 unknown F+DNA field strain and 1 mixed field sample made from all F+ coliphages found in raw sewage. High concentrations of the 11 different F+ coliphage strains were individually spiked into surface water then separated into four petri dishes. Three were placed under the sun and one was kept at room temperature in the dark as control. One mL was collected after 15, 30, 45, 60, 90, 120, 180 and 300 minutes of exposure. Samples were analyzed by the spot titer or the double agar layer methods. Sunlight UV data was collected with a manufacturer calibrated radiometer. Plaques from the mixed field samples were collected at the last time point and will be genotyped to determine the groups of F+ coliphages that survived after 300 minutes of sunlight exposure. The decay rate constant (K) ranged from 1.06 h-1 to 2.63 h-1. All laboratory coliphage strains had lower K than field strains in the same genogroup except for F+DNA coliphages. F+RNA GI coliphage MS2 has one of the lowest K and can be used as a conservative surrogate when estimating the effects of sunlight on F+ coliphage survival. F+RNA coliphage field strains were more susceptible to sunlight radiation that laboratory prototype strains but the opposite was observed for F+DNA coliphages. The F+DNA field strain had the lowest K out of all field strains, which could explain why the majority of F+ coliphages found in environmental waters are F+DNA coliphages. Fate of Coliphages in Surface Water Environments in the Presence of Escherichia coli - Surrogates for Human Enteric Viruses? Martin Mackowiak, University of Duisburg-Essen Additional Authors: Mats Leifels; Kerstin Paslack; Lars Jurzik; Jost Wingender In surface water environments, Escherichia coli is traditionally used as an indicator bacterium for fecal pollution. Additionally, coliphages are discussed as indicators for enteric viruses. A key feature of fecal indicators is that they must not multiply outside the human body. Although some studies investigated the occurrence of E. coli and coliphages in surface waters, their fate is not clear. Therefore, the main objective of this study was to investigate the occurrence and multiplication potential of coliphages and their host E. coli in a surface water environment. In field experiments, we determined the concentration of both organisms in water, epilithic biofilms and sediments for three sampling sites at the urban river Ruhr in Essen, Germany weekly over a period of 8 weeks from July to September, 2015. Escherichia coli was quantified in a most probable number (MPN) format using the Colilert-18/Quanti-Tray/2000 system. Somatic coliphages were quantified via a plaque assay according to DIN EN ISO 10705-2. In laboratory experiments, we examined, whether phages could multiply under distinct environmental conditions. We performed growth experiments in microtiter plates with E. coli DSM 13127 and φX174 coliphages as model organisms varying medium, temperature and growth state. In the field experiments, E. coli was detected in all water samples with a mean concentration of 7.1 x 10² MPN/ml, while the mean concentration in sediment and epilithic biofilms was 2.1 x 10³ MPN/g and 5.6 x 10³ MPN/g, respectively. For coliphages, mean concentrations were 1.0 x 10¯² pfu (plaque-forming units)/ml in water, 8.2 x 10² pfu/g and 4.9 x 10² pfu/g in sediment and epilithic biofilms, respectively. Thus, E. coli accumulated in biofilms and sediments by a factor of 3 to 8, whereas coliphages accumulated by a factor higher than 1000. However, it was not clear, whether coliphages entered the biofilms and sediments from the water phase or multiplied within the biofilm. In laboratory experiments, phage propagation in growth medium occurred at 20 °C and 37 °C, whereas no infection of E. coli was found at 4 °C within one week of incubation. The incubation at 20 °C was chosen because the average water temperature in the field experiments was 19.4 °C. The infection was most efficient, when E. coli was growing in the logarithmic phase, while E. coli in the stationary phase did not react to addition of phages. Experiments to assess the metabolic activity of E. coli in biofilms are still in progress. We conclude that phage propagation in the environment might be limited by a low metabolism of Escherichia coli, although it could be possible at temperatures found in this study. As a consequence, the suitability of coliphages as fecal indicators, especially as surrogates for enteric viruses, in surface water remains questionable.

Page 14 of 99

US EPA Coliphage Recreational Water Quality Criteria: A Year-Long Sampling Study, Treatment Impacts, and Cost Implications Thomas Worley-Morse, Hazen and Sawyer Additional Authors: Melanie Mann; Raul Gonzalez The US EPA plans to introduce draft coliphage-based Recreational Water Quality Criteria (RWQC) in 2017. Given that the existing RWQC for Escherichia coli and Enterococcus are incorporated into NPDES permit limits for many municipal wastewater facilities, the new coliphage criteria may eventually also be incorporated into permit limits for wastewater facilities. If strict effluent coliphage limits are implemented as anticipated, some facilities will require upgrades to the disinfection process and may also require upgrades to secondary treatment processes. This presentation will review the results of a year-long Water Environment & Reuse Foundation study on the fate of coliphages as compared to traditional indicator organisms at nine different wastewater facilities. The wastewater facilities in this study use a variety of disinfectants - chlorine, UV, peracetic acid, and ozone - and various secondary processes. Somatic coliphages, male specific coliphages, E. coli, and Enterococcus were enumerated monthly at various locations throughout each treatment plant to determine the log inactivation/removal for each process. E. coli was enumerated with Modified mTEC, US EPA Method 1603, and Enterococcus was enumerated with US EPA Method 1600. US EPA Method 1602 was used to enumerate somatic and male specific coliphages. Coliphage fate data from this study suggest that conventional non-nitrifying activated sludge wastewater facilities have higher concentrations of coliphage in secondary effluent as compared to facilities which employ biological nutrient removal and/or other advanced processes. Further, facilities which use chlorine disinfection in the presence of effluent ammonia, thereby effectively practicing chloramination, inactivate coliphages slowly when compared to traditional indicator bacteria. Such facilities are among the most likely to require disinfection and/or secondary treatment process improvements to comply with potential coliphage limits. The literature provides a general understanding of how coliphages respond to wastewater disinfectants. However, there is little industry experience with design or operation of full scale wastewater disinfection processes to meet coliphage-based effluent limits. This presentation will identify conceptual level treatment process changes that may be required to comply with potential coliphage criteria. Bellflower The Invisible Problem - Movement and Accumulation of Antibiotic Resistance at the Human-Wildlife-Environmental Interface in Botswana Kathleen Alexander, Virginia Tech Additional Authors: J. Tyler Fox; Claire Sanderson Antibiotic resistance has historically been considered an emergent problem in high-income countries. The tide is changing with antibiotic resistance now a rising phenomenon in low and medium income countries struggling to address complex health threats. Globalization provides a conduit for movement of microbes and resistance that crosses ecosystems, threatening global health. We evaluate trends in phenotypic expression of antibiotic resistance in Escherichia coli and other organisms cultured from patients presenting to the hospital from 2007- 2015 (n=1190) in Chobe District, Northern Botswana. We then evaluate antibiotic resistance levels observed among E. coli isolated humans and compare this to patterns observed in cattle (n=20), wildlife (n=900, 18 species), the Chobe River (n=2003), and soil (n=526). We use Moran's Index tool and areal interpolation methods in ESRI ArcGIS to evaluate spatial patterns of multidrug resistance in the environment and wildlife resources. Antibiotic resistance was widespread in humans, wildlife, and the environment. Among hospital patients, cultured isolates were resistant to multiple antibiotics (mean= 2.84 +1.84, range=0-9) with 31% of isolates (95% CI=29.4-33.6%) demonstrating multidrug resistance (MDR>3). For a number of antibiotics, levels of resistance increased significantly over the study period and were comparable to that found in surface water, wild animals, and soil, albeit at higher levels. In this system, MDR was greatest in the urban land area but was found in all land use types including the protected areas where human disturbance was minimal. No resistance could be found in the limited number of E. coli isolated from the small population of cattle used in subsistence farming. MDR accumulation among water isolates was highest in areas where humans and wildlife overlapped at the aquatic-terrestrial interface. Across wildlife species, MDR was greater in those species that were water adapted, lived in close association with humans, or were carnivores. In our study, drug resistance was wide spread independent of the presence of intensive livestock production systems, hospital waste, and waste water treatment plants. Patterns in the environment mirrored those found in the human population reporting to the local hospital. This study highlights the need to take a one health approach and broaden our focus beyond livestock and sewage as the main culprits in this growing global threat. Surveillance of Antimicrobial Resistant Bacteria in Environmental and Waste Waters of North Carolina: A Methodological Evaluation of a Candidate Indicator Systems Katy Brown, Water Institute, Gillings School of Global Public Health, UNC The rise of antibiotic resistance bacteria (ARB) exacerbates the spread and burden of infectious disease, globally. Yet, there are no harmonized efforts for ARB surveillance, response, and prevention. This study investigated the development and use of a prototype, culture-

Page 15 of 99

based indicator system for the direct detection and quantification of Extended-spectrum-β-lactamase (ESBL) and carbapenemase (KPC) producing Enterobacteriaceae in exposure-relevant environmental sites including hospital sewage, domestic sewage, treated sewage effluent, and surface waters. This was done by performing repeated, parallel assays using agar media supplemented with specific antibiotics and then quantitatively and qualitatively analyzing the clinical medias' performances via resulting concentrations and proportions of ESBL and KPC producing target organisms as well as by confirming the resistance profiles and identities of resulting assay isolates. Results showed that the performance of the clinical medium was comparable to the gold standard for the detection indicator organisms in the aforementioned samples, with the exception of E. coli in raw sewage and surface water. High concentrations and proportions of presumptive ESBL and KPC presumptive E. coli and other coliforms were found in hospital sewage and raw sewage and lower in secondary effluent and receiving surface waters. When resulting bacterial isolates were subjected to identity and resistance profile confirmation, the ESBL isolates yielded high confirmation of the ESBL medium performance in each sample matrices. Higher proportion of isolates identities originally detected on the KPC medium were not confirmed. Modified Hodge test of these confirmed a high proportion of KPC production in the isolates, supporting the performance of the medium. More must be done to address the issues of the development and spread of antibiotic resistance in waste water treatment settings. These media and methods have promise as a candidate indicator system to detect and quantify ARB of health concern in environmental media as a monitoring system to support environmental surveillance and during outbreaks. To our knowledge, this is the first method evaluation of its kind. Global spread of ARB merits evaluation across other geographic regions in US and abroad using parallel, matching methods to identify ARB threats and detect outbreaks. Quantitative Real-Time PCR Fecal Source Identification in the Tillamook Basin Orin Shanks, US EPA Additional Authors: Xiang Li; Catherine Kelty; Amity Zimmer-Faust; Pat Clinton; Jay Reichman; York Johnson; William Matthews; Stephanie Bailey; Mano Sivaganesan Rivers in the Tillamook Basin play a vital role in supporting a thriving dairy and cheese-making industry, as well as providing a safe water resource for local human and wildlife populations. Historical concentrations of fecal bacteria in these waters are at times too high to allow for safe use leading to economic loss, endangerment of local wildlife, and poor conditions for recreational use. In this study, we employ host-associated qPCR methods for human (HF183/BacR287 and HumM2), ruminant (Rum2Bac), cattle (CowM2 and CowM3), canine (DG3 and DG37), and avian (GFD) fecal pollution combined with high-resolution geographic information system (GIS) land use data and general indicator bacteria measurements to elucidate water quality spatial and temporal trends. Water samples (n=584) were collected over a 1-year period at 29 sites along the Trask, Kilchis, and Tillamook rivers and tributaries (Tillamook Basin, OR). A total of 16.6% of samples (n=97) yielded E. coli levels considered impaired based on Oregon Department of Environmental Quality bacteria criteria (406 MPN/100mL). Host-associated genetic indicators were detected at frequencies of 39.2% (HF183/BacR287), 16.3% (HumM2), 74.6% (Rum2Bac), 13.0% (CowM2), 26.7% (CowM3), 19.8% (DG3), 3.2% (DG37), and 53.4% (GFD) across all water samples (n=584). Seasonal trends in avian, cattle, and human fecal pollution sources were evident over the study area. On a sample site basis, quantitative fecal source identification and GIS land use data provided new information suggesting elevated E. coli levels may be linked to specific point and nonpoint pollution sources. Results demonstrate the advantages of combining host-associated genetic indicators and GIS mapping strategies with general fecal indicator bacteria water quality monitoring data to better characterize sources of fecal pollution in environmental waters. Mountain Laurel Validation of Bacterial Community Sequencing Methods for Microbial Source Tracking of Human-Associated Fecal Sources Relevant to Low- and Middle-Income Countries Valerie Bauza, University of Illinois at Urbana-Champaign Additional Authors: Thanh Nguyen; Jeremy Guest In this study, we validated the use of bacterial community sequencing as a tool for microbial source tracking of human-associated fecal contamination sources particularly relevant to low- and middle-income countries, including young children's feces separately from older children and adult feces, as well as open drainage ditches, and leaking pit latrines. We also evaluated two different primer sets and several methods for analyzing this sequencing data to determine the methods with highest sensitivity and specificity. Bacterial community sequencing has been previously validated for differentiating between human and animal fecal sources, as well as human feces, septic waste, and sewage, and this study adds additional fecal sources and methods recommendations to this toolbox. Current water, sanitation, and hygiene programs in low- and middle-income countries often focus on improving water delivery and toilet/latrine infrastructure, but child exposure to fecal pathogens can remain common after these improvements. Child feces, open drainage ditches, and leaking pit latrines may all remain potential sources of fecal pathogens in the environment after sanitation improvements, but their relative importance is not well understood. A better understanding of this could help identify where to target limited development resources to achieve the greatest health benefits. Prior to this work, there was no mechanistic method to identify if human fecal contamination in the environment was primarily from child feces or from other human sources. To validate the microbial source tracking methods, we collected 48 fecal source samples from young children, adults, pit latrines, and open

Page 16 of 99

drainage ditches in an urban slum in Nairobi, Kenya. We spiked these fecal sources individually and in pairs into local source water samples, extracted the DNA, and sequenced the V3-V4 and V4 variable regions of the 16S rRNA gene using the Illumina Miseq platform for 32 spiked samples. We then evaluated several statistical techniques to identify the dominant fecal source in spiked samples, and identified methods with high sensitivity and specificity including using the Bray-Curtis distance estimate of the similarity between the two bacterial community structures. We also evaluated the use of SourceTracker software with QIIME to determine the relative contamination of samples. After validating source tracking methods, we analyzed 196 environmental samples from 40 households for a human-associated Bacteroides fecal marker using quantitative PCR, and sequenced 90 environmental samples that tested positive for this marker. Method recommendations, sequencing results, and the relative fecal contamination from child feces compared to other sources will be presented. Microbial Source Tracking of Fecal Contamination in Coastal Stormwater in Beaufort, North Carolina Justin Hart, UNC-Institute of Marine Sciences Additional Authors: Denene Blackwood; Rachel Noble Poor stormwater quality threatens public health and tourism in eastern North Carolina. The Town of Beaufort (NC) is located directly upstream from the Rachel Carson Reserve (RCR), which includes several highly visited recreational areas. Stormwater receiving waters in Beaufort have previously demonstrated elevated levels of fecal contamination as measured by fecal indicator bacteria (FIB). In order to characterize the extent of this contamination, samples were collected during 15 storm events and four dry weather events between August 2016 and April 2017 from, 1) two stormwater conveyance outfalls in Beaufort, 2) downstream in Taylor's Creek, 3) stormwater pipes upstream of the outfalls, and 4) various standing water sites throughout the town. In addition, an unmanned aerial vehicle (UAV) equipped with a thermal camera was used during dry weather sampling events to visualize the fate of stormwater discharge. FIB concentrations were found to increase using EPA-approved enumeration methods in receiving waters following storm events, with total coliforms reaching 1.1 × 10^5 MPN / 100mL, E. coli reaching 8.6 × 10^3 MPN / 100mL, and Enterococcus spp. reaching 5.3 × 10^3 MPN / 100mL. In an effort to identify the source of this contamination, multiple human-associated Bacteroides spp. (HF183, BacHum, and Fecal Bacteroides) molecular assays, as well as gull-associated fecal Bacteroides marker and human-associated viral pathogens were employed. Additionally, publicly available meteorological data was combined with the molecular quantification data to identify patterns in contamination and create a conceptual framework of the potential sources. This tool will be used in an ongoing collaboration with the Town of Beaufort to systematically address sources and reservoirs of fecal contamination to preserve water quality in the RCR. Molecular Fecal Source Investigation at an Urban Marine Beach with Chronic Microbial Water Quality Problems in support of a Quantitative Microbial Risk Assessment Joshua Steele, Southern California Coastal Water Research Project Additional Authors: Meredith Raith; John Griffith; Kenneth Schiff The US EPA has enabled the use of Quantitative Risk Assessment (QMRA) as a tool for quantifying swimmer health risk for the purpose of setting site-specific objectives for fecal indicator bacteria (FIB) such as Enterococcus. However, no dry weather QMRAs have been conducted at an urban marine beach in the United States. Because of its high use, resident bird population, extensive historical water quality improvements, and persistent FIB exceedences, Inner Cabrillo beach was selected as a case study for a southern California marine beach QMRA study. Prior to estimating risk, best practice requires that the likely sources of fecal indicator bacteria be identified and characterized in order to determine the applicability of the location for QMRA and to guide the characterization of associated pathogens for risk assessment. From 6/1-9/ 4/2016 we performed a beach microbial water quality study and analysis of FIB and genetic source markers for human and avian bacterial indicators to accomplish this source identification step. Water, sand, and eelgrass wrack samples were collected at 6 sites across Inner Cabrillo beach and 1 site on Outer Cabrillo beach between 6:30-8:00am Wednesday to Sunday. Intensive sampling of water, sand, and eelgrass wrack was also performed every 2 hours over a 36-hour spring tide cycle on 6/3-6/5/2016. All samples were analyzed for Total Coliform, E. coli, and Enterococcus using IDEXX culture methods; water samples were also analyzed for molecular markers using digital PCR: Enterococcus 23S rRNA, human-specific Bacteroidetes (HF183), and avian Catellicoccus (LeeSeaGull). At Inner Cabrillo Beach, we measured IDEXX Enterococcus concentrations greater than the California single sample standard (104 MPN/100ml) at rates of 25% in the water samples and a spatial relationship around the site 3 mid beach (i.e. regulatory compliance site CBO2). We found a nearly identical spatial relationship with an avian fecal indicator, which was correlated with Enterococcus (r=0.53). HF183 was detected at low concentrations frequently (49-67%) at Inner Cabrillo Beach. HF183 concentrations also showed no spatial relationship and no relationship to Enterococcus or avian marker concentrations. No relationship was found between FIB or molecular markers and day of the week, swimmers in the water, or tide height. Molecular markers and FIB were detected at Outer Cabrillo Beach, although less frequently and at lower concentrations. These results suggest that shorebirds are a large source of Enterococcus in the beach water. The low, frequent human signal suggests a dispersed source, possibly from harbor water, local infrastructure, groundwater transport to the beach, or a combination of these. Further characterization of the human and avian sources is the next step to determine the suitability of Inner Cabrillo Beach for a QMRA; determination of the pathogen load in these sources will ultimately be used to estimate the level of exposure for beach users.

Page 17 of 99

Verbal Presentations

Tuesday, May 16th 8:30 – 10 AM Grumman Occurrence of Reovirus at a Recycled Water Managed Aquifer Recharge Site Walter Betancourt, The University of Arizona Additional Author: Charles Gerba Reoviruses (respiratory enteric orphan viruses) are nonenveloped viruses composed of 10 gene segments of double-stranded RNA encased by two concentric icosahedral capsid shells (70-80 nm double-layered protein), two major determinants of virion stability in the environment and resistance against physical and chemical agents. In addition, the stability of reoviruses toward harsh physical and chemical treatments may be explained by their ability to form large aggregates with different types of enteric viruses (e.g. poliovirus). However, the potential significance of this virus in water and wastewater has generally been overlooked because of uncertainty in the nature of illness caused by reovirus in humans. In this study, the occurrence of the three reovirus serotypes was investigated in treated wastewater and groundwater beneath a managed aquifer recharge site using different strategies to maximize virus recovery and sensitivity of detection. We evaluated the efficiency of recovery of Reovirus Type 3 Dearing (T3D) from large volumes of tap water and tertiary treated wastewater using Zeta Plus 1MDS and NanoCeram electropositive cartridge filters. LLC-MK2 Derivative (ATCC® CCL7.1?) cells and Buffalo green monkey (BGM) cells were used to test virus infectivity while direct reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was used to detect and quantify reovirus genomes in seeded and naturally contaminated environmental samples. Different reverse transcriptases for one-step and two-step RT-qPCR were investigated for efficient reverse transcription of reovirus RNA. The overall virus recovery efficiencies varied between 50 and 100% in tap water and treated wastewater using NanoCeram filtration (method 1) followed by virus elution with 1% (wt/vol) Na-polyphosphate and final concentration using Centricon Plus-70 centrifugal ultrafilters (100- KDa cutoff). Reovirus recoveries from tap water and treated wastewater by 1 MDS filters using beef extract followed by organic flocculation (method 2) for virus concentration were significantly lower than with method 1 yielding a mean recovery efficiency of 6.5% with recoveries ranging from 3.7% to 8.5%. The RNA genome of type 3 reovirus was predominantly found in treated wastewater and groundwater beneath the managed aquifer recharge site at levels between 10E1 to 10E2 genome copies per liter. Multiple cell culture passages significantly increased the detection sensitivity of the reovirus assay. Decentralized Treatment of Domestic Wastewater: Health Risk Implications for Effluent Reuse Isaac Dennis Amoah, Durban University of Technology, Institute for Water and Wastewater Technology Additional Authors: Thor Stenstrom; Poovendhree Reddy Wastewater treatment in developing countries is a challenge, mainly due to high cost of operating these plants (Paraskevas et al., 2002). To solve this problem decentralized wastewater treatment plants (DEWATS) have been developed, these are simpler and cost effective (Paraskevas et al., 2002 and USEPA, 2005). The DEWATS is widely used not only in developing countries, but in developed countries as well. This study with the sponsorship of the Water Research Commission (WRC) of South Africa was to determine the pathogen reduction efficiency of DEWATS plants under South African conditions and the microbial infection risk for farmers associated with the reuse of the effluents for irrigation. The study was carried out at a pilot DEWATS plant (comprising an anaerobic baffled reactor and planted gravel filters) serving 84 households within the city of Durban in South Africa. A 1.5 L sample was taken from various points during the treatment to measure the reduction achievable, these points are the influent (raw wastewater), after anaerobic baffled reactor (ABR) treatment and after the planted gravel filters (PGFs). Sampling was carried out for five (5) months. Bacterial concentrations were determined using standard methods (APHA, 1992) and pathogen removal efficiency determined for only Salmonella and E. coli. However, the risk of infections was determined for E. coli, Campylobacter, somatic coliphages, Cryptosporidium and soil-transmitted helminths using the QMRA framework. A 4 Log10 unit reduction was achieved for Salmonella spp and E. coli spp from the influents to the end of the ABR, a further one (1) Log10 unit reduction was achieved from the ABR to the PGFs (both the horizontal and vertical). Final effluents from the PGFS had Log10 concentrations of 3.11 (± 2.73) and 3.22 (± 2.81) for E. coli and Salmonella spp respectively. The probability of infection for farmers with the different groups of pathogens studied were all found to be higher than the WHO tolerable limit of 7.7 ×10-4 per farmer per year (WHO, 2006). The least risk was with infection with E. coli and somatic coliphages (2.89 x 10-2 and 1.64 x 10-2 respectively), the highest risk was risk of Campylobacter infection (5.17 x 10-1). Annual risk of infection was found to be high for all pathogens studied as shown below (Table 1). However, there was no risk of STHs and protozoan infection for the farmers due to an absence of STHs viable eggs in the final effluent after both the ABR and PGF treatments. Therefore, the multiple barrier approach as suggested by the WHO needs to be adopted to reduce the risk of bacterial infections. Table 1: Risk of infection with selected pathogens Pathogen One-time risk Annual risk E. coli 2.89 x 10-2 3.52 x 10-1 Campylobacter spp 5.17 x 10-1 1 Somatic

Page 18 of 99

coliphages 1.64 x 10-2 9.16 x 10-1 Cryptosporidium na$ na STHS** na na *Annual risk was estimated for farmers based on 150 days of exposure. $ na - not applicable ** STHs - soil transmitted helminths. Two-Year Monthly Study on Viruses in Lake Water Polluted by Wastewater Effluents Akihiki Hata, Kyoto university Additional Authors: Yuya Shirasaka; Masaru Ihara; Naoyuki Yamashita; Hiroaki Tanaka Lake Biwa is the largest lake in Japan and is used as a source of drinking water for 10-millions of populations. Due to effluents from three wastewater treatment plants (WWTPs) adjacent to the lake, virological water quality is of concern especially for the south-lake, the southern part of Lake Biwa. The retention time of south-lake is about 14 days. To date, little is known about the planar distribution of viruses in the lake environment, where pollutants remain for a long time. In this study, monthly monitoring of enteric viruses and indicators in the south-lake was conducted at 15 points covering entire area of the south-lake for 30-months. By means of an adsorption-elution method using an electronegative membrane and following ultrafiltration, 2-4 L of the lake water sample was reduced to be 0.7 mL. The virus concentrate was subjected to RNA extraction and following RT-qPCR based quantification of GI- and GII-noroviruses (NoVs), Aichi virus (AiV), pepper mild mottle virus (PMMoV), and GI-GIV FRNA phages (FRNAPHs). PMMoV was the most frequently detected (88% out of 365 samples) with the mean concentration of 2.9 ± 0.6 log10 copies/L (excluding negative data), which was followed by GI-FRNAPH (50%, 2.8 ± 0.6 log10 copies/L), GII-NoV (48%, 2.8 ± 0.8 log10 copies/L), GII-FRNAPH (27%, 2.6 ± 0.5 log10 copies/L), and AiV (24%, 2.5 ± 0.7 log10 copies/L). The higher detection frequency of GI-FRNAPH than other subtypes indicates that the viral pollution is mainly due to treated wastewater (Hata et al., 2016, Appl Environ Micorbial). During the sampling event, viruses were detected in broad concentration ranges, e.g., concentration of GII-NoV was ranged from <1.0 to 4.8 log10 copies/L. However, concentrations of GII-NoV within each sampling event tended to be similar regardless of the sampling point, even though those at points close to WWTPs tended to be relatively higher than at other points. This indicates that viruses emitted from WWTPs are immediately diffused throughout the south-lake. A correlation was found between log10-transformed concentrations of GII-NoV and AiV with a slope value of 0.80, close to 1.0 (R2 = 0.67), indicating that source and manner of diffusion of GII-NoV and AiV are identical. On the contrary, those of GII-NoV and PMMoV did not show any correlations. This may be due to difference between enteric viruses (icosahedral capsid, human viruses) and PMMoV (rod-shaped capsid, plant virus) in view of morphology and source. Therefore, PMMoV, which have been supposed to be an indicator for viral contamination due to its high concentration in the water environment, is not a good viral indicator in the lake environment. Our study revealed that viruses emitted into the lake environment diffuse immediately. Manner of their diffusion may be affected by viral morphological characters. PMMoV is not a good indicator for viral indicator in the lake environment due to its morphological characters and source of contamination. Use of Zooplankton in Natural Treatment Systems: Reducing Microbial Pollutants from Stormwater Runoff and Wastewater Niveen Ismail, Smith College Additional Authors: Brittney Blokker; Mariah Ollive; Sarah Price Stressed freshwater supplies pose significant risks to society, negatively affecting human health, the environment, and the economy. To improve water quality and augment existing resources, innovative engineering solutions are required. One promising solution is to use natural treatment systems to remove various pollutants that can otherwise lead to degraded water quality. Natural systems such as rain gardens, detention basins and vegetated swales, as recommended in Best Management Practices (BMPs), as well as use of treatment wetlands have received increased interest due to their low-cost operation, aesthetics and habitat benefits. However, the reliability and efficiency of these systems can vary widely, and other natural treatment approaches need to be explored to improve treatment efficacy as well as develop a mechanistic understanding of pollutant removal. Microbial pollutants are a significant contributor to poor water quality, yet limited mechanisms are available to effectively mitigate their impact in natural systems. Zooplankton can be an attractive approach to improve water quality through the removal of various microbial pollutants in impaired natural systems. As pelagic, mobile filter-feeding organisms, zooplankton can remove suspended particulate matter from the water column, but little is known about the effectiveness of utilizing zooplankton to improve water quality in natural systems. Results from laboratory experiments quantifying clearance (uptake) rates of the zooplankton feeding on the fecal indicator bacteria Escherichia coli under varying environmental conditions will be presented. Results show filter-feeding activity by zooplankton can have a quantifiable impact on microbial pollutant levels in the water column. Uptake of microbial pollutants by two types of zooplankton, D. magna and B. calcifyrous (rotifers), was observed ranging from 1 to 5 log removal depending on experimental variables such as duration, concentration, density, and temperature. In addition to laboratory experimental results, implementation scenarios and ecosystem benefits will be discussed.

Page 19 of 99

10:30 AM – 12PM Grumman Do Current Regulatory Monitoring Frameworks Account for Microbial Risk Associated with Peak Contamination Events? Emile Sylvestre, Polytechnique Montreal Additional Authors: Michèle Prévost; Sarah Dorner Introduction. As a result of global change, the assumption of stationarity to determine concentrations of microbial contamination in water sources is no longer valid. Fluctuations of microbial contamination in source waters may lead to short-term threats at drinking water treatment plants (DWTP). Yet, many international regulations require water utilities to measure central tendencies on datasets gathered through routine monitoring of Escherichia coli. The resulting point estimates are then used to set the level of treatment needed to comply with microbial health-based targets. The objective of this study is to determine the impact of monitoring strategies on the uncertainty in microbial contamination in drinking water supplies. Methodology. Study phase 1 consisted in the variability analysis of weekly E. coli monitoring data (2009-2015) for source water at 11 DWTPs in Quebec and Ontario, Canada. During phase 2, a detailed assessment of the variability of microbial contamination was carried out for a DWTP located on an urban river in Quebec using data collected between 2013 and 2017. E. coli was monitored 4 days a week and Cryptosporidium and Giardia occurrence was assessed on a monthly basis. Short-term fluctuations in E. coli concentrations were evaluated with samples taken every two hours using automated near real-time measurement of β-D glucuronidase activity. Based on this high temporal resolution data, event-based monitoring of pathogens can be performed during critical periods of fecal contamination. Short-term fluctuations in protozoan concentrations will be evaluated during the 2017 snowmelt period through intensive sampling for Cryptosporidium and Giardia at the DWTP intake. Results. Long-term monitoring of E. coli at the DWTP intake shows that the 5-year median concentrations vary over 2 orders of magnitude between study sites and over 1 order of magnitude within sites. The 1-month moving geometric mean of E. coli concentrations during the 2015 snowmelt period displays an uncertainty of 1,123 CFU/100 mL for a confidence interval of 95%. We applied criteria from multiple international regulations to the 11 DWTPs and our preliminary results shows that the consideration of peak E. coli concentrations rather than central tendencies could lead to a change of 1.5 log removal in treatment targets for drinking water supplies displaying high variabilities in microbial contamination. Current bin classification methods to set treatment targets provide disparate results that could either lead to considerable investments or result in severe underestimation of the microbial risk. Relevance. This study will guide utilities and regulatory agencies to develop sampling strategies for short-term fluctuations in microbial contamination in drinking water supplies. The collected information could be used to estimate the short-term risk at DWTPs through quantitative microbial risk assessment. Towards a Smart Decision-Making for the Sustainable Management of Environmental Waters Dolores Gutierrez Cacciabue, Universidad Nacional de Salta, UNSa Additional Authors: Macarena Abdenur-Araos; Veronica Rajal Systematic monitoring of aquatic environments is carried out worldwide to assess their quality. This involves the measurement of different variables which are indicative of water pollution. The presence of microorganisms mainly pathogens is of great concern because they are responsible for the 80% of the waterborne diseases. Due to the inability of measuring each of the pathogens present, the use of bacterial indicators has been established by legislation. Some guidelines also include physicochemical variables. Despite the importance of monitoring, data obtained are valuable for experts in the field, but lacks of importance for the population that uses water bodies, becoming a potential risk. For a global consciousness, it would be convenient to use tools that help understanding the current situation in a clearer and easily way. Multicriteria Decision Analysis (MCDA) are methodologies that allow making decisions taking into account both scientific discoveries and stakeholders priorities. Their purpose is to choose between different alternatives based on multiple criteria and know which one is the best. The aim of this work was to apply two MCDA methodologies in order to assess the impact caused by qualitative and quantitative variables on the quality of aquatic environments (AEs) in Salta, Argentina. The MCDAs methodologies chosen were: Analytical Hierarchical Process (AHP) and Multi-Attribute Utility Theory (MAUT). The alternatives analyzed were AEs previously monitored: Arenales River divided in two AEs: upstream and downstream due to their differences in quality; La Caldera and Vaqueros Rivers and Campo Alegre Reservoir. Also, each AE was divided in wet and dry season. Therefore, ten alternatives were considered. Then, criteria (or attributes for MAUT) and sub-criteria (showed in parenthesis) were selected: Qualitative: effluent receptor (industrial and domestic), recreational uses (primary and secondary contact), resource acceptability, general impacts (presence of trash, washing clothes and cars, wildlife impact); Quantitative: a Water Quality Index (WQI), calculated with nine variables: four physicochemical (Temperature, dissolved oxygen, turbidity, pH) and five microbiological (total and fecal coliforms, Escherichia coli, enteroccocci, Pseudomonas aeruginosa). AHP was solved using Expert Choice 11 Inc. and MAUT through the Generic Multi-Attribute Analysis. Besides some differences that these MCDAs have in terms of calculation of global utilities or objectives functions and sensitivity analysis, both of them showed similar results. The AE that suffered the greater decrease on its quality was the Arenales River downstream during wet season and the criteria which influenced the most was the effluent receptor. However, depending

Page 20 of 99

on the activities developed on each AE and the season studied, the impact of each criterion differ between them. These results will be useful on decision-making to reach an integrated management of water resources. Improved Simultaneous Quantification of Multiple Waterborne Pathogens and Fecal Indicator Bacteria in Environmental Water Samples by Using a Sample Process Control Qian Zhang, University of Minnisota Quantitative polymerase chain reaction (qPCR) is frequently used to measure pathogens and fecal indicator bacteria present in environmental water samples. To increase its throughput, we previously developed a microfluidic qPCR (MFQPCR) platform that can simultaneously quantify multiple pathogens for many samples, and applied this tool for water quality monitoring and risk assessment. In this study, we improved our MFQPCR platform by adding fecal indicator bacteria (FIB) and a sample process control (SPC) strain as the targets. A SPC was used to assess DNA extraction efficiency and the occurrence of PCR inhibition. A genetically-engineered Pseudogulbenkiania sp. strain NH8B-1D2 was created and used as the SPC strain. This strain has an insertion of kanamycin-resistance gene in one of the 23S rRNA gene. A qPCR assay developed to specifically quantify strain NH8B-1D2 was added to the MFQPCR platform. The DNA extraction efficiency was calculated by comparing the quantities of NH8B-1D2 cells spiked to the water samples and those measured by qPCR after water filtration and DNA extraction. When NH8B-1D2 and one of the four pathogens (E. coli O157:H7, Salmonella Thyphimurium, Campylobacter jejuni, or Listeria monocytogenes) were co-spiked to pond water at various concentrations (10 to 107 cells/L), similar recovery efficiencies were obtained between NH8B-1D2 and the target pathogens. Therefore, the DNA extraction efficiency values of SPC could be used to estimate the true concentration of target pathogens. In conclusion, our improved MFQPCR format can provide accurate and high-throughput quantitative information for multiple pathogens and fecal indicator bacteria in water samples. This should be a useful tool for future water quality monitoring and risk assessment. Predicting the Occurrence of Human Pathogens and Associated Health Risks in Surface Waters. Comparison Between Two Predictive Models: Bayesian Network and Decision Tree Shin Giek Goh, National University of Singapore Additional Authors: Nazanin Saeidi; Xiaoqiong Gu; Genevieve Vergara; Liang Liang; Masaaki Kitajima; Karina Yew-Hoong Gin The presence of human pathogens in surface waters can cause health risks to the public. Direct detection of pathogens involves a large volume of sample and complicated analytical tests, which makes their detection not feasible in routine monitoring. Current water quality monitoring relies on the detection of bacteria fecal indicators, coliphages and selected physical parameters due to the relative simplicity of their detection and analyses. However, studies have shown the lack of correlation between the presence of bacterial fecal indicators and pathogens. Although statistical models have been developed for pathogen prediction from a suite of variables, the major drawbacks in statistical models when dealing with environmental samples are the high possibility of missing data and the inherent uncertainty in environmental data. In this study, two machine learning classifiers, i.e. Bayesian network and decision tree, are applied to predict the occurrence of human pathogens in surface waters and assess the associated health risks. A five-years data set of enteric viruses (Norovirus G1 and G2 ), bacterial pathogens (Salmonella, Pseudomonas aeruginosa), bacteria fecal indicators (Escherichia coli, Enterococcus), coliphages (somatic coliphage, male-specific coliphage, FRNA genogroup 1, 2, 3 and 4), human-specific markers (Bacteroides thetaiotaomicron, human polyomavirus, Methanobrevibacter smithii, pepper mild mottle virus) and environmental parameters (pH, temperature, salinity, turbidity, dissolved oxygen, rainfall, landuse) were used for the models development. Bayesian networks with different learning algorithms (K2, TAN, HillClimber) and different decision trees (J48, Random tree, REPTree) were explored and used to examine the model prediction performance. A total of 330 data points were subjected to 10-fold cross validation. Due to the large number of parameters (24 attributes) tested in this study, the attributes were evaluated through correlation-based feature subset selection in machine learning. The Bayesian network model gave the best prediction for Salmonella (TAN, accuracy 87.72%) and P. aeruginosa (K2, accuracy 81.29%), while the decision tree model worked best for Norovirus G1 (J48, accuracy 70.79%) and Norovirus G2 (REPTree, accuracy 59.45%). In general, this study demonstrates the ability of models to predict pathogen occurrence with good accuracy. These models were incorporated with dose response models and exposure models to assess health risks to the public. Although the current models are developed based on the data collected in tropical urban water bodies, the models can also be applied to other regions through the machine learning process. A Modelling and Scenario Approach to Assess Waterborne Pathogen Concentrations in Surface Water and Consequent Health Risk Nynke Hofstra, Environmental Systems Analysis Group, Wageningen University Additional Authors: Muhammad Shahid Iqbal; M.M. Majedul Islam; Carolien Kroeze; Gertjan Medema; Lucie Vermeulen Diarrhoea caused by waterborne pathogens is a problem worldwide. Infected livestock and humans produce pathogens in their faeces that can enter the surface water. People are at risk when exposed to the contaminated water. Waterborne pathogen concentrations and consequent health risk are strongly related to global environmental change, but very few studies have quantified the relations. We will present our process-

Page 21 of 99

based modelling approach and scenario analysis that will do just that. Our models calculate pathogen concentrations from loads to the environment from human and animal populations, prevalence and excretion rates, hydrology and die-off processes. The concentrations, together with dose-response and exposure data, determine the health risk. Scenarios have been developed building on the most recent Shared Socio-economic Pathways (SSPs) and Representative Concentration Pathways (RCPs) scenarios from the Intergovernmental Panel on Climate Change (IPCC). These scenarios include changes in population, urbanisation, land use and climate variables for the future (until 2100). We add our own assumptions on sanitation, waste water treatment and agricultural management to quantify future changes in waterborne pathogen concentrations and consequent health risk. We will present a spatially explicit global overview of Cryptosporidium loads to and concentrations in surface water for 2010 and future scenarios, and a first indication of global health risk from drinking surface water. We will also present case studies for E. coli concentrations in Pakistan and Bangladesh, that both suffer from high burdens of waterborne disease. E. coli is a faecal indicator and usually not pathogenic, but pathogens are expected to respond to global change in a comparable way. In a world focussed on regional progress, culture and national security, concentrations increase with the increasing population and livestock. In that world the risk of becoming ill due to contaminated water will increase relative to today. On the other hand, we find that in a world focussed on sustainability, well-being and equity concentrations will be reduced. In many regions livestock becomes a more important source than humans. Waste water treatment will be essential when more people are connected to sewers. Our combined modelling and scenario approach enables the assessment of pathogen sources, health risk and solutions at present and in the future. The approach will be valuable for water managers to reduce the health risk and contributes to achieving the Sustainable Development Goals. 2:30 – 3:30 PM Grumman Swine Manure Treatment for Enteric Virus Removal and Phosphorus Celia Barardi, Universidade Federal de Santa Catarina Additional Authors: Gislaine Fongaro; Aline Viancelli; Maria Magri; Airton Kunz Swine manure is mainly consisted of urine, feces and water, characterizing high content of solids, enteric pathogens, organic matter, phosphorus and nitrogen. Good practices on management and treatment are necessary for reducing its environmental impact and allow a safe recycle. Wastewater treatments are normally addressed for solids and organic matter reduction and it is rarely considered for removing pathogens, such as viruses, protozoa, and bacteria. The sedimentation method (generating liquid and solid fractions) can be efficiently used in the segregation of solids particles and pathogens carryover. From the liquid fraction it is possible to recover the phosphorus present in the manure, being this nutrient recycled during animal feed and in the subsidy of soils. The use of hydrated lime (calcium hydroxide - Ca (OH)2) during this process is an attractive and inexpensive treatment option to precipitate and recover phosphorus from manure in alkaline conditions. The present study aimed to evaluate: i) Rotavirus A (RVA), Circoviruses-2 (PCV-2) and Porcine Adenoviruses (PAdV) settling profile in swine effluent and ii) the soluble phosphorus recovery after Ca(OH)2 addition in swine wastewater. PCV2, PAdV and RV-A genomes were quantified by Real-time quantitative PCR (qPCR). The reactions were performed as described by Hundesa et al. (2009), Opriessnig et al. (2003) and Zeng et al. (2008) for PAdV, PCV2 and RV-A, respectively, using the TaqMan assay. For viruses settling profile, full-scale studies were performed using samples collected from a swine manure treatment system (SMTS) located at Embrapa Swine and Poultry, Concórdia, Santa Catarina, Brazil. Samples were collected after aerobic tank and after settling tank. For phosphorus recovery evaluation, Ca(OH)2 (10%, w/v) was added in the liquid fraction generated after treatment in SMTS and the samples were stirred until pH of 9.0 was reached. The effluent was transferred to an Imhoff cone for settling. The Ca(OH)2 helped to segregate the wastewater into a liquid and solid fraction composed by precipitated phosphorus. Virus settling from the liquid fraction was significant in the settling tank (P ≤ 0.05). The PAdV, PCV-2 and RV-A reduction was 99.9% (3log10), 99% (2log10) and 90% (1log10), respectively. In effluent generated, before lime addition, the phosphorus concentration was 98±0.30 mg L−1, and after settling time of 0.5 h, it was reduced to 4.69± 0.08 mg L−1. After 3h, it was reduced to 5.38±1.94 mg L−1, meaning a decrease of 94.6 % from the initial concentration. At 3h, the efficiency of phosphorus removal from effluent was confirmed by statistical analyses (p<0.05). SMTS was efficient to remove viruses from swine manure; Solid fraction generated can be used as biofertilizer; Liquid fraction can be applied as reuse water and from that it was possible to remove the soluble phosphorus. Thus, SMTS can be considered as an alternative and sustainable system for safe recycling of swine effluents. Evaluating the Effects of Rainfall on Foodborne Pathogen and Fecal Indicator Presence in Surface Irrigation Waters on Southeaster USA Produce Farms Mia Catherine Mattioli, Centers for Disease Control and Prevention Additional Authors: Amy Kahler; Candace Miller; Moukaram Tertuliano; George Vellidis; Vince Hill; Karen Levy Introduction: Under the Food Safety Modernization Act (FSMA), the United States Food and Drug Administration recently issued the Final Rule for Preventive Controls for Human Food and the Final Rule on Produce Safety, requiring produce growers to evaluate the microbial quality of natural irrigation water sources using the fecal indicator bacteria Escherichia coli. While the indicator must be monitored periodically over the

Page 22 of 99

course of one year, there is little guidance on when those samples must be collected, and it is unclear how seasonal events, such as rainfall affect certain surface-fed produce irrigation water quality and in turn, FSMA compliance and produce contamination. Objectives: This study evaluated the impact of rainfall events on the concentration of E. coli, other traditional fecal indicator microorganisms, and foodborne pathogens in untreated surface water sources (ponds) used to irrigate produce. The results may help the FDA consider if FSMA monitoring strategies should further account for weather events and will inform growers about the risks of post-rainfall irrigation with natural water sources, especially surface-fed sources. Methods: Irrigation water was collected from three ponds in a southeastern USA growing region approximately twice a month over one year. If the total rainfall in the 48 hours prior to sampling was ≥ 0.5 inch, the samples were considered rain event samples (3-5 events/ponds). Water samples were analyzed for Salmonella, Cryptosporidium, a human-associated microbial source tracking marker (HF183), and fecal indicator organisms E. coli, enterococci, and male-specific bacteriophage. Logistic and linear mixed effects models accounting for mixed water source effects were used to determine the associations between rainfall and the microbial quality of the irrigation water. Rainfall was modeled separately as a binary (rain event yes/no) and continuous (7-day prior cumulative rainfall) predictor. Results: After a rain event, bacteriophage and the human marker were significantly more likely to be detected, and bacteriophage, E. coli, and enterococci concentrations were significantly higher. Every one-inch increase in the previous 7-day rainfall was associated with 1.7 to 5.4 times greater odds of detecting Salmonella, Cryptosporidium, the human marker, and bacteriophage. Escherichia coli concentrations were significantly more likely exceed the FSMA geometric mean standard for samples collected over one year (126 CFU/100 ml) after rain events, and every one-inch increase in the previous 7-day rainfall was associated with a 2.5 times greater odds of the E. coli concentrations being above the same standard. Conclusions: Our results indicate that rainfall may have the potential to significantly affect the microbial quality of untreated surface water sources, such as ponds, in terms of both foodborne pathogen and fecal indicator contamination. Together this suggests that the potential impact of rainfall should be considered by growers when evaluating the risks of some surface water sources for produce irrigation. High Resolution Activity Data to Model Risks of Human Excreta Use in Agriculture: Case Study from Vietnam Tim Julian, Eawag Additional Authors: Hasitha S. K. Vithanage; Chua Min Li; Ana K. Pitol; Robert Canales; Pham Hong Lien Nguyen ; Shigeo Fujii; Harada Hidenori Microbial exposure assessment typically relies on simplistic assumptions of human-environment behavior. Simplistic assumptions may be reasonable for exposure routes that are generally consistent and unvarying: drinking water consumption, for example, is assumed to be 1-2L per day. But for other exposure routes, like non-dietary ingestion and dermal exposures, large variation is likely because of the complexity of human-environment interactions. Here, we discuss the collection, analysis, and interpretation of human-environment interactions with second-level resolution for microbial exposure assessment. Data are collected through first person videography and analyzed using Video Translator software, which provides a temporal sequence of contact events with resolution at the second time scale. To demonstrate inclusion of temporal sequences in modeling exposure from complex behaviors, we examine a case study of the risks of farmers engaged in the collection and land application of human excreta in Vietnam. Specifically, 27 farmers from the Phú Xuyên district in Hanoi, Vietnam were enrolled: 10 while collecting human excreta from latrines and 17 while applying excreta, seeding, or planting on land. Translation of the videography data highlighted wide variation in the frequency of contact events amongst farmers. Average and standard deviation of contact events was 283 (123) and 324 (90) per hour for left and right hands, respectively. Although the objects most frequently contacted were generally the same across farmers (For example, excreta, handheld tools, and polysak bags), there were a number of objects only contacted by a couple of farmers (for example, boots/shoes, bicycle, and mobile phone). There was also wide variation in the frequency of hand-to-face contacts, which are the contacts responsible for risk of infection. The average farmer contacted their face, mask, or mouth and 4.6 (8.6) and 2.2 (4.2) times with their left and right hands, respectively. The high standard deviations highlight the wide range of contacts, which varied between 0 and 42 times per hour. By combining the human-environment time series data with estimates of bacterial contamination on surfaces (obtained from environmental sampling) and transfer of bacteria on contact (obtained from literature review), we further demonstrate that the bacterial dose estimates are dependent not only on frequency (how often) but also on timing (when). Implications are discussed with respect to impacts on dose and risk estimates. Dogwood Impact of Sanitation on Household Fecal Contamination in Rural Bangladesh Erica Fuhrmeister, UC Berkeley Additional Authors: Ayse Ercumen; Amy Pickering ; Kara Nelson In low-and middle-income countries diarrheal illness is a leading cause of morbidity and mortality, resulting in 1.6-2.5 million deaths annually. In the most vulnerable age group, children under five, approximately 10% of global deaths are attributable to diarrheal diseases. Many pathogens are spread through the fecal oral route in areas with poor sanitation infrastructure. Fecal pathogens move from feces to a new host through a variety of complex pathways involving fingers, water and soil. Sanitation acts as a primary barrier to block transmission pathways and reduce the burden of diarrheal disease. This study is assessing the impact of improved sanitation infrastructure on animal and human

Page 23 of 99

fecal contamination in the household environment, as well as evaluating the relative importance of different disease transmission pathways (soil, hands, stored water) to children under two in rural Bangladesh. We monitored 720 households from the sanitation and control arms of the WASH Benefits randomized controlled trial for 2 years total. Surveys, direct observations and infrared sensors were used to track sanitation practices in households. Specific pathogens as well as microbial source tracking markers were measured in soil, stored drinking water, and hand rinses of children and their mothers using quantitative and non-quantitative polymerase chain reaction assays. Results show substantial animal contamination in study households. Additionally, child hands are a reservoir for pathogens, thus an important vector in disease transmission. Impact of a Controlled, Before-and-After Trial of Shared, Onsite Sanitation on Environmental Exposure to Fecal Contamination in Low-Income Neighborhoods of Urban Maputo, Mozambique David Holcomb, UNC Chapel Hill Additional Authors: Jacqueline Knee; Trent Sumner; Joe Brown; Jill Stewart A key concern for child health is enteric pathogen exposure through fecal contamination of the domestic environment, arising in part from insufficient containment of human and animal excreta. This phenomenon is likely exacerbated in the densely populated urban settlements that house increasing numbers of the world’s poor. As part of the Maputo Sanitation trial, we conducted a controlled, before-and-after study to assess whether urban, onsite, shared latrines can reduce domestic fecal contamination and protect child health. Pour-flush latrines were constructed at 600 compounds (household clusters sharing outdoor space) to replace existing shared latrines in poor condition in low-income, semi-formal neighborhoods of Maputo, Mozambique, from which an additional 600 compounds with similar sanitation conditions were recruited as controls. We assessed fecal contamination in a subset of study compounds by quantifying fecal indicator organisms in household stored water, compound source water, household entrance soil, latrine entrance soil, and household food preparation surfaces, immediately before and one year after latrine construction. Multiple aliquots of each sample were membrane filtered for enumeration of E. coli on modified mTEC broth and to generate archive filters for molecular detection of host-specific fecal contamination using locally validated microbial source tracking (MST) markers. Baseline environmental samples were collected at 69 households in 26 intervention compounds and 81 households in 31 control compounds; endline samples were collected at 88 households in 33 intervention compounds and 89 households in 31 control compounds. Mann-Whitney U tests at 5% significance level were used to test for differences in the distribution of log-transformed E. coli concentrations between intervention and control samples and between baseline and endline samples. At baseline we observed no significant difference in E. coli concentration distribution between intervention and control samples for any sample type. At endline, only household soil E. coli distributions differed significantly between intervention and control samples, with median E. coli concentrations of 3.3 and 3.9 logCFU/g, respectively (n1=43, n2=50, p = 0.04). For all samples types but source water, median E. coli concentrations were lower at endline in both intervention and control samples. Significant endline decreases in E. coli concentration were seen in control household stored water (baseline median 1.98 to endline median 0.9 logCFU/100 mL), control food preparation surfaces (3.38 to 2.03 logCFU/100 cm2), intervention household soil (4.05 to 3.22 logCFU/g), and both intervention (3.95 to 2.64 logCFU/g) and control (4.14 to 3.47 logCFU/g) latrine soil. Ongoing molecular analyses to determine fecal source may help explain the observed general decline in culturable E. coli, some of which may be naturally occurring and subject to changing environmental conditions. The Efficacy of Alternative Reagents for On-Site Disinfection of Wastewater and Fecal Sludge Matrices Diogo Trajano Gomes Silva, University of Brighton Additional Authors: Adam Taylor; Chloe Goacher; James Ebdon; Huw Taylor Following the Ebola epidemic (West Africa 2013) it became evident that "on-site" disinfection of wastewater represents a priority WASH intervention in emergency settings. It serves as a barrier, limiting the ongoing transmission of faecal-borne pathogens to the environment. It is widely recognised that the high disinfection efficacy associated with traditional reagents such as chlorine when used to disinfect drinking water is not achieved when they are used to disinfect matrices containing a significant organic load (such as sewage or human excreta). Therefore, there is a clear need to investigate the use of alternative disinfectants that might achieve more effective disinfection against these kind of matrices. This research evaluated the ability of current WASH disinfection protocols (superchlorination (0.5% NADCC solution)) and alternative alkaline disinfectants (hydrated lime (Ca (OH)2; 30% suspension); wood ash (25% suspension); potash, potassium hydroxide (KOH; 0.5% and 1% solutions) to kill or reduce levels of viruses and bacteria within sewage and human excreta matrices. Miniaturized experiments were conducted which followed current WASH recommendations. Three wastewater matrices, containing 0%, 10% and 20% of fecal sludge/wastewater content were disinfected. Disinfection processes took place in 50 ml falcon plastic tubes containing disinfectant solution and wastewater matrix in a 1:10 ratio. Contact time was 30 minutes. Bacterial (fecal coliforms and intestinal enterococci) and viral (somatic coliphages) indicators were used to measure disinfection efficacy. Overall results for disinfection efficacy demonstrated that the log reduction of fecal coliforms was greater for lime 30% (M = 4.75) followed by potash (0.5 and 1%) (M = 4.52); NaDCC (M = 2.89) and wood ash (M= 2.24). Log reduction of intestinal enterococci was greater for lime 30% (M=4.15) followed by potash 1% (M=3.78); NaDCC (M=2.36); potash 0.5% (M=1.56) and wood ash (M=0.16). In contrast, log reduction of somatic coliphages was greater for potash (M= 3.19) followed by NaDCC (M=3.01); lime 30% (M=2.84); potash 0.5% (M=1.53) and wood ash (M=0.05). With the exception of wood ash, all disinfectants performed well

Page 24 of 99

(> 2 log reduction) when the matrix was composed of pure wastewater, but overall disinfection efficacy decreased as the amount of faecal sludge in wastewater samples increased. Interestingly, hydrated lime and potash (1%) were shown to be effective disinfectants even when matrices contained the highest organic load (log reduction M=3.35 and M= 3.52 respectively). The results demonstrated that, of the reagents tested, hydrated lime was the most effective alternative to superchlorination for the disinfection of wastewater matrices. Alkaline reagents, such as potassium hydroxide, demonstrated considerable disinfection potential, but these are generally extremely caustic products and their handling and application might represent a health and safety risk to operators. Bellflower Prevalence and Characterization of Gram-Negative Bacteria Producing Extended Spectrum Beta-Lactamase and Carbapenemase from Different Water Sources in Singapore Laurence Glass-Haller, National University of Singapore Additional Authors: Hongjie Chen; Charmaine Ng; Thai Hoang Le; Mark Sobsey; Karina Gin Beta-lactam antibiotics constitute the main therapeutic choice for treating infections caused by Gram-negative bacteria in both humans and animals. The selective pressure caused by the use and misuse of these antibiotics has led to an increase of antimicrobial resistance to those compounds over the past twenty years. Today, one of the most important resistance mechanisms in Gram-negative bacteria is the production of enzymes causing resistance to modern expanded-spectrum cephalosporin and carbapenem, mainly extended-spectrum ß-lactamases (ESBLs) and carbapenemases. The spread of ESBL- and carbapenemase-producing bacteria is an emerging global problem. In Singapore, the presence of ESBL and carbapenemase producers and their relevant resistant genes in water environments has not been well investigated. The aim of the present study was (i) to assess the occurrence of ESBL- and carbapenemase-producing strains throughout an urban water network (sewage effluents from two major hospitals and one domestic wastewater treatment plant, four water bodies and four tributaries), (ii) to characterize the isolated strains and (iii) to identify some of the ESBL and carbapenemase genes responsible for the resistance. CHROMagar ESBL and KPC plates were used to rapidly screen for Gram-negative ESBL-producing bacteria and the ones expressing a reduced susceptibility to carbapenems, respectively. The abundance of ESBL- and carbapenemase producers was higher in hospital wastewater in the range of 104-107 CFU/mL. For the rest of the water samples we observed the following concentrations: between 103-104 CFU/mL in the untreated influent from the wastewater treatment plant, between 102-103 CFU/mL in tributaries, and below 100 CFU/mL for treated domestic wastewater, as well as for the water bodies. A total of 94, 99 and 97 bacterial strains were randomly picked from the CHROMagar plates with samples from hospital sewage, domestic sewage and surface waters, respectively. The most abundant resistant pathogens or opportunistic pathogens found in hospital sewage belong to the KEC (Klebsiella, Enterobacter, Citrobacter spp.) group (48%) and the Pseudomonas spp. taxa (27%). The antimicrobial susceptibility profiles of all the isolates was evaluated using the automated Vitek® 2 Compact system. Out of the 66 isolates picked on ESBL and KPC plates with hospital sewage, 100%, 82%, 82% and 76% were resistant to cefazolin, ceftazidime (cephalosporin family), ertapenem and meropenem (carbapenem family), respectively. PCR and sequencing analysis showed that the predominant ß-lactamase genes were bla-SHV (43%) followed by bla-NDM1 (33%), bla-CTX (33%) and bla-KPC (28.5%). Similar data were generated for domestic wastewater before and after treatment as well as for surface waters. This study improves the understanding of the possible route of antimicrobial resistance dissemination and the potential impact on human health. Campylobacter and Arcobacter Source Tracking in a Freshwater Lake Environment Satoshi Ishii, University of Minnesota Additional Authors: Mayumi Kobayashi; Qian Zhang; Mitsuto Maeda; Akiho Miyamura; Takahiro Segawa; Satoshi Okabe Campylobacter species are the most common foodborne bacterial pathogens. Similar to Campylobacter pathogens, some members of the genus Arcobacter, which is phylogenetically closely related to the genus Campylobacter, can also cause human diseases. While the main source of the Campylobacter infection is the consumption of contaminated water and foods, sources of Arcobacter infection are largely unclear. The objectives of this study were to (1) quantitatively detect Campylobacter and Arcobacter in a natural freshwater lake and (2) identify their sources. Water samples were collected from Lake Miyajimanuma in Hokkaido, Japan, monthly from April 2013 to November 2014. Tens of thousands of geese use this lake as their stopover site during their migration in spring and fall. The lake water is used for irrigation in the surrounding agricultural area; therefore, fecal pollution by these geese is of concern. Based on the 16S rRNA gene amplicon sequencing, microfluidic pathogen-specific qPCR, and culture-based pathogen isolation methods, we detected high level of Campylobacter in the lake water, especially during geese migration seasons. Quantitative microbial risk assessment showed that the concentrations of Campylobacter in the water samples were above the concentrations that can potentially cause 10-4 infections per person per year when water is used to grow fresh vegetables. In addition to the water samples, we also detected Campylobacter in the geese fecal samples. Identical flaA sequences were detected from water and geese samples by flaA amplicon sequencing. These results suggest that migratory geese are the major source of Campylobacter pathogens in the lake. In contrast, Arcobacter was detected in the lake water in summer months, during which no goose was observed. Arcobacter was not detected from geese fecal samples. Based on the flaA amplicon sequencing, identical Arcobacter genotype appeared over time, suggesting that Arcobacter may be present as part of the indigenous microbial flora in the lake environment. In

Page 25 of 99

conclusion, our results suggest that occurrences of Campylobacter spp. in the lake water were most likely related to the migration of geese; while Arcobacter spp. might be naturally present in the environment. A Community-Based Approach for Determining Sources of Fecal Bacteria in a Freshwater System Clairessa Brown, University of Minnesota Fecal contamination of waterways from wild, domesticated and agricultural animals, and sewage sources are responsible for several waterborne diseases. Microbial source tracking (MST) methods aim to determine the sources of fecal pollution in waterways. Current MST methods employ molecular markers targeting specific host-associated taxa, and these may show variable specificity and sensitivity. To allow for the simultaneous detection of multiple sources, we have been developing a microbial community-based approach employing high-throughput DNA sequencing (HTS) of 16S rRNA genes to determine sources of fecal bacteria in freshwater. Analysis of the HTS data revealed the bacterial community structures (BCS) of twelve different animal fecal sources and wastewater effluent (n=273). These data were compared to the total BCS and shared bacterial taxa in environmental samples (n=202) from a freshwater system in the Duluth Harbor of Lake Superior. Based on initial studies done with E. coli, our hypothesis was that wastewater effluent influenced beach contamination. Analyses from amplicon sequencing of nearly 500 fecal and environmental samples revealed that the bacteria present in environmental and fecal samples are significantly different (p-value: <0.001), thus allowing taxonomic differentiation between bacterial communities in the two matrices. While there were common fecal-associated taxa across multiple sources, AMOVA pairwise comparisons revealed the BCS from different animals were significantly different (p-value <0.05). The program SourceTracker, which uses a Bayesian statistical classifier to calculate the amount that a source(s) contributes to contamination in an environment, revealed the predominant fecal pollution sources were likely from wastewater effluent, and to a lesser extent geese and gulls. SourceTracker used an average of 115 taxonomic families to form a multi-taxa marker signal for wastewater effluent, 68 taxonomic families for geese and 79 taxonomic families for gulls. Quantitative PCR analysis revealed >70% agreement with SourceTracker results when evaluating the presence of human-associated molecular markers (HF183/BacR287) in water samples across all sites. The results of this research may allow for an alternative method to determine sources of fecal bacteria that pollution management agencies can utilize in protecting freshwater resources. Mountain Laurel Development of Ambient Marine Recreational Water Quality Standards in Abu Dhabi, United Arab Emirates Katherine Woodward, RTI International Additional Authors: Anbiah Rajan; Salem Al Braik; Jens Thomsen; Jennifer Richkus; Mary Barber; Sheikha Al Hosani; Glenn Whaley Abu Dhabi is the largest and most populous emirate comprising the United Arab Emirates, a rapidly developing country situated on the coast of the Arabian Peninsula. In the face of robust economic development, including a growing tourism industry, Environment Agency Abu Dhabi (EAD) is developing an ambient marine water quality regulation, including a microbiological water quality standard, to protect public health at 20 private beaches and 15 managed public beaches, as well as a number of unmanaged ("informal") public beaches in the Emirate. This paper describes the development of the recommended standard by EAD and other stakeholder entities. The Agency employed a three-step approach: (1) establish the knowledge base by performing pilot studies of water quality at recreational beaches, reviewing historical data from routine monitoring programs, and reviewing international and regional best practices; (2) select designated uses for implementing the standards by assessing Abu Dhabi's marine waters; and, (3) set the standards based on both international best practice and local context. Due to widespread year-round recreational use of Abu Dhabi's marine waters, EAD concluded that a single standard should be applied to all waters in Abu Dhabi, to ensure adequate public health protection. Based on a review of international best practices and an analysis of historical monitoring data and data from pilot studies performed at recreational beaches, the Agency selected a geometric mean value of 35 MPN enterococci per 100 mL water as the recommended ambient marine recreational water quality standard. Data from pilot studies indicate that no beaches exceeded the proposed standard. The use of health-based action levels and implementation of a Beach Action Value protocol alongside the ambient standard to protect public health from immediate threats are described. Also discussed are plans to develop policies and procedures to guide monitoring, reporting, and compliance with the proposed standard. Analysis of Vibrio Dynamics in the Neuse River Estuary, NC Using Next Generation Sequencing Amplicon Data Kelsey Jesser, UNC Chapel Hill, Institute of Marince Sciences Additional Authors: Rachel Noble; Denene Blackwood; Justin Hart; Emelie Andersson; Brett Froelich; Rachel Canty The genus Vibrio encompasses a diverse and abundant group of heterotrophic bacteria which are ubiquitous and abundant members of the native flora in coastal and estuarine waters. Though most are benign commensals, several Vibrio species are important human and animal pathogens. These organisms are common in marine waters and shellfish and proliferate rapidly in warm, moderately saline waters. However, their responses to other environmental parameters (nutrients, chlorophyll-a, turbidity, etc.) are not well understood, and traditional molecular

Page 26 of 99

and culture-based analyses have failed to resolve these relationships, especially in response to storm events. In order to better understand Vibrio responses to changing environmental gradients, samples were collected biweekly from May to early September, 2016, with an increased sampling effort in response to Tropical Storm Collin, which passed nearby in early June, 2016. Preliminary culture-based results showed concentrations of total Vibrio >105 CFUs/100 mL after this storm event, and concentrations remained high throughout the summer months. Additionally, we conducted Illumina amplicon sequencing of the bacterial 16S and hsp60 genes for 94 samples collected in the Neuse River Estuary (NRE), a shallow microtidal estuary in eastern North Carolina. This approach has allowed us to analyze entire microbial communities in the NRE, and identify previously uncharacterized relationships between Vibrio abundance, other members of the bacterial community, and common water quality parameters. This study is among the first to use next-generation sequencing technologies for the ecological characterization of Vibrio pathogens in the coastal environment. Regional Monitoring of Human Fecal Contamination in Flowing Storm Drains and Creeks discharging to Southern California Bight Yiping Cao, Southern California Coastal Water Research Project Additional Authors: Meredith Raith; John Griffith Over the last decade, molecular tools have demonstrated great advantages for recreational water monitoring, due to their higher speed, specificity and sensitivity compared to culture-based methods. For example, qPCR-based fecal source markers are recognized as convenient and reliable, and are now the most popular tools for identifying sources of fecal pollution in ambient waters. However, these molecular tools have been mostly used by research laboratories. Large- scale implementation in the hands of routine end users is needed to assess the management value of these technologies. Here we report a regional monitoring study of the HF183 human fecal marker in drainages discharging to beaches in the southern California bight. Drainages (i.e. storm drains and creeks) throughout southern California bight were selected by local environmental and public health agencies based on high historical levels of general fecal indicator bacteria (i.e. Enterococcus). A total of 23 and 24 drainages were sampled upstream of tidal influence during summer dry and winter wet conditions, respectively, over 2-3 years, and all samples were analyzed for the HF183 human fecal marker using standard operating protocols. Sampling and qPCR analysis were conducted by local agency laboratories following training and an inter-laboratory calibration exercise. For summer dry conditions, samples were taken in the early morning between April 1 and October 31. During winter wet conditions, samples were taken within 72 hours following 0.10 inch of rain. During dry weather, the HF183 human fecal marker was detected in all but two sites. The frequency of detection and site-average concentration of HF183 marker were also highly variable among sites (HF183 was detected in 0-98% samples with site averages of 0.5 - 144 copies per 100ml). Wet weather generally increased both frequency and magnitude of the HF183 marker, which was detected at all 24 sites in 11-100% of the samples, with site averages of 1 - 7551 copies per 100ml. However, at a small number of sites (n=4), the HF183 marker was detected less frequently and at a lower average concentration during wet weather than during dry weather. This may indicate an interplay of differences in sources, dilution, and timing of sampling for dry vs. wet weather monitoring. This regional dataset enables managers to explore two important management applications: prioritizing sites for remediation and classifying sites for alternative management strategies based on the extent of human fecal contamination, as revealed by monitoring of the HF183 human fecal marker. Here we discuss recommendations and their scientific basis for both ranking and classification, and provide sensitivity analysis to demonstrate consequences (or lack of) of policy choices, providing valuable information for decision makers. Future work to establish a link between source markers and health risk will further improve the management value of the molecular source markers. 4:00 – 5:00 PM Grumman Time Series Analysis of Seasonal Correlation Between Concentration of Norovirus in Sewage and Clinical Cases of Acute Gastroenteritis Fuminari Miura, The University of Tokyo Additional Authors: Toru Watanabe; Kozo Watanabe; Kensuke Fukushi Norovirus is one of the most frequent causes of infectious gastroenteritis in the world. Previous researches have examined concentrations of norovirus in sewage in relation to virus contamination in water-related environments, such as river, ocean and seafood. Although previous studies supposed a synchronous pattern in the seasonal variations of norovirus epidemics and virus contamination in water, findings on their temporal correlation remain scarce due to the lack of the long-term monitoring of virus concentration in water environments. The time-series monitoring of sewage, which may contain excreta from patients in the treatment area, might be more effective than the current early warning system of outbreaks based on the reported cases from medical institutes because the case reports are normally delayed for 1-2 weeks. This study firstly aimed to test the temporal correlation between the concentration of norovirus in sewage and the number of clinical cases using our long-term monitoring data in a small town. The second aim was to develop a statistical method to utilize prior time-series data of norovirus concentrations in sewage for early warning of outbreaks. To analyze the correlation, we applied statistical models, known as autoregressive (AR) model and vector autoregression (VAR) model, to the datasets surveyed by our group (Miura et al., 2016), which weekly monitored and

Page 27 of 99

surveyed the concentrations of norovirus in sewage and the number of cases in a town in Japan for over 3 years. The survey had demonstrated that the concentration of norovirus seasonally fluctuates from 1.5 log to 5 log [copies/mL] in a year. Also, two epidemiological methods were applied to the datasets for the earlier detection of norovirus-associated epidemics. For many years, autoregressive integrated moving average (ARIMA) model and Serfling (or Serfling-Poisson) regression model have been employed in epidemiology to understand the seasonality of epidemics and estimate the excess mortality due to infectious diseases. We decided to utilize these models, which are generally used by Centers for Disease Control and Prevention (CDC) and other governmental institutes, to develop a new early warning method with the abovementioned biological datasets. As a conclusion, our present study has revealed the significant temporal correlation between the number of clinical cases and the norovirus concentrations in sewage. Furthermore, our novel approach enabled us to get appropriate prediction intervals for their upcoming values in the next few days, which indicate the possibility of earlier detection of epidemics with the time-series data in sewage. Determining Ultraviolet Inactivation Rates for Adenovirus Isolated from Sewage Roberto Rodriguez, University of Texas-Health Sciences Center at Houston Additional Authors: Cesar Navar; Karl Linden Adenoviruses have demonstrated an extreme resistance to Ultraviolet light (UV) inactivation. The hypothesis of this extreme resistance is that viral DNA could be repaired during cell culture. However, most of the work on adenovirus inactivation has been performed using adenovirus stocks adapted to grow in cell culture which can better exploit cell resources during propagation. Therefore, it is not known if this extreme resistance is also observed in adenoviruses from human origin found in the environment, not customized to grow in cell culture. The goal of this project is to determine the inactivation of sewage isolated adenovirus strains and compare those results to the inactivation of adenovirus laboratory strains. Sewage samples were collected from wastewater treatment plants in El Paso County, Texas. One-L sample was concentrated to 5 mL by organic flocculation followed by PEG precipitation. Concentrated samples were assayed using HEK 293 cell line. The first passage samples were assayed in 24 wells-plates and incubated for 20 days. Positive wells (determined by qPCR), were selected and incubated in 75cm2 flask for another 20 days. Viruses were obtained from the cell monolayer and purified by chloroform extraction and PEG precipitation. Isolates were titered using the combined cell culture reverse transcription (RT) mRNA q PCR assay, and typed using PCR targeting the fiber gene. In addition, calibration curve relating Adv mRNA to viral concentration was developed for each isolate. UV exposures were performed using a collimated beam set up with Low pressure (monochromatic at 254nm) mercury lamps. Dosage was calculated by lamp irradiance at sample height, sample UV absorbance at 254 nm, sample depth and diffusion of UV rays in the water. Three adenovirus isolates have been obtained and were identified, belonging to groups D and F. For adenovirus 41, two-Log inactivation was observed at a dose of 155 mJ/cm2. The dose required for 2 log inactivation for the three sewage-isolates was 92 mJ/cm2, 104 mJ/cm2 and 120 mJ/cm2. The inactivation rates for LP lamps were higher for the isolates than observed for adenovirus 41, but they still show high resistance to UV inactivation. Future work to be reported includes determining the inactivation rates with polychromatic (MP) UV lamps and further characterization of the sewage adenovirus isolates. Factors Affecting the Survival of Sewage-Specific Enterococci Bacteriophages for Microbial Source Tracking Kwanrawee Joy Sirikanchana, Chulabhorn Research Institute Additional Authors: Namfon Booncharoen; Natcha Chyerochana; Skorn Mongkolsuk Microbial source tracking (MST) has been successful in managing polluted water in many developed countries. MST identifies correct fecal matter origins that contaminate water. However, MST?s application is limited in developing countries. One MST technique, the bacteriophage culture method, is suitable for developing countries because it does not require highly-skilled technicians and instruments and has a low cost. In previous work, we established E. fecalis host strains AIM06 and SR14 for the detection of sewage-specific bacteriophages in water resources in Central Thailand because these strains accurately identified human sewage sources with no false positive rate (tested against a variety of animals, including cats, chickens, cows, dogs, ducks, pigs, and pigeons) and a false negative rate as low as 10%. However, to facilitate the use of the newly-developed sewage-specific enterococci bacteriophages, their persistence under different environmental conditions must be investigated. The study sought to characterize the survival patterns of bacteriophages of E. fecalis strains AIM06 and SR14 under different water mediums (freshwater vs. seawater), levels of contamination (relatively clean vs. polluted), and temperatures and in water with suspended solids and natural microorganisms. Relatively clean and polluted freshwater and seawater were collected and seeded with four types of bacteriophages in laboratory reactors. The bacteriophage concentrations were measured up to 30 days in the reactors using a double-layer agar assay. The bacteriophages seeded into raw waters had dramatically shorter lifespans than those seeded in water pre-filtered with a 0.22 µm-pore-sized mixed cellulose ester membrane, which had previously removed suspended solids and natural microbiota, in all water types for all four bacteriophages. Other significant factors that affected the decay rates include: phage type, water mediums (freshwater vs. seawater), levels of contamination, and water temperature. The results from this study will be useful in the application of enterococci bacteriophages in microbial source tracking.

Page 28 of 99

Dogwood A Quantitative Comparison of Microbial Health Risks During Urine Collection and Struvite Production from Urine Using the Microlevel Activity Time Series (MLATS) Method Heather Bischiel, University of California, Davis Additional Authors: Lea Caduff; Simon Schindelholz; Tamar Kohn; Timothy Julian This project quantifies time-dependent occupational exposures to pathogens in urine during the collection of urine and its subsequent processing into struvite fertilizer from indirect pathogen exposure. The study was conducted in Durban, South Africa, where a network of over 80,000 urine-diverting toilets is in place and the opportunity to collect urine for nutrient recovery at scale is ripe. The microlevel activity time series (MLATS) method was selected for the exposure assessment. First person videography of urine collection and processing was coded into high-resolution data yielding the frequency, duration, and chronology of contacts between each study participant hand and each surface. Measured concentrations of E.coli in urine and on surfaces were used to calculate urine volume equivalents on surfaces. Rotavirus contamination on surfaces was calculated from urine volume equivalents and expected concentrations in urine. A model was constructed to simulate the concentrations of Rotavirus on hands through time. Monte carlo simulation was performed to incorporate model parameter uncertainty into the results. Study participants contacted visibly wet, urine-contaminated surfaces more frequently during the production of struvite than during the collection of urine (e.g., 10 vs. 3 wet-surface contacts/hr). The urine volume equivalent on surfaces was determined to be up to 0.3 ml urine / 100 cm2. A tracer study was conducted to validate hand contact with presumably urine-contaminated surfaces during struvite production, revealing that 0.04 - 50 ml of urine was contacted per batch of struvite produced. Nevertheless, the probability of Rotavirus infection associated with single dose events from presumed hand-to-mouth contacts was somewhat low during struvite production. For example, for 10K simulations of 61 intermittent hand-to-mouth contacts occurring throughout a day of struvite production, the median P(response) [95% CI] was 1.5E-4 [1.4E-5 , 5.4E-4]. Such exposure may be unacceptable if multiple hand-to-mouth contacts occur during a day of work. The model of struvite production was sensitive to the transfer coefficients used for wet surfaces, indicating further research needed regarding the transfer of pathogens from liquids to skin. In the context of resource reuse, source-separated urine is often falsely considered "sterile" or nearly so. Urine treatment via storage can reduce pathogen concentrations in struvite reactor influent to reduce exposure. Fertilizer production techniques that reduce human contact with urine during processing such as automated reactors should be favored. This study is unique in its approach to accurately model the time-dependent concentration of pathogens on hands due to urine contamination and to quantify the consequent exposure potential using videography, fecal contamination surface swabs and a tracer study. The methods are more broadly useful for assessments of indirect exposures to pathogens in liquids. Photoinactivation of Pathogenic Bacteria: Mechanisms and Cellular Response of Staphylococcus Aureus Jill McClary, Stanford University Additional Author: Alexandria Boehm Recreational exposure to microbially contaminated coastal waters is associated with adverse health outcomes including gastrointestinal, respiratory, and skin ailments - all caused by pathogens. Understanding the sources and fate of pathogens in coastal waters is therefore needed. Photoinactivation, or inactivation due to sunlight exposure, is an important process that can affect bacterial concentrations in coastal waters. However, the relative importance of direct and indirect photoinactivation mechanisms remains poorly understood. Additionally, pathogens may display different photostress responses than fecal indicator bacteria; thus an understanding of photoinactivation mechanisms in pathogens is needed to improve water quality modeling and risk assessment in recreational waters. The goal of this research is (1) to investigate photoinactivation mechanisms of Staphylococcus aureus (SA), a human pathogen commonly detected at recreational beaches, using culturing, microscopy, and RTqPCR; and (2) to develop a conceptual model of photoinactivation based on bacterial characteristics and targets of sunlight-induced damage (i.e. nucleic acids, proteins, and cell membranes). We performed photoinactivation experiments by exposing SA to simulated sunlight in seawater. By controlling oxygen concentrations and assessing SA culturability, membrane integrity, and gene expression, we are able to identify important photoinactivation and cellular defense mechanisms. Results demonstrate that oxygen-mediated photoinactivation mechanisms were dominant for inactivation of SA, as determined by loss of culturability. However, SA cell membranes were protected from photostress in oxic conditions, possibly due to the scavenging ability of membrane-bound carotenoids. Additionally, increased expression of a methionine sulfoxide reductase gene in the oxic condition points to methionine residues as important targets for oxidative stress, while increased expression of a recombinase gene in the anoxic condition suggests that cells are responding to DNA damage. Results from this study highlight the importance of oxygen in the photoinactivation of bacteria in environmentally-relevant systems and the complexity of bacterial photoinactivation with respect to cell structure and transcriptional response.

Page 29 of 99

A Multi-Tier Approach to Assessing Microbial Contamination in Transient Non-Community Water Systems Sharon Long, WSLH and University of Wisconsin Additional Authors: Brandon Moss; Jessie Dowding The majority of the population in Wisconsin relys on potable ground water from small water systems known as transient non-community water systems (TNCWS). Under the Safe Drinking Water Act, these systems are not required to provide treatment nor disinfection except under certain circumstances. These systems must monitor for total coliforms as described by the Revised Total Coliform Rule (RTCR). One unsafe TCR monitoring sample from a TNCWS can lead to time consuming and financially burdensome follow up testing and assessments, and increased future routine monitoring. The burden is especially onerous in Wisconsin as there are over 9,000 TNCWS. This presentation will describe a multi-tiered analysis algorithm developed for the RTCR unsafe follow-up assessment program for use by the Wisconsin Department of Natural Resources (WDNR) to meet the source assessment requirements for total coliform unsafe wells. The program involves a screening tier that includes a sanitary survey, inspection of the system infrastructure conditions, measurement of microbial indicators, ATP measurements, and enterobacteria identification. If the screening tier indicates the potential for environmental contamination rather than a biofilm, a large volume (100L) sample is collected, concentrated and processed for molecular testing (qPCR) for fecal source tracking (FST) targets. Examples of testing results from the wells evaluated will be presented. For each well found to have FST markers of human or animal contamination, analytical results are then used to inform corrective action. For wells determined to have biofilm issues, sanitizing followed by modifications in well operation and maintenance are the preferred corrective action. This approach is designed to provide a long-term solution that is sustainable, holistic, and economical for the WDNR and each public water supply investigated. Bellflower Method Comparison of the Two-Phase Separation and Bag-Mediated Filtration System for the Detection of Poliovirus from Haiti Environmental Samples Angela Couliette-Salmond, CDC Additional Authors: Mary Alleman; Silvia Penaranda; Claire Capshew; Hanen Belgasmi Wright; Jessica Wielgus; Stacey Jeffries Miles; Pierre Wilnique; Donald Lafontant; Salomon Corvil; Jean Francois Jeannot; Emmanuel Rossignol; Magalie Stanislas; Edmund Gue; Pape Faye; Documented weaknesses in acute flaccid paralysis (AFP) surveillance for polio have led to an increased interest in environmental surveillance (ES) as a supplemental tool for poliovirus (PV) detection. Haiti's sub-optimal polio vaccination coverage, poor sanitary conditions, history of circulating vaccine derived polioviruses, high population movement, and high numbers of international travelers, contributed to this country being listed as a priority for ES by the World Health Organization. An ES program was established in Haiti in March 2016 to complement AFP surveillance. Two concentration methods for environmental samples are being compared to inform ES globally: the two-phase separation method and the bag-mediated filtration system (BMFS). Monthly environmental samples have been collected from three sites each in Port-au-Prince and Gonaïves. All samples were frozen before shipment to the CDC in Atlanta (USA). The data presented here represent paired samples from March 2016 to July 2016 (n=30) that were concentrated using the two-phase separation and BMFS methods, analyzed using the WHO virus isolation algorithm. PV intratypic differentiation using real-time RT-PCR was conducted for positive samples. Water quality analyses using Colilert®-18 (IDEXX), revealed mean E. coli concentrations to be 6.46 x 106 MPN per 100 mL (n=28; range = 1.00 x 10^4 to 5.20 x 10^7). The average volume of sample concentrated using the two-phase separation (n=30) and BMFS (n=30) methods was 500 mL and 1287 mL, respectively. The average concentration factor was approximately 33-fold for the two-phase separation method and 84-fold for the BMFS. Overall, the majority of viruses detected (e.g. non-polio enteroviruses, PV Sabin strains) were from the Port-au-Prince (25 of 30) sites compared to those in Gonaïves (7 of 30). Agreement between the methods for detecting or not detecting "any" virus occurred in 18 of the 30 samples, noting that 11 were matching negative results. PV Sabin vaccine strains were detected at one site in Port-au-Prince in March (Sabin-like type 2 PV (SL2)) and April (SL1). Sequencing of the SL2 and SL1 isolates' VP1 region showed 3- and 4-nucleotide differences, respectively, from the reference Sabin vaccine strain. Of note, a mass trivalent oral polio vaccine (Sabin strain) campaign was conducted in Haiti in March targeting children <5 years of age. The establishment of the first PV ES in Haiti has been successful and the study is projected to continue through 2019. Current results do not yet allow conclusions to be stated on which method has a higher PV detection rate. Beyond poliovirus detection, each method has its advantages. The two-phase separation method is established globally, costs less, and uses readily available equipment, while the BMFS provides the ease of shipping a filter and allows for a higher volume of environmental samples to be processed.

Page 30 of 99

Method Comparison of the Two-Phase Separation and Bag-Mediated Filtration System for the Detection of Poliovirus from Kenya Environmental Samples Christine Fagnant, University of Washington Additional Authors: Nicolette Zhou; Jeffry Shirai; James Nyangao; Evans Komen; Benlick Mwangi; Rosemary Nzunza; Alexandra Kossik; Nicola Beck; Walda van Zyl; Marianne Wolfaardt; Angela Coulliette-Salmond; Stacey Jeffries-Miles; Silvia Peñaranda; Maureen Taylor; Peter Borus; David Boyle; Cara Burns; John Meschke As poliovirus (PV) nears eradication, environmental surveillance has become increasingly important as a supplemental tool to clinical surveillance. While wild PV (WPV) is endemic in only three countries, gaps in clinical surveillance of acute flaccid paralysis necessitate environmental surveillance to verify polio-free regions do not experience outbreaks due to imported virus. Additionally, with the removal of PV type 2 from the live attenuated oral polio vaccine (OPV) in April 2016, environmental surveillance is key to monitoring the disappearance of Sabin-like type 2 PV (SL2) from environmental waters. The two-phase concentration method is recommended and used globally by the World Health Organization for environmental surveillance of PV, though a new field sampling tool - the bag-mediated filtration system (BMFS) - was recently developed for enhanced environmental surveillance of PV. The objective of this study was to compare PV detection between the two-phase and BMFS methods, and to monitor the disappearance of SL2 from environmental waters after removal of type 2 from OPV. From February to November 2016, samples for BMFS (n=78) and two-phase concentration (n=78) were collected concurrently twice per month from four sites in Nairobi, Kenya. Briefly, using the BMFS kit, ~3-L samples were filtered through ViroCap filters, eluted in 1.5% beef extract, and concentrated using PEG/NaCl precipitation. For the two-phase method, 500 mL samples were processed by PEG/Dextran two-phase separation. Samples were analyzed by virus isolation on L20B and RD cells, followed by intratypic differentiation using real-time RT-PCR. SL1, SL2, and SL3 were detected in 25.3%, 20.0%, and 56.0% of BMFS samples, respectively, and in 12.0%, 16.0%, and 28.0% of two-phase samples, respectively. The BMFS was more sensitive than the two-phase method for all SL types, with matched pair odds ratios of 11.0 for SL1 (95% CIs = 1.4, 85.2, McNemar mid-p-test p=0.021), 1.6 for SL2 (95% CIs = 0.52, 4.9, p=0.42), and 4.5 for SL3 (95% CIs = 1.86, 10.9, p=0.002). Wild polioviruses were not detected in any samples. After the proposed removal of SL2 from the OPV, SL2 was detected with less frequency in both BMFS (Pearson χ2=11.4, p=0.00036) and two-phase samples (χ2=17.5, p=0.00003), with the last SL2 detections on June 23, 2016 (BMFS) and May 27, 2016 (two-phase). This suggests the switch to the bivalent OPV was successful. The larger sample volume processed with the BMFS is likely responsible for the higher sensitivity and enhanced PV detection compared to the two-phase method. Both sample types are concentrated to a final volume of 10 mL, and 3 mL of this volume is analyzed. This results in an effective volume of 900 mL inoculated for BMFS samples, compared to an effective volume of 150 mL plated for two-phase samples. Overall, the BMFS is an effective tool for environmental surveillance of PV. Enhanced Detection of Poliovirus in Environmental Samples from Pakistan Using the Bag-Mediated Filtration System Nicolette Zhou, University of Washington Additional Authors: Christine S. Fagnant, Jeffry H. Shirai, Salmaan Sharif, Shahzad Shaukat, Masroor Alam, Lubna Rehman, Ghulam Mujtaba, Alexandra L. Kossik, Nicola K. Beck, Sadaf Khan, Rahim Agha, Syed Sohail Zahoor Zaidi, David S. Boyle, J. Scott Meschke Environmental surveillance of poliovirus (PV) supplements clinical surveillance and plays an important role in the global program for eradication of wild PV (WPV). Environmental surveillance is crucial for monitoring PV circulation as clinical cases decrease. It is also central for monitoring the disappearance of the Sabin-like (SL) PVs, as the live attenuated, oral polio vaccine (OPV) was modified in April 2016 and will be replaced by the inactivated polio vaccine in 2019. The bag-mediated filtration system (BMFS) is a newly developed field sampling technology for enhanced PV surveillance. The objective of this study was to compare BMFS environmental surveillance results with the current sampling method recommended by the World Health Organization (two-phase separation method), and to monitor the disappearance of SL PV type 2 (SL2) from the environment with the switch from the trivalent OPV (tOPV) to the bivalent OPV (bOPV). From February to November 2016, BMFS and two-phase samples were collected concurrently from 12 sites in 10 Pakistani cities, resulting in 118 total samples for each sample type. Sample concentrates were analyzed for SL1, SL2, SL3, WPV1, WPV3 and vaccine-derived PV (VDPV) by virus isolation using L20B and RD cells followed by intratypic differentiation using real-time RT-PCR. PV (in some form) was detected in a majority of BMFS (86%) and two-phase samples (64%). Compared to two-phase samples, BMFS samples resulted in more frequent detection of PV, with odds ratios of 6.7 for SL1 ((2.8, 15.7) 95% CI; p<0.0001, McNemar mid-p test), 4.0 for SL2 ((1.3, 12.0) 95% CI; p=0.007), 4.6 for SL3 ((2.2, 9.9) 95% CI; p<0.0001), and 4.5 for WPV1 ((1.0, 20.8) 95% CI; p=0.039). WPV3 was not detected by either method. Most notably, the BMFS detected WPV1 during eight sampling events in which the two-phase method did not. Four of these events occurred at two sites where the two-phase method did not detect WPV1 at any time during this study. The BMFS also detected a VDPV2 during one sampling event in which the two-phase method did not. SL2 was more frequently detected in both BMFS and two-phase samples during tOPV use than during bOPV use, and the last detection of SL2 occurred in June 2016. After the switch to bOPV, there was more frequent detection of SL2 in BMFS samples (8.4%) compared to two-phase samples (1.2%), with no results discordant in favor of the two-phase method (p=0.016). The greater frequency of detection in the BMFS samples is likely due to the greater volumes filtered with the BMFS (5.3 ± 0.8 L) compared to the 500 mL processed by the two-phase method. After processing, the BMFS samples are concentrated ~530x compared to concentration of 50x for the two-phase

Page 31 of 99

samples. As 3 mL of both sample types are inoculated into tissue culture, this results in a greater effective volume assayed of the original sample (1590 mL BMFS vs. 150 mL two-phase). This study demonstrated that the BMFS results in enhanced environmental PV detection. Mountain Laurel Are Current Stormwater Harvesting Guidelines and Treatment Technologies Adequate for Protecting Public Health from Campylobacter? Heather Murphy, Temple University Additional Authors: Ze Meng; Rebekah Henry; Ana Deletic; David McCarthy Background Campylobacter is the leading cause of enteric disease in Australia. In the State of Victoria, the number of cases of illness has been increasing annually; since 2013, the annual number of cases has increased by 32% (from 5891/ year to 7769/ year). Campylobacter is a pathogen that is found frequently in untreated water supplies, including stormwater run-off (Henry et al., 2015). Stormwater harvesting in Australia is an important component of integrated water management in urban settings (Wong et al., 2016). Stormwater is most commonly harvested for non-potable uses such as municipal irrigation, private garden irrigation and toilet flushing. This research seeks to understand whether current guidelines for stormwater harvesting for non-potable activities are adequate to protect public health. We used quantitative microbial risk assessment (QMRA) and data collected on the occurrence of Campylobacter at the outlet of a stormwater wetland and biofilters in Victoria, Australia. Methods Microbial and treatment performance data were collected from March 2014 to September 2015 from the Troups Creek Wetland, located in a south-eastern suburb of Melbourne, Australia. 49 samples were collected and analyzed for Campylobacter following Henry et al (2015). A quantitative microbial risk assessment methodology was applied to estimate the health risks associated with the use of stormwater (under various treatment regimes) for non-potable applications (i.e. toilet flushing, garden irrigation, municipal irrigation, accidental drinking event). Seven different risk exposure scenarios were modelled using Campylobacter as the reference pathogen for the risk assessment. Annual probability of infection and Disability Adjusted Life Years (DALY) were chosen as the end points for the risk model. The desired health targets used in the study were a probability of infection of less than 1 x 10-4 infections per year and less than 10-6 DALYs per person per year. Results/ Conclusions The mean Campylobacter concentration at the inlet of the Troups Creek wetland was 808 MPN/L (SD= 929). Seven exposure scenarios were modeled including: no treatment, wetland treatment, biofiltration, biofiltration +UV, 1.3 log reduction (recommended reduction for municipal irrigation), 2.4 log reduction (recommended reduction for indoor and outdoor non-potable reuse), and the current treatment in place at the Troups Creek wetland (coagulation, direct filtration, UV, chlorination). Only the last scenario was capable of consistently providing water of low enough risk to keep annual probabilities of infection below the 1 x 10-4 infections per year (Mean Pinf, year= 1.02E-07 to 1.13E-06) for municipal and household irrigation (including an accidental drinking event) and toilet flushing. The results suggest that the current stormwater reuse guidelines and biofiltration systems in place in Australia may be inadequate for protecting public health from Campylobacter infections. Survival of Campylobacter spp. in Urban Stormwater Wetlands Ze Meng, Monash University Fecal microorganism removal in stormwater wetlands can vary significantly, from good performance to net leaching. Some studies have proposed that this net leaching is cause by two processes: (1) waterfowl deposition within the wetland itself and/or (2) extended survival of fecal microorganisms in the bed sediments which are then resuspended and carried to the outlet during high flow events. However, all stormwater wetland studies have relied on indicator organisms, like E. coli or enterococci, and little is understood about their ability to reduce actual human pathogens and the processes that govern pathogen removal. As such, this study investigates the survival of a commonly used indicator organism (E. coli) and a reference pathogen (Campylobacter spp.) in a stormwater wetland, providing evidence about whether extended survival (and hence resuspension) is a possible pathway for these organisms. In-situ diffusion chambers were used to study the survival of the organisms in two wetland locations: one near macrophyte zone and one in the open water pond zone near the wetlands outlet. The chambers were setup into five dosing groups: 1. Control: laboratory Campylobacter strain previously isolated and cultured from waterfowl feces; 2. F only: fresh waterfowl feces ; 3. Ff + Ss: fresh waterfowl feces and sterilized wetland bed sediment in 1:1 mixture; 4. Ff + Sf: fresh waterfowl feces and fresh wetland bed sediment in 1:1 mixture; 5. Blank control: sterilized waterfowl feces and sterilized bed sediment in 1:1 mixture. The chambers were inoculated and remained in Troups Creek wetland for up to 64 days, with destructive sampling of at least two replicates of each configuration done on Days 0, 3, 8, 15, 22, 34 and 64. The concentration of Campylobacter and E. coli within the chambers was determined using MPN approaches (details provided in presentation). The results show that E. coli and Campylobacter can survive, and hence remain a source of contamination, for up to eight weeks in urban stormwater wetlands. However, Campylobacter die-off was faster than that of E. coli, signifying that it is a conservative indicator in this particular system. Indeed, toughly three log reductions (T99.9) were obtained within 48 days for E. coli, while the same occurred in 35 days for Campylobacter. This could suggest that while direct deposition is an important source of fecal indicator organisms to wetland outlets, it may not be important for reference pathogens. Comparison of die-off rates between dosing groups with fresh sediment and sterilized sediment suggested that, when the fecal microbes settle in the bed sediments, prediction and competition might be important for the die-off of both organisms, albeit the overall rate of die-off remains low. There were not

Page 32 of 99

observable differences between the laboratory grown culture and the indigenous Campylobacter, nor were there differences between the locations in the wetland. Quantification of Multiple Waterborne Pathogens in Drinking Water, Drainage Channels, and Surface Water in Kampala, Uganda During Seasonal Variation Thanh H. Nguyen, University of Illinois Additional Authors: Nora Sadik; Sital Uprety; Noble Banadda Background: Longitudinal water quality monitoring is important for understanding seasonal variations in water quality, waterborne disease transmission, and future implications for climate change and public health. Objectives: In this study, microfluidic quantitative PCR (MFQPCR) was used to quantify genes from pathogens commonly associated with human intestinal infections in protected springs, a public tap, drainage channels, and surface water in Kampala, Uganda from November 2014 to May 2015. We assessed the differences in relative abundance of genes during the wet and dry seasons. Results: All water sources tested contained multiple pathogenic genes, with drainage channels and surface waters containing higher abundance of genes over protected springs and the public tap. Genes detected represented the presence of Enterohemorrhagic E. coli, Shigella spp., Salmonella spp., Vibrio cholerae, and Enterovirus. Drainage channels were found to be more contaminated during the wet season compared to the dry season, whereas surface water and drinking water sources contained little seasonal variation. Conclusions: These results suggest that individual water source types respond uniquely to seasonal variability, and that human interaction with contaminated drainage waters, rather than direct ingestion of contaminated water, may be a more important contributor to waterborne disease transmission. Furthermore, future work in monitoring seasonal variations in water quality should focus on understanding the baseline influences of any one particular water source given their unique complexities.

Verbal Presentations

Wednesday, May 17th 8:30 – 10AM Grumman Characterization of a Norovirus Outbreak Caused by Bottled Mineral Water Albert Bosch Navarro, Fundació Bosch Gimpera / University of Barcelona Additional Authors: Albert Bosch; Albert Blanco; Noemi Fuster; Cristina Fuentes; Virginia Rodríguez Garrido; Rosa Bartolomé; Thais Cornejo; Tomàs Pumarola; Rosa Pintó The present study is the first report ever on virus detection in bottled water. Between 11 and 25 April 2016, a total of 4,136 cases of gastrointestinal illness were reported to the official health authorities in the Barcelona and Tarragona provinces of Catalonia (Spain). Affected individuals showed acute gastrointestinal symptoms including nausea, vomiting, diarrhea and mild fever; six cases required hospitalization. The Catalonian Public Health Agency pointed towards an association of the outbreak with drinking bottled spring water from office water coolers, bottled at source in Andorra. The company producing the bottled water recalled as a precautionary measure more than 6,150 water containers corresponding to batches of suspected quality that had been distributed to 925 companies. The water complied with all requirements of the European Commission directive on the exploitation and marketing of natural mineral waters. High levels of norovirus genogroup I and II were detected in office water-coolers associated with the outbreak. A single sequence corresponding to genotype GII.4/Sydney/2012 was detected in the positive water samples. Besides GII.4/Sydney/2012 genotype, GII.2, GII.17 and GI.2 genotypes were also identified in stools from cases related with the outbreak. Saliva samples were collected from people, with and without symptoms of gastrointestinal illness, who consumed contaminated water and employed to determine norovirus susceptibility (secretor and non-secretor status). Among symptomatic individuals, 73% were secretors and 27% were non-secretors, while in asymptomatic individuals, 60% of were secretors and 40% non-secretors. Data on the risk derived by the presence of norovirus genome copies in the water coolers, having in mind the individual water ingesta, the secretor status, as well as the genotypes present in samples from each individual will be discussed.

Page 33 of 99

Do Electronic Faucets Cause Pseudomonas Aeruginosa Outbreaks in Hospital Environments? A Review. Emile Bedard, Polytechnique Montréal Additional Authors: Cindy Lalancette; Dominique Charron; Eric Déziel; Céline Laferrière; Michèle Prévost Case studies have demonstrated that electronic and thermostatic faucets are more susceptible to colonization by Pseudomonas aeruginosa than conventional taps, leading to documented outbreaks in hospitals. As the use of electronic and thermostatic faucets appears highly desirable for water conservancy and scalding prevention, it is important to establish the cause of this proliferation. A meta-analysis of published studies documenting P. aeruginosa outbreaks and occurrence in conventional and electronic faucets was performed and factors influencing increased colonization were highlighted. A multi-hospital field study sampling campaign of electronic and conventional faucets was then conducted to analyze predominant factors behind higher prevalence. The sampling campaign was conducted on electronic (n = 100) and conventional (n = 100) faucets in hospital settings. The first liter of water and swabs from the aerator and the drain were sampled. Presence of P. aeruginosa was evaluated by standard culture methods. The meta-analysis revealed a large variation in % positive for P. aeruginosa in both conventional and electronic faucets. This variation could be attributed to differences in: type of sample (swab vs water), volume sampled (50 - 500 ml), number of taps sampled, samples per tap and context (prospective study vs outbreak). Larger studies (n > 25) report lower percentage of contamination (0 - 18%) than smaller studies (58 - 100%). Unexpectedly, based on documented studies for both conventional and electronic faucets, it is not clear whether higher prevalence is necessarily associated with electronic faucets. Other factors such as sample size, configuration and material of upflow connecting pipes, water usage, and construction setting could also be determinant. Understanding specific factors leading to P. aeruginosa tap colonization is critical in order to reduce its prevalence and decrease risk of exposure through appropriate device selection and installation best practices. The World’s Largest Waterborne Campylobacteriosis Outbreak Brent Gilpin, ESR In early August 2016 the Havelock North water supply became contaminated with E. coli and campylobacter following a very heavy rainfall event. It is estimated that over 5000 people became ill with campylobacteriosis with three deaths recorded. The water supply for Havelock North at the time of the outbreak was an untreated groundwater supply. Campylobacter isolated from clinical cases, reticulated water, bore and a range of environmental and water samples were characterised using whole genome sequencing. At least four genotypes of campylobacter were found in the reticulated water supply and among cases. Indistinguishable genotypes of campylobacter were also found in sheep in nearby paddocks. A number of pathways of contamination were investigated including direct runoff from paddocks into the borehead and infiltration of the aquifer via a range of mechanisms. This outbreak is the focus of a Government inquiry which is sitting at the end of January 2017 where this papers authors will be key witnesses. We will in this presentation discuss the investigation results presented at this inquiry and the conclusions made by the inquiry panel. The Current Outbreak of Elizabethkingia: Water Treatment Options to Address the Public Health Concern Kyana Young, Marquette University Additional Author: Brooke Mayer Elizabethkingia bacteria is the causal agent of a serious ongoing outbreak in the U.S. Since late 2015, there have been 63 confirmed cases and 18 confirmed fatalities. This dramatically eclipses typical numbers of illnesses, and is likely the largest documented Elizabethkingia outbreak in U.S. history. This opportunistic human pathogen is particularly alarming because it tends to exhibit a high degree of antibiotic resistance and mortality. Previous outbreaks have been linked to hospital water sources, and although it is likely that the current outbreak affecting 12 counties and potentially 3 states stems from a single source, the source has yet to be identified. Several studies of outbreaks associated with bacterial colonization in hospital sinks and water tanks have indicated that Elizabethkingia may be resistant to chlorine disinfection, but there are no studies specifically designed to assess the susceptibility of waterborne Elizabethkingia to common disinfection processes. Given the emergence of this pathogen and the serious ongoing outbreak, it was imperative to develop a better understanding of how to effectively inactivate these bacteria in water. The aim of this research project was to evaluate the disinfection response of Elizabethkingia to common water disinfectants. Lab experiments were used to establish concentration (or UV intensity) x time relationships. The results indicate that the bacteria are exceptionally resistant to chlorination; for the free chlorine concentrations observed in conventional drinking water systems (0 - 4 mg/L), CT values of 0 - 24 mg-min/L achieved 0-log Elizabethkingia inactivation. Alternately, 7-logs of inactivation was achieved using an ultraviolet fluency of 3.84 mJ/cm2. The results are of immediate interest as there is an urgent need to develop knowledge that can be used to stem the ongoing outbreak and to avoid future outbreaks. This research will substantially contribute to advancing understanding of drinking water disinfection strategies to better protect human health; this has immediate implications for curtailing the ongoing outbreak caused by Elizabethkingia bacteria and for preventing future outbreaks.

Page 34 of 99

10:30 AM – 12 PM Grumman Managing Microbial Risks in Drinking Water Mark LeChevallier, American Water It is estimated that 1,415 species of microorganisms, representing 636 genera, are known to pose a risk to humans and are considered a significant public health risk. However, a review of the literature only found slightly more than 30 genera had been studies in water or biosolids, but in the last few years microbial genotyping is revealing much greater biodiversity. Traditional methods for managing microbial risks have instead focused on the multiple barrier concept, but emphasis on source water control, filtration, disinfection, and the integrity of the distribution system. Quantitative Microbial Risk Assessment (QMRA) is a framework that brings data in mathematical models to address environmental exposures and to characterize adverse outcomes. Traditionally, regulators have used QMRA models in the standard setting process, but data variability, large uncertainties, and unknown variables have typically resulted in standards that are more influenced by cost and practicality (feasibility) than explicitly by risk. However, water utility managers can effectively use QRMA models to evaluate risk management procedures, because here the focus is on cost effective options to reduce risk, rather than trying to quantitate the risk. This presentation will describe the development and application of three QMRA models; one for the risk of virus intrusion into distribution systems under conditions of low pressure; another assessing the viral, bacterial, and protozoan risk from main breaks; and the final QRMA model assessing the risk from Legionella in reclaimed water used for toilet flushing, spray irrigation, and cooling towers. In each case a baseline model is constructed using plausible scenarios and relevant data to assess a baseline risk. Once this risk has been determined, mitigation options can be assessed to determine the impact these procedures have on reducing the risk. The output of the models are not always intuitive, and parameters that were thought to be important sometimes show little impact on reducing risk, while other variables show considerable impacts on reducing risk. Sensitivity analyses can help point to where further research can reduce the uncertainty in the model predictions, and can also point to areas where additional data will yield only minor improvements. Decisions to improve risk management do not always have to result in increased regulation. The presentation will point to where the results of these QMRA studies have resulted in implementation of voluntary programs, like the Partnership for Safe Water program, or changes in industry standards (e.g., AWWA C651-14), or guidelines (e.g., reclaimed water). The presentation will conclude that QMRA models are valuable for the water manger and therefore practitioners should be familiar with the process, strengths, weaknesses, and applications so that data driven decisions can both improve operational performance and protect public health. Minimizing Chlorine in Drinking Water Distribution Systems: Impact on Bacterial Diversity in Drinking Water Biofilms Sophie Courtois, SUEZ Additional Authors: Claire Bertelli; Philippe Piriou; Jean-Francois Loret; Gilbert Greub Drinking water is one of the most closely monitored and strictly regulated resources. A constant disinfectant residual concentration is usually required for limiting regrowth of bacteria in the drinking water distribution systems. The discovery of disinfection byproducts, coupled with negative public perceptions regarding the taste of chlorine, has motivated several countries, including the Netherlands, Switzerland and Germany, to move toward potable water delivery systems without residual disinfectants. Delivering water with no or reduced chlorine residual can potentially decrease the level of protection against microbial contaminants, favor bacterial regrowth and result in changes in bacterial populations in distribution systems. Our main motivation was to take a close look at whether municipalities could avoid some of the potential negative effects of a disinfectant while still ensuring public health. It is now established that the composition of bacterial populations in distribution systems is strongly influenced by water quality, and especially by the nature and concentration of disinfectants (Mathieu et al. 2009, Hwang et al. 2012, Pinto et al. 2012, Vaz-Morira et al. 2013, Gomez-Alvarez et al. 2015). Recent studies however have demonstrated that the use of disinfectants or materials with bacteriostatic properties such as copper lead to a strong reduction in bacterial biodiversity, and result in a selection of the most resistant microorganisms, e.g. Legionella and mycobacteria, which are also generally the most pathogenic (Buse et al. 2014). The absence of proliferation of pathogens in unchlorinated distribution systems in The Netherlands seems to indicate that increasing bacterial biodiversity protects against proliferation of pathogens (Roeselers et al. 2015). This natural protection brought by the presence of banal bacteria is known as the "protective biofilm" concept. Moreover, it has also been demonstrated that microbial quality of European unchlorinated waters, as evaluated in terms of compliance for fecal indicators, was equal or superior to that of chlorinated waters (Hambsch et al. 2007). In this context, and in order to verify the consequences of chlorine reduction on biofilm microbial communities, the characterization of bacterial biodiversity has been achieved by an amplicon-based metagenomic approach in network areas submitted to normal chlorination, and network areas submitted to reduced chlorination, in two separate case studies. The results showed that the highest chlorine residuals applied during the biofilm formation period resulted in a dramatic reduction in bacterial diversity in the two case studies. Disinfection selected the most resistant bacteria, which in both cases were dominated by the Pseudomonas genus. In the absence of chlorine, a much larger biodiversity was observed, dominated by banal environmental bacteria. No development of pathogenic bacteria was observed in the absence of chlorine.

Page 35 of 99

Antibiotics and Antibiotic Susceptibility Patterns of Bacteria from Source and Drinking Water Carlos Bezuidenhout, North-West University Additional Authors: Guzene O'Reilly; Khosi Sigidu; Esper Ncube Trace levels of antibiotics as well as the presence of antibiotic resistant bacteria (ARB) in source and drinking water is an emerging health and water quality issue. The aim of this study was to determine the levels of antibiotics and the antibiotic susceptibility patterns of heterotrophic bacteria isolated from full scale drinking water production facilities and distribution systems. Heterotrophic plate count bacteria were isolated and purified on R2A media and the Kirby-Bauer method was used to determine antibiotic susceptibility patterns. Quantification of selected antibiotics, were carried out following the analytical methodology of a commercial water analysis laboratory, using hybrid triple quadrupole ion trap mass spectrometer. Antibiotics to which HPC isolates showed reduced susceptibility to included, beta-lactams (ampicillin and cephalonthin) as well as aminoglycosides (kanamycin and streptomycin), erythromycin and to a certain extent ciproflaxacin and chloramphenicol. These bacteria belonged to various Gram-positive and Gram negative species. The following antibiotics were detected in raw water chloramphenicol, erythromycin and trimethoprim. Also detected were trace levels of triclosan, 3,4 methylbenzylidene and N,N-Diethyl-meta-toluamide (DEET). In the drinking water and the distribution system trace levels chloramphenicol, trimethoprim and some pharmaceutical personal products, demonstrating that the systems did not effectively remove these organic substances during purification processes. What was interesting was the overlap between the antibiotic resistance patterns of HPC in raw and drinking water and the detection of trace levels of specific antibiotics suggesting that the antibiotics were responsible for resistance selection. In this presentation we will explore the impacts of these findings could have for drinking water production and the spread of antibiotic resistance in full-scale drinking water production facilities and the distribution systems. The Effect of Pipeline Flushing on the Microbial Community in Drinking Water Distribution Systems Louise Vanysacker, De Watergroep Additional Authors: Lut De Coster; Jos Boonen; Dylan White De Watergroep is a major water company of Flanders (northern part of Belgium), producing around 155 million m3 of high quality drinking water every year for 2.8 million inhabitants. With 57 ground water and 5 surface water extraction plants, 82 water towers, 73 reservoirs and more than 30000 km distribution network, a well described sampling campaign is needed to ensure the quality of the distributed water. For this purpose, approximately 34000 samples are taken on a yearly basis and controlled on more than 80 parameters. The past years, more attention was payed to the evaluation of the flushing operation in the distribution system. The initial purpose of this action is the increase in client complaints for brownish water. Brownish water can be formed in cast iron pipes as a result of corrosion, and the formed tubercles can host a microbiological community. The purpose of this study was to map the effect of flushing on the bacterial community. Two different monitoring campaigns were performed. First, 3 main delivery lines (300 mm in diameter) were flushed very intensively (110m³/h) during 8 hours. Every 15 minutes samples were taken and analyzed on the standard inorganic (metals, NO3, NPOC,...) and microbiological parameters conform the ISO standards. Additionally, more advanced microbiological techniques were applied such as flow cytometry and 16S rRNA sequencing (Illumina MiSeq) to determine the total amount of (living) cells and the microbial population dynamics, respectively. By making use of on-site measurements (turbidity and iron), the flushing was satisfactory after 8h. By making use of the microbial parameters, one can observe a peak amount of cells after 1h, a rapid decrease after 2h30, finally resulting in a plateau value until the end of the flushing. A log 2 reduction in total amount of cells was measured between the beginning (time 0) and the end (8h) of the flushing. More interesting, it was found that there was a significant microbial community shift during the first 2 hours. After the community remained stable till the end of the flushing. These results suggest that two hours of flushing was enough to remove the initial microbial community. Recently (beginning of January 2017), numerous small pipes (43 sampling sites, 80 mm in diameter) were flushed at a lower flowrate (25-30m³/h) for a short period of time (5-20 min). The beginning, middle and end of each sampling site was sampled and analyzed as described above. The MiSeq analyses are currently ongoing and these additional data will be discussed at the conference. In this follow-up study we aim to gain more insight on how the microbial community changes upon flushing of small pipes. This work increases our understanding of microbiological processes in drinking water distribution systems and helps to develop and improve cleaning strategies.

Page 36 of 99

2:30 – 3:30 PM Grumman Microbial Quality and Risk Assessment of Alternative Sources of Drinking Water Impacted by Waste Water: An Analysis of NC Type 2 Reclaimed Water for Potable Reuse Emily Bailey, UNC Chapel Hill Additional Author: Mark Sobsey Recent NC reclaimed water legislation has proposed a new potable reuse scheme allowing the use of source water consisting of a combination of tertiary treated, dual disinfected reclaimed water with a currently used drinking water source of surface water in a ratio of at least 80% surface water and up to 20% reclaimed water. The blend must be stored for a minimum of 5 days and then treated by conventional drinking water treatment processes. However, the tertiary treated, dual disinfected reclaimed water proposed by the state of North Carolina for potable reuse and designated as type 2 has not been evaluated for its microbial health risks from pathogens in a full-scale production scenario. Furthermore, surface waters representing de facto potable reuse as drinking water sources also have not been adequately evaluated for their microbial health risks from pathogens. The goal of this research was to collect real world microbial data on type 2 (NCT2) reclaimed water by conducting field studies on the performance of NCT2 like reclaimed water (RW) treatment facilities, and then evaluate the risk of exposure to this water in various potable reuse scenarios by conducting quantitative microbial risk assessments (QMRAs). Field samples were collected over a one-year period from 4 NCT2-like RW production facilities, as well as sewage impacted surface waters as candidates for the 80/20 blend. Water samples were examined for the fecal indicator microbes of the NC legislation for reclaimed water use, and for enteric pathogens of health concern. Microbial survival experiments were also conduced to evaluate the survival of fecal indicator microorganisms in the 80/20 mixture over the state mandated 5 day storage period, and under exposure to sunlight. Based on quantitative microbial risk assessment (QMRA) analysis, it is not clear that the microbial health risks associated with consumption of treated drinking water from surface source water alone or the blended source of NCT2RW plus surface water are reduced below the annual acceptable risk level of 1 x 10-4 infections per person per year set by US EPA. These results have implications for the practical use of this type of reclaimed water, which is currently only used for landscape irrigation. The pathogen concentrations and their predicted health risks indicate that neither NC type 2 like reclaimed water nor some ambient surface waters are acceptable for this proposed use. Microbial Risk Sensitivity Analysis of Direct Potable Reuse Treatment Trains Jeffrey Soller, Soller Environmental, LLC Additional Authors: Sorina Eftim; Sharon Nappier As global population growth, urbanization, and drought continue to impact natural resources, water reuse is an increasingly important water supply option. Water scarcity has also led to an increased willingness to use recycled wastewater as a potential drinking water source. Direct potable reuse (DPR) describes processes in which recycled water are introduced into a potable water supply distribution system or into the raw water supply immediately upstream of a conventional drinking water treatment facility, without inclusion of an environmental buffer. Previously, EPA evaluated microbial risks associated with various DPR treatment trains, and provided an adaptable methodology for other treatments and newer data. Results of that work also illustrated 1) clear quantitative human health-based advantages for DPR projects in which product water is introduced into the raw water supply upstream of a conventional drinking water treatment facility, compared to those in which product water is introduced directly into a potable water supply distribution system; 2) a single hazardous day can drive annual health risks; and 3) both norovirus and Cryptosporidium are important reference pathogens. Other recent work indicates that pathogenic viruses can be present in raw wastewater at higher levels than were used to derive the suggested state benchmark reductions for potable and non-potable uses of recycled water. Herein, EPA has considered how the results from emerging research can impact our understanding of human health risks associated with recycled water usage. The analyses explore the impact of recently published higher viral densities in raw wastewater and the use of new dose response data and models. EPA employed a probabilistic approach to evaluate multiple scenarios and interpret how the published ranges of microbial log reductions afforded by various unit treatment processes within a treatment train influence the percent of time public health thresholds may be exceeded. The results indicate that choices made with respect to the appropriate dose-response relationships have a strong influence on the estimated health risk results. Specifically, depending on the model used, the widely accepted recommendation for 12-logs reduction for viruses, may not be sufficient to consistently achieve the target health threshold (10^-4 illnesses per year), particularly if there are periods of high viral densities in wastewater. The results also illustrate that a probabilistic framework provides a much more nuanced understanding of public health protection compared to the more conventional, static log reduction credit paradigm and that real time monitoring approaches should be employed to ensure individual unit treatment processes provide microbial log reductions within their expected ranges. This work will be useful for a wide range of stakeholders who are interested in designing or approving DPR projects.

Page 37 of 99

Dogwood Antibiotic Resistant Clostridium Spp. Isolated from the Surface Water and Sediment Carlos Bezuidenhout, North-West University Additional Authors: Rohan Fourie; Charlotte Mienie The aim of this study is to investigate antibiotic resistance in Clostridium spp. isolated from selected surface water and aquatic sediment in the North-West Province, South Africa. Clostridium isolates obtained from the Schoonspruit and Crocodile Rivers using a modified fung-tube method. The 67 isolates were all resistant to ampicillin, tetracycline or clindamycin. The minimum inhibitory concentration (MIC) of 6 antibiotics were determined using the recommended agar dilution method. MIC values of ampicillin (AMP) ranged from 0.25-2 µg/ml, 0.5 to >256 µg/ml for tetracycline (TE), 0.25 to >256 µg/ml for clindamycin (DA), 0.5-16 µg/ml for amoxicillin (AMX), 0.5-32 µg/ml for chloramphenicol (C) and 0.5-64 µg/ml for metronidazole (MTZ). Using these MIC values, resistance profile could be generated for each antibiotic resistant Clostridium isolate. These results revealed that antibiotics such as amoxicillin and chloramphenicol were the most effective in inhibiting the growth of the Clostridium species. Majority of the isolates were resistant to ampicillin and tetracycline. Furthermore, ten different multi-antibiotic resistant (MAR) phenotypes were also observed across these isolates. The most prevalent one being AMP-TE-DA-MTZ-C-AMX. All the isolates that presented this phenotype were obtained from aquatic sediment, demonstrating that aquatic sediment may be a reservoir for MAR Clostridium species. Additionally, the presence of several antibiotic resistance genes was also screened for using PCR. One of the genes encoding for macrolide-lincosamide-streptogramin (MLS) (ermF), and β-lactam (blaTEM) resistance were not found to be present in any clindamycin and ampicillin resistant isolates, respectively. However, several clindamycin resistant Clostridium isolates were found to harbour the ermB gene, which also encodes for MLS resistance. Two genes encoding for efflux mechanisms against tetracycline (tetK and tetL) were found in the genomes of some of the tetracycline resistant isolates. Using Gram and endospore staining, as well as 16S rRNA gene sequencing, 4 antibiotic resistant Clostridium species were identified, which included Clostridium bifermentans (3%), C. perfringens (90%), C. sordellii (4%) and C. baratii (3%). Several of these Clostridium species are known pathogens and have been associated with severe gastrointestinal diseases, botulism and necrotising gas-gangrene in both humans and animals. To conclude, the data generated revealed the presence of potentially pathogenic Clostridium species in both surface water and sediment. The presence of antibiotic resistant genes in environmental Clostridium species are also a cause for concern. These findings warrant further research into the health implications of direct contact during recreational use, direct use in domestic scenarios, direct use in agricultural production as well as in drinking water production. Occurrence of Carbapenem-Resistant Escherichia Coli from Wastewater in the United States: A Retrospective Analysis of Isolates from 2005 Hodon Ryu, USEPA Additional Authors: Laura Wessels; Laura Boczek; Jill Hoelle; Mark Rodgers We have recently reported the occurrence of an emerging carbapenem-resistant Enterobacteriaceae (CRE) in wastewater in the United States (U.S.) in 2012-13. Carbapenem antibiotics are typically held in reserve for multidrug resistant (MDR) infections, but with the rise of these types of infections, their use is dramatically increasing in healthcare facilities in the U.S. As a result, it was hypothesized that CRE would be detected rarely in environmental samples prior to the widespread usage of carbapenem antibiotics used to treat MDR infections. In this study, we investigated archived E. coli isolates from studies completed before the carbapenem era. E. coli isolates from primary and secondary effluents collected from seven geographically dispersed wastewater treatment plants (WWTPs) in 2003-04 were recovered and then screened using one of four antibiotics. We now report on the testing of a subset of these isolates to determine whether they met the CDC 2012 CRE definition (intermediate or full resistance to one or more carbapenem antibiotics (imipenem) and resistant to at least two extended-spectrum cephalosporins (cefotaxime, ceftazidime)) or the updated CDC 2015 definition (resistant to a carbapenem antibiotic or producing a carbapenemase). Based on minimum inhibitory concentrations (MICs), isolates classified as nonsusceptible to imipenem or resistant to the two cephalosporin antibiotics or resistant to a fluoroquinolone (ciprofloxacin) were used for PCR assays targeting nine carbapenemase and extended-spectrum beta-lactamase (ESBL) genes. Of the 500 antibiotic-resistant E. coli isolates tested, six (1.2%) isolates were CRE, meeting the CDC 2012 CRE definition. According to the CDC's updated definition, eight (1.6%) isolates were CRE with full resistance to imipenem; only two of these eight isolates were also determined to be CRE by the old definition. While none of these isolates were positive using the modified Hodge's test, all 12 CRE isolates determined by both of the CDC definitions showed either ESBL production or having at least two ESBL genes. These results suggested that the production of ESBLs conferred resistance to carbapenem antibiotics, but we have no evidence of carbapenem specific hydrolyzing enzymes. In contrast, seven of 85 CRE E. coli isolates recovered in 2015 showed the production of carbapenemase as well as ESBL. Additionally, from the present study, 32 isolates, including the 12 CRE isolates, were selected based on the aforementioned MICs for further PCR assays. While 9% of 32 isolates were negative for all target genes, 78% and 16% were positive for more than 2 and 4 genes respectively, indicating multiple mechanisms of antibiotic resistance. This study demonstrates the occurrence of CRE E. coli in wastewater collected before the widespread use of carbapenem antibiotics in healthcare settings in the U.S. and provides additional information about their potential multiple mechanisms of antibiotic resistance.

Page 38 of 99

Aeromonas and Arcobacter Two Genera of Bacteria Abundant in Wastewater with Implications for Human and Animal Health. Maria J. Figueras, University Rovira & Virgili Additional Authors: Ana Fernández-Bravo; Alba Pérez-Cataluña; Xavier Fernandez-Cassi; Marta Rusiñol; Rosa Araujo; Rosina Girones; Silvia Bofill-Mas The genus Aeromonas belongs to the family Aeromonadaceae while Arcobacter belongs to the Campylobacteraceae and both genera embrace Gram-negative bacteria. The former is considered a genus autochthonous of the aquatic environment while the latter is considered more zoonotic and both groups include species considered emerging pathogens. In our laboratory we have been working in those genera for around 20 and 10 years respectively. We have been analyzing these bacteria in food products, shellfish, drinking water, natural waters, wastewater and reclaimed water used for irrigation. Wastewater showed to be a natural reservoir for both genera, with concentrations that are so high that they do not require any enrichment step for their isolation. These concentrations do not correlate with the excretion of the bacteria by the population, but with the capacity of these bacteria to grow in wastewater. Treated wastewater either by lagooning or by chlorine+UV, eliminate their presence below the detection limit of the culture methods, but these bacteria could still be detected by qPCR in some samples. Some Aeromonas spp. have shown the capacity of regrowth in the irrigation water and to contaminate vegetables. Although the concentrations of both bacteria in raw wastewater is relatively similar (ca. 4.3 x 106), metagenomic analysis reveal a high relative proportion of Arcobacter versus a low or no detection of Aeromonas. Further studies to understand this behavior are needed. The presence of both potential pathogenic bacteria in wastewater may represent a public health problem because they can contaminate drinking water and food products as it has already been documented in several outbreaks. Bellflower Diel Variation of Fecal Indicators and their Correlation with Enteric Viruses in Wastewater Kyle Curtis, Hampton Roads Sanitation District Additional Authors: Jack Denby; Raul Gonzalez In 2018 EPA will revise recreational water quality criteria, moving to the use of coliphage as a fecal indicator organism. This change impacts the industry as current wastewater treatment facilities are designed to remove bacteria, not bacteriophages, which could require modification of the current treatment process. Additionally, current literature does not provide a clear consensus as to which coliphage organism (male specific, somatic) best predicts the presence of enteric viruses. To address these gaps, diel variability of fecal indicators and enteric viruses within four wastewater treatment facilities was investigated. At each plant samples were collected in a temporally-intensive manner (n=6 per site per day) from four locations across the treatment process. Results indicate minimal diel variability in concentration of conventional fecal indicators (E. coli, Enterococci) and coliphage. Enteric viruses showed markedly greater intra-daily variability. Log reduction of conventional indicators also showed minimal variability (5-7 log removal) and was consistent with literature values, while reduction of coliphage was slightly more variable and not as pronounced (1-4 log removal). Enteric virus removal was overall minimal and more variable (0-4 log removal). Correlation analysis comparing conventional and coliphage indicators showed a range of associations (Spearman's ρ 0.26-0.76) between indicators and the presence of viruses. Overall the difference in strength of association between conventional and coliphage indicators to viruses was nominal. How Does Zooplankton Grazing Affect the Fate of E. Coli in Water? Jean-Baptiste Burnet, Polytechnique Montreal Additional Authors: Tarek Faraj; Henry-Michel Cauchie; Célia Joaquim-Justo; Pierre Servais; Michèle Prévost; Sarah Dorner Microbial water quality is usually assessed by monitoring by E. coli concentrations; this requires thorough understanding of its fate when released in natural water. Whereas the roles of UV exposure, temperature, nutrient scarcity and protozooplankton grazing on E. coli survival in natural habitats are well understood, much less is known about the impact of metazooplankton grazing, despite the fact that these biotas are known to shape and structure freshwater microbial communities through predation. A limited number of studies have addressed the predation of Daphnia or rotifers on fecal microorganisms but trials were done under laboratory conditions unlikely to occur in nature. In the present study, we describe the role of zooplankton grazing at individual and community level by performing microcosm experiments with synthetic and natural water matrices. First trials were performed to describe how the model grazer Daphnia affects the viability and culturability of E. coli in water using PMA qPCR and culture, respectively. Microcosm experiments were run during 48 hours using different E. coli/Daphnia ratios and different water matrices. The seasonal impact of natural zooplankton biota (proto- and metazooplankton communities) on the fate of E. coli using was investigated for a drinking water supply in Quebec, Canada, using an adapted version of the dilution method. Daphnia efficiently removed culturable E. coli from the water and did not induce viable but not culturable cells. During microcosm experiments, E. coli loss rates ranged between 0.7 d-1 and 1.7 d-1 and increased with Daphnia population densities, thereby illustrating the potential for the filter-feeder to remove E. coli from natural waters, especially during periods of high zooplankton abundance. At zooplankton community level, grazing rates

Page 39 of 99

on E. coli varied over the season and followed a similar trend as zooplankton community abundances. No significant grazing on E. coli was observed in October, most likely due to a reduced grazing pressure caused by low water temperatures. The present study sheds light on the way metazooplankton can affect the fate on E. coli and highlights the potential for Daphnia to significantly clear E. coli from natural waters, especially during periods of high zooplankton abundance in summer. These biotic interactions are ubiquitous to surface waters since (meta)zooplankton occurs virtually in every lake or reservoir contaminated by fecal pollution. As E. coli is the most widespread indicator of microbial water quality, such knowledge is paramount for better understanding of the fate of fecal pollution in natural water bodies. Effect of Holding Time on E.Coli in Wastewater Samples Mark Citriglia, Northeast Ohio Regional Sewer Additional Authors: Nichole Schafer The U.S. Environmental Protection Agency (USEPA) defined Escherichia coli (E. coli) as one of the best indicator r organisms to determine the water quality for a number of different water sources including drinking water, waste water effluents, and recreational water. The holding-time for analysis varies based on the type of water being analyzed. Non-potable waters have a holding time of 8-hours while finished potable water allows a holding time of 30-hours. The shorter holding time for non-potable waters can create problems for laboratories analyzing samples for compliance with a Combined Sewer Overflow (CSO) consent decree or additional CSO monitoring as part of an NPDES permit. The Northeast Ohio Regional Sewer District (District) is a large regional water reclamation facility and stormwater utility located in Northeast Ohio. In 2011 the District entered into a Consent Decree with the U.S. Department of Justice, USEPA, and Ohio Environmental Protection Agency to eliminate an estimated four billion gallons of CSO annually, and achieve 98% capture of CSO. The District is required to expand treatment, handle increased flow at all three facilities, along providing treatments to any bypass events. The consent decree and NPDES permit have included monitoring of discharges during these events. One of the major challenges the District had while determining the best way to comply with the CSO consent decree was when and how to sample whenever a wet weather event occurred. Since most wet weather events occurred outside the normal working hours the District decided to evaluate the use of extended holding for samples. Based on prior articles and white papers the District designed a study to determine the viability of longer holding-time of 24-hours or 48-hours instead of 8 hours for samples collected for bacterial analysis. The study included the collection of wastewater influent, primary effluent, final effluent, and final effluent subjected to chlorination and dechlorinating. Samples were collected and analyzed at 8, 12, 24 and 48 hours after collection and stored at <6.0°C. The samples were analyzed using the Collilert method and EPA method 1603. The data indicates that the holding time had significant reduction of bacterial count in case of raw influent and primary effluent. The samples collected at the treated effluent had a slight elevation in bacterial density however this was not determined to be significant. The samples collected from the raw influent and primary effluent had a significant decrease in bacterial density with the extended holding time. This presentation will outline the data from the holding time study, along with comparison of data between the Colilert and the EPA 1603 and how this data was used to make decisions on how best perform a two-year wet weather HRT design and implementation strategy. Mountain Laurel Comparing Engineered and Environmental Controls of Microbial Denitrification in Mature Bioretention Cells Brian Badgley, Virginia Tech Additional Authors: Lucas Waller; Gregory Evanylo; Leigh-Anne Krometis; Michael Strickland; Theresa Wynn-Thompson The use of bioretention cells (BRCs) is rapidly increasing for treatment of urban stormwater, but nitrogen removal by these systems is highly variable. BRCs are engineered to promote nitrogen removal by both vegetative uptake and microbial processes, but few studies have examined the abundance or function of denitrifying bacteria directly in bioretention systems. We sampled twenty-three mature field-scale BRCs with different design specifications throughout the mid-Atlantic to determine which factors primarily control the abundance and function of denitrifying bacteria. Denitrifiers were analyzed from BRC soil medium samples by quantifying two bacterial denitrification genes (nirK and nosZ) and measuring enzymatic denitrification potential. Overall, we found that design parameters, rather than local environmental variables, had the greatest effects on variation in denitrifier abundance and activity. Specifically, three factors stood out as the strongest predictors of changes in active populations of denitrifiers in BRCs. Firstly, denitrification was increased in BRC soils with higher amounts of available organic carbon and inorganic nitrogen. Secondly, denitrification was lower in BRCs that were planted with turf grass as opposed to herbaceous vegetation. And thirdly, denitrification typically decreased dramatically in the lower depths of BRCs, despite longer periods of saturation or the presence of permanently saturated zones that are designed to promote anaerobic conditions in the deeper layers. These findings suggest that initial BRC design can reliably affect bacterial denitrification for long time periods following construction and that there is still considerable potential for improving BRC designs to improve nitrogen removal from stormwater runoff.

Page 40 of 99

High Density Sampling of Pathogenic Microbial Community in a Fecally Impaired Watershed Jennifer Weidhaas, University of Utah Additional Author: Angela Anderson Intensive sampling along the Prickett creek watershed near Fairmont, WV revealed differing distributions of waterborne pathogens and microbial source tracking marker genes. The main stem of Prickett creek or its tributaries have been listed as 303(d) impaired steams due to the presence of fecal coliforms and elevated iron since 2004. A TMDL was approved for Prickett creek in 2014 by the EPA to limit fecal coliforms in various portions of the watershed. In June 2016, intensive sampling of eight locations along the watershed was conducted to determine water quality parameters and evaluate the microbial community using ultra filtration in combination with quantitative polymerase chain reaction (qPCR) and a high density microbial source tracking (MST) microarray. The high density microarray was used to test for 416 genes associated with waterborne pathogens (viral, bacterial and eukaryote pathogens), microbial source tracking genes (humans, animals, wildlife), and antibiotic resistance genes (genes). In total 127 genes were detected at eight sample locations along the watershed. Detection of pathogen and MST genes via qPCR was conducted for Polyomavirus, Staphylococcus aureus, Salmonella enterica, Enterococcus faecalis, Escherichia coli, Bacteroides HF-183 and Bacteroidales. In general, the smaller order streams in the upper reach of the watershed were correlated with one another, while the main stem of the stream in the lower watershed reach were more likely to be correlated. Further, the microbial community was correlated with land use patterns immediately up stream of the sampling locations. For example, in the water immediately downstream from a location where cattle had direct access to the stream, a ruminant associated Methanobrevibacter MST gene, various cattle associated Bacteroidales MST genes, and cattle mtDNA were detected. Pathogens of concern detected in the water included Campylobacter jejuni, Clostridium sp., E. coli virulence genes (CFT073, ETEC and O157:H7), Enterococcus faecalis, Salmonella enterica, Yersinia sp., Listeria monocytogenes, norovirus and adenovirus. Various other marker genes detected included F-specific bacteriophage genogroups I and II, various antibiotic resistance genes (tetracycline and beta-lactams resistance), and Bacteroidales associated with dogs, duck and geese and horses. From Lab to Lake - Evaluation of Current Molecular Methods for the Detection of Infectious Enteric Viruses in Complex Water Matrices Mats Leifels, Ruhr-University Bochum Additional Authors: Ibrahim Hamza; Michael Wilhelm; Martin Mackowiak; Lars Jurzik Quantitative PCR methods are commonly used to monitor enteric viruses in the aquatic environment because of their high sensitivity, short reaction times and relatively low operational cost. However, conclusions for public health drawn from results of such molecular techniques are limited due to their inability to determine viral infectivity. Ethidium monoazide (EMA) and propidium monoazide (PMA) are capable to penetrate the damaged or compromised capsid of the inactivated viruses and bind to the viral nucleic acids. We assessed whether dye treatment is a suitable approach to improve the ability of qPCR to distinguish between infectious and non-infectious human adenovirus, enterovirus and rotavirus A in surface water of an urban river in the Rhine-Ruhr Region, Germany, and sewage before and after UV disinfection. Like the gold standard of cell culture assays, pretreatment EMA-/PMA-qPCR succeeded in removing false positive results which would lead to an overestimation of the viral load if only qPCR of the environmental samples was considered. A dye pretreatment could therefore provide a rapid and relatively inexpensive tool to improve the efficacy of molecular quantification methods in regards to viral infectivity worldwide. 4:00 – 5:00 PM Grumman Reduction of Indigenous Virus in Coagulation-Sedimentation, Sand Filtration and Ozonation in Large Scale Water Treatment Plant Hiroyuki Katayama, Vietnam Japan University Additional Authors: Ryuichi Kato; Etsuko Utagawa; Hiroaki Furumai In order to manage the risk of infection by enteric viruses via tap water, their removal efficiency in water treatment processes should be quantitatively evaluated. However, the removal efficiency in actual plants has been limited (Asami et al., 2016) so far due to its technical difficulty. The objective of this study is to measure the removal efficiency of viruses in large scale plants under operation in Japan. PMMoV (Pepper Mild Mottle Virus), which was found to be the most prevalent RNA virus in environmental surface water, was targeted to evaluate the performance in water treatment plants in Japan, where turbidity after sand filtration should not exceed 0.1 degree due to regulation for Cryptosporidium leakage management. First, in the laboratory, to compare the behavior during the water treatment process between the enteric viruses and PMMoV, laboratory virus strains were inoculated into raw water and treated by coagulation, sedimentation and sand filtration, following the design guideline proposed by of Japan Water Works Association, and determined by RT-qPCR. Then, in two water treatment plants (plants A and B) in Japan once a month from Dec 2015 to Jan 2017, water samples of 10 - 614 [L] were taken at the intake

Page 41 of 99

point, after coagulation-sedimentation, after sand filtration, after ozonation and after biological activated carbon bed filtration, respectively. The samples were concentrated to approximately 0.8 [mL] following a previous study (Hata et al., 2015). Briefly, negatively charged MF (Opticap XL2 Millipore) membrane with acid rinse and alkaline elution method was used for the primary concentration, and centrifugal filtration with UF (Centricon plus-70 filter; Millipore) membrane was conducted for the secondary concentration. After concentration, viral RNA was extracted from the concentrates and determined by RT-qPCR. The behavior of PMMoV and norovirus GII was comparable, showing similar reduction by coagulation and sedimentation (R square = 0.72, n=4) and by rapid sand filtration (R square = 0.86, n=4). PMMoV was able to be detected in the most of the samples. The log reduction values observed were; 2.38±0.74 log (n=13, plant B), 2.63±0.76 log (n=10, plant A) by coagulation-sedimentation, 1.91±1.18 log (n=5, plant B) by ozonation. In this study, the removal efficiency of viruses by coagulation-sedimentation, rapid sand filtration and ozonation was measured in real plants by concentrating large volume of samples and targeting PMMoV. The removal efficiency of PMMoV was measured with an interval estimation for each process, which is beneficial for further management of infectious risk of drinking water. This study suggested that the evaluation of removal efficiency targeting PMMoV is useful to the risk management against viruses. Asami, T., Katayama, H., Torrey, J.R., Visvanathan, C., Furumai, H., 2016. Water Res. 101, 84-94. Hata, A., Matsumori, K., Kitajima, M., Katayama, H., 2015. Food Environ. Virol. 7, 7-13. The Influence of Common Nutrient Contamination on Bacteriophage MS2 Removal by Biosand Filter Chunhwa Jang, University of Illinois at Urbana-Champaign Additional Authors: Rabin Bhattarai; Thanh Nguyen Biosand filter (BSF) has been used as a point-of-use technology for water treatment throughout the developing world. Previous studies have focused mainly on physical and biological mechanisms for virus removal in BSF, but the influence of the common nutrient contamination on virus removal has not been comprehensively studied. The objective of this study was to determine the impact of nitrate and ammonia, two most common nutrient contaminants, on the removal of bacteriophage MS2 by BSF. Five bench-scale columns were constructed from PVC. Two BSFs were fed with high and low KNO3 concentrations (50 mg/L and 4mg/L), while the other two BSFs were fed with high and low NH4Cl concentrations (35 mg/L and 4mg/L). The fifth column was fed with 0.5mM of bicarbonate buffer at pH 8 and was used as the control. The nitrate and ammonia concentrations reflected the water quality seasonality in Nepal, where BSFs are commonly used. The BSF fed with 50 mg/L nitrate showed the highest MS2 removal of 5.15 log10 and an average of 4.87 log10 after 13 weeks until 19 weeks in operation. During the first 11 weeks, the column fed with 4 mg/L ammonia showed the highest MS2 removal with an average of 5.07 log10 before decreasing to an average of 3.16 log10 during weeks 13-19. The MS2 removal for the BSFs fed with 4 mg/L nitrate concentration and 35 mg/L ammonia concentrations did not vary during the study period and the average MS2 removal for these BSFs were observed to be of 3.34 log10 and 3.10 log10, respectively. About 50% of ammonia was removed by the BSF fed with 4 mg/L ammonia while the change in concentrations of NO3- and NH4+ in other BSFs was not significant. These results suggest that the concentrations of nutrients for the biofilm grown inside BSFs can have a significant impact on virus removal and BSF design may need to be optimized to improve the removal of both viruses and nutrients. Influence of Sediments on Microbial Water Quality During Base Flow Conditions in Freshwater Rivers in New Zealand Elaine Moriarty, ESR Additional Authors: Brent Gilpin; Juliet Anderson; Isabelle Pattis Indicator organisms such as Escherichia coli and enterococci are used to evaluate the fecal contamination of surface waters, and hence their risk to public health. Currently, water quality is assessed by the microbial analysis of samples collected directly from the water column, implying that the majority of microorganisms are free-floating. However, the impairment of water quality as a consequence of resuspension of riverbed sediment has long been proposed under flood conditions. We evaluated the water quality of 30 rivers in Canterbury, New Zealand, during base flow conditions prior and after artificially stirring the sediment. A range of bacterial and protozoan indicators and pathogens were examined as well as water quality data and the land use in the surrounding areas. Concentrations of E. coli in the water samples increased post stirring significantly, with 71% of water samples (n = 64) meeting the New Zealand Freshwater Recreational Water guidelines of less than 260 cfu E. coli/100 ml prior but only 39% of samples (n = 35) met the guidelines after stirring. Most of these samples (n = 25) had moved from meeting the guidelines (<260 cfu/100 ml) to action level (>550 cfu/100 ml) upon stirring, which is regarded as a public health risk and contact should be avoided. Similarly, enterococci concentrations increased in 67 samples after stirring, of which 51 samples presented with an increase (¡Ý2 cfu/ml). We propose that assessing water quality for recreational use should always take the sediment into account and subsequently assess sediment samples and water samples.

Page 42 of 99

Dogwood Survival of Virus Surrogates in Hospital Sewage and Human Fecal Waste Contaminated with Ebola Virus Surrogates and other Highly Infectious Viruses Sam Elmes, UNC Additional Authors: Joseph Strasser; Grace Allen; Noor Baloch; Juan Carlos Camacho; Sam Fait Elmes; Gregory D. Gadai; Nadia Mishal; Alexis Valenti; Lisa Casanova; Mark Sobsey, Emanuele Sozzi Background Feces and other body fluids from Ebola cases in healthcare facilities in the U.S. can be discharged directly to local sewage systems, according to CDC guidance. However, this may put sewer workers and their community at risk. Therefore, research is needed to determine the survival of Ebola virus and surrogates in human fecal wastes under different environmental conditions. Aim of the research The major goals of the project are to provide timely quantitative information on the survival of Ebola virus through a detailed study performed using several candidate surrogate viruses in fecal waste and, at a later stage, a mutant Ebola virus (ΔVP30). Material and methods A fecal sample was prepared by mixing 75% hospital sewage with 25% human fecal sample. Then four different viral surrogates (MS2, Φx174 and Φ6 bacteriophages, TGEV) were spiked at different concentrations. Survival experiments were conducted on both MS-2 and PhiX-174 coliphages non-enveloped viruses and Phi-6 bacteriophage enveloped virus plus TGEV mammalian virus at ambient room temperature (~23 °C) and at 37 °C. The kinetics and extent of inactivation of surrogate/indicator viruses was quantified every 24 to 48 hours until it was possible to accurately assess the kinetics of inactivation. Quantification of the viral infectivity was performed through different host cells culture techniques. Results Both MS-2 and PhiX-174 coliphages proved to be very resistant. MS-2 showed a 2.7 log reduction over an 18-day period in a conservative unpasteurized matrix and PhiX-174 displayed a 1.0 log reduction over the same period. Enveloped Phi-6 bacteriophage experienced greater but somewhat more variable inactivation in both matrices compared to the non-enveloped coliphages. Phi-6 experienced far lower inactivation in the conservative unpasteurized matrix, exhibiting only a 4.7 log reduction over 18-days. TGEV proved to be capable to survive only few days within a conservative unpasteurized matrix, showing greater inactivation compared to the non-enveloped coliphages. Complete inactivation was reached within two to four days Conclusions The results from this study are currently informing the design of effective on-site management systems and protocols in healthcare and other settings to reduce the risks of the spread of Ebola and other high risk viruses fecally shed by people sick with the diseases they cause. Results from experiments comparing two different fecal waste matrices suggests that a matrix including 25% human fecal sample and 75% hospital sewage better represents what would have to be disinfected during a real future epidemic. It is reasonable to say that a matrix exclusively made of more dilute hospital sewage would not be sufficiently representative to adequately reflect the real case scenario that begins with excreted feces. Obtaining quantitative data for a worse case fecal waste sample and scenario is preferred for estimating virus survival risks. Elucidating the Long-Term Impact of Disinfection Strategies on the Drinking Water Microbiome Zihan Dai, University of Glasgow Additional Authors: Maria Catalina Sevillano-Rivera; Szymon Calus; Quyen Melina Bautista-de los Santos; Umer Ijaz; Ameet Pinto Maintenance of a disinfectant residual (e.g. chlorine/chloramine) is one of the most common approaches for controlling microbial growth in drinking water distribution systems and is routine practice much of the developed world. In contrast some countries in western Europe, such as Netherland, Austria and Germany, provide consumers with drinking water free from disinfectants. Given that the residual disinfectant in drinking water is accompanied by the tradeoff of disinfection byproduct and the comparably low risk of waterborne diseases in systems without disinfectant residuals (e.g. Netherlands), it is critical that we assess the long-term impacts of the presence and absence of disinfectant residual on the drinking water microbial community. To compare these two different microbial control strategies, samples we are conducting a comparative genomics study of distribution systems in Netherlands, England, and Scotland. Our goal is to understand the genome-level impact of disinfection practises on microbial communities in drinking water systems. Specifically, we are interested in understanding (1) whether phylogenetically closely related organisms exhibit key differences in genomic content and metabolic potential between disinfected and non-disinfected systems, and (2) whether these differences may relate to competitive advantages in chemical stressed (i.e. disinfected system) or nutrient stressed (non-disinfected systems) environments. We have collected 55 samples from the aforementioned three countries for shotgun DNA sequencing along with a range of water quality analyses. The extracted DNA was sequenced on the Illumina HiSeq 2500 to obtain 250-bp paired-end reads and reads were assembled into contigs using iterative de Bruijn graph assembler. The contigs were subject to gene calling followed by annotation against the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. Our initial community analyses indicate that while oxidative stress response and dehalogenation genes are more abundant in disinfected systems, overall functional analyses (based on gene annotation) indicates that chloraminated and non-disinfected systems are markedly distinct from chlorinated systems while being highly similar to each other. This disparity at the functional level is not borne out at the taxonomic level, where community composition of the disinfected (including chlorinated and chloraminated) and non-disinfected samples were distinct from each other. We are currently analyzing additional data through an approach involving binning of assembled contigs in metagenome assembled genomes (MAGs) to enable comparisons of functional potential between closely related microbial clusters to understand the role of disinfectant and nutrient stress on selection between closely related microorganisms.

Page 43 of 99

The Mechanism-Specific Resistance of Echovirus 11 Towards Common Disinfectants Qingxia Zhong, École polytechnique fédérale de Lausanne (EPFL) Additional Authors: Anna Carratalà; Tamar Kohn Viral resistance to common disinfectants has been reported in both viruses evolved in the lab and isolated from the environment. Nevertheless, virus resistance remains poorly understood. In this study we investigated the mechanism underlying the resistance of echovirus 11 (E11) toward chlorine dioxide (ClO2), and explored the fate of resistant E11 populations upon exposure to other disinfectants. ClO2-resistant E11 populations were produced by experimental evolution and their genotypic characteristics were determined by sequencing. The role of the observed mutations was assessed based on those of previously reported enterovirus mutations. Flow cytometry was used to evaluate the ability of E11 to bind to its host cells. The fitness of the resistant virus populations was investigated by co-infection with wild-type E11 in several cell lines. Finally, ClO2-resistant E11 was exposed to other common inactivating treatments (free chlorine, UV254, sunlight and heat) to determine if resistance is specific to ClO2 or a general trait. ClO2 resistance was linked to an improved host binding capacity, which in turn was rationalized by two potential causes: First, several mutations led to the substitution of ClO2-labile by ClO2-stable amino acids, which rendered the structural proteins less prone to oxidation by ClO2, and hence reduced binding loss during exposure to ClO2. Second, the ClO2-resistant E11 developed an enhanced affinity to alternative cellular receptors, which also strengthened the virus' binding to their host cells. Growth studies in competition with the wild-type demonstrated that the fitness of ClO2-resistant E11 was not compromised in several tested cell lines. This implies that the disinfectant resistant viruses could outcompete their susceptible counterparts. Fortunately, however, ClO2-resistant E11 remained susceptible to inactivation by most other inactivating treatments tested. Cross-resistance was only observed for free chlorine, which - similarly to ClO2 - acts largely by oxidation of the viral proteins. In contrast, disinfectants targeting predominantly the viral genome remained effective against ClO2-resistant E11, indicating that ClO2-resistance is specific to a disinfectant's mechanism of action. This study contributes to a better understanding of disinfection-resistance in waterborne viruses. To control the proliferation of disinfectant-resistant viruses, our findings suggest a two-step disinfection process that includes two disinfection methods with different mechanisms. Bellflower Human Adenovirus as Water Virological Quality Indicator Marco Verani, Hygiene and Environmental Virology Laboratory- Department of Biology - University of Pisa Additional Authors: Ileana Federigi; Annalaura Carducci In Europe, the microbial water quality is evaluated mainly with the detection and quantification of indicators and pathogen bacteria: colony count at 22°C and 37°C, coliforms, E. coli, intestinal enterococci (IE), C. perfringens, S.aureus, P.aeruginosa and Salmonella spp. Nevertheless, these parameters for public health are still a topic of great controversy, because it’s well known their lack of a consistent correlation with viral pathogens. Only a viral indicator may be better suited to assess viral pollution, and for this purpose, special attention should be given to Human Adenovirus (HAdV). This virus is members of the genus Mastadenovirus in the Adenoviridae family, which comprises 52 serotypes classified into 7 species. The wide presence in environmental waters and its resistance to disinfection treatment justifies its utilizing as indicator. In the present work, the data obtained by one year monitoring of different water sources: wastewater treatment plant sewage (entry), wastewater treatment plant treated water (exit), seawater and river water were analyzed, in order to assess the HAdV occurrence compared to E. coli, IE and Somatic Coliphages (SC). Viral particles were detected and quantified (Log Genomic Copies GC) by biomolecular tests (PCR and quantitative PCR) on concentrated water samples obtained by two step tangential flow ultrafiltration starting from a volume of 1 L for wastewater entry and 10 L for wastewater exit, seawater and river water. The results revealed a mean of 76% positive HAdV samples: 100% in wastewater treatment system (entry and exit), 82% in river water and 42% in seawater. Geometric mean of viral concentration differed greatly among the water matrices: 10.2 ± 0.89 Log GC/L for wastewater treatment plant sewage, 8.6 ± 1.04 Log GC/L for wastewater treatment plant treated water, 3.9 ± 0.38 Log GC/L for seawater and 2.9 ± 1.43 Log GC/L for river water. The same samples were parallel analyzed by ISO methods for E. coli, IE and SC and obtained quantitative data were statistical not correlated with HAdV for wastewater and seawater while only in river water samples, multiple regression provided a significant correlation. The analyzed rivers received multiple discharges from non-point fecal pollution sources, thus these waters were not influenced by dilution events or water treatment. Moreover, in 42% of seawater samples and in 80% of river water samples, resulted ?excellent? according to classification of EU directive 2006/7/CE based on E. coli and IE detection, HAdV was detected. This data confirmed the higher viral environmental resistance comparing to bacterial one and the possible role of HAdV as water virological quality indicator.

Page 44 of 99

Photosensitiser Functionalized Chitosan-Polyethylene Oxide Nanofiber for Efficient Sunlight Driven Disinfection of Enteric Viruses in Water Hussaini Majiya, University of Leeds, UK Additional Authors: Paul Millner; Nicola Stonehouse Numerous outbreaks of gastroenteritis caused by enteric viruses have been associated to the inability of disinfection methods to efficiently inactivate these viruses in treated water. This has called for development of more robust methods of water disinfection. Our previous work has shown that photosensitiser-TMPyP causes a rapid and high rate of photodynamic inactivation of MS2 phage and Bovine enterovirus in solution. Attaching TMPyP onto a solid support with high surface area to volume ratio such as chitosan-polyethylene oxide nanofiber will make it possible for use in water disinfection during wastewater treatment. TMPyP functionalized chitosan-polyethylene oxide nanofiber could be re-utilized, thereby reducing the cost and makes it an environmental-friendly technology for water disinfection. In our work, nanofibers were modified using pyromellitic dianhydride in order to have cation-exchanger properties and for adsorption of highly basic TMPyP. The TMPyP functionalized nanofiber (1 centimeter square, 0.3 millimeter thickness) showed efficient photodynamic inactivation of MS2 phage. Complete inactivation (>99.99% of inactivation, 9.6 log10 PFU per ml reduction, 1 ml) of MS2 phage were observed with this device after 6 min illumination with the light at 105 Watt per meter square. This light intensity is just about 3% of bright day time sunlight. Therefore, sunlight could be the source light for this device. Each TMPyP functionalized nanofiber was used at least three times for the photodynamic inactivation of MS2 phage without any detectable loss of their inactivation capacity. This research will lead way to simple sunlight driven water disinfection devices that could be used in both developed and developing countries as a zero man-made energy input system to produce safe drinking water. Genotyping Norovirus Genogroup II Isolated from Oysters during Epidemic Season in Japan Jian Pu, Yamagata University Additional Authors: Shinobu Kazama; Takayuki Miura; Nabil Dhyan Azraini; Erika Ito; Yoshimitsu Konta; Tatsuo Omura; Toru Watanabe A significant number of norovirus outbreaks have occurred worldwide since the mid-1990s, with the genogroup II genotype 4 (GII.4) as the major cause. The novel GII variant, GII.17 Kawasaki 2014, emerged in the 2014/2015 norovirus season and replaced the previously prevalent GII.4 Sydney 2012 variant. Oyster can accumulate norovirus when grown in contaminated marine environment and are considered one of the most important pathways of norovirus transmission. For better understanding of the norovirus genotypes circulating in the human population and those released in the environment in the 2014−2015 norovirus season, we investigated temporal variation of norovirus GII genotypes in oysters by using pyrosequencing techniques in this study. The concentration of norovirus GII genomes ranged from 101.0 to 104.3 copies/g digestive tissue for oyster samples taken weekly from November 2014 to March 2015, measured by RT-qPCR assays. Pyrosequencing analysis showed a diversity of genotypes in oysters (GII.3, GII.4, GII.6, GII.13, and GII.17). The variety of norovirus genotypes in oysters was slightly different from those found in sewage (GII.2, GII.3, GII.4, GII.6, GII.13, GII.14, and GII.17) and gastroenteritis cases (GII.4 and GII.17) in the same research region. The GII.17 strains isolated from oysters, infected patients and sewage samples clustered in the same sub-cluster Kawasaki308 2015. This is the first report that identified the novel GII.17 Kawasaki 2014 variant from oyster samples. The simultaneous existence and dominance of the GII.17 strains in oysters, sewage, and the gastroenteritis cases suggested that the emergent GII.17 Kawasaki 2014 has been circulating in the human population, oysters, and those released in the environment around the studied region during 2014-2015 winter season. The novel strain of GII.17 associated with increased severity of the clinical symptoms and displayed a high epidemic activity in 2015-2016 winter season, with 300 patients reported in over 20 cities in Japan. Norovirus accumulation into oysters may be dependent on viral genogroup, genotype or strain. As a crucial pathway of norovirus transmission, a better understanding of its accumulation based on continuous monitoring of viruses in oysters will help identify species of oysters less sensitive to virulent noroviruses such GII.17 Kawasaki 2014 variant, thus providing strategies to prevent the oyster contamination. Mountain Laurel Quantifying Viral Pathogens and Molecular Source Markers for Quantitative Microbial Risk Assessment: Hurdles and Insights Denene Blackwood, UNC Chapel Hill Additional Authors: Emelie Andersson; Dustin Bamabic; Theodore VonBitner; Darcy Ebentier; Rachel Noble In California, beaches and their respective creeks and lagoons are a significant natural resource as they provide areas for recreation and tourism. Tecolote Creek in San Diego (CA) is a 6,000-acre coastal watershed, encompassing a large natural park and nature center. In the past decade, it has been the subject of multiple source tracking studies, which have implicated mostly non-human sources. Tecolote Creek discharges directly to Mission Bay, a waterbody used by millions for recreation. Tecolote Creek was considered a candidate for Quantitative Microbial Risk Assessment (QMRA), because of the previous indications that non-human sources were dominant contributors to water impairment. During the first sampling period, the molecular samples as analyzed by qPCR were plagued by inhibitory substances which

Page 45 of 99

underestimated the true extent of human specific contamination. Samples collected during the first sampling period (2014-2015), included both dry and wet weather samples. These samples were analyzed for a variety of water quality parameters as well as FIB, and human specific Bacteroides (HF183, BacHum, HumM2) and human viral pathogens (rotavirus, norovirus, enterovirus, and adenovirus). It was determined that human sources were present as evidenced by both the presence of human-specific molecular markers, viral pathogens, and visible human sources observed during watershed surveys. This QMRA study was unique in that it allowed the field and laboratory methods to evolve over the course of the study allowing for an adaptive design. Therefore, for the next sampling period (2015-2016), it was decided that more proactive approach be taken for more stringent sample purification approaches as well as implementation of digital droplet PCR (ddPCR). ddPCR provides several advantages over qPCR in that it provides an absolute estimate of concentration, is highly sensitive, and is not as prone to inhibition as qPCR, although it is costlier to perform. ddPCR reduced the overall number of inhibition based non detects that were seen using qPCR. Overall, very strong correlative values were observed between turbidity and FIB (r>0.8). Bacteroides markers were all strongly associated with each other (r>0.6) and BacHum showed a strong correlation with both FIB (r>0.9), and enterovirus (r=0.92). An examination of the hurdles and lessons learned from the implementation and utility of quantitative molecular methods for QMRA development will be presented. Quantitative Microbial Risk Assessment for Bathers in a Popular Bathing Area in Northern Italy Annalaura Carducci, Hygiene and Environmental Virology Laboratory Additional Authors: Ileana Federigi; Gabriele Donzelli; Lorenzo Cioni; Marco Verani In this study, we used QMRA based on enterococci counts in order to evaluate the Gastrointestinal Illnesses (GI) risk resulting from recreational activities at a very popular seaside resort in Italy. Three bathing areas were selected, since they are impacted by riverine discharges, that receive polluted waters from point and non-point sources, and have been sometimes closed, owing to enterococci and E.coli levels over the European regulation. The swimmer GI risk from enterococci was estimated applying exponential dose-response model, and the simulation for QMRA model were performed using Vensim software. The ingested enterococci dose was calculated combining ingestion rate, exposure time and enterococci concentrations. In particular, exposure time was fitted to a Weibull distribution and the ingestion rate was drawn from a triangular distribution. Enterococci concentrations were fitted to a lognormal distribution for each monitoring area, basing on 10-years microbial data collected from seawaters at the river mouths. The risk estimation was obtained through the use of a Monte Carlo simulation, with each run consisting of 10 000 trials. The results were compared to acceptable marine recreational illness levels of 10 and 50 GI illnesses per 1 000 exposures (0.01 and 0.05). The results showed a difference in GI risk among the three bathing areas, with a probability of exceeding the illness acceptable levels of 0.6% and 0.01 % (respectively) for No1 area, 0.63% and 0% for No2 area and 1.34% and 0.07% for No3 area. Based on monitoring data collected according to European Bathing Directive, the percentage of values over the limits for beach closures were 3.5% for No1 area, 2.7% for No2 area and 4.9% for No3 area. These results should be further evaluated to better understand why the punctual monitoring based on current legislation seems to overestimate the risk of GI compared to QMRA model outcomes. Systematic Literature Reviews and Development of Distribution Curves for Viral Densities in Ambient Water Sofrina Eftim, ICF Additional Authors: Tao Hong; Audrey Ichida; Jeffrey Soller; Alexandria Boehm; Sharon Nappier The United States Environmental Protection Agency (EPA) is developing Recreational Water Quality Criteria for coliphage, a viral indicator, to ensure public health protection from water sources that have been influenced by fecal contamination. EPA is considering use of a quantitative microbial risk based approach to support the criterion development. To support this effort, EPA previously developed a systematic review methodology to evaluate densities of key viral pathogens and coliphages in wastewater influent (raw sewage). In this current study, EPA conducted a systematic literature review of published peer-reviewed publications to identify norovirus and coliphage density data in ambient waters. Pathogen-specific study inclusion criteria including scope, study quality, and data availability were applied to each publication. After primary screening of titles and abstracts, EPA reviewed over 100 publications for norovirus and coliphages to evaluate for study scope. EPA applied the previously developed bootstrap methodology to estimate the distribution of the aforementioned viruses in ambient waters. This approach provides valuable insight into plausible exposure levels in ambient water as they apply to recreational exposures. This information is also a valuable source of information for direct potable reuse and de facto reuse risk assessments.

Page 46 of 99

Verbal Presentations

Thursday, May 18th 8:30 – 10 AM Grumman Model Enveloped Virus Inactivation by Free Chlorine Yinyin Ye, University of Michigan Additional Author: Krista Wigginton Introduction High-profile outbreaks of viral diseases caused by human enveloped viruses (e.g. SARS and MERS coronavirus, influenza virus, Ebolavirus, Zika virus) severely threaten the public health and result huge economic loss. Multiple transmission routes of those emerging enveloped viruses bring challenges to control the spreading of the viral diseases. Although water transmission is not often considered for enveloped viruses, some enveloped viruses are shed from patients or infected animals and survive for long periods of time in aqueous environment. Free chlorine and other oxidants are widely applied to inactivate infective viruses, however the inactivation mechanisms responsible for enveloped virus inactivation in aqueous environments are not well understood. Objectives The objectives of the study are to (1) quantify the reaction kinetics of viral proteins and genome with chlorine, (2) identify the reactions that are responsible for enveloped virus inactivation with chlorine, and (3) compare the reaction mechanisms of enveloped viruses to nonenveloped viruses. Methods We will study the inactivation mechanisms of a model enveloped virus (i.e. Pseudomonas phage Φ6) with free chlorine in phosphate buffer (pH = 7.4). Plaque assays on Pseudomonas syringae will be used to measure the infectivity of Φ6. High resolution liquid chromatography-mass spectrometry (LC-MS) is employed to assess modifications on Φ6 proteins. To make the protein mass spectrometry method quantitative, 15N-labeled Φ6 peptides will be added to regular Φ6 peptides as an internal control and the ratio of 14N- to 15N- peptide peaks will be linked to relative peptide concentration. MS data will be analyzed in MASCOT Distiller software and MASCOT server. To study genome degradation, quantitative reverse transcriptase polymerase chain reaction (RT-qPCR) is applied to target regions in the three segments of Φ6 genome (i.e., S, M, and L segments). The length of amplicons from each genome segment are around 500 bp, which consists of 16.9%, 11.6% and 7.6% of S, M and L segment, respectively. Results Our preliminary results demonstrate that Φ6 can survive long periods of time in aqueous samples, but are less persistent than nonenveloped virus surrogates. When treated with chlorine, membrane proteins were more susceptible to chlorine reactions than the capsid proteins. Mass spectrometry products identified methionine oxidation as the main reaction occurring in the proteins following 1-log10 virus inactivation. In this presentation, our results will include Φ6 genome degradation data. Ultimately, we will provide comparisons of the protein and genome reaction kinetics between the enveloped virus surrogate Φ6 and the nonenveloped virus surrogate MS2. qPCR Based Monitoring of Virus UV Inactivation Johannes Ho, TZW: DVGW-Technologiezentrum Wasser Additional Authors: Jutta Eggers; Andreas Tiehm Introduction Water treatment with low pressure UV is a common disinfection method in waterworks, water treatment plants, swimming pools and for wastewater reuse. The treatment success with respect to reduction of infectious viruses is determined with cultural methods. These methods can take up to several days until a result is available. Consequently, a prompt control of disinfection is not possible. qPCR reactions allow the faster detection of waterborne viruses. Anyhow, the conventional PCR method lacks of the essential discrimination of infectious and non-infectious viruses. Objectives The objective of this study was to develop a qPCR method capable of discriminating infectious and non-infectious viruses after low-pressure UV treatment. Methods The bacteriophage phiX174 was used as surrogate for human pathogenic viruses. Low pressure UV radiation was applied to spiked drinking water. Samples were analyzed with qPCR using different amplicon lengths and PMA pre-treatment. Results were compared with the cultural method (plaque assay). Results with increasing low-pressure UV dose the numbers of infectious phiX174 were reduced. A 4 log removal occurred with 125 J/m², as analyzed by plaque assay detection. Conventional short-amplicon qPCR only showed a 0.8 log removal with 1000 J/m². PMA was unable to discriminate treated and untreated viruses, as low-pressure UV strictly damages the nucleic acid and not the viral capsid. With the use of longer amplicons, the log-removal was increased. Similar results of plaque assay and qPCR could be achieved by amplifying the whole genome of phiX174 (over 5.000 base pairs). The log-reduction revealed a first order correlation to both the amplicon size and the applied UV doses. Both dependencies were combined in an equation correlating the applied UV dose and the amplicon size with the observed log-reduction using constant kuv. Using the correlation, the results of the plaque assay and therefore the reduction of infective viruses can be calculated using a qPCR result. Conclusions The presented method can discriminate between infectious and non-infectious phiX174 phages after low-pressure UV disinfection. Therefore, qPCR could be applied to monitor low-pressure UV treatment. Data from literature showed that the equation can also be adapted to MS2 viruses. Acknowledgement

Page 47 of 99

Financial support by the German Ministry of Education and Research is gratefully acknowledged (EDIT project, INIS research priority, BMBF grant no. 033W010B; and TrinkWave project, Wave research priority, BMBF grant no. 02WAV1404G, www.trinkwave.wasser.tum.de). We also thank for fruitful discussions within the AQUAVALENS consortium (Grant agreement no: 311846). Reference Ho, J., Seidel, M., Niessner, R., Eggers, J., Tiehm, A., 2016. Long amplicon (LA)-qPCR for the discrimination of infectious and noninfectious phix174 bacteriophages after UV inactivation. Water Res. 103, 141-148. doi:10.1016/j.watres.2016.07.032 Characterization of the Efficiency and Uncertainty of Skimmed Milk Flocculation for the Simultaneous Concentration and Quantification of Water-Borne Viruses, Bacteria and Protozoa Eloy Gonzales-Gustavson, University of Barcelona Additional Authors: Rosina Girones; Yexenia Cardenas; Miquel Calvo; Marcelle Figueira; Ayalkibet Hundesa; Inmaculada Amorós; Yolanda Moreno; Laura Moreno-Mesonero; Rosa Rosell; Lliliane Ganges; Rosa Araujo In this study, the use of skimmed milk flocculation (SMF) to simultaneously concentrate viruses, bacteria and protozoa was evaluated. We selected strains of fecal indicator bacteria and pathogens, such as Escherichia coli and Helicobacter pylori. The viruses selected were adenovirus (HAdV 35), rotavirus (RoV SA-11), the bacteriophage MS2 and bovine viral diarrhea virus (BVDV). The protozoa tested were Acanthamoeba, Giardia and Cryptosporidium. The mean recoveries with q(RT)PCR were 66% (HAdV 35), 24% (MS2), 28% (RoV SA-11), 15% (BVDV), 60% (E. coli), 30% (H. pylori) and 21% (Acanthamoeba castellanii). When testing the infectivity, the mean recoveries were 59% (HAdV 35), 12% (MS2), 26% (RoV SA-11) and 0.7% (BVDV). The protozoa Giardia lamblia and Cryptosporidium parvum were studied by immunofluorescence with recoveries of 18% and 13%, respectively. Although q(RT)PCR consistently showed higher quantification values (as expected), q(RT)PCR and the infectivity assays showed similar recoveries for HAdV 35 and RoV SA-11. Additionally, we investigated modelling the variability and uncertainty of the recovery with this method to extrapolate the quantification obtained by q(RT)PCR and estimate the real concentration. The 95% prediction intervals of the real concentration of the microorganisms inoculated were calculated using a general non-parametric bootstrap procedure adapted in our context to estimate the technical error of the measurements. SMF shows recoveries with a low variability that permits the use of a mathematical approximation to predict the concentration of the pathogen and indicator with acceptable low intervals. The values of uncertainty may be used for a quantitative microbial risk analysis or diagnostic purposes. The Mechanism Underlying the Solar Irradiation Disinfection of Rotaviruses and MS2 Elbashir Araud, University of Illinois Additional Authors: Jeremy Guest; Joanna Shisler; Thanh Nguyen Although sunlight disinfection is a promising approach to inactive pathogenic viruses in wastewater stabilization ponds for subsequent reuse, the susceptibility of different virus strains, across different species or within the same species, is less understood. This work aimed to study the mechanism underlying the direct inactivation (endogenous) and inactivation by oxygen reactive radicals (ROS) (exogenous) of rotaviruses (RVs) and MS2 phage under visible-UVA light disinfection in wastewater. Five RV strains belong to five different serotypes (serotype G1, human strain Wa, serotype G2, human strain S2; serotype G3, human strain YO; serotype G4, human strain ST3; and G5, porcine strain OSU) and MS2 were irradiated in wastewater, organic-free water or organic-free water contained sodium nitrite (as a source of OH radicles). Rotavirus strains had various susceptibility to the sunlight disinfection. For instance, the human RVs strains S2 and ST3, that belong to serotypes G2, and G4, respectively, were more susceptible to endogenous disinfection compare to G1and G5 serotype strains, Wa strain and OSU, the porcine strain. The difference in RV resistance to solar disinfection may be related to differences in VP4 gene (the spike protein gene of RVs). The sequence alignment of VP4 gene showed a high content of aromatic amino acids of the light sensitive RV strain, ST3, compare to the more stable strains, Wa and OSU. Transmission electronic microscopy imaging did not show any clear changes in the morphology of the capside of solar treated or untreated viruses. However, all RV strains lost their ability to bind to the porcine gastric mucin-conjugated magnetic beads (PGM-MBs), which contains 0.5 to 1.5% sialic acid, the main RV receptor, after the solar disinfection. RVs binding ability to sialic acid was determined by real-time reverse transcriptase PCR (RT-qPCR), suggests that the solar disinfection interrupt the virus ability to bind to the host cell.

Page 48 of 99

10:30 AM – 12PM Grumman Performance Target of Virus Reduction Efficiency in Wastewater Reclamation: Effect of Tolerable Health Risk, Dose-Response, and Reliability Daisuke Sano, Hokkaido University Introduction Multiple-barrier is a universal practice for managing microbiological risks in wastewater reclamation and reuse, in which treatment unit processes are combined to achieve a performance target value of pathogen reduction. The target value of virus log10 reduction (LR) in wastewater needs to be determined based on region-specific factors, including virus types of concern, initial virus concentration in untreated wastewater and water reuse scenario. In this study, we calculated virus LR target values under two exposure scenarios of water reuse for agricultural irrigation using quantitative data of norovirus genogroup II (NoV GII) in untreated wastewater, and compared the effect of tolerable health risk, dose-response model, and performance reliability on the calculated LR values. Methods and Results The tolerable concentration of NoV GII in reclaimed wastewater was estimated based on tolerable annual disease burden (10-4 or 10-6 disability-adjusted life years per person per year (DALYpppy)). The virus LR target value was obtained as a difference between the influent virus concentration and the tolerable virus concentration in reclaimed wastewater. When the exposure of reclaimed wastewater to farmers was assumed, the LR target values of 3.2, 4.4, and 5.7 log10 at 95, 99, and 99.9% performance reliability to meet the annual disease burden of 10-6 DALYpppy were obtained, respectively. Meanwhile, 2.2, 3.4, and 4.7 log10 at 95, 99, and 99.9% reliability, respectively, were obtained when the consumption of raw vegetable irrigated by reclaimed wastewater was assumed. The calculated LR values were not substantially affected by dose-response when hypergeometric model and fractional Poisson model were compared. When the tolerable disease burden of 10-4 DALYpppy was employed, approximately 1 log10 smaller LR values were obtained. These results indicate that the reliability level is more influential to LR values than dose-response model and tolerable disease burden. The calculated LR value is also affected by the mean and standard deviation of virus concentration distribution in untreated wastewater, which forces wastewater reclamation operators to monitor the quantity of a target virus in untreated wastewater during the operation of wastewater reclamation system. Conclusion The virus reduction target values of 5.7 log10 and 4.7 log10 were obtained at 99.9% performance reliability to meet the annual disease burden of 10-6 DALYpppy, when two exposure scenarios (farmers directly exposed to reclaimed wastewater and consumers of raw vegetable irrigated by reclaimed wastewater) were assumed, respectively. The calculated target values were more sensitive to the reliability value than dose-response model employed and the level of tolerable annual disease burden. It is required to monitor virus density in untreated wastewater during the operation of wastewater reclamation system to ensure that the calculated target value of virus reduction is valid. Viraqua - New Approaches for the Surveillance of Enteric Viruses in the Environment Kata Farkas, Bangor University Additional Authors: James McDonald; Dafydd Peters; Lisa Cross; Shelagh Malham; Davey Jones Enteric viruses are frequently detected in environmental waters due to wastewater discharge and hence are often associated with waterborne and foodborne outbreaks worldwide. Although the risk of waterborne illness is well known, the direct detection of enteric viruses in wastewater, surface or groundwater is not mandatory. This is partly due to the lack of available methods to efficiently investigate the number and infective state of viral particles. The aim of this project is to develop and validate methods for the direct investigation of enteric viruses in surface water, wastewater and sediment samples that may be suitable for standardization. The investigation focuses on noroviruses (NoV), sapovirus (SaV) and hepatitis A/E viruses (HAV and HEV). The usefulness of DNA viruses (human adenoviruses and polyomaviruses) as tracers for wastewater-derived viral contamination is also investigated. These validated methods are also applied for the investigation of seasonal and temporal changes in viral titers in the Conwy River and estuary (North Wales, UK). In this project a tangential flow ultrafiltration (TFUF) method coupled with beef extract elution and polyethylene glycol 6000 (PEG) precipitation was validated for the detection of viruses in surface water (river, estuarine and seawater) and wastewater. For the detection of viruses in sediment, beef extract elution followed by PEG precipitation technique was validated. The concentrate was then subject of viral nucleic acid extraction and quantitative PCR (qPCR) and multiplex quantitative reverse transcription PCR (qRT-PCR). Spiking experiments using NoV and a common extraction control, mengovirus, showed viral recovery of 80-100% in surface water samples and 20-100% in sediment samples. Using these methods, surface water, wastewater and sediment samples taken monthly over one year at the Conwy River and estuary have been processed and analyzed. Results suggest seasonal changes in NoV concentrations, with a peak during winter, that was not noted in DNA virus concentrations. SaV and HEV were not found in any of the samples. However, HAV RNA was occasionally detected in untreated and secondary treated wastewater samples. Our results suggest that the methods developed for the concentration of water and sediment samples are suitable for the rapid and efficient assessment of enteric viruses in the environment. The concentration methods do not affect viral integrity, hence the acquired samples may be subject of integrity and infectivity assays as well as metagenomic analysis. Furthermore, the concentration methods are suitable for the co-concentration of various pathogens, e.g. bacteria and protozoa, allowing a thorough assessment of public health risks associated with wastewater

Page 49 of 99

contamination. The data present here can be applied to inform predictive models for the transport of enteric viruses in water and to improve current viral risk assessment. Environmental Surveillance of Viruses in Kenya Using Metagenomics Tiong Gim Aw, Tulane University Additional Authors: Nicholas Kiulia; Joan Rose Waterborne and water-related infectious diseases are a major cause of morbidity and mortality in developing countries due to the lack of proper sanitation. Pathogenic viruses can be of great concern because they are more environmentally stable as compared to bacteria, display resistance to various conventional methods used for controlling bacterial pathogens and cause high probability of infection at low doses. The actual burden of waterborne infections caused by pathogenic viruses is likely underestimated because they are not routinely monitored for both in clinical and environmental samples. There is currently no established method to fully describe the broad diversity of human viral pathogens in environmental samples despite the increasing importance of environmental viral infections in global public health. The advent of high throughput sequencing technologies coupled with metagenomics offers an opportunity to identify human viral pathogens in various environmental samples without a priori knowledge of what viruses may be present. This study aimed to examine the occurrence of diverse pathogenic viruses in wastewater lagoons in Kenya using metagenomics. A total of 10 untreated wastewater grab samples were collected from four lagoons in Kenya. These lagoons receive wastewater from residential areas, hospital and biomedical research center. Treated wastewater is discharged to rivers where various recreational and agricultural activities take place. Viruses were recovered from 5 liters of wastewater using adsorption-elution method. Viral nucleic acid was extracted and pooled for metagenomics sequencing on Illumina HiSeq. Bioinformatics approaches were used to analyze the viral metagenomics fingerprints. Among all assembled contigs, about 30% were assigned to viral taxa based on the GenBank Viral Reference Sequence database. A metagenomics analysis of purified viral particles in wastewater from Kenya revealed sequences to 10 viral families infecting humans (BLASTx E score <1E-5 and >90% protein identities). Many recently described human viruses including human picobirnavirus, novel astrovirus MLB strains, cosavirus, cardiovirus, bocavirus, Aichi virus, parechovirus and salivirus, were detected. Enteroviruses were more abundant with numerous enterovirus subtypes including novel subtypes (such as EV75, 76, 86, 90 and A119) were identified. The results presented here demonstrated that environmental surveillance by metagenomics could be a useful tool for rapid monitoring and characterization of various groups of viral pathogens circulating in the community in order to complement conventional epidemiological investigation and reporting practices. Moreover, the procedures applied here for metagenomics sequencing of viruses in wastewater should be useful tools for rapid identification of possible sources of fecal contamination in water environments. Modeling the Endogenous Sunlight Inactivation Rates of Laboratory-Strain and Wastewater-Sourced E. Coli and Enterococci Using Biological Weighting Functions Andrea Silverman, New York University Additional Authors: Kara Nelson Sunlight exposure is a dominant mode of disinfection of bacteria in sunlit waters, and is often found to be more important for bacteria removal from surface waters than sedimentation or other dark processes. Consequently, numerical models that can accurately estimate the sunlight inactivation rates of bacteria are valuable tools for predicting the fate of pathogens in sewage-impacted recreational waters, and designing natural wastewater treatment systems (e.g., open water treatment ponds or constructed wetlands) that meet health-related disinfection targets. In this work, biological weighting function (BWF)-based numerical models were developed to estimate the endogenous sunlight inactivation rates of <i>E. coli</i> and enterococci. BWF-based models allow for the prediction of inactivation rates under a range of environmental conditions that shift the magnitude or spectral distribution of sunlight irradiance (e.g., solar declination, latitude, presence of dissolved organic matter, depth), and are therefore broadly applicable across locations and water qualities. The BWF models were developed using data from controlled inactivation experiments conducted in the laboratory with a series of long-pass spectral cut-off filters (cut-off wavelengths ranged between 280 nm and 515 nm). Experiments were conducted with two sets of bacterial communities: laboratory-strain organisms cultured in the laboratory, and indigenous wastewater bacteria extracted directly from wastewater for use in experiments (i.e., without enrichment). For all four bacterial populations evaluated, photon-fluence normalized inactivation rates decreased with increased cut-off wavelength, and little to no inactivation was observed when bacteria were exposed to light with wavelengths greater than 455 nm. Separate inactivation rate models were developed for laboratory-strain and wastewater-sourced bacteria, given that wastewater bacteria had inactivation rates that were 5 to 7 times slower than those of their laboratory-strain counterparts. Given that it is the bacteria actually present in wastewater that we must target for disinfection, this finding highlights the critical importance of conducting experiments with indigenous bacteria sourced directly from wastewater. The BWF inactivation rate models fit experimental data well, and were successful in predicting the inactivation rates of wastewater E. coli and enterococci measured in clear marine water by researchers from a different laboratory.

Page 50 of 99

2:30 – 3:30 PM Grumman Choosing Dose-Response Norovirus and Campylobacter Dose-Response Functions Graham McBride, NIWA Additional Author: Jeff Soller Selection of appropriate dose-response formulations is a key step in developing QMRA (Quantitative Microbial Risk Assessments), often including Norwalk virus and/or Campylobacter. In a number of such studies only one dose-response function is cited for these pathogens, but each has at least two candidates. Furthermore, these functions can give markedly different results in terms of predictions of infection and of illness. In the case of Norovirus that has to do particularly with the degree of virus aggregation assumed for the QMRA calculations whilst for Campylobacter the results of a clinical trial on healthy adults differ substantially from those obtained from outbreak studies among children drinking contaminated milk on farm visits. We report results of QMRA numerical experiments in which each of these formulations is deployed, indicating the range of predicted risks that may be expected. This includes sensitivities to the inferred doses in the Campylobacter outbreak study (Campylobacter concentrations in the milk consumed by children on farm visits could not be measured directly so had to be inferred--as is common in outbreak studies). We also present results obtained when using the range of dose-response curves as the boundaries of a 'cloud' from which we draw samples. We acknowledge that there are multiple reasons that a risk practitioner could select just one dose response function when multiple are available and highlight that the selection can have profound effects on the reported results. We conclude that two of the most important components to this process to ensure that study-specific results are not inappropriately extrapolated to unrelated conditions are transparency and dose-response function selection justification. Infectivity Potential of VBNC Legionellae to Amoebae and Human Macrophages Silvia Cervero-Arago, MedUniWien, ICC Water & Health Additional Authors: Barbara Schrammel; Elisabeth Dietersdorfer; Regina Sommer; Julia Walochnik; Alexander Kirschner The proliferation of Legionellae in engineered water systems is related to the interaction with amoebae, which provide nutrients for the intracellular bacteria and a shelter against harsh environmental conditions. Under unfavorable conditions Legionellae enter into a viable but not culturable (VBNC) state in which the bacterial cells are unable to form colonies on standard medium but are still alive. The aim of the current study was to assess the infectivity of artificially produced VBNC Legionella spp. cells to amoebae and human macrophages. We induced the non culturable state of six Legionella strains by starvation at 45°C in ultrapure water. The transition to such state was monitored by using different viability markers. In this work we focused on monitoring the replication of these Legionella spp. strains within an Acanthamoeba strain a human macrophage-like cell line (THP1) and human macrophages. Samples were taken weekly for the first five weeks and at three different later time points and co-cultured with the three hosts by using different bacteria:host ratios. Results showed a high variability between the strains tested regarding their replication within the amoebal hosts. Most of the strains replicated within amoebae the first week after the transition to the VBNC state. After longer times under starvation conditions, replicating bacterial cells were observed for some strains only at the highest bacterial concentration used. Remarkably, most of the VBNC Legionella spp. strains investigated did not replicate within THP1 cells throughout the five weeks of starvation nor in later time points. However, some VBNC Legionella spp. strains infected human macrophages after 200 days under starvation conditions. Thus, starved VBNC Legionella cells may represent a risk for human health since they were able to replicate within host cells although they could not be detected by cultivation on standard medium. This is a joint publication within the Interuniversity Cooperation Centre for Water and Health (www.waterandhealth.at). The Effect of the 2015 Earthquake on the Bacterial Community Compositions in Water in Nepal Sital Uprety, University of Illinois at Urbana Champaign We conducted a study to examine the effect of seasonal variations and the disruptive effects of the 2015 Nepal earthquake on microbial communities associated with drinking water sources. We first characterized the microbial communities of water samples in two Nepali regions (Kathmandu and Jhapa) in May-August 2014 to understand the stability of microbial communities in water samples and to compare microbial communities from two geologically distinct regions in Nepal. We analyzed additional water samples from the same sources approximately 12 months later. When examining samples from Jhapa, we identified an increased abundance of Acinetobacter in samples collected in the monsoon season as compared to the dry season. When examining samples from Kathmandu, we the abundance of bacterial genera responsible for maintaining the geobiochemical characteristics of water (Ammonia Oxidizing Archaea and Bacteria, Nitrite-Oxidizing Bacteria and Sulfate-Reducing Bacteria) increased immediately after the earthquake and decreased eight months later (December 2015). In addition, microbial source tracking of human fecal contamination revealed deteriorated water quality due to the lack of adequate sanitation practices in

Page 51 of 99

some specific sites in Kathmandu after the earthquake. This study highlights a disruption of the environmental microbiome after an earthquake and the restoration of these microbial communities as a function of time and sanitation practices. 4:00 – 5PM Grumman Distribution Comparison and Risk Assessment of Free-Floating and Particle-Attached Bacterial Pathogens in Recreational Water TingTing Fang, School of Environment, Tsinghua University Additional Authors: Hui Wang; Qijia Cui; Peiyan Dong Pathogen exposure risk in recreational water is a great concern to the public health, although recreational lakes/rivers provide numerous ecological benefits. Moreover, these waters typically contain high nutrients, which could aggravate algae growth and increase water turbidity. The suspended particles in water can be important matrices for pathogen survival, and so far few studies concerned about the risks caused by the pathogen-particle attachment in water. In this study, we aimed at revealing the influence of particle attachment on pathogen distribution and survival in recreational water. Accordingly, water samples in three recreational lakes in Beijing were collected and were separated into free-living (FL) and particle-attached (PA) fractions. Detailed characteristics of the suspended substances in lakes were analyzed. Next-generation sequencing (NGS) was employed to determine the diversity of genera containing pathogens, and quantitative PCR (qPCR) was used to assess the presence of genes from Escherichia. coli (uidA), Salmonella enterica (invA), Aeromonas spp. (aerA), Mycobacterium avium (16S) and Pseudomonas aeruginosa (oaa). Firstly, our observation suggested that suspended particles in these lakes were mainly made up of algaes. The NGS results showed stable pathogen composition distinctions between the PA and FL fractions. Some genera, like Aeromonas and Mycobacterium, exhibited higher abundances in PA fractions. Next, qPCR revealed that most of the gene concentrations were higher within particles compared with FL fractions. Some gene levels showed correlations with particle concentrations and lake nutrient levels. Moreover, the quantitative microbial risk assessment (QMRA) of S. enterica and M. avium indicated that the infection probabilities in PA fractions posed a higher health risk. We concluded that suspended particles in recreational water influenced the pathogen distribution and could serve as reservoirs for pathogen. This study made a full-scale pathogen risk assessment in recreational water, and suggested the necessity to control nutrient level and particle density for water management practice. Disease Burden from Recreational Activities Along an Urban River David McCarthy, Monash University Additional Authors: Anna Lintern; Rebekah Henry; Mark Edmunds; Ana Deletic; Toby Prosser; Rhys Coleman; Trish Grant; Judy Blackbeard; Nick Crosbie; Dan Deere; Heather Murphy Cities around the world rely on their rivers to provide multiple benefits to communities, and many are campaigning to have city-based rivers re-opened for swimming (e.g. Melbourne's Yarra River, Sydney's Parramatta River, Paris' Seine River, and Boston's Charles River). Understanding the risks of aquatic recreation, and the overall potential disease burden, is essential for determining the need for management interventions as well as assessing the costs and benefits associated with various mitigation options. The Yarra River is used here as a case study, where dry and wet weather samples (n>5000) were collected over a five-year period from seven recreational sites and analyzed for a suite of reference pathogens and indicator organisms. A Quantitative Microbial Risk Assessment (QMRA) was then performed to estimate risks associated with specific recreational activities at different locations along the river. The reference bacterial pathogen (Campylobacter) represented twice the risk of illness per primary contact swimming event as compared to the reference protozoa and viruses. Full genome sequencing of the Campylobacter isolates, however, identified a high proportion of isolates not previously linked to human infections, hence the risk to human health may be overestimated. Through desktop and field surveys, primary, secondary or tertiary contact recreation usage was estimated. The desktop survey obtained information by contacting all organizations that provide or support aquatic recreation activities along the Yarra (boating organizations, boat rental agencies, swimming groups etc.). The field survey manually counted daily usage information from three sites along the Yarra, representing low, medium and high use. Overall, we estimated that there are 14,000 primary recreation events per year along the 240km reach of the Yarra River. Combined with the QMRA results, the greatest risk to primary contact recreation in the Yarra River is associated with Campylobacter, which may result in up to 70 illnesses per year. As many of the Campylobacter isolates have not previously been associated with human disease, this potentially represents 1-2% of the annual reported cases of campylobacteriosis in Melbourne.

Page 52 of 99

The Chicago River Microbial Health Study Prior to Disinfection Geeta Rijal, Metropolitan Water Reclamation District of Greater Chicago Additional Authors: Melissa Dsouza; Naseer Sangwan; Jarrad Hampton-Marcell; Herbert Ssegane; Tifani Eshoo; Cristina Negri; Jack Gilbert Microbial communities are key players in maintaining the health of the Chicago Area River (CAR). Traditional laboratory-culture methods such as fecal bacteria counts and select pathogen Polymerase Chain Reaction (PCR)-based methods have been used to characterize the CAR microbial quality; however, these methods are limited in their ability to resolve the source of fecal and/or sewage contamination. In addition, these methods do not completely describe the diversity of microbial communities present in the CAR. The Metropolitan Water Reclamation District of Greater Chicago (MWRD) in partnership with the scientists from the United States Department of Energy's Argonne National Laboratory (ANL) has designed a 7-year study program to track the diverse sources of microbial pollution and understand how metagenomics can add to the information provided by traditional fecal coliform monitoring. The CAR-Microbiome framework study includes the microbial-community-specific source metagenome linked to physical and chemical data. The study completed the baseline phase one before the disinfection and is currently conducting the second phase to assess the relative impact of post effluent disinfection in the storm water improvements in the CAR. The pre-disinfection results show no significant differences by year between samples collected across 2013, 2014, and 2015, suggesting a stable riverine ecosystem. There were differences in microbial community composition across the sampling environments. In addition, microorganisms associated from secondary treatment can be tracked downstream, and typically show increased abundance in proximity to the secondary-treated final effluent location. These include human fecal indicators, such as Bifidobacterium and sewage contamination indicators, such as Acinetobacter. Land-use types have a significant effect on CAR water and sediment-associated physiochemical properties. There were no significant differences in microbial alpha or beta diversity between wet/dry events. Mapping genes against E. coli supported amplicon evidence for a low abundance of this species, including a very low abundance of E. coli associated virulence markers. The microbiome data generated from MWRD's pre- and post-disinfection and engineering improvements efforts will enable good stewardship and management of this important water resource, as well as to gain insights into how to improve CAR's water quality for primary contact recreation.

Poster Presentations

Monday, May 15th Prevalence of Free-Living Amoebae in Households, Farming and Healthcare Potable Water of South Africa Petros Muchesa, University of Johannesburg Additional Authors: Mats Leifels; Petros Muchesa; Clarissa van der loo; Patrick Malaka; Tobias Barnard; Catheleen Bartie Free-living amoebae (FLA) have gained interest over the past decades as an important component of microbial ecology in various aquatic environments. Although most FLA are non-pathogenic and beneficial to the environment, some species for example Naegleria fowleri, Balamuthia mandrillaris and Acanthamoeba species are known human pathogens. FLA has also been shown to host and transmit pathogens such as Legionella spp., Pseudomonas aeruginosa and methicillin-resistant Staphylococcus aureus. In the past five years, the University of Johannesburg has done studies on the prevalence of FLA and associated bacteria in different aquatic environments. A total of 910 samples were collected from household tap water in five areas (n=182), borehole water of seven farming communities (n=453) and tap water of three public hospitals (n=275). FLA were isolated and identified based on morphology using the amoebal enrichment technique. FLA were isolated in 50 (27%),154 (56.0 %) and 102 (22.5%) of households, hospital and farm samples respectively. Using microscopy, PCR and 18S rRNA sequencing, Acanthamoeba spp. (T3, T1 and T20 genotypes), Vermamoeba vermiformis and Naegleria gruberi specie were identified. Although Acanthamoeba species are known to the most abundant in the environment, V. vermiformis was the most abundant amoebae species in the three water sources analyzed. The low prevalence of the genus Acanthamoeba in our study relative to Vermamoeba can be attributed to the use of FLA common primers which might have been more effective in amplification of Vermamoeba rather than Acanthamoeba. Nonetheless, Acanthamoeba T1, T3 and T20 genotypes identified in our studies have been implicated in eye and central nervous system infections. These results may present a potential public health risk to farming communities, immuno-compromised patients in hospitals and city residents if exposed to contaminated water. Therefore, there is a need in South Africa to investigate microbiomes in these environments in relation to human infections.

Page 53 of 99

Environmental Evaluation of Novel Crassphage Based qPCR Markers Elyse Stachler, University of Pittsburgh Additional Author: Kyle Bibby Environmental waters are monitored for fecal pollution to protect the public during recreational activities as well as protecting waters used for drinking sources or food production. Contamination of environmental waters can occur from wastewater treatment plant effluent, wildlife and domestic animals, and combined sewers; however, human waste has been shown to pose a greater risk to humans compared to other animal sources with viral particles representing a large portion of this risk. Thus, there is significant value in identifying a human (sewage) specific fecal pollution marker for environmental monitoring and source tracking. A newly discovered bacteriophage, "crAssphage", was predicted to be both highly abundant in the human gut and primarily human-associated, suggesting it would be an ideal indicator of human fecal pollution. Recently, two novel human-associated qPCR assays, crAss056 and crAss064, have been designed and evaluated based on the newly discovered bacteriophage, "crAssphage". The assays were determined to have specificities comparable to current top performing sewage source tracking assays. A 30-day sampling project of Nine Mile Run in Pittsburgh, PA was performed to compare the crAssphage markers with other human-source tracking markers and conventional culturable fecal indicator bacteria (FIB) in a sewage-impacted urban waterway. Nine Mile Run is a small stream frequented by humans and dogs for recreational purposes along with wildlife such as deer. The specific sampling site is directly downstream from a combined sewer outfall. Samples were collected daily for one month. Daily sampling and processing included: tracking rainfall amounts and combined sewer overflow (CSO) events, chemical parameter evaluation, enumeration of culturable E. coli and Enterococci levels, and enumeration of somatic coliphage. In addition, samples were filtered daily and frozen for bulk DNA extraction for use in qPCR assays. CrAssphage qPCR will be completed in addition to other human specific source tracking markers. Correlation between crAssphage qPCR assays and pollution events, other fecal source tracking markers, and culturable indicators will enable an initial evaluation of the utility of the new assays in an environmental matrix. It is expected that the crAssphage assays will correlate better with CSO events than the culturable indicators and other qPCR assays. This presentation will discuss the performance of the crAssphage qPCR assays in a real-world environment and their usefulness for future water quality and waste management applications. Disclaimer: This abstract does not necessarily reflect U.S. EPA policy. Binding Affinity and Toxicity of Thirteen Microcystin Congeners Debmalya Bhattacharyya, Northeast Ohio Regional Sewer District Additional Author: Mark Citriglia Cyanobacteria produce several secondary metabolites known as cyanotoxins, that are toxic to humans and animals upon ingestion. The most commonly observed cyanotoxins are microcystin, cylindrospermopsin, anatoxin, and saxitoxin. Microcystins are hepatotoxins that are observed to be most frequently associated with the HAB and its chemical structure consists of a cyclic heptapeptide with more than different congeners characterized. Microcystins is most commonly detected using HPLC coupled with a PDA detector or dual mass spectrophotometer or biochemical techniques such as ELISA or PPIA. Both method types are acceptable for monitoring however there is much controversy on which method is the most accurate and reliable. Data obtained from between the chemical and biochemical methods can vary widely due to matrix effects, competition, method sensitivity, and specificity. Cross-reactivity and competition with the ELISA antibody among the different congeners are key reasons for this discrepancy between the methods. The ADDA-specific antibody is expected to alleviate the large differences in cross-reactivity over the range of the congeners. However, our research indicates large variations in recoveries due to cross-reactivity between 14 different microcystin congeners. Calibration curves were used to evaluate the binding affinity of 14 different microcystin congeners. The Abraxis ELISA kit which use an ADDA-specific polyclonal antibody was used to for all experiments. The calibration curves were compared, evaluated and statistically analyzed using a 4- parameter logistic curve fit and a Log-Logit fit for the same 14 individual congeners. All the congeners observed had individual binding patterns and were different from the MC-LR curve fit. The EC50 of all the congeners were compared to that of the previously published values of few of the congeners. The EC50 values were similar considering the changes in the assay method, reagents during the development and commercialization of the assay procedure. The EC50 values derived from the logistic curve indicate that the MC-RR (EC50 = 0.629 ppb) has the least affinity for the antibody whereas the [D-Asp3] MC-LR (EC50 = 0.275 ppb) has the highest affinity for the ADDA antibody. The data obtained from the research indicates that using a single correction factor to determine cross-reactivity might not be the most accurate method because the cross-reactivity varies at the different points along the calibration curve. The cross-reactivity data generated from this study is being used to compare the results of sample containing a mixture of microcystin congeners that have been analyzed by LC/MS/MS and ELISA to best determine false positives and false negative of the methods and the best method to use when a sample matrix contains more of the other congeners than MC-LR. This presentation will discuss the results of the affinity study and variations between samples analyzed.

Page 54 of 99

Direct One-Step Culture Detection of Vibrio cholerae in Drinking Water in Low-Resource and Disaster Settings Megan Lott, Gillings School of Global Public Health, UNC-Chapel Hill Cholera is an acute diarrheal disease that results from consumption of contaminated water containing the bacterium Vibrio cholerae. Although preventable and easily treatable, an estimated 1.4 billion people are at risk of contracting the illness and an estimated 142,000 die each year of the disease. In 2011, the World Health Assembly adopted resolution WHA 64.15 that calls for enhanced surveillance and rapid testing to identify cholera hotspots, anticipate outbreaks, and increase community preparedness. Timely detection of V. cholera can be achieved by field monitoring of drinking water quality. Present technologies were not designed for low-resource or disaster settings, as they require access to clean water, consistent electricity, specialized equipment, and advanced training. To address this gap, our team hypothesized that the Aquagenx Compartment Bag Test (CBT) system could be adapted for the direct, chromogenic detection and quantification of V. cholerae bacteria in drinking water. The CBT is a simple, self-contained low-cost, portable test that uses a multi-chambered plastic bag and a chromogenic media to detect and quantify E. coli bacteria in water. Multiple experiments were performed on candidate media using laboratory and environmental test waters spiked with ATCC and wild-strain V. cholerae and other Vibrio spp. to evaluate performance and suitability as a liquid, flurogenic medium for the detection of V. cholerae in the CBT. Preliminary results suggest that a modified Tellurite Taurocholate Gelatin Broth (TTGB) is sensitive to the multiple strains of V. cholerae found in outbreak settings, and can be used to appropriately determine their concentration in drinking water. Rigorous laboratory evaluation will further optimize the media for application with the Compartment Bag Test. Field testing will guide product development and global deployment. If successful, this product will be a low-cost tool designed specifically for community-driven surveillance of drinking water sources in cholera endemic, low-resource, and disaster settings. Isolation of Amoeba Associated Gram Negative Bacteria in Water Systems of a South African Public Hospital Petros Muchesa, University of Johannesburg Additional Authors: Mats Leifels; Lars Jurzik; Kousar Hoorzook; Tobias Barnard; Catheleen Bartie The prevalence of free-living amoeba and associated bacteria in hospital environment may pose a risk to immuno-compromised patients and health care workers. The purpose of this study was to investigate the occurrence of Legionella pneumophila and other Gram negative bacteria associated with amoebae in a hospital water network of Johannesburg. A total of 94 water and swab samples were collected from the theatre, intensive care unit and milk room. All samples were analyzed using an amoebal enrichment and molecular techniques. Observed amoebae were purified and lysed to release potential intracellular bacteria. L. pneumophila were detected using conventional and real time PCR. Other Gram negative bacteria were characterized using the VITEK®2 Compact System. Furthermore, 20 isolates from the ICU and theatre were tested for antibiotic susceptibility using the VITEK®2 Compact System. Antibiotic assay using 19 antibiotics was done on the isolates using antibiotic serial dilutions. FLA were isolated in 48 (51.1%) water and biofilm samples. L. pneumophila were detected in 4.3% of the amoeba positive samples. The Legionella-positive samples were isolated from the ICU. The most commonly detected Gram negative bacterial species in the hospitals were Sphingomonas paucimobilis, Delftia acidovorans, Serretia marcescens and Stenotrophomonas maltophilia, which are all known opportunistic nosocomial pathogens. Of the 20 isolates, resistance of least two to seven of the 19 tested antibiotics was observed, with the highest minimum inhibitory concentrations value of 512 mg/L being observed in a Sphingomonas paucimobilis isolate. Two S. marcescens isolates isolated from theatre exhibited the highest resistance to seven antibiotics. Nitrofurantoin and colistin-resistant bacteria had the highest prevalence, followed by amoxicillin and ampicillin-resistant bacteria. This study revealed that hospital water system may be source of pathogenic and antibiotic resistant organisms. This baseline information point out to a potential health risk to large population of immuno-compromised individuals in hospital settings. Isolation and Characterization of Non-tuberculous Mycobacteria and Mycobacteriophages from a South Carolina River Kim Borges, University of Maine Additional Authors: Regine Johnson; Briana White; Zach Beal The non-tuberculous mycobacteria (NTM) are natural inhabitants of waterways and soil that can colonize municipal drinking water and plumbing systems. Some species of NTM are opportunistic human pathogens that can cause pulmonary, wound, and systemic infections, especially in immunocompromised or elderly individuals. Since person-to-person transmission of mycobacterial infections has not been documented, it is likely that non-hospital infections are acquired either by direct environmental contact, or by bacteria that enter potable water from the original natural water source. Mycobacteriophages infect and kill mycobacteria, but their roles in controlling NTM numbers in the environment and in patients are virtually unknown. Thousands of distinct mycobacteriophages have been identified, mostly from soils, but the natural hosts for most of these phages have not been identified. Despite their health and environmental significance, little is known about the interactions among aquatic NTMs and their phages. NTMs have been isolated from swamps and other waterways in Georgia and the southeast, and similar conditions in South Carolina waterways are likely to favor their growth. In this study, an NTM isolate and several mycobacteriophages were cultured from a water - sediment mixture from the Combahee River in Beaufort County SC. The rapidly - growing (2 days), yellow-pigmented NTM isolate was identified as related to several Mycobacterium neoaurum strains (100 percent identity) by 16s rRNA

Page 55 of 99

gene sequence analysis. M. neoaurum has been isolated from environmental samples, and it is associated with human infections, mostly in immunocompromised hospital patients. The presence of mycobacteriophages in the Combahee River sample was investigated using the bacterium M. smegmatis as the host in enrichment cultures. The river sample yielded several hundred phage plaques. Of these plaques, six were purified to produce pure mycobacteriophage populations. Preliminary studies of the river phages indicate that four of the isolates are temperate phages and two are lytic phages, and they exhibit differences in growth temperature profiles. The mycobacteriophages were evaluated for their abilities to infect the NTM isolate from the Combahee River. All of the phages infected the M. neoaurum-like isolate, though with reduced efficiency compared to infection of their isolation host M. smegmatis. To our knowledge, these are the first NTM and mycobacteriophages to be co-isolated from water in South Carolina. The Combahee River mycobacteriophages also were evaluated for host specificity against three type mycobacterial species: M. abscessus, M. brumae, and M. fortuitum. The mycobacteriophages showed distinctive host specificities, with some unable to infect these hosts, and others able to infect one to all of the additional hosts. Host range of mycobacteriophages is of interest ecologically, since little is known of mycobacterium - phage dynamics in ecosystems. Impact of Vegetable Surface Properties and Sanitizer Type on Rotavirus Infection Risks from Consumption of Fresh Produce Miyu Fuzawa, University of Illinois at Urbana-Champaign Rotavirus contamination in water supplies are common, and the risk to infection via rotavirus-contaminated fresh produce is is a concern. Although vegetable is commonly sanitized before being sold to customers, it remains unknown how the properties of sanitizer and fresh produce affect rotavirus infection risks. The main focus of this study was to estimate infection risks caused by consumption of fresh produce ('Totem' Belgian endive (Cichorium intybus) and 'Starbor' kale (Brassica oleracea)) disinfected with two kinds of vegetable sanitizer (either an oxidant-based sanitizer or a surfactant-based sanitizer). Both cultivar vegetables were assumed to be contaminated with irrigation water containing rotavirus. Surface area and weight of cultivar vegetables, previously obtained rotavirus inactivation data, and literature-based infection parameters were combined in a quantitative microbial risk analysis (QMRA) model to estimate risk of rotavirus infection from consuming these fresh produce. As a result, risks were estimated to be sanitizer- and produce-dependent, as the disinfection efficacy of rotavirus adhered to the surface of fresh produce varied. Among the four studied combinations of sanitizer and cultivar vegetable, the risk of rotavirus infection was the highest with a median of 2.61 × 10^(-2) under the condition of 'Totem' Belgian endive with low wax crystals disinfected with the oxidant-based sanitizer, while other combinations of vegetable and sanitizer had approximately 100-fold lower risk. Properties of produce surface and vegetable sanitizer affected rotavirus infection risks via consumption of these vegetables. This finding should be incorporated into food sanitation strategies to reduce foodborne viral infections. Microbial and Turbidity Removal by Chitosan Coagulation in Natural Waters to Optimize Ceramic Saree Cloth Water Filtration for Household Drinking Water Treatment Hemali Oza, The University of North Carolina at Chapel Hill Additional Authors: Eleanor Holmes; Lydia Abebe; Mark Sobsey Microbial And Turbidity Removal By Chitosan Coagulation in Natural Waters To Optimize Saree Cloth Water Filtration For Household Drinking Water Treatment Oza, H., Holmes, E., Coleman, C., Abebe, LS1, and Sobsey, MD1 1Department of Environmental Sciences and Engineering, University of North Carolina, Chapel Hill, Campus Box 7431, Chapel Hill, North Carolina 27599-7431, USA Introduction: To combat diarrheal disease from contaminated drinking water, water treatment technology and safe storage (HWTS) have been implemented in developing countries. While household level purification technologies have drastically reduced diarrheal illness, the majority of filtration technologies fail at removal of viruses. To address this shortfall, we combine a natural coagulant as a form of pretreatment with saree cloth filters (SCFs) to evaluate the coagulation and pretreatment capacity of chitosan. While SCFs have been a subject of research, performance deficiencies still exist. Chitosan is a natural organic polymer that is ubiquitous, inexpensive, commercially available, but has seen only limited use as a water coagulant. Chitosans are non-toxic and biodegradable polymer materials that are derived by simple chemical treatments from chitin. Objectives: Our approach is to integrate chitosan use with the SCFs and determine the coagulation effects of chitosan through evaluating the removal of bacteria, virus, and turbidity. To evaluate effectiveness of chitosan coagulation we evaluated performance in lake water spiked with indicator microorganisms. Methods: To evaluate microbiological removal in lake water spiked with indicator microorganism, test water was prepared by adding E. coli B and MS2 bacteriophages as surrogates for bacteria and virus contaminants to lake water. The spread plate method was used to enumerate E. coli K011, and the Double Agar Layer (SAL) assay was used for MS2 detection. The following water quality characters with evaluated in both sets of tests water: turbidity using Hach 2001N Laboratory Turbidity meter and pH. Log10 values were calculated based on the microbiological reduction. Results and Conclusions: Preliminary results indicate chitosan is a promising coagulant that optimizes the removal. Based on WHO health based microbial removal criteria for household water treatment technology, chitosan coagulation raised the health protective targets for both viruses and bacteria. As such, these results support the use of chitosan to optimize water filtration processes for household drinking water treatment through significant virus reduction and decreasing the clogging of filters, thereby increasing their lifespan. Observed log reductions have been between ~0.5 and ~1.0.

Page 56 of 99

Spatial and Temporal Drivers of Fecal Contamination in a PNW Estuary and Associated Shellfish Harvesting Waters Amity Zimmer-Faust, USEPA Additional Authors: Cheryl Brown; Darryl Marois; York Johnson Tillamook Bay, a National Estuary Program site, has a long history of elevated fecal indicator bacteria (FIB) levels in exceedance of acceptable standards. Elevated FIB levels have significant consequences in Tillamook Bay, including closure of large sections of the bay for recreational and commercial shellfisheries. Potential sources of fecal bacteria are widespread and may include human (wastewater treatment plant runoff, septic systems) and animal sources (runoff from cattle operations, wildlife). Our research effort aims to understand drivers of variability in fecal coliform (FC) levels within Tillamook Bay. Densities of indicator bacteria may be related to various hydrologic, environmental, and land use parameters. Statistical, data-driven models were applied to past measurements of FC levels, providing information regarding which environmental conditions were related most closely to exceedances. Results identified direct relationships of discharge velocity, salinity, and antecedent rainfall to FC concentrations. FC concentrations exhibited pronounced seasonal and spatial variability. The highest FC levels in the bay coincided with high discharge and primarily occurred in winter, likely driven by runoff. Moreover, trend analyses were applied to evaluate effects of water quality best management practices (BMPs) implemented within the Tillamook watershed. For this analysis, 49 historical sampling sites were chosen that represented the five major river systems draining into Tillamook Bay and the three conditionally approved shellfish management areas within it. Selected sites were regularly sampled for the duration of a 10-year study period. Among the watershed (river-based) sites, highest levels of E. coli occurred within the lower watershed, coinciding with primarily urban, rural residential, and agricultural land uses. Evidence suggested river water quality improvement at several sites during the study period, potentially in response to changes in land use and implemented BMPs. In addition, the ecohydrology model, VELMA, was applied to one of the five major rivers draining into Tillamook Bay (the Trask River), to simulate the effects of changes in forest harvest or precipitation on river inputs. Model outputs of riverine water flow were then used to predict effects on FC loading from watersheds to Tillamook Bay. By evaluating drivers of fecal coliform levels, including land use, precipitation, and hydrology, results of this study can help inform management of important shellfish harvesting waters. Quantitative Microbial Risk Assessment (QMRA) in the Roof-Harvested Rainwater Intake Jálvaro da Hora, IFBA Additional Author: Eduardo Cohim This study evaluates the microbiological risk in rain water intake collected from roof considering the presence of the microorganism pathogenic Campylobacter. The study was conducted on the basis of Quantitative Assessment methodology Microbiological-AQRM risk with use of @RISK software. The AQRM has been widely used as an alternative to epidemiological assessment in various situations of exposure to microorganisms that can cause diseases to man, the methodology is divided into four basic steps; (I) hazard identification and characterization, (ii) exposure assessment, (iii) evaluation of the dose-response, and (iv) risk characterization. The results showed that the median risk for intake would be 3,374 x 10-04 DALYs (years) per person per year, sourced from 1,217 x 10-01 cases of the disease, which amounts to about 3 hours per person per year the disease and that drinking rainwater untreated represent a percentage increase of 4% in cases of disease have occurred in countries with similar characteristics to Brazil. Based on these values and considerations made regarding the establishment of a tolerable risk we can consider that rainwater collected from the roofs could be used for drinking without treatment and risk of low to moderate. We also recall that additional security alternatives in the management and handling of that rainwater should be considered as a kind of catchment area used the first water diversion, storage time, hygiene and other structures in order to further contribute to a reducing the concentration of pathogens therein and therefore reach values even safer. Occurrence of Human and Bovine Pathogens and Fecal Markers in Non-Disinfected Drinking Water from Community and Non-Community Wells in Minnesota Joel Stokdyk, U.S. Geological Survey Additional Authors: Anita Anderson; Lih-in Rezania; Susan Spencer; Aaron Firnstahl; Trisha Robinson; Mark Borchardt Many studies conducted in the USA on groundwater-borne pathogens have focused on human enteric viruses and community public water systems (CPWS). There is a need for information regarding pathogen presence in non-community public water systems (NCPWS) and the occurrence of non-viral pathogens in groundwater. The Minnesota Department of Health conducted an occurrence study of ground-waterborne pathogens, including non-viral pathogens, in both CPWS and NCPWS throughout the state to assess microbial contamination. Samples were collected over two years from 146 wells, including 88 CPWS wells and 58 NCPWS wells. Wells sampled in the first year (n = 89) and the second year (n = 85, including 28 from year one) were sampled once every two months. Samples were collected using ultrafiltration and analyzed by qPCR for 19 pathogens and markers of fecal contamination, including human and bovine viruses and agricultural zoonotic bacteria. Overall, 171 of 962 samples (18%) were positive for at least one microbial target (including 60 samples not yet analyzed for all targets). One or more microbial targets were detected in 96 of 146 wells (66%), with detections in 50 of 88 CPWS wells (57%) and 46 of 58

Page 57 of 99

(79%) NCPWS wells. The non-viral pathogen Salmonella was the target most commonly detected (6% of samples). The other most common targets detected in samples were pepper mild mottle virus (5%), human adenovirus (3%), and bovine Bacteroides (3%). Human enterovirus, norovirus genogroup II, human polyomavirus, bovine polyomavirus, Bacteroidales-like Cow M3, and rotavirus group A were also detected. Regular sampling of each well over all seasons of the year allowed observation of microbial contamination that would have gone undetected with less thorough sample collection (e.g., yearly), as most contaminated wells were positive for microbial targets only once. The percentage of NCPWS wells positive for a microbial target was higher than that of CPWS wells, indicating that sampling NCPWS may be an important consideration for protecting human health. Likewise, the relatively high occurrence of Salmonella indicates the potential importance of non-viral pathogens in drinking water supplies. Microbial contamination data will be used with well characteristics (e.g., casing depth) and environmental data (e.g., geology, precipitation, land use) to determine factors that contribute to well vulnerability. Potential Health Hazards from Residual Contaminants in Domestic Backwater-Recovered Struvite Fertilizer Rachel Yee, University of Alberta Additional Authors: Nicholas Ashbolt; Yang Liu Introduction The feasibility of nutrient and energy recovery from wastewater effluent is increasing with knowledge and emerging practice. The high organic content in source-diverted blackwater provides considerable efficiency with potential health protection gains over traditional centralized sewage treatment, but uncertainty exists with regards to the human safety of recovered products. Using an upflow anaerobic sludge blanket (UASB) blackwater digester, high energy recovery is provided through biogas and the residual NH4+ and PO43- content of the digestate can be recovered as a slow release struvite (MgNH4PO4·6H2O) fertilizer. Though a promising technology for recovery and reuse, the nature of blackwater raises concerns regarding the biological and chemical contaminants that could co-precipitate with struvite. The biological contaminants of concern include antimicrobial resistant (AMR) bacteria, bacteriophages and their corresponding resistance genes; whereas the chemical contaminants include heavy metals and micropollutants. Both contaminant presence and the reaction chemistry/interactions between contaminants and struvite formation could play a role in the purity of the final product. Hence, the aim of this study is to generate struvite under controlled conditions and compare it to pilot-scale products with respect to residual contaminants. Methods and Results Standard coagulant jar test apparatus was used to examine the water chemistry involved in precipitating struvite from a simulated blackwater. Additionally, two important parameters, the pH of the feed and the Mg2+:PO43- molar ratio, were considered and studied in relation to their effect on struvite formation and contaminant partitioning. Preliminary molecular and chemical analysis of struvite products obtained from pilot-scale plants showed that both biological and chemical contaminants do co-precipitate. ICP-OES analysis detected a low level of metals in struvite with Zn, Ni and Cd principally of potential concern. Subsequently, the pH effects on antibiotic resistant E. coli and Enterococcus isolates were examined via live/dead staining where a decrease in viability was observed, particularly due to the alkaline conditions used to precipitate struvite. Nonetheless, even with partial loss in bacterial viability, AMR genes (dfrA1, tetA, vanB) and an associated class 1 integron gene (intI1) were detected by qPCR, which could be taken up by autochthonous soil bacteria. Conclusion Consideration of contaminant co-precipitation needs to be balanced against yields of struvite in future optimization studies if blackwater-derived fertilizer is to be commercially generated. Additionally, the ability of any residual AMR genes in struvite to impact local soil bacteria/plants is unknown. Nonetheless, these preliminary results raise the need to examine commercial products made from domestic wastewaters for intact AMR genes, with a view to minimize any public health impact. Does Monochloramine Use for Municipal Drinking Water Disinfection Increase the Risk of Nontuberculous Mycobacterial Infection? Nadine Kotlarz, University of Michigan Additional Authors: Lutgarde Raskin; Madalyn Zimbric; John LiPuma; Lindsay Caverly The prevalence of disease caused by nontuberculous mycobacteria (NTM) has increased substantially over the past 20 years but the reasons for this increase are unclear. NTM are frequently recovered from municipal drinking water. Chlorine is the most common drinking water disinfectant used but chloramine is becoming more popular. NTM levels are generally higher in chloraminated water. We compared the prevalence of NTM infection in three Michigan cities (Lansing, East Lansing, and Ann Arbor), which have been using chloraminated water for at least 17 years, with prevalence in cities using chlorinated water to test whether municipal disinfectant type is a significant predictor of NTM infection. We obtained results of all NTM cultures at the University of Michigan Health System (UMHS) from January 2000 through September 2015. We also obtained culture source, patient address at the time of culture collection and associated diagnosis codes. The US Environmental Protection Agency provided information on drinking water disinfection practices. The annual number of patients with NTM diagnoses increased from less than 12.7/100,000 patients in 2000 to 28.6/100,000 patients in 2015, demonstrating that NTM disease prevalence is increasing. There were 2,009 NTM isolations for 60,155 samples (3.3% positive) and Mycobacterium avium complex predominated, accounting for 1,066 (58.2%) of the 1,833 isolates with species information. Median NTM isolation prevalence (positive/total cultures) was 74.7 per 1,000 across chloraminated cities and 46.3 per 1,000 across chlorinated cities. Disinfectant type was a significant predictor of culture result for this dataset (Χ^2, p < 0.0001). Understanding risk factors for NTM disease is increasingly important as the US population ages and becomes more susceptible to infection. We found a higher prevalence of NTM infection in cities using chloraminated

Page 58 of 99

water compared with cities using chlorinated water, suggesting that replacing chlorine with chloramine disinfection may be increasing the burden of NTM disease. The Impact of Household Drinking Water Quality on Diarrhea and Specific Enteropathogens in Peruvian Infants Miranda Delahoy, Emory University Additional Authors: Mia Mattioli; Jackie Knee; Forest Altherr; Rebecca Hodge; María del Rosario Jaramillo Ramírez; Alisson Zevallos-Concha; Lilia Cabrera; Andres Lescano; Joe Brown; Robert Gilman; Karen Levy While the relationship between household water quality and diarrhea is well-established, until recently it has been difficult to assess which particular pathogens are most strongly associated with consumption of household drinking water. New multiplex assays make it easier to evaluate the presence of enteropathogens in stool and water samples. Additionally, many cross-sectional studies on the relationship between water quality and diarrhea have been conducted, but there are few prospective studies of this association. Further research on these topics can enhance knowledge on the influence of household drinking water on child health. From June-July 2016 we collected water and stool specimens from a balance of urban and rural households with infants in Piura, Peru (n = 96). The infants had previously been enrolled in a birth cohort with their mothers. The first follow-up (visit 1) occurred when infants were approximately 7 months old, at which time we used dead-end ultrafiltration to concentrate 20 liters of water from the household's primary drinking water source. A 100 ml grab sample was also collected from this source and from up to 2 additional containers of household drinking water. At visit 1 a detailed health and exposure questionnaire was administered. Households were visited 4-7 days later (visit 2), at which time 100 ml water samples were taken from the sources sampled at visit 1, a stool sample was collected from the study infant, and a questionnaire on diarrhea symptoms and medication use was administered. Nucleic acids were extracted from stool and from PEG precipitates of large-volume water samples and assayed using the Luminex multiplex Gastrointestinal Pathogen Panel, which detects 16 bacterial, viral, and parasitic enteropathogens. The 100 ml samples were tested on the day of collection for the presence of fecal indicator bacteria (total coliforms and E. coli) using the IDEXX Colilert method. At visit 1, 19/96 infants had diarrhea and 12/94 available for stool collection at visit 2 had diarrhea at that time. Enteropathogens were found in 67% of stool samples. Salmonella, Campylobacter, and Clostridium difficile (toxins A+B) were the most common infections, each isolated in 22-24% of samples. Co-infections with multiple pathogens were found in 36% of study infants. 75% of households had a connection to the municipal water supply. Of the 351 small-volume water samples, 61% were positive for total coliforms and 36% were positive for E. coli. Half of the large-volume water samples have been tested to date, with no detection of enteropathogens. To assess the contribution of contaminated drinking water to infant diarrhea and enteropathogen infection, we will present results of analyses examining (1) associations between enteropathogen infection and water quality metrics, as well as other risk factors; (2) the variability in water quality across household sources; and (3) the relationship between water quality and subsequent diarrhea. Viz-DR A Microbial Dose Response Visualization and Optimization Tools for QMRA Students and Novices Mark Weir, The Ohio State University Additional Authors: Jade Mitchell; William Flynn Quantitative microbial risk assessment (QMRA) is a valuable tool that crosses environmental matrices and personnel expertise. The future development of QMRA requires the inclusion of typically un- or under-represented experts. Social scientists, microbiologists and non-quantitative experts and decision makers will allow for the broadened use and applicability of QMRA. The difficulty is in the training of and use of quantitative skill sets that are required to complete a QMRA. One area that has a unique combination of skills required to accomplish is the dose response modeling and assessment. To optimize a dose response model based on candidate data, the modeler needs to have an understanding of: microbiology, pathogenesis, statistics, mathematics and programming. Teaching each of these skills sets even in a semester length course is challenging at the least. Additionally, in practice QMRA modelers may need to consult a dose response modeling expert to determine optimal dose response models, or how to develop their own dose response models. Therefore, to expand dose response modeling to a wider audience and expertise base especially non-quantitative scientists, Viz-DR was developed. Viz-DR is a web-based and standalone app that allows the user to visualize the current bank of dose response models housed on the QMRA scientific wiki (qmrawiki.canr.msu.edu). Viz-DR is also capable of optimizing the users' own data to the two physiologically plausible dose response models using an R code used throughout the Center for Advancing Microbial Risk Assessment. Development of and examples of use of the app will be presented. Longitudinal and Source-to-Tap New Orleans, LA, USA Drinking Water Microbiology Natalie Hull, University of Colorado Boulder Additional Authors: Eric Holinger; Kimberly Ross; Charles Robertson; J. Kirk Harris; Mark Stevens; Norman Pace Understanding of the microbiology of drinking water treatment and distribution systems is critical to public health and safety, but is currently limited. The two municipal drinking water systems of New Orleans, LA, USA offer the opportunity to compare independent systems that treat the same surface water, from the Mississippi River, while battling aging infrastructure and unique climate and topographic challenges. To

Page 59 of 99

better understand the sources of microbiology delivered to taps, these treatment plants and distribution systems were subjected to source-to-tap sampling over four years. Both plants employ traditional treatment by chloramination, applied during or after settling, followed by filtration before distribution. Longitudinal samples indicated microbiology to have significant stability both spatially and temporally, and between treatment plants and distribution systems. Disinfection had the greatest impact on microbial composition, which was further refined by filtration and influenced by distribution and premise plumbing. Actinobacteria spp. exhibited trends with treatment. In particular, Mycobacterium spp., very low in finished waters, occurred idiosyncratically at high levels in some tap waters, indicating distribution and premise plumbing as main contributors of mycobacteria. Source water microbiology was most divergent from tap water, and each step of treatment brought samples more closely similar to tap waters. Observed variation in the systems over time and during treatment emphasizes the need for continued longitudinal studies to optimize understanding and safety of treated drinking water. SARA's Bacterial Source Tracking: How One Small Environmental Lab Developed an Impactful Molecular Biology Program Hillary Halderman, San Antonio River Authority Additional Author: David Hernandez Improving water quality through novel and effective monitoring programs is the goal of Municipalities, academic researchers, and River Authorities across the nation. Though there are many factors impairing our water bodies, bacteria have consistently been a front line offender when it comes to water quality. Current practices uphold E. coli and Enterococci monitoring. These methods are great for general monitoring yet knowing the location of bacterial hot spots is only winning half the battle. Enter, source tracking. Bacterial source tracking identifies the source of fecal contamination in a waterway and can differentiate between species. This capability is an enormously helpful resource in mitigating bacterial loads in water bodies. However, laboratories with molecular biology capabilities and experience in the environmental monitoring realm are far and few between. Incorporating these methodologies into an environmental laboratory can be expensive, complex, and overall not feasible. This presentation will outline the development of a qPCR laboratory dedicated to bacterial source tracking. It will discuss the research, setup, and optimization of methodologies our team went through to implement molecular biology into our small environmental laboratory. In addition the presentation will highlight some of the preliminary studies we have conducted throughout our watershed. Opening Pandora's box Unmasking the Need for a Continuous Sample Processing Control for PCR Based Fecal Marker Analysis Rita Linke, TU Wien, ICC Water & Health Additional Authors: Sibel Zeki; René Mayer; Katharina Keiblinger; Robert Mach; Regina Sommer; Georg Reischer; Andreas Farnleitner PCR based techniques for the detection and tracking of faecal pollution have gained considerable popularity. Molecular techniques are opening the "black box" of faecal pollution in order to guide a more problem oriented quality management of water resources. However, applying molecular diagnostics to environmental matrices can be challenging, e.g. the PCR reaction can be inhibited and thus strongly biased by compounds such as humic acids or heavy metals. The aim of this study was a detailed process evaluation of the cell filtration, DNA-extraction and qPCR-performance characteristics applied to water samples from one habitat with a very diverse and changing matrix composition. The aquatic habitat selected was Lake Neusiedl, located in the Eastern part of Austria, an important recreation area for the large urban area of Vienna. High and fluctuating levels of salt, humic acid, and suspended solids (TSS) characterize the water matrix of Lake Neusiedl. Therefore, this habitat represents a perfect "realistic world" model to study the basic performance characteristics of PCR-based diagnostics on water samples with changing matrix conditions. A filtration/extraction process control was added to each sample by spiking with a defined cell standard (DeTaCS). In addition, a strict evaluation of PCR-inhibition by using an internal amplification control and different dilutions for each sample was performed. DNA was extracted using a phenol-chloroform and CTAB based method. Results clearly demonstrated that inhibition of the PCR reaction played only a minor role in (some of) the samples investigated. In contrast, the presence of high amounts of (inorganic) TSS led to a complete loss of DNA during the process of DNA-extraction (i.e. recovery rates ≤1%). To test the hypothesis that the adsorption of DNA to surface-reactive matrix components during DNA-extraction was the causing mechanism, experiments with different amounts of sodium pyrophosphate and salmon sperm were conducted in the laboratory. Addition of these adsorption site competitors helped to recover DNA concentrations to near control levels. The results of the presented study impressively show the importance of using a stringent and continuous process control on a "sample-per-sample" basis. Using this approach, we were able to unmask the challenges of diverse matrices of water samples within a single habitat and could even adapt the DNA-extraction protocol in order to get comparable results. We postulate that the herein observed challenges are rather the rule than the exception. We think that this situation is conferrable to many surface waters, as high amounts of TSS are frequently observed (e.g. during event situation). We thus propose a continuous use of a stringent filtration/extraction process control as basis for a robust quality management of qPCR-based diagnostics for water quality monitoring. This is a joint investigation within the Interuniversity Cooperation Centre for Water and Health.

Page 60 of 99

Isolation and Detection of Diarrhoegenic E. coli from Environmental Water Sources in South Africa Using Molecular Biology Methods Kousar Omar, University of Johannesburg Additional Author: Tobais George Barnard The addition of PCR and q-PCR to microbiological methods used for the analysis of water samples can be valuable in detecting and characterizing E. coli communities. However, there are several disadvantages that hinder the implementation of these methods, such as the lack of standardization of protocols and sample processing. The aim of this study was to test and compare the detection and quantification of E. coli in wastewater final effluent- (n=30), environmental- (n=30) and potable water (n=60) samples with molecular and culture based methods. DNA was extracted from bacterial cells concentrated from the samples with an optimised DNA extraction method followed by analysis with q-PCR targeting specific virulence and housekeeping genes. The qPCR cell number estimates were compared to bacterial number estimates obtained using the Colilert Quanti-Tray most probable number method. Comparison of the microbiology and q-PCR cell numbers determined indicated that the q-PCR detected less bacterial cells in 40% of the final effluent and 70% of environmental water when compared with the cultured cell numbers. In 57% of final effluent and 20% of the environmental the q-PCR estimated the presence of more bacterial cells than the culture based method. For the remainder of the samples both methods gave similar results. The study showed that the DNA extraction protocol had the potential for good DNA recovery and quality for PCR analysis with no inhibition in the samples that could result in reporting false negative reactions. A q-PCR protocol was successfully developed and validated to quantify E. coli from environmental waters. At the same time DNA associated with diarrhoeagenic E. coli was detected in water samples with bacterial counts <1 cfu/100 m§¤, implying the presence of either DNA or the DEC strains in a viable but non-culturable state. Global Cryptosporidium Loads from Livestock Manure Lucie Vermeulen, Wageningen University Additional Authors: Jorien Benders; Gertjan Medema; Nynke Hofstra Introduction Understanding the sources of Cryptosporidium to surface water is essential for effective management of human and animal cryptosporidiosis. In this paper we analyse published Cryptosporidium prevalence and excretion rates of oocysts in livestock manure. Subsequently, we quantify livestock Cryptosporidium loads to land on a global scale using process-based modelling, and we explore the effect of manure storage and treatment using scenario analysis. Methods Systematic literature review: We performed a systematic literature review to analyse prevalence of cryptosporidiosis and oocyst excretion rates in manure of 11 livestock species (cattle, buffaloes, pigs, sheep, goats, chickens, ducks, horses, mules, asses and camels), differentiating between young and adult animals and different world regions. We found 250 papers for prevalence and 68 for oocyst excretion that were relevant and included. Modelling: We applied the model GloWPa-Crypto L1, a global spatially explicit model at a 0.5x0.5° grid, to calculate the total annual oocyst loads to land from manure of 11 livestock species. We use gridded livestock data and the results of the literature review, and we model temperature-dependent survival during manure storage. We compare the current situation to four management scenarios. Results Prevalence: Average prevalence was found to be highest in pigs, sheep, cattle and buffaloes (19-22%), somewhat lower in goats, camels, ducks and chickens (11-15%) and lowest in horses (7.5%) and asses (0.9%). Prevalence was found to be higher in young (under three months) than in adults. Excretion rates: Average oocyst excretion rates in manure (10log oocysts/gram feces) were found to be between 2-2.3 for adult cattle, sheep and goats, 3.9 for adult pigs, between 4.4-5.3 for young cattle, sheep, goats, and pigs, and 3.1 for horses. For chickens and ducks oocyst excretion rates (10log oocysts/infected animal/day) were found to be 6.8 and 4.7, respectively. Modelling: We calculate a total global Cryptosporidium oocyst load from animal manure of 3.2x10^23 oocysts/year. Cattle, especially calves, are the largest contributors. We compared the current situation to four management scenarios. Assuming that 1) all manure goes directly to land would increase the oocyst load to land by a factor 2.6; 2) all manure goes to storage would reduce the load by a factor 2; 3) all manure is treated by mesophilic anaerobic digestion would reduce the load by a factor 37, and 4) all manure is treated by thermophilic anaerobic digestion would reduce it by a factor 37000. Regions with high reduction potential include India, Bangladesh, western Europe, China, several countries in Africa, and New Zealand. Conclusion Our literature review shows that cryptosporidiosis is ubiquitous in livestock around the world. Manure treatment, particularly of cattle manure especially at elevated temperatures, has a larger load reduction potential than manure storage. Selection of Microbial and Molecular Markers Useful to Differentiate the Source of Fecal Pollution in the Bogota River (Columbia) Andrea Catherine Sánchez Alfonso, Javeriana University Additional Authors: Camilo Venegas; Díez Hugo; Juan Jofre; Anicet Blanch; Claudia Campos Intestinal pathogenic microorganisms can be introduced in to the water by means of fecal contamination, creating a threat for public health and also for the environment. Detection of these contaminants have been difficult due to the high cost and time needed for analysis, however, as an alternative, microbiological indicators have been used for this purpose, although they cannot differentiate between human or animal source contamination because they are part of the digestive tract for both. To determine and differentiate the source of contamination it has been proposed the use of chemical, microbiological and molecular markers which can have geographical specificity. The aim of this study was to

Page 61 of 99

select microbial and molecular markers that are useful to differentiate the source of fecal pollution in the Bogotá river; and to use them as tools for the evaluation and monitoring of the origin of discharges and quality control of the water. Additionally, to existing microbial source markers, a phage host strain that differentiates porcine contamination was isolated from porcine intestinal content. The strain was identified biochemically using the kit API20A and genotypically by amplifying and sequencing 16sRNA gene as Bacteroides fragilis. The strain was evaluated using water samples from bovine and porcine slaughterhouse wastewaters, raw municipal wastewaters and Bogotá river. Beside the isolated strain (PZ8), we evaluated non-discriminating indicators of fecal contamination such as total coliforms, Escherichia coli, somatic coliphages and phages infecting strain RYC 2056 of Bacteroides, source tracking markers as phages infecting strains GA17 and CW18 of Bacteroides, and molecular markers of Bifidobacterium adolescentis (ADO) and Bifidobacterium dentium (DEN), and Bacteroidetes HF183F and CF128F. The results obtained indicate that the microbial and molecular markers selected allow for the determination of the source of fecal contamination in the Bogotá river. Characterizing Antibiotic Resistance Genes in a Singapore Wastewater Reclamation Plant Hongjie Chen, National University of Singapore Additional Authors: Hongjie Chen; Charmaine Ng; Thai Hoang Le; Mark Sobsey; Karina Gin Beta-lactam antibiotics constitute the main therapeutic choice for treating infections caused by Gram-negative bacteria in both humans and animals. The selective pressure caused by the use and misuse of these antibiotics has led to an increase of antimicrobial resistance to those compounds over the past twenty years. Today, one of the most important resistance mechanisms in Gram-negative bacteria is the production of enzymes causing resistance to modern expanded-spectrum cephalosporin and carbapenem, mainly extended-spectrum ß-lactamases (ESBLs) and carbapenemases. The spread of ESBL- and carbapenemase-producing bacteria is an emerging global problem. In Singapore, the presence of ESBL and carbapenemase producers and their relevant resistant genes in water environments has not been well investigated. The aim of the present study was (i) to assess the occurrence of ESBL- and carbapenemase-producing strains throughout an urban water network (sewage effluents from two major hospitals and one domestic wastewater treatment plant, four water bodies and four tributaries), (ii) to characterize the isolated strains and (iii) to identify some of the ESBL and carbapenemase genes responsible for the resistance. CHROMagar ESBL and KPC plates were used to rapidly screen for Gram-negative ESBL-producing bacteria and the ones expressing a reduced susceptibility to carbapenems, respectively. The abundance of ESBL- and carbapenemase producers was higher in hospital wastewater in the range of 104-107 CFU/mL. For the rest of the water samples we observed the following concentrations: between 103-104 CFU/mL in the untreated influent from the wastewater treatment plant, between 102-103 CFU/mL in tributaries, and below 100 CFU/mL for treated domestic wastewater, as well as for the water bodies. A total of 94, 99 and 97 bacterial strains were randomly picked from the CHROMagar plates with samples from hospital sewage, domestic sewage and surface waters, respectively. The most abundant resistant pathogens or opportunistic pathogens found in hospital sewage belong to the KEC (Klebsiella, Enterobacter, Citrobacter spp.) group (48%) and the Pseudomonas spp. taxa (27%). The antimicrobial susceptibility profiles of all the isolates was evaluated using the automated Vitek® 2 Compact system. Out of the 66 isolates picked on ESBL and KPC plates with hospital sewage, 100%, 82%, 82% and 76% were resistant to cefazolin, ceftazidime (cephalosporin family), ertapenem and meropenem (carbapenem family), respectively. PCR and sequencing analysis showed that the predominant ß-lactamase genes were bla-SHV (43%) followed by bla-NDM1 (33%), bla-CTX (33%) and bla-KPC (28.5%). Similar data were generated for domestic wastewater before and after treatment as well as for surface waters. This study improves the understanding of the possible route of antimicrobial resistance dissemination and the potential impact on human health. Can We Get E. coli Results Faster from Fluorescence Fluorometry? Elkana Kurgat, The University of Arizona Can We Get E. coli Results Faster from Fluorescence Fluorometry? E. coli densities are used for determining water quality and illness risks in recreational waters. Investigations of tryptophan fluorometry have shown promise for expediently predicting E. coli density. Proteins found in cell walls of the E. coli have shown to fluoresce in the same region as the amino-acid, tryptophan, therefore tryptophan-like fluorescence could be used to measure E. coli in water using a fluorometer. Flurometers emit light at one wavelength and detecting light emitted by the target at another wavelength. It was hypothesized that tryptophan would predict E. coli densities in both Lake Reba and Wilgreen Lake. Between September and April 2015, 48 water samples were collected using Whirl-Pak© bags for E. coli density quantification using EPA method 1603 (Modified m-TEC). Nitrates analysis was performed with Hach® DR890 colorimeter using Cadmium Reduction Method. Total Phosphorus was analyzed with Method 8190, U.S. EPA PhosVer ® with Acid Persulfate Digestion Method with the DR 2800 spectrophotometer. Turner Designed Cyclops Submersible Fluorometer & DataBank Handheld Datalogger/Display Unit collected the tryptophan data. The Relative Fluorescence Units and Millivolts were tested instantaneously at surface waters. From the results, Wilgreen Lake had greater transparency with secchi depth and higher nitrate levels. At Lake Reba, tryptophan signals were stronger and exhibited higher E. coli and phosphorus levels. A Strong association between depth and tryptophan, indicated a relationship between tryptophan levels and E coli. Linear regression analysis, there was a marginal association using the data from the two lakes aggregated, evaluating the predictive capability of tryptophan for E. coli densities. No association was found between tryptophan and E. coli when evaluating individual lakes. Overall, tryptophan levels are indicative of fecal bacteria densities used by health officials issuing swimming advisories and routine monitoring beach water quality instantaneously.

Page 62 of 99

Sustainable Energy Generation through Waste Water: A Case Study of the City of Lagos, Nigeria Timothy Ajayi, Ogun State Institute of Technology Additional Authors: Oluwatosin Ajoke Ajayi; Grace Jadesola Ajayi As Nigeria’s economic capital and commercial nerve centre, the city of Lagos is undergoing speedy urbanization. With an estimated population of over seventeen million people, Lagos is one of the world’s fastest growing cities in the world. One of the prominent natural endowments that has borne the brunt of this rapid expansion is the Lagos Lagoon, a water body that has been used for sewage disposal for more than half a century. The large volume of sewage deposited in the lagoon on a daily basis has escalated due to the rapid growth in the city’s population. Besides adding beauty to the city, the Lagos Lagoon is a veritable source of seafood for Lagosians. As is the case with other sewage-rich, densely-populated cities, the city of Lagos has not fully utilized its bounteous sewage resources to upscale its energy supply needs. Extant studies have pointed to the fact that sewage waste is a key energy source, with 1 kilogramme of dry faecal sludge having a calorific value of 17.3 millijoule. The thrust of this paper is to explicate the repercussions of wanton sewage disposal into the Lagos Lagoon and to highlight the potential which Lagos has to generate massive energy from sewage waste in order to meet its energy challenges. Development of a MALDI-TOF Database for Identification of Drinking Water Bacteria: Drinking Water Library Project Maite Muniesa, University of Barcelona Additional Authors: Cristina Garcia-Aljaro; Anicet R. Blanch; Daniel Toribio; Belén Galofré; Gemma Saucedo; Carles Vilaró; Sonia Fernández; David Baquero; Maria A. Ruvira; Lidia Rodrigo-Torres; M. Carmen Macián; David R. Arahal; Maria J. Pujalte; Rosa Aznar; Francisco Lucena; Laura Sala-Comorera Drinking water management plants ensure drinking water safety based on the use of the traditional microbial indicators according to each country regulations. Nevertheless, drinking water is a complex ecosystem as has been revealed by different metagenomic analyses. The study of how water processing affects these communities could help water management plants to more efficiently manage their plants. Three main methods are used to study the diversity of microbial communities: phenotypic techniques, molecular methods and proteomic methods. Although molecular techniques have shown their potential in microbial ecology, they are expensive and cumbersome, and therefore they cannot be used on a routinely basis. On the other hand, phenotypic methods are excessively time consuming. Among proteomic methods, matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF MS) has proven as an efficient, robust and fast technique for its use in routine analysis, especially in clinical settings. Nevertheless, although bacteria typing by MALDI-TOF MS seem a promising method to replace conventional routine phenotypic methods for the identification of bacteria in drinking water laboratories its use for identification of environmental bacteria is limited by the lack of a suitable mass spectra database. The objective of the Drinking Water Library project is to generate a database of the culturable fraction of bacteria present in drinking water to be used by drinking water laboratories to improve the efficiency in the management of this resource. The participants in this project are a multidisciplinary team involving researchers from the University of Barcelona, the Spanish Type Culture Collection (CECT) and a drinking water utility (Aigües de Barcelona) that supplies drinking water to the metropolitan area of Barcelona. The use of this technique is providing better precision and coverage of the identified species, speed of analysis, low cost and simplicity. The workflow involves: a) the isolation of bacteria from distribution networks and mineral water by plating on R2A Agar and Water ISO media followed by incubation at 22°C for up to 7 days, b) the identification of isolates by MALDI-TOF with current database, c) generation of a MALDI-TOF MS proteomic profile database of non-identified isolates, d) profile clustering and selection of representative isolates, e) identification of isolates by 16S rRNA sequencing and fatty acids (FAME) and other phenotypic tests analysis, f) validation of the database. In summary, a total of 1053 isolates have been isolated and processed so far from bottled mineral water (307), mineral source water (349) and drinking water treatment plant (DWTP) and distribution network (397). Forty-seven percent of the isolates could not be identified at the species level by the current MALDI-TOF MS database, 65% of bottled mineral water, 33% of mineral source water and 52% of isolates of DWTP and distribution network. Biological Control of Toxic Cyanobacteria Luyanda Ndlela, Council for Scientific and Industrial Research More than 60% of water sources in South Africa are eutrophic. Climate change, Africa's vulnerability and water scarcity in South Africa place the occurrence of toxic cyanobacterial blooms at the fore of the country's water related issues. The occurrence of these blooms has similar significance globally. Due to limitations in terms of infrastructure and the energy constraints of some cyanobacteria treatments, the use of more natural methods is favourable in developing countries. This study looks at the use of biological control using bacteria as a control agent and the resulting impacts. Biological control is a common phenomenon with a few bacterial strains known to lyse cyanobacterial cells successfully. This however, does not target the issue of cyanotoxins, which are released into the environment when these cells die. This research aims to look into the control of cyanobacteria, particularly the toxin release and control, using predatory bacteria and the potential environmental impacts on the aquatic ecosystem.

Page 63 of 99

Inactivation of Pseudomonas Aeruginosa by Electrochemical Oxidation Rosa Maria Araujo Boira, University of Barcelona Additional Authors: Carmina Bruguera-Casamada; Ignacio Sirés; Humbert Salvadó; Enric Brillas The effective removal of pathogens and organic pollutants from water by electrochemical advanced oxidation processes (EAOPs) has been examined with growing interest. Many of these studies have been focused on the inactivation of Escherichia coli as process indicator, with much less attention on other hazardous bacteria like Pseudomonas aeruginosa. Most of the infections by this opportunistic pathogen result from contact with contaminated water, either in natural environments or in aquatic facilities. Among the EAOPs, major attention has been paid to electro-oxidation (EO), which involves the degradation of (bio)organic molecules from a contaminated solution either by direct oxidation at the anode surface or by mediated reaction with strong oxidants. In this work, the disinfection of P. aeruginosa has been tested at 33.3 mA cm-2 employing two kinds of anodes: boron-doped diamond (BDD) and IrO2-based or RuO2-based dimensionally stable anode (DSA). Stainless steel was used as cathode and the electrolyses have been performed in Na2SO4, with and without NaCl. Physisorbed hydroxyl radicals M(?OH) formed from anodic water oxidation and active chlorine generated from anodic Cl oxidation were the main oxidizing species in pure Na2SO4 medium and in the presence of NaCl, respectively. A faster inactivation was always found using DSA. In 7 mM Na2SO4, this behavior was associated to the much larger adsorption of the bacteria onto the anode, which accelerates the M(?OH)-mediated oxidation and cleavage of the cells. The inactivation rate was strongly enhanced in 7 mM Na2SO4 1 mM NaCl due to the large oxidation power of active chlorine. The effect of NaCl concentration and current density was examined with BDD and the best performance was obtained in 7 mM Na2SO4 7 mM NaCl at 8.3 mA cm-2, with total inactivation in 2 min. These results show that EO may be an alternative to conventional water disinfection methods. Results of Molecular and Culture-Based Assays to Target Human and Non-Human Faecal Contamination in the River Tagus Silvia Monteiro, University of Brighton and Laboratorio Analises, Instituto Superior Tecnico Additional Authors: James Ebdon; Ricardo Santos; Huw Taylor The existence of faecal contamination in environmental waters constitutes a potential threat to human health. Determining sources of faecal contamination is paramount in assessing associated health risks and implementing remediation measures. Traditional indicators are able to detect faecal contamination but they are unable to determine its origin. This promoted the development of several microbial source tracking methods. This study sought to assess the effectiveness of the various indicators and markers within a catchment-level application. A total of 105 samples were collected at different locations along the River Tagus, for 13 months, and tested for traditional and alternative faecal indicators (EC, intestinal enterococci (IE), and somatic coliphages (SC)). MST markers chosen were GB-124 phages (culture method), human adenovirus (HAdV) and mitochondrial markers for detection of human (HMMit), cattle (CWMit), pig (PigMit) and poultry (PLMit) faecal contamination. HAdV and mitochondrial markers were determined by qPCR. In addition, newly-developed markers for dog and cat faecal contamination were also tested. Results from the catchment study demonstrated that certain sites on the River Tagus are relatively highly impacted by faecal contamination (as indicated by EC, IE and SC concentrations). Moreover, the MST markers revealed that this contamination appears to be not only of human origin, but also originates from a range of other animal sources. The HMMit marker was the most prevalent and was found at the highest mean concentrations, followed by the CWMit marker. The culture-based MST marker (i.e., phages of Bacteroides) was only found in a single sample throughout the study. Two-way ANOVA revealed a correlation between concentrations of non source-specific indicators (and the CWMit marker) and season. Physico-chemical parameters, such as temperature and UV radiation, were found to correlate with levels of CWMit, EC, IE, and SC. Interestingly, rainfall levels were found to be related to concentrations within the river of the PLMit, dog and cat markers. Weak to no correlations were found between non source-specific indicators and the various MST markers. Results from the catchment study indicated that high levels of faecal contamination still exist in several parts of the R. Tagus despite improvements to wastewater treatment. The markers revealed that the study sites were highly impacted by human and bovine contamination. Furthermore, porcine and poultry sources were also commonly detected. However, GB-124 phages were not shown to be a good marker for MST in this particular catchment. Additionally, this catchment study provided further evidence that non-specific faecal indicators were unsuitable for determining the source(s) of contamination in this study. In contrast, the relatively high sensitivity and specificity of mitochondrial DNA markers supported their use as appropriate markers of the origin of faecal contamination in this scenario. Association of Land Use and Beach Closure in the United States

Jianyong Wu, USEPA Additional Author: Laura Jackson Swimming in natural waters (e.g., oceans, lakes, rivers) is one of most popular recreational activities in the United States. However, exposure to pathogens (e.g., Salmonella spp., Shigella spp., Cryptosporidium, Giardia, adenovirus, norovirus) in recreational waters can lead to a variety of adverse health outcomes. To protect public health and reduce the number of outbreaks associated with recreational waters, the BEACH Act

Page 64 of 99

was passed in 2000, which required beach regulators to develop a formal plan to assess beach water quality and to notify the public if recreational waters are unsafe. High levels of microorganisms in water often follow extreme weather events. Besides extreme weather events, the proximity of certain land uses to beaches may also have great influence on beach water quality. Microbial contaminants that lead to beach closures and human illness come mainly from land, either from discrete point sources or from diffuse non-point sources. It is expected that land use will have considerable influence on beach microbial water quality. However, to date, studies on impacts of land use on beach microbial contamination are rare, and few researchers are aware of the relationship between land use and beach closures. In this study, we analyzed beach closure data obtained from 2004 to 2013 for more than 500 beaches in the United States, and examined their associations with land use around beaches in 2006 and 2011. The results show that the number of beach closures due to elevated indicators of health risk is negatively associated with the percentages of forest, barren land, grassland and wetland, while positively associated with the percentages of urban area. The examination of the change of land use and the number of beach closures between 2006 and 2011 indicates that the increase in the number of beach closures is positively associated with the increase in urban (â=1.612, p<0.05) and agricultural area including pasture (â=0.098, p<0.05), but negatively associated with the increase in forest area (â= -1.789, p<0.05). The study suggests that urbanization and agriculture development near beaches have adverse effects on beach microbial water quality, while afforestation may protect beach water quality and reduce the number of beach closures. This abstract has been reviewed and approved by the U.S. Environmental Protection Agency. Its contents do not necessarily reflect the views and policies of the Agency. Coastal Water Surveillance of Pathogenic Enteric Viruses as Complementary Faecal Indicators of Water Quality Management José Manuel Carita Gonçalves, National Institute of Biology, Slovenia Additional Authors: Ion Gutierrez-Aguirre; Mukundh Balasubramanian; Nejc Rački; Kovač Katarina; Matjaz Hren; Maja Ravnikar; Valentina Turk Pollution of coastal waters is a major global problem, since these areas are often recipients of wastewaters and are used for recreation and for aquaculture. Microbial quality of waters has been traditionally assessed by monitoring faecal coliform bacteria (FC), however, several studies showed that the quantification of FC is insufficient to protect human health. One of the main limitations of FC, as indicators of faecal pollution, is their poor relationship with non-bacterial pathogens, in particular with the presence of human viruses. A group of viruses that have significant impact on public health are enteric virus, which are transmitted via faecal-oral route. Rotavirus (RoV) and norovirus (NoV) are among the most prevalent enteric viruses in polluted coastal waters. Estimations indicate that they are the main agents of human viral gastroenteritis worldwide. Due to the low numbers of human viruses in natural waters and their low infection dose (as few as 10 particles), an efficient concentration step is critical for an effective detection. The objective of the present study was to develop a protocol to concentrate RoV and NoV from coastal waters with different salinity concentrations using CIM columns, prior to detection by one-step RT-qPCR. RoV and NoV were further monitored, during a year, along a salinity/pollution gradient, mussel farming areas and recreational swimming, at the Bay of Koper in Slovenia. Our results exhibit that CIM C4 hydrophobic interaction monolithic supports are efficient to bind and concentrate both RoV and NoV, in one step, from water samples. The concentration performance was consistent in seawater and brackish river water. The performed survey showed that RoV and NoV are released into the Bay of Koper, with higher rates close to the wastewater treatment plant discharge of Koper. However, RoV and NoV can be detected at recreational waters and mussel farming areas. This study supports the idea that water bodies that are considered safe based on bacterial concentrations, may still have low, yet infective, concentrations of human viruses. Even if, a universal indicator for fecal pollution is not confirmed, we propose that direct measurement of RoV and NoV can be an important complementary choice when accessing water quality.

Poster Presentations

Tuesday, May 16th Evidence of Poor Sanitation and Hygiene in Urban and Rural Bindura: Counting the Risk of Diarrheal Outbreaks in Zimbabwe Walter Chingwaru, Bindura University of Science Education Additional Authors: Charity Parawira; Prosper Zvenyika; Hilda Tagarira; Nicole Muzvidzwa; Catherine Mafuse; Monica Chikwangwani; Edwina Mashoko; Tasca Chingoto Zimbabwe's population is affected by erratic outbreaks of diarrhea. The first 10 months of 2016 recorded approximately 1720 cases of typhoid. Against this background, access to safe drinking water is increasingly stifled by the failure of many local authorities to cater for the water needs of their citizens. This study aimed to quantify the salient environmental and food-based risk factors for the outbreaks of diarrheal diseases in Bindura, which is arguably a model of Zimbabwe's urban and rural areas. The study assessed the microbial quality, and hence safety, of waters (surface; irrigation; well; borehole and tap), vegetables and air, and household sanitation and hygiene in Bindura. At least 121 cases of diarrhea were reported at health centers in Bindura per month. Microbial quality was generally poor for all waters in Bindura urban and rural

Page 65 of 99

[rural protected wells [(total aerobic viable counts (TAVC): 10˄3 - 10˄5 CFU/mL; E. coli: 10˄2 - 10˄6 CFU/mL), open wells (TAVC: 1.8 x 10˄3 - 2.6 x 10˄5 CFU/mL; E. coli: 3 x 10˄3 - 1.2 x 10˄5 CFU/mL), borehole water (TAVC: 1.1 x 10˄3 - 4.8 x 10˄4 CFU/mL; E. coli: 0 - 3 x 10˄4 CFU/mL), surface irrigation waters (TAVC: 1 x 10˄3 - 2.7 x 10˄7, 0 CFU/100 ml (drinking water) / 10˄3 CFU/100ml (irrigation water), and tap water (TAVC: 10 CFU/mL; E. coli s: 0 CFU/mL)], irrigated vegetables (E. coli: 0 - 1.97 x 10˄7), ready-to-eat fruits and vegetables (RTE-FV) (E. coli: 2 x 10˄3 to 2 x 10˄9 CFU/g) and dust collected within open market (E. coli: 3.3 x 10˄3 to 5.9 x 10˄3 CFU/g). Univariate analysis showed that incidences of diarrhea were significantly associated with poor household sanitation (prevalence ratio (PR) = 1.28; p = 0.038), poor personal hygiene (PR = 1.15; p = 0.03) or consumption of RTE-FV sold within the study area (PR = 1.08; p = 0.045). The Bindura surrounds, including the surface waters (stream/well) and air, and the RTE-FV that the population of Bindura was exposed to were shown to be of poor microbial quality. Open wells and stream waters in both the urban and rural areas posed a significantly greater risk as shown by their high content of fecal contaminants (p < 0.03). Sanitation and personal hygiene were also shown to be poor, especially among the urban poor and rural folks. The multifactorial nature of the diarrheal epidemiology in Bindura, and perhaps other Zimbabwean centers, calls for site specific interventions that ensure improved water and vegetable microbial quality, and household sanitation and hygiene is recommended to avert a looming crisis of diarrheal outbreaks in Bindura. Identifying Norovirus Exclusion Zones in Shellfish Production Areas Through Microbiological Monitoring, Drogue Tracking and Sewage Effluent Tracing: Studies in a Shallow Estuary and a Deep Coastal Embayment David Walker Additional Authors: Gregory Goblick; Ron Lee; Ken Wittamore; David Lees; David Walker The establishment of exclusion zones to provide separation between sewage discharges and shellfish production areas (SPAs) can reduce the risk of shellfish-related illness, particularly for norovirus (NoV). This study developed a sewage dilution-based approach to buffer zones for SPAs with different oceanographic characteristics and shellfish species. Cages with mussels and oysters were placed at different distances from sewage discharges representing varying dilutions in a shallow estuary and in a coastal embayment on the coast of England. Microbiological pollution in the sites was characterised through a monitoring programme for NoV (genogroups I and II) and E. coli. Fluorometers were attached to the shellfish cages to record levels of dye tagged effluent and determine the residence time and dilutions at steady state. Satellite drogue tracking as well as dye tracing by boat were conducted to determine the dispersion of dye tagged effluent within the SPAs. High percentages of samples were NoV-positive during the sampling periods. Effluent circulation patterns and dilutions were compared with NoV and E. coli levels. Linear associations were found between effluent dilution and NoV (R2 = 74%) and E. coli (R2 = 54%) contamination in oysters during the period October-March. The NoV (GI + GII) concentrations predicted by the model at 300:1, 1,000:1 and 5,000:1 dilutions of estuarine water to sewage effluent were 1,200; 600; and 200 copies/g, respectively. The approach used in this study enables understanding of the factors that influence exclusion zones and can be applied with confidence as a control measure for NoV in SPAs. Pathogenic Acanthamoeba in Recreational Water in Salta, Argentina María Mercedes Juárez, INIQUI-CONICET-UNSa Additional Authors: Diego Sanguino Jorquera; Hugo Poma; Verónica Irazusta; Verónica Rajal Free living amoebae (FLA) are ubiquitous microorganisms that cause several pathologies. Some of them are devastating, like keratitis caused by Acanthamoeba or encephalitis caused by Acanthamoeba, Naegleria or Balamuthia. Water is the media that transport the infective elements to the brain or eyes. Then, the use of water for recreational activities can be considered a risk to acquire these diseases. We have studied the presence of FLA in Vaqueros River, Salta, Argentina. This aquatic ambient is used extensively for recreational activities during spring and summer. Water samples (20 L) were collected from four sites along the river, during the dry season (October) and the wet season (December). Later, ultra-filtered through a dialysis membrane to concentrate and the retentate cultured in a Non-Nutrient Agar. We have isolated a total of thirty two strains of FLA from all the environmental samples, by its microscopic morphology. The strains isolated were growth axenically and a 400 bp segment of the 18S genomic DNA was amplified using JDP1 (5′GGCCCAGATCGTTTACCGTGAA3′) y JDP2 (5′TCTCACAAGCTGCTAGGGAGTCA3′) primers for the genotypic classification of Acanthamoeba strains. Last, the PCR products were sequenced. The results showed that from the thirty two strains, only nine were Acanthamoeba. The other strains most likely belonged to the Naegleria genus, because Balamuthia is not able to grow in a culture media rather than in a cell culture. Although most of the FLA isolates were made in the wet season (75%), the Acanthamoeba strains were only found in the dry season. Sequence analysis in these isolates showed high homology between them and strains belonged to T4 genotype strains from the Genbank. Overall, T4 is the predominant genotype in both clinical and environmental samples. The widespread distribution of pathogenic Acanthamoeba T4 across the environmental sources and the increasing number of contact lens wearers, demand more awareness within the public and health professionals as this pathogen is emerging worldwide as a risk for human health. One issue not yet considered, is the ease of growing the Acanthamoeba T4 species, this may be a cause that influences its predominant environmental findings. Comparison of this type of studies with metagenomic analyzes could help answer this question.

Page 66 of 99

Human-Associated Bacteroidetes MST Markers in Communal and Domestic Wastewater and Comparison to Standard/Alternative Indicators of Faecal Pollution René Mayer, TU WIEN Additional Authors: Egle Lukas; Sílvia Bofill-Mas; Georg Reischer; Margit Schade; Xavi Fernandez-Cassi; Alexander Kirschner; Rosina Girones; Matthias Zessner; Regina Sommer; Andreas Farnleitner Human-associated microbial source tracking markers based on intestinal Bacteroidetes populations (hB-MST) are increasingly applied to trace fecal pollution from communal and domestic sewage in water resources. hB-MST are often extending traditional monitoring schemes using standard fecal indicator bacteria (SFIB). Considerable effort has been dedicated to fecal sensitivity and specificity testing of hB-MST assays during recent years. Emphasis has also been put on the efficacy of sampling techniques, DNA extraction, and PCR quantification. Until recently sound information on the occurrence of hB-MST in wastewater regarding the characteristics of the disposal system (size and type of the system), its seasonal variability and relationship to SFIB and alternative indicators (e.g. human-specific JC polyomaviruses, adenoviruses) did not exist. This study presents a detailed investigation of the seasonal occurrence, dynamics, removal and resistance of human-associated genetic Bacteroidetes fecal markers compared with ISO-based SFIB, human-specific viral MST markers and one human-associated Bacteroidetes phage in raw and treated wastewater of municipal and domestic origin. To recover representative results 24-hours integrated auto-sampling procedures at WWTPs were applied and multiplicative standard deviation (s*) was introduced to obtain an appropriate measure of statistical variability for log-normal distributed parameters. Characteristics of five representative municipal wastewater treatment plants (WWTPs) using mechanical and activated sludge treatment and from 8 domestic WWTP from Austria and Germany were studied in detail (connected populations from 3 individuals to 49000). hB-MST were consistently detected in high concentrations in raw (median log10 8.6 marker equivalents (ME) 100 ml-1) and biologically treated wastewater samples (median log10 6.2-6.5 ME 100 ml-1), irrespective of plant size, type and time of the season (n=53-65). HB-MST and SFIB concentrations revealed the same range of statistical variability for raw (s*=2.3-3.0) and treated wastewater (s*=3.7-4.5), with increased variability after treatment. In raw wastewater correlations among microbiological parameters were only detectable between hB-MST, C. perfringens and JC polyomaviruses. Statistical associations amongst microbial parameters increased during wastewater treatment. Two plants with advanced treatment were also investigated, revealing a median 4 log10 reduction of hB-MST in the activated sludge membrane bioreactor, but no reduction of the genetic markers during UV irradiation (254nm). In conclusion, this study highlights the huge potential of human-associated. HB-MST to complement wastewater impact monitoring based on the determination of SFIB for recent fecal pollution events. In addition, human-specific JC polyomaviruses and adenoviruses seem to be a very attractive support if highly specific and more persistent markers are needed to complement the monitoring approach. Evaluation of a Low-Cost Compartment Bag Test to Quantify Hydrogen Sulfide Producing Bacteria in Drinking Water Claire Tipton, UNC Gillings School of Global Public Health Additional Authors: Mark Sobsey; Jill Stewart Tests for detecting hydrogen sulfide (H2S) producing bacteria as fecal indicators have been proposed to assess drinking water safety in low-resource settings. This study compared a semi-quantitative compartment bag test (CBT) to the EPA- and FDA-approved multiple test tube (MTT) method to quantify H2S-producing bacteria in drinking water sources. Both methods used PathoScreen™ medium to detect target bacteria in 60 surface water samples collected from North Carolina drinking water reservoirs. Samples were subjected to paired levels of incubation temperatures (25° C, 35° C) and numbers of incubation days (1, 2, 3). Results indicated there was a significant positive correlation between methods, particularly at 25° C and 2 days incubation (r=0.80). However, the CBT tended to underestimate H2S-producing bacteria concentrations in samples. The CBT shows promise as a microbiological drinking water test for low-resource environments, particularly where quantitative information is preferable to presence/absence results. However, further calibration is recommended to improve test performance. A Loop-Mediated Isothermal Amplification (LAMP) Assay for the Rapid Detection of Enterococcus spp. in Water Roland Martzy, TU Wien, ICC Water & Health Additional Authors: Claudia Kolm; Kurt Brunner; Robert Mach; Rudolf Krska; Hana Sinkovec; Regina Sommer; Andreas Farnleitner; Georg Reischer Molecular detection methods based on quantitative polymerase chain reaction (qPCR) are being used extensively for routine water quality monitoring. However, expensive equipment and computer software are required for their application and the interpretation of the results. To overcome these drawbacks, isothermal amplification methods have recently become a useful alternative to the molecular detection method of qPCR, allowing molecular diagnostics with simple or no instrumentation. The aim of this study was the development of a novel method for the rapid molecular detection of Enterococcus spp. in water by loop-mediated isothermal amplification (LAMP) and its comparison to the qPCR of method 1611 recommended by the US Environmental Protection Agency. The LAMP mechanism that is propelled by the interaction of three primer pairs and a DNA polymerase with strand-displacement activity makes an initial denaturation step obsolete and does not require any temperature changes throughout the 45 minute reaction. Therefore, a simple heating block is sufficient to fulfil the requirements for the

Page 67 of 99

implementation of the Enterococcus LAMP assay that can be completely performed at 64°C. A set of six specific LAMP primers was designed to amplify a diagnostic fragment of the Enterococcus 23S rRNA gene, which is present in several enterococcal species targeted by the reference qPCR. The sensitivity and specificity tests were performed using a set of 30. Optimizing the Performance of a Conventional Water Treatment System: First Application of Quantitative Microbial Risk Assessment in Iran Alireza Mesdaghinia, Institute for Environmental Research (IER), Tehran University of Medical Sciences Additional Authors: Mahdi Hadi; Masud Yunesian; Simin Nasseri; Ramin Nabizadeh Nodehi; Patrick W. M. H. Smeets; Hamidreza Tashauoei; Esfandiar Jalilzadeh Background: Most of water treatment systems in Iran are conventional and highly dependent on chlorine. Improving current systems or adding new technologies for lowering these dependencies may be achievable using risk-assessment-based approaches such as Quantitative Microbial Risk Assessment (QMRA). A QMRA study on Cryptosporidium was conducted to assess the performance of an old treatment plant (Jalaliyeh WTP) producing the drinking water of some urbanized regions of Tehran, Iran. Methods: The infection risk of Cryptosporidium was estimated by incorporating not only its physical reduction but chemical inactivation within treatment system as well. Cryptosporidium was analyzed using EPA 1623.1 method. The density of Cryptosporidium in treated drinking water was estimated by monitoring the pathogen in source, within the system and stochastic modeling of treatment processes. From this, the magnitude of human exposures, the infection risk and the burden of disease were calculated and compared with health-based targets, i.e. one case of infection per 10,000 persons per year or 10-6 DALYs per person per year. Results: The current removal (by pre-settling, coagulation and flocculation, filtration) and inactivation (pre- and post-chlorination) logs of Cryptosporidium were determined to be 2.3 and 0.018, respectively. The estimated infection risk and the burden of disease for age groups of less than 2, 2 to 6, 6 to 16 and older than 16 years were 0.0065, 0.0058, 0.013 and 0.018 cases and 6.53×10-6, 5.83×10-6, 1.30×10-5 and 1.81×10-5 DALYs per person per year, respectively, which are affected by the amount of water consumed. Comparison of these values with targets confirms that the risk for Cryptosporidium exceeds both the infection risk and the DALY target. To manage the excess risk two theoretical scenarios for additional treatment were examined including: (1) UV irradiation with a dose of at least 10 mJ/cm2 after filtration process and (2) Ozonation (at intake point) with a concentration of 0.75 mg/L (Ct=22.5 min.mg/L). For both scenarios the gas chlorine injection at intake point was reduced by half. The removal efficiency of Cryptosporidium may increase to 5.1-log and 5-log by using ozonation and UV irradiation, respectively. Findings show the ozonation or UV irradiation systems seem to overcome the health concerns related to this pathogen. However, selection of these systems depends on other factors such as the cost of technology and its maintenance. Conclusion: As the first QMRA study in Iran, findings confirm this tool is able to identify the vulnerabilities of treatment system and to facilitate decision-making to improve water treatment system performance. We recommend promoting the use and development of QMRA in conventional water treatment systems in Iran to determine the risk from other pathogens for which there is no local data, and to identify treatment performance gaps that need to be filled. Availability and Flows of Regulatory Microbial Water Quality Testing Data in Sub-Saharan Africa Emily Kumpel, University of Massachusetts Amherst Monitoring of drinking water quality by water suppliers and public health surveillance agencies are established practices in many sub-Saharan African (SSA) countries. However, such testing is only efficient if the data are used to manage and improve water safety. Understanding the extent and use of regulated water quality data by these agencies can inform how to best target resources for monitoring. The objectives of this study were to: “Characterize regulatory agencies' monitoring of microbial drinking water quality, including sources, frequency, methods, and results reported in 8 countries in SSA.” Evaluate the systems for conveying information about microbial water quality within institutions and to stakeholders. Methods: Through the Monitoring for Safe Water (MfSW) program, we collected data on water quality testing practices from regulated monitoring agencies (18 water suppliers and 16 public health surveillance agencies) in 8 countries in SSA. Data were collected between 2012-2015 during several stages of MfSW: (1) applications; (2) needs assessments; (3) midterm assessments; and (4) ongoing testing. To apply, agencies submitted a written survey and one year of retrospective water quality data. The needs and midterm assessments consisted of in-person semi-structured interviews and observations. During ongoing testing, agencies tested water quality and submitted water quality data monthly. We then used these data to construct Data Flow Diagrams (DFDs) for each monitoring agency to systematically map information flows from water sample collection through reporting of results. DFDs were then used to summarize and compare trends within and between institutions. Results: The final dataset meting inclusion criteria included 28,331 tests for fecal indicator bacteria (FIB) collected primarily from piped systems or non-piped improved sources (wells, springs, rainwater tanks). All 26 institutions reported responding to contamination with actions: suppliers primarily verified contamination (resampled, investigated contamination) or mitigated risks (e.g. increased chlorine, flushed pipelines), while surveillance agencies engaged with consumers (e.g. education, public meetings, radio). All monitoring agencies reported water quality results to at least one national-level ministry or regulatory authority. Eight suppliers also reported to upper management and one to a local government unit (LGU) ministry office. Surveillance agencies reported to a variety of groups, including LGUs, health agency managers and staff, non-governmental organizations, or in community meetings. This study documents the extent and scope of water quality information available from monitoring agencies conducting regulated testing, and demonstrates that water quality testing results

Page 68 of 99

are used to manage water safety. Therefore, interventions to improve water quality monitoring in these settings can focus on identifying and levering existing monitoring systems. Effect of High Flow Events on Spatiotemporal Variation of E. coli Concentrations in Creek Sediments Matthew Stocker, USDA - ARS - Environmental Microbial and Food Safety Laboratory Additional Authors: Michael Penrose; Daniel Shelton; Yakov Pachepsky Sediments can harbor large populations of Escherichia coli often times in greater amounts than the overlying water column. Resuspension of sediments during storm events causes the release of E. coli which drastically changes microbial water quality metrics. It is not well known how populations of E. coli in sediments change in the days following high flow events. We created artificial high flow events in a first order creek and measured E. coli concentrations in water and sediment along a 500 m reach of this creek one day prior to, during, and after one, three, six, and 10 days. The experiment was performed in duplicate. Concentrations of E. coli in water remained high several hours after the high flow events despite turbidity and suspended solids returning to baseline levels. Statistical differences were found between concentrations of E. coli in water and sediment samples before and after high flow events. Correlation between mean E. coli concentrations in water and in sediment over all sampling days varied among replications, and was generally high. Application of three spatio-temporal pattern recognition methods showed that the general spatial pattern of variation of sediment E. coli concentrations along the reach was preserved during the whole month of experimentation. Insights gained from this research will help in microbial water quality forecasting. Salmonella Transport through Irrigation Systems and the Risk of Fresh Produce Contamination on Farms in Southern Georgia Debbie Lee, Emory University Additional Authors: Elizabeth Antaki; Moukaram Tertuliano; Casey Harris; George Vellidis; Michele Jay-Russell; Karen Levy On many produce farms in southern Georgia, surface water ponds adjacent to fields are used for irrigation even though Salmonella has regularly been detected in surface water in the region in low concentrations. Salmonella can survive in non-host environments, such as soil and water, which can pose a hazard to produce safety. To evaluate the risk of produce contamination via surface water irrigation, this study evaluated the prevalence of Salmonella in surface water ponds, irrigation systems, and on fresh produce crops at harvest on farms in southern Georgia. Ninety-four water samples (2 L) from irrigation sources (surface water ponds and wells) and irrigation distribution systems (drip irrigation, sprinkler, and pivot), and 65 standardized units of produce were collected. Salmonella concentrations were enumerated using a most probable number (MPN) method. Presumptive positives were confirmed using PCR and isolates were analyzed with pulsed-field gel electrophoresis (PFGE). Salmonella was detected in 29% of irrigation ponds and systems throughout the study, with positive samples ranging in concentration from 0.055 MPN/100 mL to 1.8 MPN/100 mL. Two out of 65 produce samples (cantaloupe and cucumber) were positive for Salmonella, but concentrations were low (1.1 MPN/sample). PFGE analysis indicated 26 distinct pulsotypes present in the samples and that strains found in irrigation ponds were also found in irrigation systems. Strains found on crops were also detected in the irrigation systems, indicating that Salmonella in water from irrigation systems could be a source of produce contamination. Phi6 Persistence in Liquid Media and its Suitability as a Surrogate for Enveloped Viruses Nathalia Aquino de Carvalho, University of Pittsburgh Additional Authors: Elyse Stachler; Nicole Cimabue; Kyle Bibby Recent enveloped virus outbreaks, such as Ebola virus, Coronaviruses (e.g. MERS and SARS), Hantavirus, and Lassa virus have raised questions regarding the appropriate management of infectious patient waste, including wastewater, and the persistence of these viruses in the water environment. The investigation of many enveloped viruses requires biosafety-level (BSL) 3 or 4 handling. It is challenging to work with these pathogens because access to BSL 3 and 4 laboratories is expensive and limited. Consequently, it is desirable to work with agents that do not require access to these specialized facilities. Subsequently, efforts have been made to find appropriate virus surrogates - viruses that mimic the behavior of the pathogen of concern but are not infectious to humans. The bacteriophage Phi6 is a candidate surrogate for enveloped viruses as it has a lipid envelope, requires minimal containment (BSL 1), the analysis is relatively rapid, and the assays are cost-effective. In this study, the bacteriophage Phi6 was evaluated as a surrogate for enveloped waterborne viruses. The persistence of Phi6 was tested in representative aqueous conditions chosen based on previously published studies. Additionally, a regression model for the temperature effect on the persistence of Phi6 in DI water was developed. In order to assess the suitability of Phi6 as a surrogate for enveloped viruses, we also compared Phi6 T90 with the T90 of other enveloped viruses reported in the literature. Our results demonstrated that temperature, biological activity, and matrix composition have a significant effect on the persistence of Phi6. In addition, we found that enveloped virus persistence is widely distributed and the apparent suitability of Phi6 as a surrogate is dependent upon the evaluated condition. To overcome this limitation, it would be necessary to perform persistence studies with other enveloped viruses that could be used as surrogates, or to work with the actual pathogen of interest. Ultimately, further evaluation of enveloped viral surrogate and pathogen persistence is necessary to develop appropriate responses for highly infectious disease outbreaks.

Page 69 of 99

Development of a Sensitive and False-Positive Free PMA-qPCR Viability Assay to Quantify VBNC Escherichia coli and Evaluate Disinfection Performance in Wastewater Effluent Richard Kibbee, Carleton University Additional Author: Banu Örmeci The detection and quantification of viable Escherichia coli cells in wastewater treatment plant effluent is very important as it is the main disinfection efficacy parameter for assessing its public health risk and environmental impact. The aim of this study was to develop a sensitive and false-positive free propidium monoazide-quantitative polymerase chain reaction (PMA-qPCR) assay to quantify the viable but non-culturable (VBNC) E. coli present in secondary wastewater effluent after chlorine disinfection. The qPCR target was the E. coli uidA gene, and native Taq was used to eliminate false positives caused by the presence of contaminant E. coli DNA in recombinant Taq polymerase reagents. Due to issues with qPCR inhibitors in wastewater, this study explored several pre-DNA extraction treatment methods for qPCR inhibitor removal. PMA-qPCR validation was done using salmon testes DNA (Sketa DNA) as an exogenous control added directly to the wastewater samples and amplified using a separate qPCR assay. After disinfection of secondary effluent with 2ppm chlorine at the plant, the mean Log10 CFU reduction in E. coli was 2.85 from a mean CFU of 3.48/10mL compared to 0.21 Log10 CCE mean reduction of the uidA gene from a mean CCE of 3.16/10mL. The VBNC cell concentrations were calculated as 2.32 Log10/10mL by subtracting the colony forming units (CFU) obtained from membrane filtration from the calculated CFU equivalent (CCE) values obtained from PMA-qPCR. These results demonstrate the effective use of a PMA-qPCR method for the quantification of the E. coli uidA gene and indicate there are high numbers (2.01×10³ CCE/100mL) of VBNC E. coli cells leaving the wastewater treatment plant in the final effluent after chlorine treatment. VBNC bacterial cells are of concern as they have the potential to resuscitate and grow, regain virulence, affect natural microbiome in the discharge sites, and pass on antimicrobial resistant genes to other microorganisms. Universal Neutralizer for Common Antimicrobials in Dental Unit Waterline Treatment Products Nicole Beetsch, NSF International Additional Authors: Peri Nelson; Devi J.V. Raghavan; Christine Greene BACKGROUND: The dental industry employs a number of different chemical products to disinfect the water used in dental offices ranging from chlorine to silver ions. Currently, sodium thiosulfate is used to neutralize water treated with chlorine and bromine based products, but it does not neutralize most of the disinfection products used in treating dental water. Dey/Engley (D/E) neutralizing broth has the ability to neutralize a broader spectrum of antimicrobial chemicals including quaternary ammonium compounds and heavy metals. Current methods for testing microbial contamination of dental water do not take into account the range of antimicrobial products used by this industry. Consequently, the water samples are not properly neutralized before testing, resulting in unreliable results. We tested the ability for D/E neutralizing broth to perform as a universal neutralizer for the most commonly used chemicals used by the dental industry. METHODS: We tested the ability for D/E broth to neutralize high concentrations of iodine, silver ions, hydrogen peroxide, citric acid and ascorbic acid, a mix of chlorhexidine gluconate and ethanol, and a sodium chlorite/sodium dichloroisocyanurate dehydrate (SDD) mix in water. ASTM E1054 liquid assay was followed using Staphylococcus aureus ATCC 6538 as the test bacteria and a D/E concentration of 39g/L. RESULTS: The D/E neutralizing broth effectively neutralized all 5 independent replicates of water containing silver ions (Chi-square p<0.0001) as well as those containing the chlorhexidine gluconate and ethanol mix (Chi-square p<0.0001). Testing for the ability of D/E to effectively neutralize hydrogen peroxide, citric acid and ascorbic acid, and a sodium chlorite and SDD mix is underway. CONCLUSIONS: D/E neutralizing broth can be used as a universal neutralizer for the testing of water samples, particularly for water that could have undergone a number of different disinfectant treatments. Verification of Alternate Wavelength UV Disinfection Systems Jovan Lubardic, NSF International Additional Authors: Rob Herman; Robin Bechanko The rapidly evolving technologies of UV disinfection have prompted an inquiry into alternate methods of measuring the effectiveness of these systems. While traditional UV disinfection systems utilize low pressure mercury bulbs that generate a 254nm wavelength, conventional systems have expanded to include alternate wavelengths with broad band, single narrow band and multiple band UV generators. The USEPA Microbiological Purifier Guide Standard is still the baseline for evaluating UV disinfection products for microbiological performance and requires a minimum of 4 log reduction of viruses. The current method of determining whether this reduction was achieved involves correlating the UV dose required to achieve a 4 log reduction of a UV resistant virus to the dose output by the system. Rotavirus was identified as the most resistant common pathogen that was present in water supplies and it requires a minimum of 40 mJ/cm2 at a 254nm wavelength to achieve a 4 log reduction. The use of surrogate organisms is preferred as they are safer to use and easier to analyze. The difficulty is that UV sources do not all emit radiation at the same wavelength. The susceptibility of pathogens and surrogate organisms to inactivation can vary between organisms and is not linear as the UV wavelength varies. Collimated beam studies generate a graph of the organisms? response to increasing

Page 70 of 99

doses of UV radiation. The collimated beam study is dependent on a 254nm source, so the log reductions generated based on the 254nm dose may not correlate the response of the pathogen at the wavelength that the device is inactivating the surrogate organism. Since the established dose (40 mJ/cm2) was generated using data primarily from UV sources at 254nm, this dose will most likely not be relevant at other wavelengths. Our study looks at the effects of wavelengths in the range of 240 - 280nm on rotavirus and a potential surrogate, the phage Q-beta. Four systems were determined to be of interest, a low pressure mercury lamp system (254nm) and three alternate UV wavelength systems with UV peak output at 265, 275 and 285nm. Wavelengths under 240nm that could be generated by broad band and multiple band systems are a concern as they can skew the results of the study so the use of absorbents is required to minimize this effect. PHBA, Acetylsalicylic acid (aspirin), and Superhume have been identified as suitable absorbents that have high absorption values at wavelengths under 240nm. Three test water batches were prepared, all containing Rota and Q-beta and one of the three absorbents. All 4 of the systems were challenged with each of the three test waters and analyzed for rotavirus and Q-beta reduction. A collimated beam study was run on both rotavirus and Q-beta. Results will be presented outlining the suitability of the phage Q-beta as a surrogate of rotavirus, comparing their reductions at each wavelength, as well as the performance of each absorbent. Examining Trends in General Fecal Indicator Bacteria and Microbial Source Tracking Genetic Markers at Non-Point Source Impacted Chicago Beaches Abhilasha Shrestha, University of Illinois at Chicago School of Public Health Additional Authors: Catherine Kelty; Mano Sivaganesan; Orin Shanks; Samuel Dorevitch In the Chicago area, treated wastewater and storm water flow through the engineered Chicago River system to the Mississippi River, with the goal to protect Lake Michigan from urban discharges. Therefore, under dry weather conditions, nearby Lake Michigan recreational beaches should only be impacted by non-point sources of fecal contamination. Nevertheless, many Chicago beaches often exceed United States Environmental Protection Agency (EPA) recommended Beach Action Values (BAV). The goal of this study was to compare paired measurements of general fecal indicator bacteria (FIB) with host-associated genetic markers targeting human, bird, and dog in water samples collected from nine Chicago area recreational beaches to identify trends in non-point source fecal pollution. Surface water samples were collected five days a week over the 2016 beach season (nine beaches tested on 70 days = 630 total samples). Enterococci (EPA Method 1609.1) and E. coli (Colilert®) FIB concentrations were measured for local beach monitoring and public notification. Enterococci analyses resulted in 4.8% advisories (30 of 624 total days sampled) of the EPA recommended BAV of 1000 CCE/100mL, while 21.2% (88 of 416 total days sampled) resulted in exceedance of E. coli BAV recommendations (235 MPN/100mL). A total of 195 samples were selected for microbial source tracking analysis for human (HF183/BacR287, HumM2), canine (DG3, DG37), and avian (GFD) based on enterococci and E. coli BAV advisories. Qualitative analysis indicates that out of the 195 samples tested, 20% (n=39) yield amplification products for HF183/BacR287, 8.2% (n=16) for HumM2, 21.5% (n=42) for DG3, 6.7% (n=13) for DG37 and 55.4% (n=108) for GFD. Initial findings suggest that non-human fecal pollution sources including canine and avian may influence recreational water quality at these Chicago area Great Lakes beaches. Further data analysis will explore potential links between fecal pollution trends and precipitation. Prevalence of Antibiotic-Resistant E. coli in North Carolina Watersheds with and without Swine CAFOs Elizabeth Christenson, University of North Carolina - Chapel Hill Additional Authors: Lindsay Wickersham; Ryan Leighton; Jill Stewart Antibiotic resistance is an increasingly global health concern and a One-Health approach encourages sampling humans, animals, and the environment for antibiotic resistance to understand sources and transport of antibiotic resistant elements. Our objectives are to compare watersheds with different land use characteristics, primarily with respect to swine concentrated animal feeding operations (CAFOs) and wetlands, and their effect on microbial water quality as defined by E. coli concentration and antibiotic susceptibility to 12 antibiotics. Testing surface water for fecal indicator bacteria, such as E. coli, is commonly used as an indicator for fecal pollution and potential human pathogen exposure. Additionally swine CAFOs in North Carolina commonly administer antibiotics to swine which pass into the swine waste, subsequently sprayed onto fields as fertilizer, and may runoff into nearby streams. Thus, we hypothesize that we will find higher prevalence of antibiotic resistant E. coli in water downstream of swine CAFOs compared to background sites. We sample 22 surface water sites representing 13 watersheds with swine CAFOs and 9 background watersheds without swine CAFOs over nine sampling events between September 2016 and August 2017. Watershed areas range between 0.65 and 9.34 square miles. With 44% of sampling completed at time of abstract submission (January 2017), median E. coli concentration is 204 colony forming units (CFU)/100mL (range= 12 - 2,500 CFU/100mL) at swine CAFO sites compared to 104 CFU/100mL (range= 4 - 820 CFU/100mL) at background sites. To date, 115 E. coli isolates from swine CAFO sites and 67 from background sites have been tested for susceptibility to twelve antibiotics using the standard Kirby-Bauer disc diffusion method. Preliminary results indicate that antibiotic resistance to at least one antibiotic is found more frequently at swine CAFO sites (32%, n=37) compared to background sites (6%, n = 4 isolates) with three multi-drug resistant isolates resistant to tetracycline, ampicillin, and ceftriaxone or chloramphenicol identified at two swine CAFO sites over three sampling times. Future work will further test E. coli isolates for carbapenem resistance and extended-spectrum beta-lactamase (ESBL) and AmpC beta-lactamase production. We will also compare prevalence of fecal source tracking genes specific to swine (pig-2-bac) between site types. Additionally, future work will identify conditions (e.g.

Page 71 of 99

precipitation, temperature) associated with elevated microbial measures and allow comparison of watersheds with respect to land use characteristics including wetlands to test for protective effects. Effect of Holding Time on E.coli in Wastewater Samples Debmalya Bhattacharyya, Northeast Ohio Regional Sewer Additional Author: Mark Citriglia, Nichole Schafer The U.S. Environmental Protection Agency (USEPA) defined Escherichia coli (E. coli) as one of the best indicator r organisms to determine the water quality for a number of different water sources including drinking water, waste water effluents, and recreational water. The holding-time for analysis varies based on the type of water being analyzed. Non-potable waters have a holding time of 8-hours while finished potable water allows a holding time of 30-hours. The shorter holding time for non-potable waters can create problems for laboratories analyzing samples for compliance with a Combined Sewer Overflow (CSO) consent decree or additional CSO monitoring as part of an NPDES permit. The Northeast Ohio Regional Sewer District (District) is a large regional water reclamation facility and stormwater utility located in Northeast Ohio. In 2011 the District entered into a Consent Decree with the U.S. Department of Justice, USEPA, and Ohio Environmental Protection Agency to eliminate an estimated four billion gallons of CSO annually, and achieve 98% capture of CSO. The District is required to expand treatment, handle increased flow at all three facilities, along providing treatments to any bypass events. The consent decree and NPDES permit have included monitoring of discharges during these events. One of the major challenges the District had while determining the best way to comply with the CSO consent decree was when and how to sample whenever a wet weather event occurred. Since most wet weather events occurred outside the normal working hours the District decided to evaluate the use of extended holding for samples. Based on prior articles and white papers the District designed a study to determine the viability of longer holding-time of 24-hours or 48-hours instead of 8 hours for samples collected for bacterial analysis. The study included the collection of wastewater influent, primary effluent, final effluent, and final effluent subjected to chlorination and dechlorinating. Samples were collected and analyzed at 8, 12, 24 and 48 hours after collection and stored at <6.0°C. The samples were analyzed using the Collilert? method and EPA method 1603. The data indicates that the holding time had significant reduction of bacterial count in case of raw influent and primary effluent. The samples collected at the treated effluent had a slight elevation in bacterial density however this was not determined to be significant. The samples collected from the raw influent and primary effluent had a significant decrease in bacterial density with the extended holding time. This presentation will outline the data from the holding time study, along with comparison of data between the Colilert? and the EPA 1603 and how this data was used to make decisions on how best perform a two-year wet weather HRT design and implementation strategy. Long-Term Spatial and Temporal Microbial Community Dynamics in Drinking Water Distribution Systems: A South African Case Study. Sarah MacRae, University of Pretoria Additional Authors: Ameet Pinto; Makhosazana Sigudu; Esper Ncube; Stephanus Venter Long-term investigations of spatial and temporal dynamics of microbial community dynamics in full-scale drinking water distribution systems are limited. Such investigations can reveal robust processes, infrastructure, and environmental factors that influence the microbial community, offering opportunities to re-think microbial control in drinking water systems. Often, these insights are lost or are unreliable in short-term studies due to stochastic variabilities inherent to large full-scale systems. In this 2-year study, we investigated the spatial and temporal dynamics of the microbial community in a large, full scale South African drinking water distribution that uses both chlorine and chloramine as primary and secondary disinfectants, respectively. Bulk water samples were collected on a monthly basis at the outlet of the treatment plant and at 17 points in the distribution system spanning nearly 150 kilometres. The bacterial community composition was characterised by Illumina Miseq sequencing of the V4 hypervariable region of the 16S rRNA gene, followed by statistical analyses using Mothur and R. Similar to other studies, Alpha- and Betaproteobacteria dominated the drinking water bacterial communities, with an increase in Betaproteobacteria post-chloramination. Temporal variation was consistently stronger than the spatial changes and demonstrated seasonal cycling, which correlated with changes in the temperature. The observed richness, diversity, and evenness of the bacterial communities were higher in the winter months as opposed to the summer months. In addition to temperature effects, the seasonal variations are also likely to be influenced by changes in average water age in the distribution system and corresponding changes in disinfectant residual concentrations. The spatial dynamics of the bacterial communities also showed distance decay features, with bacterial communities becoming increasingly dissimilar with increasing distance between sampling locations. Interestingly, the spatial effects, likely emerging from effects of biofilms on bulk water community, dampened the temporal changes in bulk water community. Specifically, the extent of temporal change at each sampling location decreased with increasing distance from the treatment plant. This study emphasises the significance of a long-term study to fully understand the temporal and spatial dynamics within a large-scale drinking water distribution system and how the bulk water ecosystem could be affected by environmental factors as well as the microbial community within the system.

Page 72 of 99

Hygienic-Sanitary Evaluation of the Water from Drinking Fountains and Vaporizers in Municipal Parks of the City of Sao Paulo Geyse Aparecida Cardoso dos Santos, University of Sao Paulo Additional Authors: Solange Martone-Rocha; Felipe Candido; Giovanna Santiago; Maria Tereza Pepe Razzolini Urban parks play an important role for recreational functions, helping the improvement of the aesthetic, functional and environmental quality of the city resulting in wellbeing for the population. Currently, in the city of São Paulo there are more than 100 municipal parks, which can contribute to improve air quality, reduce pollution, noise and mild temperatures. Park's visitors, especially children and elderly, use it to practice physical activities, recreation, groups gathering and other activities; so these spaces have offered a democratic environment. So, these spaces must provide appropriate conditions for the park goers as to water with adequate quality to meet physiological needs. It´s worthy to say that there are vaporizers in these parks, which are used, especially, by children to refresh. Water from drinking fountains and vaporizers located in the municipal parks is provided by the public water supply network. Considering the importance of these public spaces, the aim of this study was to evaluate the water quality of from drinking fountains and vaporizers in three municipal parks located in the city of São Paulo. For a seven-month period, Escherichia coli, Staphylococcus sp. (coagulase positive), Pseudomonas aeruginosa and HPC were analyzed. Water samples from drinking water fountains (122) were analyzed according to the Standard Methods for the Examination of Water and Wastewater (22nd, 2012) and samples from vaporizers (84) were analyzed according to Health Surveillance Agency (ANVISA 2013). Out of 122 water samples Staphylococcus coagulase positive was present in 31.2% of showing slight variation within the parks studied while in the vaporizers samples the frequency was 7.7%. As Staphylococcus genus is responsible for the second largest number of infections in humans, these results highlight the importance to investigate and control their presence in both this urban equipment. E.coli and P. aeruginosa were not found neither in water samples nor in the vaporizers, which is a surprising result. For water samples HPC results did not overpass 500 CFU/mL, which is a standard limit for Brazilian legislation. The future perspective is to identify the specie of Staphylococcus strains isolated and antibiotic resistance of them. These results reveal that this urban equipment must be monitored constantly in order to control microbial contamination and then protect park users health. Linking Fecal Indicators, Microbial Source Tracking Markers and Pathogens to Characterize an Urban Stretch of the Danube River at Vienna as a Water Resource Katalin Demeter, TU Wien, ICC Water & Health Additional Authors: Rita Linke; Simone Ixenmaier; Rene Mayer; Regina Sommer; Gerhard Lindner; Alexander Kirschner; Christa Zoufal-Hruza; Christina Frick; Julia Derx; Alfred Paul Blaschke; Andreas Farnleitner Comprehensive management of drinking water resources requires a catchment-to-tap principle. It is therefore fundamental to gain a deep understanding of the spatial and temporal dynamics of fecal pollution within the catchment. Riverbank filtrate of the Danube, second largest river in Europe, serves as the alternative drinking water resource for the City of Vienna (Austria, 1.8 million inhabitants). Since numerous pressures affect the Danube during its course to Vienna, the characterization of its water quality requires a complex set of tools as well as an extensive spatial and temporal monitoring. Here we present the comprehensive characterization of the microbial water quality of the Viennese Danube stretch. Five surface water sampling sites were selected to cover the spatial heterogeneity of this river section. Additionally, samples were taken from major wastewater treatment plants in the greater area of Vienna. Standard and alternative fecal indicators (E. coli, enterococci, Clostridium perfringens, somatic coliphages), genetic microbial source tracking markers (human-, ruminant- and pig-associated Bacteroidetes markers), pathogens (enteric viruses) as well as physicochemical parameters were monitored monthly over a five-year period (2011-2016) to determine the characteristics of the raw water resource. Statistical analysis of this multi-parametric data set revealed complex temporal and spatial patterns and offered an insight into the interplay among the various indicators, markers and pathogens in the environment. Results from this long-term study will also serve as a unique basis for further catchment-based modeling using the QMRAcatch approach [Schijven et al., Journal of Environmental Quality, 44, 5 (2015)]. Analysis of current and future pollution and risk scenarios by QMRAcatch will allow to guide target-oriented remediation efforts in the catchment and to estimate required water treatment levels to provide safe drinking water. This is a joint publication within the Interuniversity Cooperation Centre for Water and Health (www.waterandhealth.at). This study was supported by FWF (Vienna Doctoral Program on Water Resource Systems W1219-N22 and P23900-B22) and the Ground Water Resource Systems (GWRS) project (Vienna Water) as part of the "(New) Danube-Lower Lobau Network Project" (LE07-13). Validation of Quantitative PCR Assays to Detect Fecal Contamination of General, Human, and Poultry Origin in Low-Income Neighborhoods of Urban Maputo, Mozambique David Holcomb, UNC Chapel Hill dditional Author: Jill Stewart Fecal contamination is traditionally assessed by culturing fecal indicator organisms, an approach limited by the time required to obtain results (typically 18+ hours) and the inability to discriminate between fecal sources. Recently developed microbial source tracking (MST) techniques overcome these limitations using real-time polymerase chain reaction (qPCR) to detect host-specific fecal microbe DNA for determining fecal

Page 73 of 99

source, yielding results in a few hours. Because MST targets the gut microbiota, which varies among populations, it is necessary to validate MST assays in each new location to determine whether the selected microbial targets are both present and unique to the intended fecal source in the study area. As part of the Maputo Sanitation (MapSan) trial, an evaluation of a shared, onsite sanitation intervention in semiformal neighborhoods of urban Maputo, Mozambique, we validated eight published MST assays against fecal material collected from MapSan participant households for use in assessing the effect of sanitation on fecal contamination of the domestic environment and its relationship with child enteric infection. We selected open source assays that had been validated in other settings and targeted a variety of genes and microbes. Two general, four human, and two avian fecal-source assays were challenged against the stools of 10 chickens, 13 ducks, 1 dog, 2 pigs, a single stool composite from 6 piglets, and surface sludge from 14 unimproved pit latrines (representing composite, anonymous human-source fecal material). DNA was purified with the FastDNA SPIN Kit for Soils from 500mg of each sample. Reaction mixtures consisted of 12.5uL TaqMan Environmental Master Mix 2.0, 2.5uL 10x primers and probe mixture, and 10uL ten-fold diluted DNA template, for a total reaction volume of 25uL; all reactions were run in duplicate. All assays employed TaqMan probe-based chemistry except the avian assays, which used SYBR Green. Sensitivity, specificity, and accuracy were calculated for each assay. Both general fecal assays, EC23S857 targeting E. coli and BacUni targeting Bacteroidales spp., were relatively sensitive at 87% and 89%, respectively. Of the human-source assays, Mnif, targeting the archaeon M. smithii, was the most accurate (80%), with 71% sensitivity and 84% specificity. HF183, targeting B. dorei, was equally sensitive (71%), but only 71% specific. The human adenovirus assay HAdV was the most specific (90%), but less sensitive (64%). Another human Bacteroidales assay, BacHum, was as accurate as HF183 (71%) but more variable, as it was more specific (84%) but less sensitive (43%). Both avian assays were 100% specific, but only GFD was sensitive (70%); LA35, which was developed for commercial US poultry litter, was 0% sensitive. Ongoing analyses will evaluate assay quantitative performance and assess the predictive value of combining multiple assays through Bayesian analysis to inform selection of MST assays for use in the MapSan trial. Agreement between Quantitative Microbial Risk Assessment and Epidemiology at Low Doses during Waterborne Outbreaks of Protozoan Disease Tucker Burch, USDA-ARS The assumptions underlying quantitative microbial risk assessment (QMRA) are simple, biologically plausible, and conservative towards protecting public health. Nonetheless, disease rates determined by QMRA and epidemiology have never been compared comprehensively at environmentally relevant doses (<< 1 organism). My objective was to compare the two approaches using data from reported waterborne outbreaks of gastrointestinal disease. I screened 2000 papers and identified nine outbreak reports that supplied the necessary data: responsible pathogen, attack rates from cohort studies or laboratory surveillance, and pathogen concentrations measured in the source water. All nine outbreaks involved drinking water; seven were caused by Cryptosporidium and two by Giardia. Reported cyst/oocyst concentrations varied between 0.00003 and 4 per liter, with four of nine values below 0.01 per liter. Crude attack rates varied between 0.0001 and 0.3 cases/person/outbreak. The QMRA accounted for daily drinking water intake, outbreak duration, and used published exponential dose-response models for both organisms. Reported attack rates were adjusted for background rates and reporting bias using published factors; attack rates from retrospective cohort studies and laboratory surveillance were adjusted downwards and upwards, respectively, to account for over- and under-reporting. QMRA predictions correlated well with epidemiological measurements at an order-of-magnitude scale (R² = 0.61 for log-transformed data). For eight of nine data points, QMRA predicted the adjusted attack rate within an average factor of 4.3 (range = 1.6 to 13), while the remaining data point was off by a factor of 280. There was no systematic bias in QMRA predictions compared to epidemiological measurements; QMRA over-predicted attack rates in five of nine cases and under-predicted them in four. These results demonstrate that QMRA and epidemiology can produce equivalent estimates of disease rates for waterborne Cryptosporidium and Giardia. Furthermore, agreement between the two approaches at low doses supports the validity of the assumptions underlying QMRA. Novel Bio-beads of PVA-Alginate Immobilized Marine Yeasts for the Treatment of Shrimp-Processing Effluent Jesitha Salam, Cochin University of Science & Technology Additional Author: Mohamed Hatha Abdullah Shrimp-processing industries produce effluents containing high amounts of salts, organic matter and nitrogen. In order to explore a new treatment process for the simultaneous removal of organic and inorganic load in the shrimp-processing effluent (SPE), a novel system involving marine yeasts immobilized as bio-beads were studied in batch-mode. The marine yeast strains were entrapped in a polyvinyl alcohol-sodium alginate hybrid matrix to stably maintain in the batch culture setups for SPE remediation. Selected proteolytic and chitinolytic marine yeast strains isolated from Arabian Sea sediments were used for the preparation of the bio-beads. The yeast strains were identified as Candida sp. mYJrh9 and Trichosporon sp. mYJrh51 by the molecular homology of the 18S-ITS1-5.8S-ITS2-28S rRNA gene fragment. Bio-treatment of the effluent was performed for a period of 45 days under room temperature. Post treatment, the systems were analyzed for various physico-chemical parameter viz., pH, COD, TDS, TAN, nitrate and nitrite. It was observed that the mixed culture treatment using PVA-alginate bio-beads could remove the initial COD from 1761.21 to 158.5 mg/L along with an 83% reduction in TDS. There was a formation of agglomerates in the treatment flasks, the size of which increased over time and was proportional to the reduction in the suspended solids. The

Page 74 of 99

clarity of the SPE post treatment was comparable to that of clear water. The nitrates in the SPE were reduced by 72% after 45 days. The present investigation shows the ability of a novel bio-bead system for the treatment of high organic load effluents such as SPE. Health-Related Inactivation Requirements for UV Irradiated Waste Water Effluents Discharged to Recreational Surface Waters Regina Sommer, Medical University Vienna, ICC Water & Health, UV-Team Austria Additional Authors: Gerhard Lindner; Georg Hirschmann; Thomas Haider; Alois Schmalwieser Recreational water users can be exposed to a wide range of pathogens, e.g. Campylobacter jejuni, E. coli O157:H7, Giardia intestinalis and norovirus. These pathogens derive from fecal, especially human pollution. Effluents from wastewater treatment plants (WWTP) represent a significant fecal source. Primary and secondary treatment of WWTP are intended to reduce organic carbon, nitrogen and phosphate preventing the eutrophication of receiving waters, but do not diminish the concentrations of microorganisms sufficiently. Thus, the effluents still remain infectious. Disinfection of water serves as most efficient tool to protect human health from infectious diseases. Approved methods include chlorination, ozonation and UV irradiation. Studies observed exposure-response associations between intestinal enterococci and E. coli, commonly used bacterial indicators of fecal contamination in water (FIB), and gastroenteritis among bathers. As a result, intestinal enterococci and E. coli are widely used to monitor and manage the quality of recreational waters (WHO, 2003; EU Directive 2006; US-EPA, 2012). Due to the higher sensitivity of FIB to disinfectants, the presumed relationship between them and pathogen presence is altered. In water receiving disinfected effluents the concentration of FIB may not provide an accurate estimate of the risk for gastrointestinal infections. Therefore, the monitoring of FIB concentrations is not sufficient to assess the performance of disinfection systems of WWTP effluents. So far, no generally accepted requirements for the needed degree of inactivation for waste water disinfection systems exist. We investigated the microbicidal efficacy of a UV system installed in a municipal WWTP. The effluent of the plant is discharged to a lake, which serves as a popular recreational area. The study included the parameters intestinal enterococci, E. coli, coliphages and spores of Clostridium perfringens. The operation conditions of the UV system (flow, UV irradiance) and essential physicochemical water quality parameters (UV transmittance, turbidity, suspended solids, conductivity, total organic carbon) were carefully controlled. Many bacteria (e.g. E. coli, Vibrio cholera) possess the enzyme photolyase, which enables the repair of UV damages of nucleic acids leading to retrieval of infectivity. This may happen, if the delivered UV fluence to the waste water effluent is not sufficient. Thus, we developed a standardized protocol for the investigation of the photoreactivation of bacteria in the effluent samples. The comprehensive multi-parameter approach enabled us to define meaningful microbiological performance targets and appropriate operational parameters for the design, monitoring and assessment of the disinfection efficiency of UV systems for waste water effluents. This is a joint publication within the Interuniversity Cooperation Centre for Water and Health (www.waterandhealth.at) and the UV-Team Austria (www.uv-team-austria.at). Assessing the Possible Human Health Effects from Gold Mining Polluted Water in South Africa and the Importance of Multiple Species Ecotoxicity Testing Maronel Steyn, CSIR Additional Authors: Bettina Genthe; Paul Oberholster; Anna-Maria Botha Bioassays using bacteria for toxicity screening have been applied widely as acute toxicity bioassays to understand the ecotoxicological impact of pollutants on aquatic organisms due to their advantages in simplicity, rapidity, cost-efficiency, and reproducibility. Similarly, in vitro test systems making use of cell lines are widely employed for detection of potential environmental contaminants. This project compared the findings from multispecies toxicity bioassays (Daphnia magna, Allium cepa, Lactuca sativa and Ames Test), with SASS5 scores as well as DNA damage and RNA-seq results in human liver cancer cell lines (HepG2). SASS 5 refers to the South African Scoring System used for rapid bioassessment of river health by sampling and classifying the abundance of macroinvertebrates for rivers and streams at each sampling site. HepG2 cells are a highly differentiated human hepatoma cell line representing a suitable in vitro system for studying (geno)toxicity in humans. The human health impacts of acid mine drainage (AMD) are not well understood and the links between environmental levels of AMD and eventual health outcomes are complex. Water sampling and analysis were done at 7 sites downstream from acid mine drainage decant in the gold mining area of South Africa. Apoptosis, by means of flow cytometry, was used to determine the DNA damage of the cells after exposure to AMD at 30 minutes, 2.5hrs, 24hrs, and 96 hrs. RNA sequencing technology offers an attractive method by which to look globally at the extent to which gene expression is affected by for example carcinogen exposure and may give key insights into its carcinogenic effects. Study results indicate that the improvement in the SASS5 index downstream from the decant site and after pH treatment (e.g., the addition of lime) of the AMD water, did not necessarily match the more sensitive genetic impacts observed in the in vitro test system, indicating possible long term genetic impacts. The same was shown by the mutagenicity for the downstream site. Comparison of the 50 most significantly expressed genes revealed that MT2A, SQSTM1, and APOA were significantly upregulated at the upstream sites (untreated and lime treated decant sites). Overall, significantly expressed genes were mostly associated with neurodegenerative disease and mental retardation which could possibly be traced back to the metal content of the AMD. KEGG pathway enrichment analysis revealed a large number of pathways related to cancer, demonstrating that the environmental pollution by AMD could have far reaching impacts on human health. From the above it is clear that selection of the best battery is important for environmental health impact assessments.

Page 75 of 99

Comparative Performance of a New Method, Legiolert, vs. Standard Methods for the Quantification of Legionella Pneumophila in Potable and Nonpotable Water Samples Daniel Broder, IDEXX Laboratories Legionella pneumophila is a Gram-negative bacterium that is commonly found in both potable and nonpotable water systems, and this species is the primary cause of a severe pneumonia-type illness termed Legionnaires' Disease. A key step in mitigating L. pneumophila risk is to perform routine monitoring to quantify the presence of L. pneumophila, for which there are several methods in routine use internationally. In this study we compared the performance of standard colony counting methods defined by the CDC, Standard Methods for the Examination of Water and Wastewater, or ISO to Legiolert, a chromogenic, quantitative, MPN-based, culture method. Independent field trial data was generated in both North America and Germany. To compare a Legiolert 0.1 mL nonpotable protocol to both the CDC method "Procedures for Recovery of Legionella from the Environment" and method SM9260J for examination of 0.1 mL of nonpotable water, a total of 1063 U.S. nonpotable water samples, predominantly from cooling towers, were analyzed by 2 commercial laboratories yielding 141 positive data pairs. A two-tailed Wilcoxon Signed Rank test revealed no statistical difference(s) (p = 0.249 vs. the CDC method (n=92) and p = 0.728 vs. SM9260J (n=49), both at a significance level of 0.05). A two-tailed t-test also revealed no statistical difference vs. either standard method (p = 0.0749 and p = 0.201, respectively). The combined specificity from both labs was 96.4% (378/392 positive wells confirmed by subculture). To compare a Legiolert 100mL potable water protocol to method ISO-11731-1/2 for examination of 100mL of potable water, 1604 German potable water samples were analyzed by 4 commercial laboratories yielding 290 positive data pairs. Log transformation/mean relative difference analysis as per ISO-17994 methodology revealed better sensitivity for Legiolert (+35.3%) and the specificity was 96.4% (1102/1143 positive wells confirmed by subculture). To compare a Legiolert 10mL potable protocol to method SM9260J for examination of 10-500 mL of potable water, 491 U.S. potable water samples were analyzed by 1 commercial laboratory yielding 74 positive data pairs. A two-tailed Wilcoxon Signed Rank test revealed higher sensitivity (p < 0.0001, significance level = 0.05). A two-tailed t-test showed no statistical difference (p = 0.0749). The specificity was 100.0% (199/199 positive wells confirmed by subculture). In summary, each of the test methods were either equivalent to or less sensitive than Legiolert for L. pneumophila quantification in these water matrices. Legiolert has a counting range of 1-2272 (MPN) compared to petri plates which are ≤ 200 (CFU), requires no secondary confirmation, has a greatly simplified setup, and is highly repeatable and reproducible. Given these characteristics and performance statistics, routine test facilities are encouraged to examine their process to determine whether Legiolert can enhance their throughput and accuracy. Biodegradation of Microcystins in Lake Erie Source Waters and Sand Filters from Drinking-Water Plants Jessica Cicale, U.S. Geological Survey Additional Authors: Christopher Ecker; Erin Stelzer; Dane Reano; Donna Francy Cyanobacteria cause a multitude of water-quality concerns, including the potential to produce cyanotoxins, like microcystin. Treatment methods for reducing microcystins in drinking water, such as adsorption on activated carbon and chlorination, are effective techniques but can elevate costs and result in the formation of toxic by-products. Biodegradation of microcystins remains a promising, environmentally friendly, and cost-effective treatment technique; however, few studies have identified microorganisms possessing an ability to degrade microcystin from impacted environments in the United States. Identifying the presence of microcystin-degrading bacteria from Lake Erie waters and drinking-water plants may lead to incorporation of biodegradation as a control strategy for microcystin removal. Samples were collected to identify the presence of naturally-occurring microcystin-degrading bacteria in source waters and sand filters of 6 drinking-water plants in the Lake Erie Western Basin in Ohio. Laboratory microcosms with these samples spiked with microcystin were used to quantify biodegradation; biodegradation of microcystin, as determined by enzyme-linked immunoassay (ELISA) occurred in many of the samples. Aliquots were taken at various time points over two weeks to identify potential biodegraders by culture methods, ability to form biofilms, and molecular assays for the mlrA gene involved in microcystin cleavage. Individual isolates from microcosms were assessed for their ability to degrade microcystin through development of a high-throughput tetrazole-based colorimetric assay and identified by 16S rRNA gene sequencing. Interestingly, the mlrA gene was not detected in any of the 107 isolates, suggesting Lake Erie isolates possess a different biodegradation pathway than isolates from other regions of the world. Data from ELISA, molecular assays, and other variables are being used to determine if microcystin biodegradation is a viable treatment option for Lake Erie water treatment plants. Although results show potential isolates for use in biodegradation, more data needs to be collected to determine rates of biodegradation of isolates before implementation as a treatment method.

Page 76 of 99

Reducing Excreta-Borne Diseases in Rural Communities in Semi-Arid Climates: Evidence to Support the Formulation of Household 'WASH safety plans' Rather than Drinking Water Safety Plans Mario Rodrigues Peres, University of Brighton Additional Authors: Huw Taylor; James Ebdon; Sarah Purnell By 2050, one in four people may live in a country affected by chronic or recurring fresh water shortages and radical changes are needed to control human waterborne disease in such situations. Investigating how this might be achieved in the Brazilian semi-arid Sertão region - where widespread use of household rainwater harvesting systems has failed to provide safe water and where families rely on irregular supplies of tankered water - may provide strategies that can be applied elsewhere. There is growing evidence that 'water safety planning' (WSP) can minimise human waterborne disease. However, in practice WSP is almost entirely applied to urban water supply networks, rather than to the vulnerable supplies on which many low-income rural communities in arid and semi-arid regions depend. This study focused on ten communities in four municipalities of Paraíba, Brazil. Interviews with stakeholders led to conceptual models of the drinking water supply structure. Faecal indicator bacteria were enumerated at strategic points along the supply chain and semi-structured interviews with householders elucidated how human behaviour influenced the quality of consumed water. Groundwater, surface water and harvested rainwater were the main sources of water. Different sources of water were sometimes mixed within these storage systems. No significant difference was recorded in the median values for the bacterial quality of water from the various storage systems. However, source waters demonstrated significantly higher quality than water from both storage systems and in-house containers. Whereas a significant decrease in the concentration of E. coli was observed in water from in-house containers compared with that from storage systems, no significant difference was observed in levels of intestinal enterococci between these two forms of storage, suggesting that they may survive longer in this setting than E. coli. It is evident that water in both household storage systems and in-house containers may become contaminated because of poor handling practices during its transfer from the storage systems. Lack of hygiene practices (e.g., handwashing) combined with the use of buckets on a rope to collect water from these systems may result in a critical control-point for human pathogen transmission and if this is the case, the provision of improved drinking water may not protect the community from excreta-borne diseases. In conclusion, the findings indicate that in the communities studied (1) household hygiene behaviour may have a greater impact on the quality of consumed water than the quality of the source water. This further suggests that (2) inadequate household hygiene may also cause disease transmission in the home that is not associated with water consumption. From this it can be posited that (3) evidence-based household-level 'WASH safety plans' may present a more effective way to protect human health than traditional water safety planning. Occurrence of Antibiotic Resistant Fecal Indicator Bacteria in Point-Source Polluted Surface Waters Asli Aslan, Georgia Southern University Surface waters often receive wastewater treatment plant effluents (WWTP). These sources contribute to antibiotic levels and promote resistance in the water. The purpose of this study was to compare the occurrence of fecal indicator bacteria in beach water resistant to five commonly utilized antibiotics (tetracycline, ampicillin, sulfamethoxazole, ciprofloxacin, and vancomycin). Samples were collected five times in 2016 from a beach receiving UV disinfected WWTP effluents. Triplicates of diluted influent, secondary effluent, undiluted disinfected effluent and beach water were filtered (100 ml each) through a sterile membrane filtration system. Enterococci were enumerated by using Method 1600 and Escherichia coli by Method 1604. Antibiotic resistant fecal indicator bacteria (ARFIB) were enumerated by culturing a separate set of filters on mI Agar plates with tetracycline, ampicillin, sulfamethoxazole and ciprofloxacin at 37∓ 0.5℃ and mEI Agar with vancomycin at 37∓ 0.5℃ for 24 hrs. The resistance was calculated as percentages. E. coli resistant to sulfamethoxazole was the most commonly detected FIB (12%) at the beach and followed by ampicillin resistant E. coli (10%). Vancomycin-resistant Enterococci was the least detected FIB. The ARFIB concentrations significantly (p<0.05) increased from influent to secondary effluent for ciprofloxacin and tetracycline in all five sampling events, indicating that E. coli gained resistance to these two antibiotics during treatment. This study presents that a WWTP with UV disinfection has been poorly removing ARFIB and contributing to their presence at the beach. A significant percentage (20%) of ampicillin resistant E. coli reached to the beach and exceeded the beach action value. Except for vancomycin, all beach water samples were positive for at least one type of ARFIB throughout the study. Recreational surface waters are at significant risk as antibiotic resistant bacteria may be introduced via point sources. Treatment efficiency of WWTP needs improvement to prevent antibiotic-resistant waterborne diseases among swimmers.

Page 77 of 99

Poster Presentations

Wednesday, May 17th Diurnal Variability and Sources of Coliphage, Enterococci and Non-typhoidal Salmonella in a tidal beach Asli Aslan, Georgia Southern University Additional Author: Jeff Jones Earlier studies presented poor relationships between enterococci and waterborne pathogens and coliphage has been suggested as an alternative fecal indicator. The majority of eastern U.S. beaches have semidiurnal tidal cycles which can influence water quality at various times of the day. The purpose of this study was to compare the hourly and seasonal occurrence of Enterococci, coliphage, and non-typhoidal Salmonella at a tidal beach (JK3) and an adjacent creek (JK1) on Jekyll Island, Georgia. Samples were collected every hour in January and July 2016. Culture methods were utilized to enumerate Enterococci (Method 1600), somatic and male-specific coliphages (Method 1602) and non-typhoidal Salmonella (Method 1200). In-situ collected environmental data (temperature, salinity, pH, dissolved oxygen, turbidity, tide height, and three days of cumulative precipitation) were compared with microbial data. Among all microorganisms, only male-specific coliphage and Enterococci presented a significant correlation (p<0.05) at the beach. Both Enterococci and male-specific coliphage concentrations (1-41 PFU/100 ml) elevated during the day as high tide conditions occur at the beach. Seasonality was only observed within male-specific phage, and their levels were greater in the summer than winter. Tides influenced the somatic coliphage means, and their concentrations decreased from 71±1.8 PFU/100 ml during low tide to 20±5 PFU/100 ml during high tide in the creek. Among environmental factors, water temperature and male-specific phage were significantly correlated (p<0.05). Salmonella as a waterborne pathogenic bacteria was only detectable in the creek (with a maximum of 26 MPN/100 ml) and significantly decreased below detection limits by the time they reach to the beach. Further studies are needed to investigate the relation between enteric viruses and coliphage, and environmental factors affecting phage ecology. This study shows that male-specific coliphage has a potential to be utilized as an alternative indicator at tidal beaches. Numbers of Somatic Coliphages Versus Numbers of Phages Detected by Strain CB390 Andrea Catherine Sánchez-Alfonso Camilo Venegas Barbos, Pontificia Universidad Javeriana Additional Authors: Camilo Venegas Barbos; Luisa Riaño; Paula Castaño; Hugo Diez; Claudia Campos Both somatic and F-specific coliphages have been used in scientific studies for many years as both fecal and viral indicators in different types of water. Regulatory authorities in different areas of the world have already accepted bacteriophages as indicators of water quality criteria and both to validate and verify water treatment processes. Regulations including bacteriophages involve those affecting water reclamation, groundwater and biosolids applied in agriculture. Moreover, the US regulatory authorities are currently studying the application of coliphages in quality control of bathing surface waters (https://www.epa.gov/wqc/ microbialpathogenrecreational-water-quality-criteria). However, some questions remain regarding which of the two groups of coliphages to analyze. Simultaneous detection of both somatic and F-specific coliphages in a single E. coli host would seem a sound option as both are abundant in wastewater, and they respond differently to natural inactivation and treatments. E. coli, strain CB390, has been reported to detect both somatic coliphages and F-specific bacteriophages as efficiently as when they are detected by separate analysis using the standard methods (ISO and USEPA), yet somatic coliphages are the more abundant in the vast majority of settings. Here we present a number of data aimed to validate the adequacy of CB390 (CECT 9198) in Colombia which is a different geographical area than Europe and USA. For it, samples from settings were somatic coliphages have been described elsewhere as predominant were tested for somatic coliphages according to the ISO standardized method (ISO 10705-2) and phages infecting strain CB390 according to Guzmán et al. (Appl. Environ. Microbiol. 74: 531-534; 2008). As an additional control of the level of fecal contamination of the samples E. coli was tested according to ISO 93018-1. Eighty-two samples, with E. coli concentrations ranging from 1.08 to 9.55 log10 units (CFU per 100 ml), corresponding to wastewater from abattoirs slaughtering pigs, raw municipal wastewater and water at different locations of the Bogotá River, before and after receiving the impact of the dumping of the urban conurbation of Bogotá, were tested. The somatic coliphages values ranged from to 0.60 to 8.95 log10 units (CFU per 100 ml) and phages detected by strain CB390 ranged from 0.47 to 8.85 log10 units (CFU per 100 ml). As reported elsewhere in most of the samples (86%) the numbers of somatic coliphages slightly over numbered the numbers of phages infecting strain CB390. But, as described elsewhere the differences were not significant (Students t test, P <0.05). This results validate the use of strain CB390 in Colombia and very likely in South.

Page 78 of 99

Quantification of Giardia, Cryptosporidium and Toxoplasma (oo)cysts in Wastewater for Reuse Veridiana Karmann Bastos, SCHOOL OF PUBLIC HEALTH Additional Authors: Francisca Alzira Peternella; Milena Dropa; Giovanna Santiago; Maria Tereza Pepe Razzolini Facing water crisis requires strategies such as water reuse as sustainable management approach of water resources. Though, health effects of exposure to these waters cannot be ignored. Due to the resistance of infective stages (cysts and oocysts) in the environment, particularly in water, Giardia, Cryptosporidium and T. gondii have received considerable attention because of their roles in waterborne diseases worldwide. Although detection of Giardia and Cryptosporidium is well established, detection and quantification of T.gondii oocyst in water sources it is still a challenge. The aim of this research is to quantify (oo)cysts in reuse water samples from two WWTP in São Paulo city, Brazil, during running a 12 month- monitoring. The samples (30L) are being collected according to method USEPA 1693/USEPA 2014 for the quantification of (oo)cysts of Giardia and Cryptosporidium. All resulting supernant from Giardia/Cryptosporidium analysis was kept for T.gondii analysis. Detection and quantification of T.gondii oocysts will be accomplished by qPCR, targeting B1 gene. A standard curve will be developed by using sporulated suspension of oocysts, in order to quantify number of oocysts based on DNA copies. Partial results from detection of Giardia and Cryptosporidium showed high frequency of limit of detection (LD=0.03 (oo)cyst). Concentrations of Giardia in WWTP 1 samples ranged from LD to 16 cysts/L, while Cryptosporidium ranged from LD to 25.8 oocysts/L. In WWTP 2 Giardia concentrations ranged from LD to 2.6 cysts/L and Cryptosporidium ranged from LD to 2.3 oocysts/L. Regarding T. gondii its concentration will be determined considering 280 copies from B1 gene using a calibrated curve obtained from a known concentration of sporulated suspension, which means 8 sporozoites/oocyst. T. gondii quantification has been challenging to be faced since there is no an established methodology. So, for moving forward there is in need to set a standard curve and an equation in order to determine the concentration of oocysts in water samples. It´s worthy to mention that some issues to tackle. One is the high frequency of LD concentrations of Giardia and Cryptosporidium observed, which demand a more complex way in adjusting data for further evaluation such as risk assessment. These protozoans are well-known causative agents of enteric diseases worldwide and frequently reported as the cause of food or waterborne outbreaks, which means we have to be careful to not underestimate the risk of infection by water reuse. Second is the detection and quantification of T. gondii oocysts in environmental samples that is a great challenge and by developing a qPCR standard curve that allows quantify the oocysts in wastewater samples we hope that this gap can be fulfilled. The authors would like to thank CAPES - Coordination for the Improvement of Higher Education Personnel- for their financial support. Quantitative Metagenomic Approach for Classifying Environmental Reservoirs of Antimicrobial Resistance Emily Crossette, University of Michigan Additional Authors: Lutgarde Raskin; Melissa Duhaime; Krista Wigginton Quantitative PCR (qPCR) and whole-genome sequencing (WGS) are popular tools to detect resistance genes in various environments of interest. WGS coupled with metagenomic analyses can help identify a suite of antimicrobial resistance genes (ARGs) and their relative abundances, sometimes called the 'resistome,' while also revealing information on the microbial community's structure and diversity. qPCR can only target one gene per assay, but the quantitative nature can reveal the dynamics of a particular gene, such as how the absolute abundance of a resistance gene changes throughout a treatment process or over time after land application of municipal solids. Quantitative metagenomics would combine the benefits of WGS and qPCR, providing a high-throughput tool to evaluate the dynamics of the environmental resistome. This study tests a method proposed by Satinsky et al. (2003) to use WGS as a quantitative tool. In brief, internal standard genomic DNA was spiked into sample DNA extracts so that relative gene abundances can be related back to absolute abundances in the original sample. Specifically, in our experiments, DNA extracted from dairy manure samples before and after treatment from three different farms was spiked with genomic DNA from a well-studied marine bacterium and sequenced using Illumina (HiSeq4000) technology. A calibration curve of a sample with different ratios of internal standard DNA to total DNA (0.1%, 1% and 10%) was also sequenced to establish the relationship between internal standard reads and total sample DNA reads. Reads assigned to the internal standard DNA will be compared to the known number of DNA molecules in the internal standard spike in order to convert the relative abundance of genes of interest, e.g., antimicrobial resistance genes, to absolute abundances. The Comprehensive Antimicrobial Resistance Database (CARD) in combination with manual curation will be used to annotate resistance genes based on established homology criteria. Selected resistance genes found in the samples will be quantified using qPCR to validate the quantitative WGS approach. Lastly, read binning by differential coverage and assembly will be performed and used to characterize the microbial community and assign resistance genes to organisms within the community. This study will assess the robustness of a proposed quantitative metagenomic approach and predict key strains harboring relevant antimicrobial resistance genes in a dairy farm setting. This is a critical step to better predict the risk of ARG release into the environment from engineered treatment systems. Satinsky, B. M. et al. 2013. Use of internal standards for quantitative metatranscriptome and metagenome analysis.

Page 79 of 99

Complex Phylogenetic Group Pattern of Escherichia coli from Commensal Human and Wastewater Treatment Plant Isolates Nancy Stoppe, SMS-PMSP Additional Authors: Juliana Silva; Maria Inês Sato; Antonio Saraiva; Laura Maria Ottoboni; Tatiana Torres Escherichia coli is an important microorganism in the gastrointestinal tract of warm-blooded animals. Phylogenetic analysis has showed these bacteria can be classified to four main phylogenetic groups (A, B1, D, and B2), which has been widely used for different purposes including host source relationships. Among the available techniques, Clermont´s phylogenetic grouping is widely used to be simple, fast, and a reliable method for the assignment of E.coli isolates. The method, based on triplex PCR, uses the combination of three loci (chuA, yjaA, and TspE4.C2). The strains were assigned according to the combination of PCR products of the loci chuA, yjaA, and TspE4.C2, as follows: A (-/-/- or -/+/-), B1 (-/-/+), B2 (+/+/- or +/+/+), and D (+/-/- or +/-/+). Commensal populations of E. coli consist of stable genetic isolates, which means that each host has only one phylogenetic group (PG). We evaluated the frequency of human commensal E. coli PGs from 116 people and observed that the majority of isolates belonged to group A. We also evaluated the frequency of PGs in wastewater samples and found a strong positive correlation between the PG distribution in wastewater and human hosts. In order to find out if some factors that could influence the worldwide PG distribution, we evaluated the geographical location, climate, feeding habits, and living area. We performed a meta-analysis of 39 different studies in 24 countries using the following tools: analysis of variance, clustering using Euclidean distance, correspondence analysis, probability distributions model, social network analysis, data mining, and multivariate analysis. Unexpectedly, our results showed no substructuring patterns of PGs; indicating there was no correlation between PG distribution and geographic location, climate, living area, or feeding habits. Risk Assessment of Legionella Infection by the Release from Biofilms in Premise Plumbing Conghui Huang, University of Illinois at Urbana Champaign Legionella is the most frequently reported agent which is responsible for drinking water-associated disease outbreaks. L. pneumophila can be persistent when they are associated with biofilms, a common niche found in drinking water premise plumbing. In this study, a Monte Carlo model simulating the risk of infection based on the number of culturable L. pneumophila released by biofilms grown from groundwater with or without free chlorine or monochloramine exposure. The number of culturable L. pneumophila released over the shower time was estimated from the number of L. pneumophila cells detected in premise plumbing from previous surveys and the time-dependent relationship of culturable L. pneumophila cells released from the biofilms grown from simulated drinking water. This time-dependent relationship was determined by heterotrophic plate count (HPC) for culturable L. pneumophila cells and qPCR for total L. pneumophila cells released when the biofilms were exposed to shear stress. The median risk of infection was the lowest for L. pneumophila released from groundwater biofilms under free chlorine or monochloramine at all time (0.003 or 0.004 per person per year, respectively). The median risk of infection was the highest for L. pneumophila released from groundwater biofilms by groundwater or monochloramine (0.021 or 0.020 per person per year, respectively). Sensitivity analysis revealed that the initial concentration of L. pneumophila cells in premise plumbing was the most important factor, followed by fitting parameters for the time-dependent relationship of L. pneumophila release, partition of L. pneumophila in air and water, deposition of aerosols on lung, dose-response parameter, inhalation rate, and shower time. Shower time had the least impact on risk of infection by L. pneumophila released from the biofilms previously exposed to either free chlorine or monochloramine. The study findings suggested that when L. pneumophila was associated with biofilm, it is essential to maintain residual chlorine-based disinfectant until taps in premise plumbing. Quantification and Genotyping of Cryptosporidium and Giardia from Surface Water Catchment in Sao Paulo, Brazil Bruna Breternitz, University of Sao Paulo Additional Authors: Milena Dropa; Francisca Alzira Pertenella; Maria Tereza Pepe Razzolini; Adelaíde Nardocci Review studies on waterborne outbreaks have been showing that Cryptosporidium parvum and Giardia duodenalis (synonym: G. lamblia and G. intestinalis) are the primarily responsible for the highest number of cases recorded worldwide. Contamination of surface waters catchments by these protozoa is a risk factor to human health because as both parasites are resistant to chlorination, conventional process used for disinfection in water treatment plants (WTP). Although the occurrence of pathogenic protozoa in water for human consumption has been observed in studies in Brazil, identifying the species in aquatic environment is still incipient. In view of this gap, the present study aims to identify species of Cryptosporidium and Giardia recovered from surface water catchments samples from 11 municipalities from the State of São Paulo, totalizing 128 samples. Quantification of both parasites was carried out according to method 1623.1 (USEPA, 2012). In order to genotypic parasites, the recovering of (oo)cysts from slides following USEPA´s protocol by scraping slides and then carry out nested-PCR using the 18S rRNA genes for Cryptosporidium and gdh for Giardia and sequencing. The results showed that the frequency of occurrence of these protozoa at the catchment points was 83.3% for Giardia and 58% for Cryptosporidium. Cysts were present in 10 of 11 catchments points with frequencies varying from 17 to 100% with concentrations ranged from <0.1 (LD-limit of detection) to 17.7 cysts/L, which put in evidence the low quality of water. Oocysts occurred in a frequency from 17 to 50% in positive samples with concentrations ranging from <0.1 (LD) to

Page 80 of 99

11.5 oocysts/L. The following step is to identify the genotypes occurrence. Positive for Giardia and Cryptosporidium stool samples were used as positive control in order to verify the efficiency of the whole PCR process. The results obtained were satisfactory for Cryptospordium but for Giardia there are still some issues to deal with such as definition of primers. Other aspect is the scraping procedure since we are testing using of foam, scalpel, swab and bacteriological loop. Interesting to note that using this technique we will be able to genotyping both protozoa evidencing species which affect human health. Another interesting point is it will be possible to identify the kind of source of contamination according to each area of the study. Financial Support: FAPESP PPSUS 2014/50016-3 Active Bacterial Communities and Opportunistic Pathogens in Chlorinated and Non-Chlorinated Drinking Water Distribution Systems Sallamaari Siponen, National Institute for Health and Welfare Additional Authors: Balamuralikrishna Jayaprakash; Anna-Maria Hokajärvi; Pia Räsänen; Eila Torvinen; Tarja Pitkänen Majority of the microbes in the drinking water distribution systems (DWDS) are expected to be harmless to the human health. However, opportunistic pathogens may colonize DWDS and the severity of potential health risks is dependent on many factors including the microbiome structure and activity in the DWDS water and biofilms. The present study aims to describe the dynamics of the DWDS microbiome, identify the factors that shape the community structures and activity in the selected DWDSs, and learn to control these factors affecting the DWDS microbiome. Large-volume drinking water and warm water, biofilm and water meter deposit samples from five DWDSs were collected. The water originating from two surface water supplies (chlorinated), two artificially recharged groundwater supplies (non-chlorinated) and a groundwater supply (chlorinated) were sampled in four seasons in 2015 using dead-end ultrafiltration. In chlorinated DWDSs, concentrations of <0.02-0.97 mg/l free chlorine were measured. Total nucleic acids were extracted and RNA was further purified and transcribed into its cDNA from a total of 174 water and biofilm samples. Bacterial communities in the DNA and RNA fractions were analysed using Illumina MiSeq sequencing with primer pair 341F-785R targeted to 16S rRNA gene. The sequence libraries were analysed using QIIME pipeline and Program R. The detection of potentially pathogenic species (i.e. Legionella, Mycobacterium and Pseudomonas aeruginosa) was verified using (RT)-qPCR method. In total, 5181 operational taxonomic units (OTUs) were identified, of which 85.7 % were bacterial sequences and 0.6 % archaeal. The rest remained unidentified. Most abundant bacteria belonged to classes Alphaproteobacteria (23.7 %) and Betaproteobacteria (23.3 %). Species richness was higher in samples from two non-disinfected DWDSs (chao1 diversity index mean values of 990 and 1 000) as compared to samples from three disinfected DWDSs (chao1 mean values 190, 460, and 170). The difference in community structures between non-chlorinated and chlorinated water was clear also in the beta-diversity analysis. Not all bacterial cells were active based on their 16S rRNA content, and the species richness in the RNA fraction was lower (chao1 mean value 490) as compared to the DNA fraction (710). Forty-five OTUs of Legionella and 23 of Mycobacterium were detected among the sequences. The (RT)-qPCR confirmed the presence of opportunistic pathogens in the studied DWDSs as Legionella spp. was detected from 83.1 %, Mycobacterium spp. from 94.9 %, and Pseudomonas aeruginosa from 72.5 % of the drinking water samples. Next we will investigate the phylogeny of the detected opportunistic pathogens and identify the factors correlating with bacterial activity and the presence of pathogens. Community structures of other microbial groups, i.e. archaea, fungi, protozoa, and viruses, will also be studied and compared to each other later on in the present study. Could Septic Systems be the Source of Human Fecal Markers in Private Wells in Rural Pennsylvania, USA? Heather Murphy, Temple University Additional Authors: Susan Spencer; Joel Stokdyk; Aaron Firnstahl; Mark Borchardt Background Pennsylvania (PA) has the second highest number of private wells in the US, with 3 million people relying on well water. Private wells are not regulated by the USEPA or any other authority, and thus the burden is on the homeowner to test and treat their water accordingly. Between 1971 and 2008, 30% of all waterborne outbreaks in the US were associated with the consumption of untreated groundwater. PA had the second highest number of outbreaks during this time-period. The CDC recently identified that the burden of disease associated with private wells in the US is unknown and could be significant. Based on previous research, we estimate that there could be 81,000 cases of acute gastrointestinal illnesses per year in PA due to private well water. This research investigated whether septic systems could be impacting the water quality in private wells in rural PA. We also explored the impact rainfall events had on the occurrence of enteric pathogens and indicators in private groundwater supplies. This research will help regulators establish guidelines to support households in the protection of their well water. Methods Five private wells were selected for preliminary study in rural PA. The wells were all located in fractured rock aquifers in Bucks and Montgomery Counties, two counties that have the highest density of private wells and septic systems in the state. Samples were collected every two weeks between May-August 2016 (n=34). Samples were collected for general water quality analysis and for the analysis of E.coli and total coliforms (TC) using culture based techniques. At the time of sampling, large volumes (~800L) of water were filtered using dead- end ultrafiltration. Ultrafilters were sealed in sterile plastic bags and shipped on ice for analysis at the USDA-USGS laboratory in Marshfield, Wisconsin where they were eluted and concentrated using established methods. Concentrated samples were frozen at -80oC until analyzed using RT-qPCR for the following targets: human Bacteroides, human polyomavirus, pepper mild mottle virus, Campylobacter jejuni, Salmonella, enterohemorrhagic E.coli, norovirus GI & GII, adenovirus and enterovirus. Results/Conclusions The wells ranged in depth from 15 to > 700 feet deep. All wells were positive for TC (n=27) and 3 wells for E.coli (n= 9), on at least 2 occasions. All wells

Page 81 of 99

were positive for human Bacteroides on 2 or more sampling events (n=13). Four out of five wells were positive on 1 sampling event for the pepper mild mottle virus and one well was positive for human polyomavirus. Occurrence of human Bacteroides, human polyomavirus and pepper mild mottle virus corresponded with a lag time of 10 days following an extreme rain event in two wells in the same region. The results suggest that septic systems could be the source of contamination in these groundwater wells. Further research will begin in Spring 2017 to understand the temporal variability and and source of contamination in these wells. The Impact of Combined Sewer Overflows (CSOs) on the Presence of Pathogens and Indicator Organisms in Urban Creeks Heather Murphy, Temple University Additional Authors: Shannon McGinnis; Susan Spencer; Aaron Firnstahl; Joel Stokdyk; Mark Borchardt Background CSOs cause contamination of surface water in many urban areas across the United States. During rain events, these systems can overflow and release a mix of stormwater and human sewage into local waterways, which can lead to recreational exposure to pathogens. Due to the complexity and cost of measuring human pathogens in environmental samples, water quality is typically measured using indicator organisms. However, it is widely accepted that the presence of these indicators in the environment do not correlate well with the presence of human pathogens. This study measured the concentration of indicator organisms, human sewage markers, and enteric pathogens in two surface water bodies in the City of Philadelphia that are impacted by CSOs. These data were analyzed to understand the impact of CSO overflow events on the subsequent presence of indicator organisms, sewage markers, and pathogens in the creeks. Methods Samples were collected bi-weekly from May-July 2016 on two creeks in Philadelphia where recreation is known to occur. Samples were collected 7 times from each site. Grab samples (250mL) were collected and analyzed for indicator organisms including E. coli and total coliforms (TC) using culture based techniques. Large volume (200L) water samples were filtered on site using dead-end ultrafiltration with a pre-filter. After collection, filters were sent to the USDA Microbiology lab in Marshfield, Wisconsin for analysis where they were eluted and concentrated prior to DNA/RNA extraction. Samples were analyzed using qPCR for human Bacteroides, human polyomavirus, adenovirus, enterovirus, norovirus GI & GII, Campylobacter jejuni, enterohemorrhagic E. coli, and Salmonella. CSO data was provided by the Philadelphia Water Department and included the total hours of overflow per day at the five closest upstream outlets to each site. Results/ Conclusions All samples (N=14) were above the EPA recreational water recommendations for both E. coli (>126 cfu per 100mL) and TC (>200 cfu per 100mL). Human Bacteroides was detected in all samples (10.6-768.5 gc/ L) and human polyomavirus (1.9-20 gc/ L) was detected in two samples at each site. The most frequently detected human pathogens were Salmonella (n=3) and adenovirus (n=3) followed by enterohemorrhagic E. coli (n=1) and GI norovirus (n=1). Using Spearman Rank correlation, both E. coli and TC had a statistically significant relationship with human Bacteroides (rs= 0.727 and 0.731, respectively). No relationship was observed between human pathogens and indicators. No relationship was observed between CSO events 24 hours, 2 days, 3 days or 7 days prior to sampling and human pathogens, or indicators. This study found that E.coli and TC corresponded with human Bacteroides and human polyomavirus. Human Bacteroides also correlated with CSO overflow data on the day of sampling, suggesting that human Bacteroides may be a better fecal indicator organism than E. coli. Virus Inactivation by Ozone: Kinetics and Influence of Water Quality Parameters Camille Wolf, EPFL Additional Authors: Urs von Gunten; Tamar Kohn Disinfection is an important step in (waste)water treatment to prevent the transmission of waterborne diseases. Ozone is an effective disinfectant against all types of waterborne pathogens, including viruses. While ozone has typically been used to treat drinking water, its application to wastewater (WW) has also been tested. However, in particular for virus inactivation, data regarding its efficacy remain scarce. In Switzerland, a new regulation mandates the upgrade of major WW treatment plants with an advanced treatment step such as ozonation, for the abatement of micropollutants. This measure could also result in the inactivation of enteric viruses, though to an unknown extent. There are many practical limitations to directly monitoring concentration and infectivity of enteric viruses during WW ozonation. However, inactivation may be estimated if the ozone exposure, the virus inactivation rate constants and their susceptibility to environmental parameters (pH, temperature, dissolved organic matter (measured as DOC)) are known. Alternatively, inactivation may be monitored based on an "easy-to-measure" proxy. For example, the decrease in UV254 absorbance (ΔUV254) is indicative of the extent of micropollutant removal during ozonation of WW. ΔUV254 is an indirect measure of the ozone exposure, which in turn, depends on the specific ozone dose (mg O3/mg DOC). Similar proxies may exist for viruses. The objectives of this study were (1) to quantify the second order ozone inactivation rate constants (kO3-Virus) for several enteric viruses and bacteriophages in buffered solutions and assess their dependence on temperature and pH; (2) to assess the influence of DOC on inactivation in differing water matrices; and (3) to test the utility of ΔUV254 as a proxy for inactivation. To determine kO3-Virus in buffered solutions, an experimental system was developed that allows to track ozone exposure and virus inactivation accurately and simultaneously. Experiments were conducted over a temperature range of 2-22° C and a pH range of 6.5-8.5. Due to the relatively fast decay kinetics, ozone exposure in environmental water matrices were determined by a quenched-flow method. The kO3-Virus of all viruses tested spanned a narrow range of 10^5 to 10^6 M-1s-1. Qβ was the most susceptible, and T4 and an environmental isolate of CoxB5 were the most resistant. Interestingly, significant differences in the rate constants of differing CoxB5 isolates and its lab strain were observed. Both pH and temperature increases resulted in higher kO3-Virus values, though the effect of temperature was more pronounced. In buffered solutions, the

Page 82 of 99

ozone exposures to inactivate 99% of viruses were about 100x lower than those reported for ClO2 and free chlorine. Effects of DOC on kO3-Virus and correlations between ΔUV254 and virus inactivation in WW are currently under investigation. Overall, our findings demonstrate that ozone is an effective disinfectant for viruses in WW effluent. Infectivity of Human Norovirus through Water Reuse Disinfection Processes Nicole Rockey, The University of Michigan - Ann Arbor Additional Authors: Christiane Wobus; Tamar Kohn; Lutgarde Raskin; Krista Wigginton Direct potable reuse (DPR) is gaining interest in water-scarce and water-conscious regions of the world as a technology capable of treating domestic wastewater to potable water standards. Because wastewater is the source water of such treatment schemes, the removal of biological and chemical contaminants present in wastewater is necessary. One of the primary challenges for water reuse applications is the effective removal of pathogens. Although no national regulations currently exist in the United States for pathogen removal, states moving towards DPR schemes have developed minimum pathogen removal levels to keep the yearly risk of infection at or below 10^-4 in finished water. Of the viral pathogens of interest in DPR, human norovirus (HuNoV) is of principal concern because of its large burden of disease (19 to 21 million cases of acute gastroenteritis per year in the United States) and ubiquitous presence in wastewater. Yet much is still unknown regarding infective norovirus levels through DPR treatment trains. Because there are currently no readily accessible methods to quantify infective HuNoV through DPR processes, the fate of other enteric viruses or surrogates has been used to approximate HuNoV removal. Reduction in norovirus genome concentration has also been applied for this purpose. These approaches are not ideal because in each case, infectious HuNoV levels may be incorrect. To mitigate public health risk, more accurate inactivation data for HuNoV are necessary to ascertain appropriate virus removal is achieved through DPR. In this study, we will assess the inactivation of HuNoV during disinfection processes, including chlorine, ozone, and UV, using a novel HuNoV infectivity assay. Host cells will be infected with HuNoV taken from inactivation experiments. Reverse transcription quantitative PCR (RT-qPCR) will be used to quantify HuNoV gene copies at 0 and 3 days’ post infection to determine the change in HuNoV infectivity after various levels of disinfection. Simultaneously, the reduction in RNA signal through treatment will be assessed to obtain a relationship between infectivity and qPCR disinfection kinetics. With this relationship, other laboratories should be able to track HuNoV inactivation with qPCR methods. Proof of concept experiments have demonstrated decreased RNA amplification in cells infected with virus samples from increasing UV254 doses. Results from our ongoing experiments will be presented in which we link amplified RNA levels in host cells with infective virus concentrations in disinfected samples. By carrying out inactivation experiments and correlating results with reduction in RT-qPCR signal through disinfection, this work will address the current gaps in HuNoV inactivation and allow DPR utilities to more effectively monitor for infective virus through treatment. The research will also help address concerns that current removal guidelines are too conservative or not conservative enough. Simultaneous Measurement of Genetic Fecal Indicators in Water Column and Periphyton Biofilms in Artificial Streams Orin Shanks, US EPA Additional Authors: Xiang Li; Lindsay Peed; Catherine Kelty; Christopher Neitch; Mano Sivaganesan Periphyton is a complex mixture of algae, heterotrophic microbes, fine inorganic sediment, and detritus that are attached to submerged surfaces in most flowing freshwater systems. These communities are known to absorb many pollutants, resulting in improved water quality. However, it remains unknown whether these natural biofilms can sequester genetic fecal indicators from the water column. An indoor mesocosm study was conducted at the U.S. Environmental Protection Agency Experimental Stream Facility to simultaneously measure genetic fecal indicators in the water column and associated periphyton biofilms when subject to wastewater point source loading. The experiment was conducted over 16-weeks and organized into colonization and wastewater loading periods. To simulate point-source wastewater loading, treated sewage effluent from an adjacent facility was pumped directly into mesocosms. Inflow and overflow surface water grabs were paired with the collection of periphyton samples on a weekly basis. Samples were analyzed with five genetic fecal indicator qPCR assays targeting E. coli (EC23S857), enterococci (Entero1a), and Bacteroidales (GenBac3), as well as human host-associated fecal pollution (HF183 and HumM2). In addition, total suspended solids (water column) and total biotic mass (periphyton) were measured. During sewage loading, genetic indicators were detected at frequencies up to 100% (EC23S857, Entero1a, and GenBac3), 56.3% (HF183), and 37.5% (HumM2) in periphyton confirming sequestration from the water column. Net flux shifts in water column genetic indicator concentrations further supported potential interactions under most test conditions. In addition, positive correlations were observed between periphyton biotic mass and genetic indicators ranging from r = 0.63 (Entero1a) to r = 0.83 (GenBac3). Overall, findings support the notion that genetic indicators suspended in the water column can be absorbed by periphyton biofilms suggesting that the benthos environment in flowing freshwater systems is an important factor to consider for water quality management.

Page 83 of 99

Changes on the Bacterial Populations of Water Processing in a Paper Mill and Their Potential Effects on Microbial Quality and Safety in Wastewater Effluents Anicet Blanch, University of Barcelona Additional Authors: Laura Sala-Comorera; Francisco Lucena; Cristina García-Aljaro There is an open discussion about the effects of paper mill effluents when discharged into the environment as a potential pollution source of the receiving waters. The presence or increase of coliform and particularly high numbers of Escherichia coli have been suggested as usual in pulp and paper mill effluents and biosolids. Their presence in paper mill effluents could concern water quality and safety when discharged on waterbodies later used for other activities (shellfish culture, recreational areas, fishing, reclaimed water...). Consequently, the determination of the bacterial population changes in water processing at paper mills and the possible presence, regrowth/increase of certain bacterial indicators such as E. coli and particularly the possible presence of enterotoxigenic strains is essential to assess their associated risk. In this study, the composition and structure of fecal coliforms and enterococci, the enumeration of E. coli and the presence of enterotoxigenic strains have been evaluated in different sampling sites along the water processing in a paper mill. Bacterial populations were enumerated by using ISO standard methods and a representative number of fecal coliforms and enterococci were isolated for further characterization and biodiversity analysis based on the biochemical phenotyping by the Phene Plate System. The enumeration of total and cultivable E. coli was determined using a specific qPCR and the traditional ISO standardized culture method, respectively. The presence of 4 genes coding for 4 toxins (Shiga toxin 1, Shiga toxin 2, heat labile toxin and thermostable toxin) was analyzed by conventional PCR. These genes are mainly responsible of the enterotoxic character of some E. coli and other fecal enterobacteria. In all samples analyzed, a high diversity of fecal coliforms and enterococci was detected. These populations present changes in composition and structure at the different stages of water processing. However, they were more similar between those presented in input and output (treated effluents) waters than those associated to raw wastewater coming from the paper mill activity. A concentration of cultivable E. coli around 2 log units is detected in all analyzed samples. The concentrations of E. coli measured by qPCR correspond to the values found by culture analysis being slightly higher since the inactivated and non-cultivable E. coli molecular targets are detected at the same time and can be considered as total E. coli (viable, non-viable and non-cultivable). No positive result was detected for the toxins tested in bacterial populations at any of the sampling points. Consequently, although changes on the fecal coliforms and enterococci populations were observed at the different sampling sites of the studied paper mill water processing, wastewater effluents do not present an increase of E. coli and do not contain common microbial pathogens (enterotoxigenic strains) which could be a health hazard. Biodegradation of Microcystins in Lake Erie Source Waters and Sand Filters from Drinking-Water Plants Jessica Cicale, U.S. Geological Survey Additional Authors: Christopher Ecker; Erin Stelzer; Dane Reano; Donna Francy Cyanobacteria cause a multitude of water-quality concerns, including the potential to produce cyanotoxins, like microcystin. Treatment methods for reducing microcystins in drinking water, such as adsorption on activated carbon and chlorination, are effective techniques but can elevate costs and result in the formation of toxic by-products. Biodegradation of microcystins remains a promising, environmentally friendly, and cost-effective treatment technique; however, few studies have identified microorganisms possessing an ability to degrade microcystin from impacted environments in the United States. Identifying the presence of microcystin-degrading bacteria from Lake Erie waters and drinking-water plants may lead to incorporation of biodegradation as a control strategy for microcystin removal. Samples were collected to identify the presence of naturally-occurring microcystin-degrading bacteria in source waters and sand filters of 6 drinking-water plants in the Lake Erie Western Basin in Ohio. Laboratory microcosms with these samples spiked with microcystin were used to quantify biodegradation; biodegradation of microcystin, as determined by enzyme-linked immunoassay (ELISA) occurred in many of the samples. Aliquots were taken at various time points over two weeks to identify potential biodegraders by culture methods, ability to form biofilms, and molecular assays for the mlrA gene involved in microcystin cleavage. Individual isolates from microcosms were assessed for their ability to degrade microcystin through development of a high-throughput tetrazole-based colorimetric assay and identified by 16S rRNA gene sequencing. Interestingly, the mlrA gene was not detected in any of the 107 isolates, suggesting Lake Erie isolates possess a different biodegradation pathway than isolates from other regions of the world. Data from ELISA, molecular assays, and other variables are being used to determine if microcystin biodegradation is a viable treatment option for Lake Erie water treatment plants. Although results show potential isolates for use in biodegradation, more data needs to be collected to determine rates of biodegradation of isolates before implementation as a treatment method.

Page 84 of 99

Diversity of Adenovirus in Recreational Waters in Southern Brazil Caroline Rigotto, Feevale University Additional Authors: Viviane Girardi; Meriane Demoliner; Vania Schneider; Suelen Paesi; Fernando Spilki The recreation practice in contaminated water may be associated with the transmission of waterborne diseases. In Brazil, water quality parameters are predetermined by bacterial agents such as total coliforms (CT) and Escherichia coli. However, such analyzes have been shown to be inefficient, since they do not reveal the contamination by other pathogens such as enteric viruses, as human adenoviruses (HAdV). AdV is one of the most diverse group that can cause several diseases, such as respiratory, conjunctivitis and gastrointestinal infections. The objective of the present work was to evaluate the diversity of AdV and the presence of bacteria coliform group along the Arroio Belo, that is a stream crossing the city of Caxias do Sul / RS- Brazil, located in the mountains and frequently used as a recreational area, specially for bathing in the summer time. Samples were collected monthly from May 2015 to April 2016 along the Arroio Belo in four distinct sites: P1 and P2 located in the urban region, P3 in the rural region and P4 in the recreational area. Tests for the detection of total coliforms (TC) and Escherichia coli were performed by the Colilert substrate enzyme method (Iddex, USA) following the manufacturer's instructions. Virus concentration was performed by the ultracentrifugation protocol. The viral DNA was extracted from the pre-concentrated samples by means of the BioPur® Kit, according to the manufacturer. To evaluate the presence of different AdV species, a partial sequence of the DNA polymerase gene was amplified by the nested polymerase chain reaction (Nested-PCR), then positive samples were analyzed by sequencing. In a total of 47 samples evaluated, AdV was detected in 44% of samples, and the following species were identified: HAdV: C (2; 4.2%), D (6; 12.7%), E (2; 4.2%) and F 9, 19.1%). AdV from other hosts were also found, including bovine adenovirus (1; 2.1%) and murine adenovirus (1; 2.1%). Thus, in the comparison of AdV species found, the most prevalent species was the one belonging to the F group. All samples were positive for the bacterial analyzes, highlighting that at least one month P1 and P3 exceeded the detection limits of the method for both tests of E. coli and TC. Thus, based on these results, all points would be considered inappropriate for bathing by the Brazilian regulation - CONAMA Resolution 274, dated November 29, 2000. The detection of TC, E. coli and AdV along the study stream reveals the fecal contamination and shows the inefficiency or absence of sewage treatment processes suitable for the removal of these pathogens. Since part of this stream is used for leisure and recreation, this contamination can put the exposed population at risk. Quantification of Toxoplasma Gondii in Source Water Samples from São Paulo State, Brazil Ana Tereza Galvani, CETESB - São Paulo State Environmental Company, Brazil Additional Authors: Maria Inês Zanoli Sato; Mikaela Renata Funada Barbosa; Ana Paula Christ; Josè Antonio Padula; Maria Tereza Pepe Razzolini Introduction-Water has been considered a relevant vehicle for the occurrence of toxoplasmosis' outbreaks. In the water environment, T.gondii oocysts may remain for a long time and are resistant to chemical inactivation, including the usual disinfection procedures in water treatment. In Brazil, few reports have been published about the real extent of the contamination of water sources by T.gondii, which is of major importance to implement preventive actions. Currently methods for the recovery, identification and quantification of the parasite in water bodies are not standardized and have limitations. Objectives-This study aimed to implement a method to determine the occurrence and densities of T.gondii in surface waters used for drinking water supplies in São Paulo State (Brazil). Method-Ten public water supplies were monitored every two months during May to December 2015. Volumes of 20L of surface water were concentrated with Envirocheck® HV capsule according to USEPA 1623.1/2012. DNA was extracted from the yielded pellet with PowerSoil DNA isolation® extraction kit. A fragment of 62 b p of the B1 gene was selected as target sequence for detection and quantitation of T.gondii DNA by qPCR. The primers 5'TAGTATCGTGCGGCAATGTG3' (531-551) and 5'GGCAGCGTCTCTTCCTCTTTT3' (571-592), and the probe 5'(6-FAM) CCACCTCGCCTCTTGG-(NFQ-MGB) 3' were used. Standard curves were built from synthetic DNA (gBlocks®). Ultrapure water and the water samples were spiked with a known amount of oocysts to determine the initial and matrix recovery. PCR inhibitors were evaluated testing DNA dilutions of spiked samples. Results and conclusions-The average recovery efficiency in ultrapure water was 48.5% whilein surface water samples the maximum rate was 8.9%. Although there was no evidence of PCR inhibitors in the samples, the recovery results indicated that the selected concentration and purification methods can be influenced by the surface water matrix, which should be considered in future environmental monitoring. T.gondii was detected in 30% (3/10) of the sites evaluated, and in 7.7% (3/39) of all samples analyzed. Number of genomic copies varied from 1.28x102 to 1.79x104 /L. The positive results were obtained in the rainy season during November or December, indicating that the increase in T.gondii contamination may be attributed to high rainfall and runoff. Although further research is required to elucidate the effect of seasonality on the detection of T. gondii in water, and the routine methods for monitoring the parasite must be optimized to increase the recovery rates of this protozoan in environmental samples, the present study demonstrated the occurrence of T.gondii in drinking water sources of the State of São Paulo. Considering that waterborne toxoplasmosis presents a threat to public health and drinking water quality, T.gondii monitoring results could be important to understand the circulation of parasite and minimize the waterborne transmission of the disease.

Page 85 of 99

Microbiological Health Risks in Drinking Water After Artificial Ground Water Recharge Process Anna-Maria Hokajärvi, The National Institute for Health and Welfare (THL) Additional Authors: Päivi Meriläinen; Tarja Pitkänen; Ari Kauppinen; Ilkka Miettinen Artificial groundwater recharge (AGR) using surface water as raw water is an increasing method to produce drinking water to the communities. The raw water quality is an issue since surface water resources are typically recipients of municipal or industrial waste waters and loads from catchment area. Sewage overflows, draught and floods are the most typical situations causing raw water quality problems and subsequently may pose a risk to human health. The river water of the Kokemäenjoki River water course in southwestern part of Finland is used for AGR after pre-treatment using combined flotation and sand filtration. AGR is done at Virttaankangas esker and the produced drinking water serves population of 300 000 inhabitants in Turku region. A predictive Monte Carlo Quantitative Microbial Risk Assessment (QMRA) method was applied to estimate the probability of infection via drinking water consumption using Analytica software. The estimation was based on prior empirical studies on the fate of pathogens such as noroviruses, Campylobacter spp. and Salmonella spp. in the Kokemäenjoki River water course and during AGR. Both measured and modelled microbe counts in the river water were used as an input data in QMRA. The microbial removal efficiency of pre-treatment, AGR and chloramine disinfection was assessed based on existing literature. Further, dose-response values from literature were utilized to assess the probability of infection and number of illness cases. In addition to business as usual (BAU) situation, several scenarios including extreme water flow and accidental sewage spill scenarios were assessed. Noroviruses, Campylobacter spp. and Salmonella spp. were examined separately taking into account species level information in the raw water uptake site. As a result from the health risk assessment, only the most severe contamination scenario, direct sewage spill into the raw water source, caused on average 53 (min:0; max:5988) gastrointestinal illness cases per day among the water consumers when the retention time in the AGR process was not taken into account. Most illness cases were caused by noroviruses but also Campylobacter spp. was a notable pathogen. In the BAU scenario, the removal efficiency of drinking water production process was proved to secure the good microbiological quality of the drinking water produced. The present study provided valuable information for knowledge-based decision-making at the waterworks and at the municipal and regional level. The QMRA estimations were successfully applied for risk management purposes. During the project, a decision to add UV disinfection to the treatment process was made. Furthermore, there are plans to improve the upstream river water quality by centralizing the municipal waste water treatment. When evaluating the effects of different risk scenarios of the raw water, the measures to minimize the drinking waterborne health risks of drinking water consumers can be tested. Poikilothermic Animals as a Previously Unrecognized Source of Fecal Indicator Bacteria Katalin Demeter, TU Wien, ICC Water & Health Additional Authors: Julia Vierheilig; Horst Zornig; Roswitha Antensteiner; Christian Baumgartner; Christian Bucher; Alfred Blaschke; Julia Derx; Alexander Kirschner; Gabriela Ryzinska-Paier; René Mayer; Dagmar Seidl; Theodossia Nadiotis-Tsaka; Regina Sommer; Andreas Farnleitner, Christina Frick Microbiological water quality monitoring is strongly dependent on standard fecal indicator bacteria (SFIB). However, the usefulness of SFIB as an indicator has been increasingly questioned following the discovery of so-called "naturalized populations". For a better understanding of all potential sources of SFIB in the environment, comparative investigations including all suspected non-biotic and biotic compartments are needed. So far, there was no quantitative and comprehensive study including all potential SFIB sources in a defined study area. The aim of this study was to allow a systematic quantitative comparison between animal sources reflecting the zoological diversity of the study area, an alluvial backwater area in eastern Austria. Fecal samples (n=189) from abundant wild homeothermic (ruminants, wild boars, carnivores, birds) and poikilothermic animals (earthworms, gastropods, frogs, fish) and surrounding soils (n=44) and sediments (n=45) were investigated for Escherichia coli, intestinal enterococci and Clostridium perfringens by cultivation-based enumeration according to ISO-methods. With the exception of earthworms, the prevalence and abundance of SFIB were high in all poikilotherms. The median E. coli concentrations were 4.2 log10 CFU*g-1 in gastropods, and 4.7 log10 CFU*g-1 in poikilothermic vertebrates (fish, frogs). Enterococci reached extraordinarily high concentrations in gastropods (5.7 log10 CFU*g-1), and a median concentration of 3.6 log10 CFU*g-1 in poikilothermic vertebrates. The median concentration of C. perfringens was 2.7 log10 CFU*g-1 in earthworms and gastropods, and 3.0 log10 CFU*g-1 in the poikilothermic vertebrates. The observed median concentrations were only slightly lower or at the same level compared to homeothermic animals (E. coli 5.6 log10 CFU*g-1, enterococci 4.6 log10 CFU*g-1, C. perfringens 3.8 log10 CFU*g-1). To evaluate the relevance of the investigated animal groups as potential pollution sources, the best available information on animal abundance and fecal excretion rates was integrated into a pollution source profile (PSP) for a statistical estimation of the daily SFIB production for the study area. The PSP showed that poikilotherms, especially gastropods, may contribute significantly to daily SFIB production. In the context of the presented data, the long-standing hypothesis that only humans and homeothermic animals are the primary sources of SFIB is questioned. The results indicate the necessity to extend the fecal indicator concept by treating poikilotherms as primary sources as well. These results do not imply that SFIB should not be used as indicators; however, they suggest that interpretation of these data at low contamination levels is more complex than previously believed. This is a joint publication within the Interuniversity Cooperation Centre for Water and Health (www.waterandhealth.at).

Page 86 of 99

Modelling the Present Dynamics and Future Impact of Socio-Economic and Climate Changes on Faecal Indicator Bacteria in a Surface Water Source Nynke Hofstra, Wageningen University and Research Additional Author: Majedul Islam This study explores the present dynamics and future impact of socio-economic and climate changes on faecal indicator bacteria (E. coli and enterococci) concentrations in the Betna River in Bangladesh using MIKE21-ECOLab model. The model for the river was calibrated using measured water level and discharge data during 2012, and validated using measured water temperature, salinity and bacteria data during October 2014 - September 2015. The model output during the base year (2014-2015) corresponded very well with the measured E. coli and enterococci concentrations in the river. The Root Mean Square Error and the Nash-Sutcliffe efficiency for log transformed E. coli and enterococci concentrations were found to be 0.23 and 0.19, and 0.84 and 0.86 respectively. Then, the model was applied to investigate the impact of future socio-economic and climate changes on bacteria concentrations. The scenarios comprise changes in population, urbanization, land use, sanitation, sewage treatment and temperature, precipitation and sea level rise for the 2040s and 2090s. The four scenarios are based on Shared Socio-economic Pathways (SSPs) 1 and 3 and Representative Concentration Pathways (RCPs) 4.5 and 8.5 in a matrix, as currently is common practice in the Intergovernmental Panel on Climate Change and own interpretations of storylines. Two global circulation models (MPI-ESM-LR and IPSL-CM5A-LR) were selected to develop potential change in future climate. Different future scenarios were found to have a significant impact on E. coli and enterococci concentrations in the river. A less sustainable future resulted in a deterioration of microbial water quality due to socio-economic changes, such as higher population growth, land use change and increased sewage discharges and changes in rainfall patterns. Microbial water quality was found to improve under a sustainable climate and an improved sewage treatment, but still it does not comply with the USEPA bathing water quality standards. The results also revealed that contaminant loads were generally more sensitive to changes in socio-economic factors (i.e population growth, urbanization, change in sanitation, land use and sewage treatment) than in the climate. Results of this study indicate that the combined modelling and scenario approach enables the assessment of indicator bacteria sources and dynamics at present and in the future. The results provide decision-support information for the water managers in reducing the widespread faecal contamination and the risks of waterborne disease outbreaks. Incidence and Diversity of Arcobacter spp. in Shellfish, in Water from a Harvesting Bay Area and a Freshwater Heavily Contaminated Channel Maria J. Figueras, University Rovira & Virgili Additional Authors: Nuria Salas-Massó; Karl B. Andree; M. Dolors Furones The genus Arcobacter is a relatively poorly known group of bacteria related to Campylobacter which includes both pathogenic and free-living species. The bacteria of this genus is associated with the presence of faecal contamination, because they are frequently isolated from sewage and faecally contaminated water. Marine ecosystems seemed to be a primary source for sequences from non-culturable strains and new Arcobacter species. This study investigates whether using media that contain NaCl might help to improve the recovery of Arcobacter spp. from marine environments. We have analysed a total of 108 samples which included seawater (n= 25), contaminated freshwater from a channel (n= 20) and shellfish samples which included oysters, mussels, clams and cockles (n=63). All the samples were analysed in parallel, with both a commonly used culture method (enrichment in Arcobacter-CAT broth (ACB) followed by culture on Blood Agar) and a new one that supplements the ACB with 2.5% NaCl (w/v) followed by culturing on Marine Agar. Both methods were incubates in parallel with two atmospheres (aerobiosis and microaerophilia). Isolates were first genotyped to eliminate clones with ERIC-PCR, and each genotype was identified by multiplex-PCR for confirmation of the genus and by 16S rRNA RFLP for identification to the species level and if required by sequencing the rpoB. From the 108 studied samples of water and shellfish, 78.7% (85/108) were positive for Arcobacter. Of those, 51.8% (44/85) were positive with both culturing methods, 40% were only positive when the Arcobacter-CAT broth was supplemented with 2.5% NaCl followed by growth on Marine Agar, whereas 8.2% were positive exclusively in Arcobacter-CAT broth followed by growth on Blood Agar. After genotyping with ERIC-PCR, the 1901 isolates corresponded to 813 (42.8%) different genotypes (strains), of which 326 (40.1%) were found with the new method and 503 (61.9%) with the previous one and 16 genotypes were common to both methods. The 326 strains obtained using the new culture media with NaCl showed RFLP patterns that corresponded to 13 known Arcobacter species. Among those 503 strains, nine known species (A. aquimarinus, A. bivalviorum, A. butzleri, A. cloacae, A. cryaerophilus, A. defluvii, A. ellisii, A. molluscorum and A. mytili) were recognised by the RFLP patterns described for those species. However, four strains had unknown RFLP patterns and according to their rpoB sequence corresponded to four new Arcobacter species. Eight of those species were common to both methods but five were exclusively found by the new method (A. cloacae, A. halophilus, A. marinus, A. nitrofigilis and A. skirowii). 83 strains also had different patterns to those described and were distributed among ten new potential species on the basis of their rpoB. This study shows that a simple modification to the media (such as the addition of salt) can have a big influence on the community and diversity of species.

Page 87 of 99

Inactivation of E. coli and MS2 Bacteriophage by Copper and Silver Ions in Stored Water Mark Sobsey, UNC Chapel Hill Additional Authors: Doris van Halem; Gertjan Medema; Katie Camille Friedman Background: Safe water storage is a key component in household water management, particularly for those who lack access to a continuous piped water source. Water is subject to recontamination during storage, potentially reversing the previous improvements achieved during treatment. One potential approach for safe water treatment and storage is the incorporation of antimicrobial metals. Despite the documented use of copper and silver as antimicrobial metals in water treatment and storage, published data on inactivation kinetics of copper and silver, separately and in combination, at concentrations relevant for drinking water remain limited. Goal: The aim of this research was to determine disinfection kinetics and magnitude as well as potential synergies of different concentrations and combinations of copper and silver ions to reduce concentrations of E. coli strain WR1 and MS2 bacteriophage from test waters. Methods: Test water was composed of a buffered saline solution (20 mg/L KCl, 20 mg/L KH2PO4,800 mg/L NaCl, 115 mg/L Na2HPO4) adjusted to pH 7.2 and spiked with both a stationary culture of E. coli strain WR1 and MS2 phages, resulting in concentrations of 10^6 CFU/ml and 10^5 PFU/ml, respectively. Each reaction vessel (50 ml polypropylene centrifuge tube) was filled with 45 ml of spiked test water and covered in aluminum foil to simulate a dark environment typical of household stored water. At t=0, each vessel was spiked with a concentrated AgNO3 and/or CuCl2 solution. Samples were taken at a series of time points over 24 hr, and a solution containing EDTA, sodium thiosulfate, and sodium thioglycolate was added to quench metal ions. E. coli were enumerated using the spread plate method on lauryl sulfate agar, and MS2 phages were enumerated using the double agar layer method. CFUs and PFUs were used to compute log10 reduction values (LRVs). Results: Within 3 hr, 3.3 LRV for E. coli was observed by the highest concentration of metals tested: 1 mg/L Cu + 0.1 mg/L Ag. At 6 hr, 0.1 mg/L Cu + 0.1 mg/L Ag also exceeded 3 LRV (3.2 LRV) for E. coli. Both of these results were greater than the sum of the observed E. coli LRVs of the individual metals at each time point, illustrating a potential synergistic effect. However, no statistically significant reduction was observed for MS2 under all but two conditions over the 24 hr period. Two conditions showed 0.9 LRV after 24 hr: 1 mg/L Cu alone and in combination with 0.1 mg/L Ag. Overall, copper and silver ions used individually and together gave appreciable reductions of E. coli bacteria but little if any reduction of MS2 bacteriophage in buffered water at the metal ion concentrations tested. Further investigation is needed to determine if metal ion amended water storage under different conditions, such as light exposure, might improve virus reductions. Ability of Benzonase Pre-treatment to Reduce False-positive Rotavirus Results by RT-PCR Leena Maunula, University of Helsinki Additional Author: Satu Oristo Rotavirus infection causes approximately 500 000 deaths annually in children younger than 5 years. The majority of these deaths occur in the developing countries, where contaminated drinking water is an important source of infection. The most often used method for the detection of these viruses is reverse transcription-polymerase chain reaction (RT-PCR). The downside of this method is, that it does not provide information about the infectivity of these viruses. Therefore, the aim of our study was to develop an enzymatic pre-treatment, which would eliminate nucleic acids from inactivated viral particles in the sample, prior to the RT-PCR. We used benzonase, which is a nuclease that degrades both single-stranded and double-stranded RNA and DNA. As a model virus we used the rotavirus strain Wa, propagated in MA104 cell culture. The samples were subjected to thermal inactivation at 80°C for 10 min, and then incubated with benzonase (100 U or 200 U) at 37°C for 1 h. The nucleic acids were extracted using commercial RNA extraction kits. Real-time RT-PCR, with primers targeting the NSP3 region of the rotavirus genome, was used for elucidating the efficacy of this pre-treatment. The log reductions were calculated by plotting the Ct values on a standard curve, and compared to the respective infectious control samples' Ct values treated with the same amount of benzonase. The same protocol was tested with a rotavirus-positive G1P[8] fecal sample. Benzonase caused a minor log reduction for the infectious, non-thermally treated Wa control samples (0.63 log with 100 U, and 0.52 log with 200 U benzonase). In the thermally-inactivated samples, the application of 200 U of benzonase caused a log reduction of 1.7, and was shown to be more efficient than the application of 100 U of benzonase. The log reductions for the infectious (non-thermally treated) control fecal samples were 0.34 log with 100 U and 0.42 log with 200 U. Thermal inactivation at 80°C for 10 min, followed by treatment with 100 U benzonase, reduced the log by 3.4, and by 4.1 log with 200 U. Our studies are still ongoing, but these preliminary results show that the use of benzonase pre-treatment, which degrades both RNA and DNA, may be a promising alternative when determining, whether the RT-PCR detected viruses are still infectious. We intend to continue our studies with naturally contaminated water samples. Pathogen Removal in an Onsite Hybrid Adsorption and Biological Treatment System Michelle Henderson, University of South Florida Additional Authors: Sarina Ergas; Kebreab Ghebremichael Introduction In the United States approximately 25% of domestic wastewater is treated in onsite treatment systems (mainly septic tanks and drainfields). However, septic systems are not efficient at removing nutrients and pathogens, making them a risk to public health and the

Page 88 of 99

environment. To address the problem of nitrogen released from septic tank effluent, Hybrid Adsorption Biological Treatment Systems (HABiTS) are being developed that incorporate ion exchange, biological nitrification and denitrification processes. HABiTS are considered "passive" bioreactors in that they have low energy costs and do not require chemical feed systems. In the first stage of HABiTS, clinoptilolite serves as a cation (NH4+) exchange material for nitrification. In the second stage of HABiTS, tire chips are used as an anion (NO3-) exchange material and combined with elemental sulfur for sulfur oxidizing denitrification. Although studies of nutrient and pathogen removal in centralized and continuous flow systems are widely reported, studies of small-scale onsite systems under transient flow conditions are limited. Such studies are important to understand the impact of idle time and flow on household bioreactor performance. The potential of HABiTS for pathogen removal has not been studied limiting its reuse applications. Thus, it is important to assess the reuse potential of the effluent and generate new data for quantifying microbial risk of HABiTS reuse. Research Objectives and Hypothesis The goal of this research is to investigate the pathogen removal capacity of HABiTS to further assess the reuse potential of the effluent. The specific objectives include: 1) estimate E. coli and Human Adenovirus removal from the first and second stages of HABiTS, 2) study modified media (iron oxide coated media) to enhance pathogen removal of HABiTS to assess the reuse potential of the HABiTS. The guiding hypothesis is that HABiTS will reduce the risk of pathogen exposure by sorption of pathogens onto the HABiTS media, allowing for more die-off and predation. It is also hypothesized that modifying surface characteristics of the media using iron oxide coating will improve E.coli and Human Adenovirus (HAdv) removal to produce effluent fit for reuse. Methodology and Preliminary Results This research includes column and batch adsorption experiments. In the column studies E. coli from the septic tank, HABiTS effluents, and control column effluent were enumerated using the modified mTEC membrane filtration method (EPA method 1603). HAdv strains 40 and 41 will be quantified using quantitative polymerase chain reaction (qPCR) SYBR Green method. In the batch adsorption studies pathogen adsorption kinetics onto modified media will be evaluated where varying doses of media are added in synthetic wastewater inoculated with cultures of E. coli and HAdv. Preliminary E. coli enumeration data shows that there is on average a 98% reduction in E. coli throughout HABiTS from the sewage influent. Urban-Rural Differences in the Effects of Heavy Rainfall Events on Diarrheal Disease Epidemiology Aniruddha Deshpande, Emory University Additional Authors: Howard Chang; Karen Levy Diarrhea remains a leading cause of mortality amongst children under five years of age, causing over 498,900 deaths per year. Climate change is expected to result in increases in extreme weather events and greater contrasts between wet and dry periods in the 21st century. This is expected to have ramifications for health outcomes since heavy rainfall events (HRE) have been linked to diarrheal diseases. Urbanization has the potential to modify this relationship due to underlying demographic and infrastructure factors. We examine how urban versus rural contexts affect the relationship between HREs and diarrheal diseases by analyzing daily case counts of diarrhea and average daily precipitation estimates in the Esmeraldas province of Ecuador from 2013-14. A HRE was defined as daily rainfall greater than the 90th percentile for the entire study period and antecedent rainfall conditions were defined as wet or dry depending on 8-week total prior rainfall. We carried out mixed effects Poisson regression on daily case count data, with indicators of HREs, antecedent rainfall, and their interactions lagged from 0 to 14 days and assessed significant expected count ratios (SECR) across all lags tested for each environmental condition. Dry conditions without a HRE were highly associated with increased diarrhea (SECR: 1.19-1.27 (Urban), 1.16-1.25 (Rural)). When considering HREs in addition to total rainfall in rural areas, we found a positive association between HREs and diarrhea during the dry season (SECR: 1.16-1.29), whereas a protective effect was observed in the wet season (SECR: 0.84-0.91). Similar associations were observed in urban areas with even stronger measures of association (SECR: 1.22-1.46 (Dry); 0.83-0.89 (Wet)). This study provides interesting insights into differences in mechanistic differences in how rainfall is associated with diarrhea in urban and rural areas, with potential implications for understanding how climate change might affect diarrheal diseases under different contexts. Inactivation of Foodborne Viruses in Fresh Produce Using Green Tea Extract Celia Barardi, Universidade Federal de Santa Catarina Additional Author: Elisabet Marti Contamination of fresh produce with enteric viruses is a matter of concern because they may persist in food surfaces under normal storage conditions for long periods. Chlorinated compounds are the most common disinfectants used in the fresh produce but they present some disadvantages as the formation of by-products, as triahalomethanes. Green tea extract (GTE) is a natural compound from Camellia sinensis that has been reported to have antimicrobial effects against bacteria, fungi and viruses. Particularly, group of polyphenols named catechins are the compounds from GTE associated to antimicrobial effects. Hence, this study aimed to determine the potential of GTE to be used for fresh produce disinfection. Chorine was also employed to compare the action of GTE with a common disinfectant. Organic lettuce, green onions and strawberries, were contaminated with 8 log10 of human adenoviruses type 2 (HAdV-2) and 6 log10 of infectious murine noroviruses type 1 (MNV-1), and treated with GTE and chlorine solutions to evaluate the inactivation of these viruses. MNV-1 was selected as a representative of RNA viruses, as it was described as the best surrogate for studying HNoV stability and inactivation in the environment. HAdV-2 was included in this study as a representative of double-stranded DNA viruses and because it is an ideal indicator of faecal pollution as it has high UV-resistance and it is prevalent in untreated domestic wastewater all year round. Comparing the two sanitizers studied, higher viral inactivation

Page 89 of 99

were obtained with chlorine compared to GTE. However, the concentration of 200 ppm chlorine, which is the maximum concentration recommended by the WHO for fresh produce decontamination in the industry also failed to achieve 4 log10 (99.99%) of inactivation in most cases. In fact, we only observed a reduction of 4 log10 of HAdV-2 exposing lettuce at 200 ppm of chlorine, while the same treatment in strawberries and green onions yielded less than 3 log10. This demonstrated that the nature of the food plays an important role on virus attachment and removal. Regarding the effect of GTE as a potential disinfectant for fresh produce, we found that it exhibited greater antiviral activity against HAdV than against MNV. This is in accordance with another study that demonstrated that L-epicatechin, one of the catechins presents in GTE, was not effective to inhibit MNV. However, since HAdV-2 does not present these targets and was inhibited by catechins, it seems that the antiviral effect of catechins might be a result of several mechanisms and further research is needed to improve our understanding. Overall, results demonstrated that, although GTE was not as efficient as chlorine, it demonstrated good effectiveness to decrease the amount HAdV-2 in fresh produce. Taking into account these results it can be concluded that GTE could be a good disinfectant, in addition to act acts as a natural antioxidant of fresh produce, extending their shelf-life. Fate and Persistence in Soil Microcosms of Environmental and Fecal Escherichia coli Isolated from Low-Income Countries Maria Camila Montealegre, Swiss Federal Institute of Aquatic Science and Technology Additional Authors: Franzisca Böni; Lea Caduff; Tala Navab-Daneshmand; Mohammad Aminul Islam; Timothy Julian Timothy Julian Understanding the factors that influence the fate of Escherichia coli outside its primary host is crucial, as persistence of this bacterium in environmental compartments compromises its utility as a pathogen indicator. Furthermore, the potential health risk posed by pathogenic E. coli in domestic environments and the contribution to ongoing transmission is of high relevance, as pathogenic E. coli is one of main drivers of enteric diseases in low- and middle- income countries. Herein, we investigated the potential for growth and persistence in soil microcosms of 4 different E. coli strains isolated from environmental and fecal sources in low-income countries. Two types of soils (sandy loam and loam, adjusted to an initial moisture content of 13% and 14%, respectively) were spiked in triplicates with 10^4 CFUs of each of the strains. The soil microcosms were maintained at 30°C and the fate of E. coli was followed for 7 weeks, using a culture base approach. In addition, we evaluated the effect of the starting inocula (10^2, 10^4 and 10^6) and initial soil moisture content (2%, 14% and 24%) in the ability of E. coli to persist. We found that the mean log10 CFU per gram of dry soil (CFU/g) increased by up to 2.5 logs within 3 days: from 10^4 to 10^5 or 10^6 CFU/g. As time progressed, from week 1 to week 4, E. coli concentrations in soil persisted in loam soil but significantly decreased at week 7. In contrast, E. coli concentrations were found to decrease steadily in the sandy loam soil. While no significant differences at any time point were found between the strains evaluated, E. coli concentrations were influence by soil type, with the sandy loam soil supporting the persistence of all the strains at higher level (p=0.0007 - 0.0127). When we assayed the effect of different starting inocula, we found that beginning from day 14 post-inoculation no significant differences were observed in the E. coli concentrations (range, 10^6- 10^7 CFU/g). Furthermore, we found no difference in the E. coli concentrations between the soils adjusted to initial moisture of 14% and 24% (10^7 CFUs/g of dry soil from day 3 onward), while E. coli recovered in the soil adjusted to 2% moisture remained in the range of 10^4 to 10^5. Overall, these findings indicate that E. coli can persist at high levels under ample soil conditions (soil type and moisture content) independent of the starting seeding inocula. Further studies are warranted in order to elucidate the factors that contribute to E. coli long-term persistence in the environment. Inactivation of Pseudomonas Aeruginosa by Electrochemical Oxidation Rosa Maria Araujo Boira, University of Barcelona Additional Authors: Carmina Bruguera-Casamada; Ignacio Sirés; Humbert Salvadó; Enric Brillas The effective removal of pathogens and organic pollutants from water by electrochemical advanced oxidation processes (EAOPs) has been examined with growing interest. Many of these studies have been focused on the inactivation of Escherichia coli as process indicator, with much less attention on other hazardous bacteria like Pseudomonas aeruginosa. Most of the infections by this opportunistic pathogen result from contact with contaminated water, either in natural environments or in aquatic facilities. Among the EAOPs, major attention has been paid to electro-oxidation (EO), which involves the degradation of (bio)organic molecules from a contaminated solution either by direct oxidation at the anode surface or by mediated reaction with strong oxidants. In this work, the disinfection of P. aeruginosa has been tested at 33.3 mA cm-2 employing two kinds of anodes: boron-doped diamond (BDD) and IrO2-based or RuO2-based dimensionally stable anode (DSA). Stainless steel was used as cathode and the electrolyses have been performed in Na2SO4, with and without NaCl. Physisorbed hydroxyl radicals M(?OH) formed from anodic water oxidation and active chlorine generated from anodic Cl oxidation were the main oxidizing species in pure Na2SO4 medium and in the presence of NaCl, respectively. A faster inactivation was always found using DSA. In 7 mM Na2SO4, this behavior was associated to the much larger adsorption of the bacteria onto the anode, which accelerates the M(?OH)-mediated oxidation and cleavage of the cells. The inactivation rate was strongly enhanced in 7 mM Na2SO4 1 mM NaCl due to the large oxidation power of active chlorine. The effect of NaCl concentration and current density was examined with BDD and the best performance was obtained in 7 mM Na2SO4 7 mM NaCl at 8.3 mA cm-2, with total inactivation in 2 min. These results show that EO may be an alternative to conventional water disinfection methods.

Page 90 of 99

Poster Presentations

Thursday, May 18th Detection Sensitivity Assessment of Sewage Markers in Recreational Beach Waters Warish Ahmed, CSIRO Additional Author: Bridie Hughes Microbial source tracking (MST) is an effective tool to help utilities improve the water quality around the globe. Human fecal pollution poses significant public health risks compared to animal faecal pollution. Several sewage markers have been developed and used for MST field studies. However, a head to head comparison in terms of the detection sensitivity of these methods is lacking. Here, we determined the sensitivity of six MST markers (Bacteroides HF183, E.coli H8, nifH, human adenoviruses (HAdVs), human polyomaviruses (HPyVs), and pepper mild mottle viruses (PMMoVs) in relation to a fecal indicator bacteria (Enterococcus spp. 23S rRNA) and three enteric viruses [human adenovirus serotypes 40/41 (HAdV 40/41), human noroviruses (HNoVs) and human enteroviruses (EVs)] in beach water samples seeded with raw and secondary treated wastewater. These markers, FIB, and enteric viruses were then quantified in beach water (n = 12) and sand samples (n = 12) from Southeast Queensland (SEQ), Australia to estimate the levels of fecal pollution and associated health risks. HF183 was the most sensitive MST marker and could be quantified up to a dilution of 10-6 in raw and 10-4 in secondary treated wastewater seeded beach water samples. No correlation was observed between MST markers and enteric viruses (HNoVs and EVs) in both raw and secondary treated wastewater. Of the twelve sites examined, beach water and sand samples from several sites had quantifiable concentrations of HF183 and PMMoVs. Overall, our results indicate that while HF183 is the most sensitive sewage marker, it should be used in conjunction with a conferring viral marker to avoid overestimating the risk of gastrointestinal illness. Antibiotic-Resistant Bacteria in Therapy Pools Stefanie Huber, Bavarian Health and Food Safety Authority Additional Authors: Daniela Köck; Nadera Hanifi; Christiane Höller The number of patients colonized with antibiotic-resistant bacteria (ARB) is increasing in health care facilities. There is often great uncertainty how to handle these patients. They are frequently excluded from important therapies. Hydrotherapy is a non-invasive and beneficial treatment but water disinfection is not always sufficient to kill all released bacteria. Bacterial contamination can occur either due to deficiencies in water treatment or due to colonization of pool equipment. Yet, to our knowledge, no information exists about the public health impact of therapy pools in the dissemination of ARB. The main objective of our study is to investigate the occurrence of ARB in therapy pools. Factors contributing to their occurrence will be discussed with regard to details in pool water treatment and disinfection, number of patients in the pools and usage of the pools for other purposes. Eleven therapy pools in Bavaria are sampled (pool, filter, balance tank and filter backwash water). ARB are isolated on different selective media. The isolates are identified by MALDI-TOF-MS and tested for antimicrobial susceptibility by BD Phoenix. In addition, samples from the surrounding surfaces are also examined for ARB. Typical water quality parameters are determined. Furthermore, a standardized questionnaire was given to the facilities operating the therapy pools to document the technical details of the pool, water treatment, cleaning procedures, frequency and duration of pool usage. The number of bathers/patients ranges from <50 to 35,000 patients per year. So far 65% of the samples from 11 different therapy pools have been collected. We obtained 53 isolates from water samples and 170 isolates from surrounding surfaces, with Pseudomonas spp. (22%) and Staphylococcus spp. (18%) as the most common genera. The preliminary results indicate a correlation of the number of isolates in water samples with the number of patients in combination with deficiencies in water treatment. Only in one health care facility isolates could be obtained directly from the pool water. This clinic has the highest number of bathers and problems with the water treatment. A correlation between the high number of isolates from surrounding surfaces and the high number of bathers can be observed. As the cleaning intervals of the pool and the surrounding of the pool are very similar between the different health care facilities, there is no detectable correlation between the number of isolates and the cleaning interval. The highest number of isolates was obtained from barefoot-areas (39) and floor cleaning equipment (34). Sampling is still ongoing and will be finished in April 2016. Despite the reduction of ARB due to water treatment and disinfection, some are still present in the water of therapy pools and on surfaces. ARB are potentially transferred from patients to the therapy pool environment. There they may persist and infect other patients and staff. Survival and Replicate of Helicobacter Pylori in Water: Effect of Grazing by Free Living Amoebae Rafik Dey, University of Alberta Helicobacter pylori, is a fastidious Gram-negative bacterium that infects and colonizes the lining of the stomach and/or duodenum. It is a cause of gastric inflammation, also known as gastritis, which is a risk factor for the development of peptic ulcer disease and gastric cancer. Recent studies suggest that free-living amoeba present in water sources can increase the survival of H. pylori in the environment. We considered the

Page 91 of 99

possibility that amoebae might serve as natural amplifiers of B. anthracis spores within the soil and water and thereby contribute to their persistence. To address this possibility, we examined H. pylori interactions with different species of free living amoebae such as Acanthamoeba polyphagae, Vermamoebae and Willaertia sp. Here we show that under simulated environmental conditions, H. pylori persist and multiply within amoebae. The growth kinetics of H. pylori showed an increase in numbers after 24 hours. Electron and time-lapse fluorescence microscopy revealed that H. pylori multiply within amoebal phagosomes. Understanding how H. pylori persists in soil/water systems and interacts with the free-living amoeba will contribute to our understanding of the epidemiology and microbial ecology of H. pylori and potentially permit the development of methods to aid in its eradication. Adenoviruses, JC Polyomavirus and GB-124 Phages in Reclaimed Water Produced by Sand-Anthracite Filtration and MBR/Reverse Osmosis System Tatiana Prado, Environmental Company of the São Paulo State (CETESB) Additional Authors: Mikaela Renata Barbosa; Vilma Bonanno; Suzi Garcia; Maria Inês Sato Introduction: In the metropolitan region of São Paulo city, Brazil, four large municipal wastewater treatment plants (WWTPs) are responsible to generate reclaimed water for urban and industrial purposes, such as landscape irrigation, street washing, among others. Although non-potable reuse is practiced, pathogenic viruses must be reduced to levels that pose no significant risk since these agents can be transmitted via aerosols or remaining viable in surfaces or in soil. Objective: The aim of this study was evaluate potential viral markers of human fecal contamination (human adenoviruses (HAdV), JC polyomavirus (JCPyV) and phages of Bacteroides fragilis (GB-124) in reclaimed water from four WWTPs composed by different tertiary treatment processes: sand-anthracite filters followed by chlorination (WWTPs 1-3) and membrane bioreactor (MBR) coupled with reverse osmosis treatment and chlorine dioxide disinfection (WWTP-4). Method: Reclaimed water samples were collected monthly during one-year period: April 2015 to March 2016. Enteric viruses were concentrated through of hollow-fiber ultrafiltration system and detected by Real Time PCR (qPCR) assay. An integrated cell culture (ICC)-qPCR assay using HEp-2 cell culture permissive to human adenoviruses infection was performed. For GB-124 phages detection a plaque assay was used. Results and Conclusions: HAdV were the viruses most frequently detected (100%, 66,6% and 75 %) in effluents from sand-anthracite filters (WWTP 1, 2 and 3, respectively) and the viral load ranged from 6.6 x 101 genome copies (GC/L) (WWTP-2) to 1.4 x 106 GC/L (WWTP-1). The percentage of JCPyV detection varied from 41.6% (WWTP-2) to 100% (WWTP-1). In MBR/reverse osmosis system only HAdV was detected (16.6%), with viral loads from 9.3 x 101 and 6.6 x 102 GC/L, suggesting a better performance of this system in virus removal. GB-124 phages occurred in low frequency (16.6% to 22.2 %) in these samples and the densities ranged from 50 (WWTP-2) to 950 PFU/100mL (WWTP-1), indicating the resistance of viable viruses to these disinfection processes. Comparison of data obtained for GB-124 phages and infectious HAdV in these samples demonstrated that relative higher detection rates were found for HAdV in reclaimed water from WWTP-1 (44.4%) and similar data to those obtained for GB-124 phages were recorded for effluents from WWTP-2 and 3 (16.6% and 8.3%, respectively). Infectious AdV were not detected in effluents from MBR/reverse osmosis system, suggesting that molecular methods can overestimate viral concentrations with infectious potential in these samples. Results point out that molecular methods coupled with alternative culture methods could provide more realistic data for health risk assessments. Keywords: adenovirus, GB-124 phages, polyomavirus, reclaimed water, risk assessment. Support: Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) (grant number No 2013/26586-1) and Environmental Company of the São Paulo State (CETESB). Should We Study Sediments Microbial Quality in Natural Aquatic Environments? Veronica Rajal Additions Authors: Dolores Gutiérrez-Cacciabue; Hugo Poma; Waman Haro; Oscar Gamboni; Lucia Chavez Diaz Recreation is one of the many uses of water natural resources. Depending on the chemical and microbiological quality, recreational aquatic environments, like rivers and lakes, may become a risk to the population. In particular pathogens including bacteria, viruses, and parasites may transmit waterborne diseases. The aims of the study were to characterize water and sediments from two recreational natural aquatic environments in Salta, Argentina, and to evaluate the importance of sediments as potential reservoir of microorganisms. Water and sediment samples (3 replicates per occasion) were collected from December 2015 to September 2016 from two recreational natural aquatic environments: Wierna River (WR, 5 samples: WR1, WR2, WR3, WR4, WR5) and General Belgrano Reservoir (GB, 6 samples: GB1, GB2, GB3, GB4, GB5, GB6). Physicochemical variables in water (pH, turbidity, dissolved oxygen, temperature, conductivity, hardness) and sediments (organic matter, humidity, ash, conductivity) were measured. For the microbiological characterization bacteria and viruses were analyzed. Total aerobic mesophiles (TAM), total (TC) and thermotolerant coliforms (THC), E. coli (EC), enteroccocci (ENT) and P. aeruginosa (PA) were culture-based enumerated. Bacteria were detached from sediments with 1% Tween 80 and 15 min of handshaking. Adenovirus and enterovirus were quantified by real-time PCR from ultrafiltration water concentrates and from sediments after extraction of nucleic acids with commercial kits. The main physico-chemical variations were observed in temperature (according to the season) for both environment, turbidity in WR (2-999 NTU) and dissolved oxygen (WR: 2-7 mg/l, GB: 2-10 mg/l). Culturable bacteria were mainly in the sediments (75-99%) rather than in the water column of each corresponding sample. The highest counts were for TAM in both environments (2.8x103 CFU/ml and 2.4x104 CFU/g for water and sediments in WR and 8x102 CFU/ml and 1.8x105 CFU/g for water and sediments in GB). More than 50% of the samples

Page 92 of 99

were negative for TC, THC, EC and ENT in water. Although water samples from WR5 and GB2 had the highest bacterial contamination, only in RW2 and GB3 exceeded the limits for EC and ENT established for recreational water by the USEPA (2002) (Argentina does not have legislation), being all these associated with rain events. Respecting viruses, only adenovirus was found in WR3 and WR4 water samples and in water and sediments in GB4. In these cases, the counts for ENT and EC in water were below the USEPA limits, showing that the presence of virus was not related to the concentration of bacterial indicators. Concluding, sediments were the main reservoir of microorganisms. As they can be resuspended and microorganisms returned to the water column due to the turbulence of rain events or recreational activities, they should also be analyzed at the time the water quality of a recreational natural aquatic environment is assessed in order to protect public health. Efficacy of Flushing and Chlorination in Removing Faecal Microorganisms from a Pilot Distribution System Nikki van Bel, KWR Watercycle Research Institute Additional Authors: Anita van der Veen; Gertjan Medema During construction works or incidents in the drinking water distribution system (DWDS) a faecal contamination can enter the network. Drinking water companies have to (re)act quickly and appropriately to protect the health of consumers. Besides strict hygiene protocols, cleaning procedures are needed to ensure that faecal pathogens that may have entered the network are removed or inactivated. The current cleaning protocols are based on experience. First the DWDS is flushed and 12-24 hours after flushing the water is sampled for faecal indicator bacteria. If the DWDS still contains faecal indicators after flushing, repeated flushing and/or chlorination is applied. The effectivity of flushing and chlorination to remove faecal contaminants from the water and the biofilm in a DWDS, in the Dutch, unchlorinated, system was tested in this research. In addition, the effect of time between flushing and sampling of the water was tested. Experiments were performed in a pilot DWDS. A biofilm was developed in two weeks upon addition of carbon, nitrogen en phosphate and Escherichia coli bacteria, phiX174 phages and Clostridium perfringens D10 spores were added. After 24 hours circulation, to allow attachment to the wall and biofilm, the system was flushed and/or chlorinated. The concentration of microorganisms in water and biofilm was measured at several moments during the cleaning procedure. To evaluate the effect of time after flushing on recovery, E. coli, enterococci and MS2 were added as suspension or combined with sand, followed immediately by flushing. At several time points after flushing, the water was sampled and the concentration of microorganisms determined. After 24 hours circulation, on average 13.7% of E. coli, 23.8% of C. perfringens D10 and 0.3% of phiX174 was bound to the biofilm. Flushing (1.5 m/s, 3 volumes) removed maximally 3.3 log, but on average 1.8 log of a homogeneous microbial contamination from the water. Removal from the biofilm is lower (0.5-1.0 log removal). Chlorination (10 mg/l) strongly reduced the concentration microorganisms in the water and the biofilm. After 6, respectively 6-48 hours (3,868-25,711 mg*min/l), the number of microorganisms in the water or biofilm was below the detection limit. Using a reverse-QMRA approach it was calculated that 1.8 log reduction of flushing is sufficient for small contaminations (¡Ü10 cfu E. coli/100 ml) of the DWDS and little or no attachment to the biofilm. Chlorination is required in case of larger contaminations especially if present in the DWDS for at least 1-2 hours and considerate attachment to the biofilm could have occurred. 1-24 hours of waiting time between flushing and sampling does not influence the concentration microorganisms recovered from the drinking water, regardless of the flushing rate. The recommendation is therefore to reduce the waiting time from 12-24 hours to 1 hour, thus reducing the time during which it is uncertain whether the drinking water is safe. Advanced UV Treatment for Inactivation of Emerging Microbiological Contaminants Vincent Martino, Marquette University The goal of the project is to test the viability of a novel approach to pathogen mitigation using advanced oxidation in the form of a UV system combined with waste slag and hydrogen peroxide. The target contaminants are P22 bacteriophage, which is being used as a surrogate for human enteric adenovirus and E. coli, which is the common benchmark used for biological water quality parameters. While UV treatments have been established to be effective in neutralizing bacteria and viruses, typically high inputs of energy are needed to inactivate certain viruses, i.e., adenovirus. Due to this, the energy inputs required for UV treatment can be relatively high, lowering the viability of UV as an efficient treatment option. By using advanced UV treatment, the energy inputs for a given level of inactivation are hypothesized to be lower, increasing the viability of these treatment processes in widespread municipal applications. By combining UV light with waste slag and hydrogen peroxide, reactive hydroxyl radicals are produced, therefore stimulating photocatalysis in the water. This has been shown to be feasible through the use of iron and hydrogen peroxide. Furthermore, this is a potentially sustainable option as the waste slag is a by-product of steel production and would decrease the stress on nearby landfills and other waste reclamation sites. All UV tests are being performed at variable wavelengths (255, 265, and 285 nm using LEDs) and various UV fluences. All tests are being performed with UV alone as well as combined with the waste slag and hydrogen peroxide. Results demonstrate 3-logs of P22 inactivation using energy inputs as low as 20 mJ/cm2. This project aligns with the conference theme of Water and Wastewater Treatment and Disinfection Technologies due to the emphasis on improving current UV water treatment approaches and would be a worthwhile addition to the conference.

Page 93 of 99

A Seasonal Distribution of Opportunistic Pathogens in Roof-Captured Rainwater Tanks Warish Ahmed, CSIRO Land and Water Additional Authors: Kerry Hamilton; Simon Toze ; Charles Hass A seasonal (dry vs. wet) study on the occurrence of six opportunistic pathogens in 24 roof-captured rainwater (RCR) tanks over six events was conducted using quantitative qPCR. The opportunistic pathogens selected for this study were Legionella spp., Legionella pneumophila, Mycobacterium avium, Mycobacterium intracellulare, Pseudomonas aeruginosa, and Acanthamoeba spp.In addition, fecal indicator bacteria (FIB) Escherichia coli (E. coli) and Enterococcus spp. were enumerated using culture-based methods. All tank water samples over the six events were positive for at least one opportunistic pathogen during the course of the study. FIB were positively but weakly correlated with P. aeruginosa, but not the other opportunistic pathogens. FIB were more prevalent during the wet season than the dry season, and L. pneumophila was only observed during the wet season. However, concentrations of Legionella spp., M. intracellulare, Acanthamoeba spp., and M. avium peaked during the dry season. Correlations were assessed between FIB and opportunistic pathogens with meteorological variables. P. aeruginosa was the only opportunistic pathogen positively associated with an increased antecedent dry period, suggesting stagnation time may play a role for their occurrence in tank water. Infection risks may exceed commonly cited benchmarks for uses reported in the rainwater usage survey such as pool top-up, and warrant further exploration through quantitative microbial risk assessment. Dissemination and Prevalence of Enteric Viruses in Surface Waters and in Children with Acute Gastroenteritis Regina Keller, UFES Additional Authors: Rodrigo Pratte; Ethel Maciel; Marize Miagostovich; Tulio Fumian; Sara Martins; Servio Cassini Due to the discharge of sewage without proper treatment, pathogenic microorganisms as enteric viruses may come into contact with surface water and cause serious consequences to the health of the population especially elderly and young children, Despite the reduction of infant mortality in many countries in recent years, a large number of children still die from Acute Diarrheal Diseases (ADDs) of undetermined etiology. The present study aimed to evaluate the prevalence of enteric viruses in surface waters of Vitoria Bay, Espírito Santo, Brazil, and in clinical samples of children diagnosed with acute diarrhea attending two health care units in the same region. Water Samples (n=48) were collected from September 2011 to August 2012 and physico-chemical and microbiological analysis of water were realized. Stool samples from children with gastroenteritis (n=134) were collected at the same period of water samples. Enteric viruses (rotavirus, norovirus GII and human adenovirus) were detected and quantified by quantitative PCR, followed by nucleotide sequencing. The epidemiological relationship between the enteric viruses present in surface waters and the population were compared through phylogenetic analysis based on the sequences of the viral genomes. The microbiological analysis of the water showed average concentrations of Enterococci and thermotolerant coliforms ranging from 1.9 x 101 to 3.9 x 103 CFU 100 mL-1 and 1.2 x 102 to 6.5 x 103 CFU 100 mL-1, respectively. All three enteric viruses were detected in almost all the monitoring period (34/48, 70.8%). The average concentration these viruses in the water ranged from 1.6 x 100 - 1.5 x 104 genomic copies 100 mL-1. Ninety-three percent of the clinical samples tested were positive for at least one of the three viruses studied. Fifty-six samples (41.8%) were positive for only one virus and 69(51.5%) children had two or three faecal viruses. Rotavirus was the pathogen that presented the largest number of genomic copies and was detected in most cases of mixed infection. Sequencing of rotavirus positive samples identified G2, G3 and G9 genotypes. The genotype (G1P [8]) present in the Rotarix® vaccine composition introduced by the Brazilian government's immunization program in 2006 was not identified in any of the rotavirus-positive stool samples. The close relationship of the population of this region with contaminated water may explain the high prevalence of enteric viruses found in the pediatric population (93.3, 95% CI 87.7 to 96.4). The analysis of viral genomes demonstrated the formation of phylogenetic groups containing enteric viruses detected in the water and in the population, indicating a co-circulation or dissemination of these pathogens in the two matrices. In conclusion, the monitoring provided important data to know viruses that are circulating in the community and will contribute for future studies of public health to reduce morbidity rates and child mortality due to diarrheal diseases. Propagation of Bacteriophages in the Host Cell in the Biofilm Hiroshi Hirotani, Osaka Kyoiku University Additional Author: Kosuke Dezaki Biofilms are structures consisting of extracellular polymeric substances formed on the solid-liquid interfaces by microorganisms. Biofilms exist ubiquitously in the environment and it is considered to play an important role on survival of microorganism. It is reported that natural biofilms developed on riverbed surfaces retain more phage particles than in the water body. But it is not known whether phages could propagate in the host cells in the biofilm. In this study we used artificially developed biofilm to find that phages are able to propagate in the host bacterial cells constituting the biofilm. This may bring about false-positive results in the phage indicator surveys. Escherichia coli ATCC 15597 was grown in a liquid culture and was transferred to grass bottom dishes cultured for 5 h to develop E. coli biofilm on bottom surface of the dishes. Thereafter, culture solutions in the dishes were replaced with MS2 bacteriophage solutions, and the culture was continued for 12 h. Development of biofilms were monitored by DAPI stain examined by a confocal laser microscope. Every four hours, the fluid layers were tested for

Page 94 of 99

bacteriophage titer. Addition of bacteriophage solution caused detachment of bacterial cells in the biofilm layers. A vast propagation of bacteriophage was observed. Bacteriophage infection may affect biofilms to cause collapse in the structure and may result in the propagation of phage in the biofilm host cells. Under certain conditions, bacteriophage may propagate in host cells in biofilms, and this may lead to false-positive phage densities. Development and Validation of Cultural and Molecular Methods for the Detection and Quantification of Campylobacter in Water Samples Michael Hügler, DVGW-Technologiezentrum Wasser (TZW) Additional Authors: Sabrina Kannegiesser; Beate Hambsch Within the European project Aquavalens (grant agreement no: 311846), new analytical tools for the detection of pathogens in drinking water and water for food production are developed and tested in field studies. One of the index pathogens studied in the Aquavalens project are thermotolerant Campylobacter spp., as they are one of the most important causes for acute gastroenteritis worldwide. The standardized cultural detection of Campylobacter according to ISO17995 is very time-consuming and expensive, taking a minimum of 9 days to achieve results. Thus, the development of faster methods is highly desirable. The Fluorescence in situ Hybridization (FISH) technology has been proven to represent a sensitive and rapid method for the specific molecular detection of bacteria. A quantitative method for the detection of Campylobacter based on FISH has been developed. Furthermore, an alternative semiquantitative method for the cultural detection of Campylobacter spp. was established in order to facilitate validation of the FISH protocols. Presently, the newly developed methods are tested in field studies in large drinking water systems at four demonstration sites across Europe over a period of 12 months. The German site is one of the biggest long distance water supplies in Germany, which uses river water as raw water for the production of drinking water. Large volumes of water are concentrated to lower the detection limit, processed and investigated for different waterborne pathogens including Campylobacter among others. A comparison between cultural and molecular detection (quantitative FISH and quantitative PCR) is done to test and validate the newly developed methods in practical settings. A Metagenomic Assessment of Viral Contamination on Fresh Parsley Plants Irrigated with Fecally Tainted River Water Xavier Fernandez-Cassi, Faculty of Biology, University of Barcelona Additional Authors: Natalia Timoneda; Eloy Gonzales-Gustavson; Josep Abril; Silvia Bofill-Mas; Rosina Girones Microbial food-borne diseases are still frequently reported despite the implementation of microbial quality legislation to improve food safety. Among all the microbial agents, viruses are the most important causative agents, with noroviruses accounting for the majority of reported cases of illness. The development and application of a new generation of sequencing techniques to test for viral contaminants in fresh produce is an unexplored field that allows for the study of the viral populations that might be transmitted by the fecal-oral route through the consumption of contaminated food. To advance this promising field, parsley was planted and grown under controlled conditions and irrigated using contaminated river water. The viruses that contaminated the irrigation water and the parsley leaves were studied by metagenomic means. To address possible contamination due to sample manipulation, library preparation, and other sources, parsley plants that were irrigated with nutritive solution were used as a negative control. In parallel, the viruses that were present in the river water used for plant irrigation were analyzed using the same methodology. Sequences were taxonomically assigned to viruses from 2.41 to 26.11% of the total reads. Most of the viral reads detected in the river water were related to the plant viral families Tymoviridae (57.64%) and Virgaviridae (15.47%) and the phage viral families Myoviridae (1.86%), Siphoviridae (1.47%), and Microviridae (1.19%). Less than 1% of the viral reads were related to viral families that infect humans, including members of the Picornaviridae and Astroviridae families. On the surface of the parsley plants, most of the viral reads that were detected were assigned to the Dicistroviridae family (41.52%). Sequences related to important viral pathogens, such as the hepatitis E virus, several picornaviruses from species A and B as well as human sapoviruses and GIV noroviruses were detected. The high diversity of viral sequences found in the parsley plants suggests that fecally contaminated food may have a role in the transmission of a wide diversity of viral families. Sequences related to Circoviridae, Flaviviridae, Anelloviridae, and Parvoviridae, whose importance to the food-safety field is not fully understood, were also detected. This finding reinforces the idea that the best way to avoid food-borne viral diseases is to introduce good field irrigation and production practices. New strains have been identified that are related to the Picornaviridae and distantly related to the Hepeviridae family. However, the detection of a viral genome alone does not necessarily indicate that there is a risk of infection or disease development. Thus, further investigation is crucial for correlating the detection of viral metagenomes in samples with the risk of infection. There is an urgent need to develop new methods to improve the sensitivity of Next Generation Sequencing (NGS) techniques in the food safety area.

Page 95 of 99

Development of a 2D Simulation Based Method for Dose Response Model Optimization for Uncertain Pathogens Mark Weir, The Ohio State University Norovirus is a pathogen of increasing concern in both potable and recreational water systems as well as food production and service. All age groups are affected and norovirus has been discovered in raw well water as well as finished drinking water for utilities that do not chlorinate. With the increasing level of disease burden and widespread exposure potential, a quantitative microbial risk assessment (QMRA) model is vital. However, the uncertainty regarding the dose response model options hampers the ability to have an accurate QMRA model. The inability to culture human norovirus has lead to this knowledge gap. Therefore, the result has been the development of 3 different attempts to develop a candidate dose response model that utilized human feeding trails data using a viral aggregation model. This research was developed to address two remaining issues with the current set of Norovirus dose response model options. First is the uncertainty of either how to implement or the validity of the aggregation models used in the development of these dose response models. Second is the need to have such aggregation models at all, or if a combination of simulative techniques within the optimization can alleviate the need for any of these aggregation models. This research utilizes a 2-dimensional simulation method to optimize the dose response models (exponential and beta Poisson) using a wide range of possible aggregation values. Resulting dose response models are extremely similar to those previously reported, however, with tighter confidence bounds of the estimate. Additionally, based on simulated outbreaks, the 2-D simulation model shows better descriptive potential than others reported. Possibly most important is that this research can demonstrate that the aggregation of viruses is likely negligible to the dose response modeling results. The method of incorporating a 2-D simulation technique directly into a dose response optimization will be presented. By not introducing a new source of uncertainty, but rather controlling for unknown variability, this method of optimization can be very useful for emerging pathogens that may prove similar to norovirus (lack of culture method). Determining the Antimicrobial Resistance Profiles of Diarrheagenic Escherichia coli Strains from Rainwater Harvesting Tanks in Eastern Cape, South Africa Shirley Makoba Malema, CSIR Additional Authors: Makoba Malema; Akebe Abia; Roman Tandlich; Jean-Marc Mwenge Kahinda; Eunice Ubomba-Jaswa Although, rainwater harvesting is practiced routinely in South Africa there is currently little to no monitoring that assesses the microbial and chemical quality of harvested rainwater, especially in rural and peri-urban areas. Furthermore, guidelines designed specifically to address the quality of harvested rainwater do not currently exist. A study was conducted in the Eastern Cape, South Africa, where harvested rainwater is commonly used for drinking and other household use to determine the possible microbial exposure of users to diarrheagenic and antimicrobial resistant E. coli strains. The need of this study is also in light of increasing evidence that shows the proliferation of multiple antibiotic resistance organisms and their associated negative health impacts. Rainwater samples were collected once a week from 11 tanks located in various areas in the Eastern Cape during the three (July -September) month winter period of 2016. Physiochemical parameters were analysed and the Colilert®18/Quanti-Tray® 2000 method was used to isolate and enumerate E. coli. Antimicrobial resistance profiles of 100 E. coli strains to 12 commonly used antibiotics were determined using the disc diffusion method. Standard values provided by the Clinical and Laboratory Standards Institute were used to classify (sensitivity or resistance) the zones of inhibition measured. DNA extraction from purified E. coli isolates followed by RT-PCR was used to identify diarrheagenic E. coli virulence genes. Results revealed the presence of E. coli strains carrying one or more DEC virulence genes (eaeA, stx1, stx2, ipaH, eagg, st1a and st1b) as well as the presence of E. coli strains exhibiting multiple resistances to tested antibiotics. The implications of these preliminary results are off great concern, as standard antibiotic treatments in response to a waterborne disease outbreak due to diarrheagenic E. coli is likely to be ineffective and as a result, E. coli infections will persist and waterborne disease will spread. The Application of Bacteriophages as Indicators of the Removal of Enteric Viruses in Wastewater Treatment Processes Edgard Dias, Federal University of Juiz de Fora (UFJF) Additional Authors: James Ebdon; Huw Taylor Introduction Although wastewater reuse presents potential environmental and economic benefits, a matter of concern is the potential risk to human health associated with the presence of pathogenic microorganisms, especially human enteric viruses (De Luca et al., 2013). Unfortunately, levels of faecal indicator bacteria (FIB) do not appear to correlate consistently with levels of human water/excreta-borne viral pathogens (Morens et al., 2010). There is, therefore, a need for novel viral indicators (Symonds and Breitbart, 2015). The aim of this study was to compare the concentrations and removal of human enteric viruses, phages and FIB in municipal wastewater treatment plants (WWTP) in order to provide a framework that can be used to optimise the removal of enteric viral pathogens from wastewater and consequently minimise risks to public health associated with wastewater reuse Methods Samples were collected once a fortnight (June 2013 to May 2014) from each stage of the treatment process from four small- to medium-sized WWTP (Pop. Eq. ~ 5,000 - 45,000) in southern England, comprising two activated sludge (AS) and two trickling filter (TF) plants. Tertiary treatment comprised maturation ponds at the TF sites and sand filters at one AS site. For all samples, somatic coliphages (SOMPH), F-specific coliphages (F RNAPH) and phages infecting B. fragilis (Bf124PH) were

Page 96 of 99

enumerated using standardised double-layer techniques (BSI, 2001, 2002, 2003). Faecal coliforms (FC) and intestinal enterococci (IE) were enumerated using membrane filtration (BSI, 2000, 2009), and Human Adenovirus (HAdv) were quantified using RT-qPCR, as described by Dias (2016). Results AS systems removed all microorganisms significantly more effective than TF. The secondary (biological) stage was the treatment predominantly responsible for the removal of microorganisms in both AS and TF systems (p value < 0.05). FIB and SOMPH were consistently found in all samples, whereas F RNAPH, Bf124PH and HAdv were less frequently detected, especially following AS treatment. Concentrations of SOMPH and FIB were statistically higher (p value < 0.05) than concentrations of F RNAPH, Bf124PH and HAdv in raw wastewater. FIB were more effectively removed than phages in both systems. Removal rates of HAdv were very similar to those of phages at the secondary treatment stage of both systems. In TF systems, HAdv were removed at the same rate as F-RNAPH and Bf124PH, but at lower rates than SOMPH. It was not possible to analyse statistically the global removal rates of HAdv in AS systems because of the low detection rate in the final effluent. Conclusions AS systems more effectively removed enteric viruses, FIB and bacteriophages than TF systems. In addition, FIB were more effectively removed than phages in all the treatment plants studied. With regards to the removal of HAdv, the findings suggest that phages (in particular SOMPH), are better indicators of the fate of viral pathogens in WWTP than existing FIB. Assessment of the Human Infectious Disease Health Risks Associated with the Use of Recycled Wastewater to Augment Potable Water Supplies Sarah Purnell, The University of Brighton Additional Authors: James Ebdon; Freya Newman; Andrew Halliday Treated wastewater is being increasingly recognised as a valuable and sustainable resource that can supplement water supplies. This is particularly important as population growth and climate change are projected to increase the strain on limited conventional freshwater supplies. In many parts of the world water reuse systems have already been implemented and the practise has the potential to provide potable water as long as the potential risks to human health associated with the consumption of wastewater contaminants, including pathogenic microorganisms, are comprehensively and continuously controlled. Currently in the UK, there is no consensus surrounding what standards are appropriate to govern wastewater reuse, although the World Health Organisation (WHO) has developed guidelines on the safe reuse of wastewater in agriculture (WHO, 2006), and international reuse guidelines are available (EPA, 2012; Australian Public health Act, 2005). This project aims to assess the human infectious disease health risks associated with the use of recycled wastewater to augment potable water supplies through surface waters above abstraction points. To achieve this aim, existing levels of faecal and chemical contamination (including bacterial, protozoa and viral pathogens) are being determined in environmental surface waters upstream (up to three kilometres) of a drinking water abstraction point and in treated wastewater intended for use in augmentation of surface waters. The project is currently 6 months into a twelve-month monitoring programme, where researchers at the University of Brighton are monitoring levels of faecal indicators organisms (thermotolerant coliforms, intestinal enterococci, somatic coliphages, GB124 human specific bacteriophage), chemical parameters (metaldehyde, nitrate, ammonia and phosphate) and bacterial, viral and protozoan pathogens (adenovirus, Salmonella and Cryptosporidium) at three different sampling sites on a monthly basis. Treated wastewater is also being taken monthly for analysis. This data will allow for the assessment of potential risks to human health using a quantitative microbial risk assessment approach and will inform human health evidence-based recommendations on the level of wastewater treatment required in order to avoid any reduction in the hygienic quality of river water at the treated wastewater discharge point and at the water abstraction point. If accepted to the International Symposium on Health-Related Water Microbiology 2017 conference the authors will present the theoretical and methodological approach to this project, as well as the findings of this research. At this early stage in the project, unfortunately analysed results cannot be presented in this abstract. Comparison of Two-Dimensional Gel Electrophoresis-based and Mass Spectrometry-Based Proteome Analysis of Virus Protein Ryohei Kuraoka, Kyoto university Additional Authors: Yasuhiro Asada; Takashi Sakakibara; Sadahiko Itoh In Japan, it has been required to reduce residual chlorine as low as possible because chlorine disinfection causes disinfection by-products and chlorinous odor. However, under the situations of reduced chlorine residual, the increase of microbiological risks in finished water has been concerned. Therefore, combinations of disinfection processes are required to minimize microbiological risks. Estimations of the inactivation mechanism of microorganisms in disinfection processes are important for optimizing combinations of them. In this study, we focused on proteome analysis of viruses that are more resistant to disinfectants than bacteria. Virus proteins can be separated by gel electrophoresis and the mass of each protein is measured by mass spectrometry after in-gel digestion. However, this electrophoresis-based method consumes much time. On the other hand, mass spectrometry-based method without using the gel electrophoresis has been developed. The objectives of this study are to compare and to evaluate two methods for identification of damaged viral protein induced by disinfection. Bacteriophage MS2 was used as a surrogate of pathogenic viruses. Recovered MS2 was purified by isopycnic centrifugation using cesium chloride. As two-dimensional gel electrophoresis (2DE)-based method, proteins of MS2 were separated by 2DE. The gel spots of 2DE were digested using trypsin to obtain the peptide fragments. By Q-TOF, the information of the peptides was obtained. As mass spectrometry-based method, MS2 sample was directly digested using trypsin. These peptide samples were subjected to Q-TOF and LC-MS/MS. The main spectra of peptides including MS2 protein were identified using the MASCOT database. Finally, we analyzed MS2 protein inactivated by disinfection processes

Page 97 of 99

with the two methods. As a result of the 2DE-based method, only one spot was clearly detected and it was coat protein of MS2 capsid. Some spectra of peptides derived from coat protein were also found in the mass spectrometry of digest. On the mass spectrometry-based method, the spectra of peptides derived not only from coat protein but also from assembly protein were found. These results mean that the two methods were probably proper. The 2DE of 2-log inactivated MS2 in UV/H2O2 almost completely lost the spot of coat proteins. The spectral intensity of coat proteins also diminished from untreated in the mass spectrometry. This means that the degradation of virus protein was identified both by 2DE and by direct mass spectrometry. These fundamental data will contribute to clarify the inactivation mechanism of microorganisms in disinfection processes. In addition, there is some possibility that sensitivity of the direct mass spectrometry is better than that of the 2DE. Moreover, the effectiveness of mass spectrometry-based method is not only simplification of proteome analysis but also acceleration of data accumulation about proteins of inactivated viruses. Clinically Relevant Antibiotic Resistant Bacteria in Water Used for Drinking Water Production Claudia Stange, DVGW-Technologiezentrum Wasser Additional Author: Andreas Tiehm The increasing frequency of infections by resistant bacteria, which cannot be treated by classic antibiotics, is a global threat for human health. Due to the widespread use of antibiotics in human and veterinary medicine resistances have spread in the environment during the last few years. Multi resistant bacteria are also increasingly found in the population, unrelated to hospitalization, suggesting the transfer of resistant pathogens from the environment into humans. However, knowledge with respect to antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) in raw water used for drinking water production is limited. PCR based methods were used to investigate the elimination of ARGs during drinking water treatment. For molecular biological analysis DNA extractions were performed from the concentrated samples using the FastDNA® SPIN Kit for Soil (MP Biomedicals) following the manufacturer´s instructions. Overall, samples from four different water works using different types of raw water were quantitatively analyzed for the ARGs sul1, sul2, ermB and tet(C). Furthermore, culture based methods were used to detect the clinically relevant pathogens in raw water. Selective CHROM agar plates (MAST diagnostics) were used to confirm the presence of vancomycin-resistant enterococci (VRE), methicillin resistant Stapyhlococcus aureus (MRSA), carbapenemase-producing Enterobacteriaceae (CPE) and extented spectrum beta lactamase (ESBL)-producing bacteria. Analysis of different types of raw water showed clear differences between surface water and groundwater. Surface water is significantly more contaminated with ARGs than groundwater. During drinking water treatment, a reduction over the whole treatment process of ARGs was observed. Not only the reactive techniques (like UV, ozone, chlorine disinfection) led to a decrease, but also the non-reactive treatment steps (like flocculation and multi-layer filtration) contributed to the decline of ARGs. First analysis of samples using culture based methods showed the presence of MRSA and ESBL bacteria in surface water as well as in downstream sand filtration and a soil passage. VRE and CPE were only detected in surface water. However, the sand filtration and soil passage led to a significant reduction of these antibiotic-resistant pathogens. In a next step, more samples will be analyzed and the isolated resistant bacteria will be tested for a broad spectrum of resistance genes using PCR. The results will help to identify and to avoid the risk of spreading multi-resistant bacteria via the water pathway. The mitigation of this important water quality issue goes along with sustainable risk management and upholds the "sustainable development goals" of the UN. The study was funded by the German Technical and Scientific Association for Gas and Water (DVGW, grant number W4/04/09) and the German Federal Ministry of Education and Research (BMBF project HyReKA, www.hyreka.net, grant number 02WRS1377G). Advancing Evidence-Based Management of Recreational Waters: Integration of Microbial Source Tracking and Risk Assessment Sonya Kozak, Griffith University Additional Authors: Warish Ahmed; Cameron Veal; Mark Weir; Simon Toze; Helen Stratton; Anne Roiko How can our best scientific knowledge be used to inform recreational water management? In order to address this question, we need to re-evaluate the scientific evidence base underpinning recreational water policy. This is important for two main reasons: first, water-based recreation provides significant health and well-being benefits in addition to potential health risks. Second, our analytical tools and methodologies used in quantitative microbial source tracking (QMST) and microbial risk assessment are advancing rapidly, with QMST out-pacing risk assessment. The translation of more robust scientific evidence into policy would allow recreational water users to obtain the maximum health benefits without facing undue risk. With regards to microbial exposures in natural recreational waters, pathogens are of greatest public health concern, yet faecal indicator organisms (FIOs) are still relied on to manage health risks in most cases due to the paucity and high cost of pathogen data as well the comparative ease and low cost of FIO detection. The limitations of FIOs are well documented and stem primarily from the fact that many FIOs are not pathogenic and do not correlate reliably with pathogens in natural waters. FIOs can come from a number of warm blooded animals and even environmental sources, making it difficult to determine their original source. On the epidemiological front for recreational waters, numerous studies have demonstrated a correlation between FIO concentrations and adverse health outcomes where there are point sources of faecal pollution. Conversely, few correlations have been found where there are no such point sources. In light of these discrepancies, QMST methods, which are an effective way to identify faecal pollution sources, are being combined with quantitative microbial risk assessment (QMRA) to inform both health risk assessment and management in recreational waters. This paper reports on preliminary results from research to assess the value of an integrated QMRA/QMST modelling approach to stakeholders

Page 98 of 99

managing recreational use of inland waters in south-east Queensland, Australia. The study site at Lake Somerset is not impacted by point sources of faecal pollution but is used extensively for swimming, boating, water-skiing, tubing and fishing during peak holiday periods. Against a background of non-human faecal sources of pollution, the high bather densities at the designated swimming site have raised concerns about microbial health risks due to bather shedding and the resuspension of potentially contaminated sediments. This paper presents modelled estimates of health risk based on measured concentrations of selected pathogens by qPCR and exposure profiles incorporating self-reported exposure data. These estimated levels of health risk are then evaluated in light of QMST data and self-reported health outcomes collected through a prospective cohort study conducted at the same site during several peak periods of use. Do Electronic Faucets Cause Pseudomonas aeruginosa Outbreaks in Hospital Environments? A Review Emilie Bédard, Polytechnique Montréal Additional Authors: Cindy Lalancette; Dominique Charron; Eric Déziel; Céline Laferrière; Michèle Prévost Case studies have demonstrated that electronic and thermostatic faucets are more susceptible to colonization by Pseudomonas aeruginosa than conventional taps, leading to documented outbreaks in hospitals. As the use of electronic and thermostatic faucets appears highly desirable for water conservancy and scalding prevention, it is important to establish the cause of this proliferation. A meta-analysis of published studies documenting P. aeruginosa outbreaks and occurrence in conventional and electronic faucets was performed and factors influencing increased colonization were highlighted. A multi-hospital field study sampling campaign of electronic and conventional faucets was then conducted to analyze predominant factors behind higher prevalence. The sampling campaign was conducted on electronic (n = 100) and conventional (n = 100) faucets in hospital settings. The first liter of water and swabs from the aerator and the drain were sampled. Presence of P. aeruginosa was evaluated by standard culture methods. The meta-analysis revealed a large variation in % positive for P. aeruginosa in both conventional and electronic faucets. This variation could be attributed to differences in: type of sample (swab vs water), volume sampled (50 - 500 ml), number of taps sampled, samples per tap and context (prospective study vs outbreak). Larger studies (n > 25) report lower percentage of contamination (0 - 18%) than smaller studies (58 - 100%). Unexpectedly, based on documented studies for both conventional and electronic faucets, it is not clear whether higher prevalence is necessarily associated with electronic faucets. Other factors such as sample size, configuration and material of upflow connecting pipes, water usage, and construction setting could also be determinant. Understanding specific factors leading to P. aeruginosa tap colonization is critical in order to reduce its prevalence and decrease risk of exposure through appropriate device selection and installation best practices. A Decision Support System (DSS) for Recreational Water Use - Revision of the South African Water Quality Guidelines Bettina Genthe, CSIR Additional Authors: Maronel Steyn; Marius Claassen The South African Water Research Commission and Department of Water and Sanitation (DWS) embarked on revising the 1996 South African Water Quality Guidelines. The guidelines will be primarily a software-based decision support system (DSS) and "risk-based" to indicate the suitability of water, in terms of risk of specific adverse effects. The overall DWS initiative aims to develop a DSS for all significant water users, with this project addressing guidelines for recreational water use. The guidelines, in addition to being risk-based, will also be activity- and site-specific recreational water quality guidelines to enable a tiered approach to improve water resource management. Public health risks associated with recreational water activities are predominantly due to microbial microorganisms, however, chemical and physical hazards are also considered. Exposure assessment is the most important factor, as different levels, frequency of contact and events will determine the possible risk. Considerations that are essential but cannot be included in a DSS risk-based guideline should be dealt with through water safety plans and IWRM approaches. As a tiered approach is used, the DSS will allow the end-user to alter certain parameters under specific conditions requiring a detailed motivation why this is warranted. For example, in one section of the country, natural surface water pH values are in the range of 4 - 5. Cultural and religious activities such as baptisms, initiation ceremonies and rituals to name a few, are included in the revision of the recreational guidelines, necessitating a better understanding of the potential exposure/s. Acceptable risk will not be prescribed in the revised guidelines but will be put into perspective by comparing to international recreational water quality guidelines and swimming associated illness rates. The current US-EPA Recreational Water Quality Criteria (2012) allows between 32 and 36 gastro-intestinal illnesses per 1000 primary contact users (U.S. EPA, 2012). The DSS is a risk-based software tool developed to present human health risks based on different exposure scenarios, likely levels of contact and likely exposure to different volumes of water (ingested) reported in international literature and likely associations with health impacts. All routes of exposure are addressed which is specifically relevant in the case of cyanobacterial toxins which can lead to adverse health effects through inhalation, ingestion or dermal contact. This data is built into the DSS to allow for water resource managers to assess likely risk or fitness for use at specific sites based on different recreational activities. Algorithms for individual parameters have been developed for the DSS and will demonstrate uncertainties where possible.

Page 99 of 99

Occurrence of Antibiotic Resistance Genes and MST Markers in a Rural Catchment Area Claudia Strange, DVGW-Technologiezentrum Wasser Additional Author: Andreas Tiehm In recent years, the aquatic ecosystem was recognized as reservoir for bacteria carrying antibiotic resistance genes (ARGs). However, knowledge with respect to ARGs in raw water used for drinking water production is limited in particular. Karst systems are important sources of drinking water, but are also known to be vulnerable to human and animal waste contamination. In our study the occurrence of ARGs and the origins of fecal pollution were investigated at a karst spring in a rural catchment area. The occurrence of eleven antibiotic resistance genes (tet(A), tet(B), tet(C), tet(K), sulI, sulII, dfrA1, dfrA12, ermB, aadA, and blaSHV) was analyzed using PCR. The presence of fecal indicator bacteria, turbidity, electrical conductivity, and the karst spring discharge rate were determined. In addition, culture-independent Microbial Source Tracking (MST) tools for identification of fecal pollution sources (e.g. human, ruminant, chicken) were applied. The ARGs most frequently detected were sulI (48.2 %), sulII (37.5 %), dfrA1 (37.5 %), tet(B) (33.9 %) and ermB (28.6 %) which encode for resistance to sulphonamides, trimethoprim, tetracycline, and macrolides. In particular, during storm events resulting in high discharge rates (up to 0.78 cubic metres per second), maximum numbers of ARGs, E. coli and enterococci were observed. ARG copy numbers increased up to 2,800 and 12,700 gene copies per mL for suI1 and ermB, respectively. Studies into MST revealed the presence of mainly human gene markers. The study demonstrates that ARGs are present in the karst spring water used for drinking water supply. A storm water retention basin in the catchment area (located in 9 km distance from the spring) was identified as main input source for the ARGs and the simultaneously observed fecal indicator bacteria. However, the results showed that also a nearby chicken and a horse farms should also be considered as sources of fecal contamination and antibiotic resistances in the raw water. These results are currently used for improved environmental management in the catchment. Acknowledgement: The study was funded by the German Federal Ministry of Education and Research (BMBF) as part of the funding program Sustainable Water Management (NaWaM-RiSKWa, grant number 02WRS1277C and 02WRS1377G, project ARGO and HyReKA). We also thank our colleagues within the AQUAVALENS consortium (EU grant number 311846) for stimulating discussions with regard to the selection of MST markers. Critical Elements for Local Indigenous Water Security Tessa Latchmore, Public Health Ontario Additional Author: Anna Majury Indigenous communities in Canada are over represented with respect to poor water quality, including boil water advisories, and the crisis is on-going. To date, approaches to solve the water crisis, although often with good intentions, have been based on the approaches designed in the western science context with little to no consultation or dialogue with those communities most impacted and without regard for without regard for cultural beliefs. The purpose of this paper is to document traditional knowledge, perspectives and attitudes with regard to water in Indigenous communities as derived from both peer reviewed and gray literature, and to identify current water security tools utilized by Indigenous communities including the gaps. This review of the literature will provide sound evidence that addressing Indigenous water issues requires input and leadership by Indigenous communities; traditional practices must remain consistent with traditional views in order to ensure sustainable water security. An Isothermal Amplification Method Complementary to US EPA qPCR for the Detection of Enterococci in Environmental Waters Claudia Kohm, TU Wien, ICC Water&Health Additional Authors: Roland Martzy; Kurt Brunner; Robert Mach; Rudolf Krska; Georg Heinze; Regina Sommer; Georg Reischer; Andreas Farnleitner Here, we present a novel molecular assay for the detection of enterococci as markers for fecal pollution in water resources based on helicase-dependent amplification (HDA). This isothermal assay targets the exact same Enterococcus 23S rRNA gene region as existing quantitative polymerase chain reaction (qPCR) assays of the United States Environmental Protection Agency (US EPA; Method 1611 and Method 1609), but can be entirely performed on a simple heating block. During the evaluation, the developed Enterococcus HDA assay successfully discriminated 15 enterococcal target strains from 15 non-target reference strains and reliably detected 48 environmental isolates of enterococci. The limit of detection determined by analyzing a dilution series of Enterococcus faecalis genomic DNA was 25 target copies per reaction, only three times higher than that of qPCR. The applicability of the assay was tested on 30 environmental water samples, comprising spring and ground water, surface water as well as waste water (corresponding influents/effluents) to simulate a gradient of fecal pollution. Despite the use of simple instruments and the isothermal nature of the reaction, obtained results of HDA were consistent with those of the reference qPCR (χ²-test; phi = 1.000, p < 0.001). Given this performance, we conclude that the developed Enterococcus HDA assay has great potential for use as a complementary screening method to US EPA qPCR. Its ability to detect enterococcal targets by an isothermal amplification strategy offers the opportunity to deliver the benefits of molecular assays beyond well-funded, centralized laboratories. In fact, HDA-based screening approaches can broaden the applicability of molecular methods (e.g. for high-throughput analysis) and greatly increase their accessibility and overall utility (e.g. in resource-limited settings or developing regions).