Aberrant LPL Expression, Driven by STAT3, Mediates Free ... · U. Rozovski and S. Grgurevic contributed equally to this article. Corresponding Author: Zeev Estrov, The University

Signal Transduction

Aberrant LPL Expression, Driven by STAT3,Mediates Free Fatty Acid Metabolism in CLL CellsUri Rozovski1, Srdana Grgurevic1, Carlos Bueso-Ramos2, David M. Harris1, Ping Li1,Zhiming Liu1, Ji Yuan Wu1, Preetesh Jain1,William Wierda1, Jan Burger1, Susan O'Brien1,Nitin Jain1, Alessandra Ferrajoli1, Michael J. Keating1, and Zeev Estrov1

Abstract

While reviewing chronic lymphocytic leukemia (CLL) bonemarrow slides, we identified cytoplasmic lipid vacuoles in CLLcells but not in normal B cells. Because lipoprotein lipase(LPL), which catalyzes hydrolysis of triglycerides into free fattyacids (FFA), is aberrantly expressed in CLL, we investigatedwhether LPL regulates the oxidative metabolic capacity of CLLcells. We found that unlike normal B cells, CLL cells metabolizeFFAs. Because STAT3 is constitutively activated in CLL cells andbecause we identified putative STAT3 binding sites in the LPLpromoter, we sought to determine whether STAT3 drives theaberrant expression of LPL. Transfection of luciferase reportergene constructs driven by LPL promoter fragments into MM1cells revealed that STAT3 activates the LPL promoter. In addi-

tion, chromatin immunoprecipitation confirmed that STAT3binds to the LPL promoter. Furthermore, transfection of CLLcells with STAT3-shRNA downregulated LPL transcripts andprotein levels, confirming that STAT3 activates the LPL gene.Finally, transfection of CLL cells with LPL-siRNAs decreasedthe capacity of CLL cells to oxidize FFAs and reduced cellviability.

Implications: Our study suggests that CLL cells adopt theirmetabolism to oxidize FFA. Activated STAT3 induces LPL, whichcatalyzes the hydrolysis of triglycerides into FFA. Therefore, inhi-bition of STAT3 is likely to prevent the capacity of CLL cells toutilize FFA. Mol Cancer Res; 13(5); 944–53. �2015 AACR.

IntroductionChronic lymphocytic leukemia (CLL) is characterized by the

gradual accumulation of mature-appearing lymphocytes (1)whose gene expression profile and expression of the cell surfaceCD27 antigen resemble typical features of memory B cells (2,3).Normally,memory B cells are quiescent, and extracellular stimuli,such as the CD40 ligand, are required to induce their proliferation(4). Unlike memory B cells, approximately 1% of CLL cellsproliferate daily (5). However, what energy source CLL cells useand which metabolic pathways they recruit to provide the energyneeded for survival and proliferation are not known.

Lipoprotein lipase (LPL), commonly expressed in adipocytesandmuscle cells, plays a central role in lipid metabolism (6). LPLcatalyzes the hydrolysis of triglycerides into free fatty acids (FFA)and increases the cellular uptake of lipoproteins in a noncatalyticmanner (7).

LPL transcripts were found in CLL cells but not in normal Blymphocytes (3, 8), and high levels of LPL were detected on thecell surfaces and in the cytosol of CLL cells (9). Remarkably,increased levels of LPL-mRNA were correlated with unmutatedimmunoglobulin heavy-chain variable region genes, aggressivedisease, and an unfavorable prognosis (3, 8–11). However, whatactivates LPL in CLL has not been deciphered.

STAT3 is a latent cytoplasmic transcription factor that relayscytokine and growth factor signals from the cell membrane to thenucleus (12). In CLL, STAT3 is constitutively phosphorylated onserine 727 residues. Serine pSTAT3migrates to the nucleus, bindsto DNA, activates transcription, and provides CLL cells with asurvival advantage (13, 14).

In several human tumors, signal transduction pathways regu-late metabolic pathways, and in some of those tumors, lipidmetabolism is altered (15). Because STAT3 was found to mod-ulate lipid synthesis and modify the expression of genes thatregulate cellular metabolism(16), and because sequence analysisrevealed that the LPL promoter harbors g-interferon activationsequence (GAS)–like elements, known to bind STAT3, we soughtto determine whether STAT3 activates the transcription of LPL.

Here, we show that the aberrant expression of LPL is driven bySTAT3. Unlike normal B cells, the cytoplasm of CLL cells containslipid-filled vacuoles, and the cells utilize fat as an energy source inan LPL-dependent manner.

Materials and MethodsFractionation of CLL cells and normal B cells

Peripheral blood cellswere obtained frompreviously untreatedpatients with CLL who were followed at The University of TexasMD Anderson Cancer Center Leukemia Clinic after we received

1Department of Leukemia,The University of Texas MDAnderson Can-cer Center, Houston, Texas. 2Department of Hematopathology, TheUniversity of Texas MD Anderson Cancer Center, Houston, Texas.

Note: Supplementary data for this article are available at Molecular CancerResearch Online (http://mcr.aacrjournals.org/).

U. Rozovski and S. Grgurevic contributed equally to this article.

Corresponding Author: Zeev Estrov, The University of Texas MD AndersonCancer Center, 1515 Holcombe Blvd, Unit 0428, Houston, TX 77030. Phone: 713-794-1675; Fax: 713-745-4612; E-mail: [email protected]

doi: 10.1158/1541-7786.MCR-14-0412

�2015 American Association for Cancer Research.

MolecularCancerResearch

Mol Cancer Res; 13(5) May 2015944

on March 25, 2021. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst March 2, 2015; DOI: 10.1158/1541-7786.MCR-14-0412

http://mcr.aacrjournals.org/

Institutional Review Board approval and written informed con-sent from the patients (Supplementary Table S1). To isolate low-density cells, the patients' peripheral blood cells were fractionatedusing Ficoll–Hypaque 1077 (Sigma-Aldrich). More than 90% ofthe peripheral blood lymphocytes obtained from these patientswere CD19þ/CD5þ, as assessed by flow cytometry (Becton, Dick-inson and Company). Peripheral blood samples from healthydonors were obtained from theCentral Blood Bank as buffy coats.After Ficoll–Hypaque fractionation, the donors' B cells wereisolated using Miltenyi CD19–coated beads according to themanufacturer's instructions (Miltenyi Biotec).

Cell cultureThe fractionated CLL cells were maintained in DMEM (Sigma-

Aldrich) supplemented with 10% FBS (HyClone). Cells from thehuman multiple myeloma line MM1 were obtained from theATCC.MM1cells weremaintained inRPMI 1640 (Sigma-Aldrich)supplemented with 10% FBS in a humidified atmosphere of 5%CO2 at 37�C. The human renal epithelial carcinoma 293T cellswere grown in DMEM (Sigma-Aldrich) supplemented with 10%FCS (HyClone). Human umbilical vein endothelial cells(HUVEC)weremaintained in vascular endothelialmedium(bothfrom Lonza).

Oil RedO staining of bonemarrow aspirates fromCLL patientsSlides of bone marrow aspirates from the patients with CLL

were placed in absolute propylene glycol for 2 minutes andstained in Oil Red O solution for 16 hours, after which thestained slides were transferred to an 85% propylene glycolsolution for 1 minute, rinsed in distilled water, counterstainedinMayer's hematoxylin solution (Sigma-Aldrich) for 15 seconds,rinsed in distilled water, and mounted in a warmed glycerin jellysolution.

Transmission electron microscopyTransmission electron microscopy (TEM) visualization of CLL

and normal B cells was done as previously described (17). Briefly,pieces of agarose containing embeddedCLLornormal B cellsweretrimmed into 1- to 2-mm3 cubes using a razor blade. After stainingthe sampleswith en blocwith 1%Millipore-filtered uranyl acetate(EMD Millipore), they were dehydrated in increasing concentra-tions of ethanol and then infiltrated and embedded in LX-112medium. The samples were then polymerized at 60�C for 2 daysand cut using a Leica Ultracut microtome (Leica Microsystems),stained with uranyl acetate and lead citrate using a Leica EMstainer, and examined using a JEM 1010 transmission electronmicroscope (JEOL USA, Inc.) at an acceleration voltage of 80 kV.Digital images were obtained using the AMT Imaging System(Advanced Microscopy Techniques, Corp.).

Confocal microscopyCLL low-density cells were incubated in microtubes in PBS

supplemented with 5% bovine serum albumin (BSA) medium(Cell Signaling Technology). After 1 hour of incubation, the cellswerewashed three timeswith PBS and then incubatedwithmouseanti-LPL antibodies (Abcam) or mouse anti-CD19 antibodies(BD Biosciences) for 1 hour. After washing three more times inPBS, the cells were incubated with Alexa Fluor 488–labeled anti-mouse antibodies (Invitrogen/Life Technologies) for 1 hour,washed in PBS, resuspended in a 0.1% solution of Evans bluedye (Sigma-Aldrich) for 5 minutes, and washed in PBS to remove

unbound dye. The cells were resuspended in PBS and placed intom-slide VI0.4 chamber slides (ibidi, LLC) for microscopic analysis.The slides were viewed using an Olympus FluoView 500 LaserScanning Confocal Microscope (Olympus America), and imageswere analyzed using the FluoView software (Olympus America)

Western blot analysisWestern blot analysis was performed as previously described

(18). Briefly, cell lysates were assayed for their protein con-centrations using the bicinchoninic acid protein assay reagent(Pierce Chemical). Each set of paired lysate was adjusted for thesame protein concentration. A lysate of CLL cell extract wasmixed with 4x Laemmli sample buffer and was then denaturedby boiling for 5 minutes. Forty micrograms of lysates weredissolved separated using 8% SDS–PAGE and then transferredto a nitrocellulose. The transfer was done overnight at 30 V in acooled (4�C) reservoir. The nitrocellulose membrane was thenplaced in a Ponceaus S staining to verify equal loading ofprotein. The membranes were blocked with 5% dried milkdissolved in 50 mL of PBS. After blocking, the membrane wasincubated with the following primary antibodies: monoclonalmouse anti-human STAT3 (BD Biosciences; Cat# 610190; in adilution of 1:2 � 103), monoclonal rabbit anti-human Tyr705STAT3 antibodies (Cat# 9131; Cell Signaling; in a 1:103 dilu-tion), monoclonal mouse anti-human LPL (Abcam; Cat#21356; in a dilution of 1:103), and mouse anti-human b-actin(Sigma-Aldrich). After incubation with horseradish peroxi-dase–conjugated secondary antibodies (GE Healthcare) for 1hour, blots were visualized with an enhanced chemilumines-cence detection system (GE Healthcare).

Densitometry analysis was performed using an Epson Expres-sion 1680 scanner (Epson America, Inc.). Densitometry valueswere normalized by dividing the numerical value of each samplesignal by the numerical value of the signal from the correspondinglevels of each sample's density by the density of the correspondingb-actin protein, used as a loading control.

Measurement of cellular O2 consumptionBecause fatty acid metabolism increases O2 consumption,

palmitic acid, and oleic acid, utilization was assessed by measur-ing the level of dissolved O2 (dO2) using the SevenGo proDissolved Oxygen Meter (Mettler Toledo).

Preliminary experiments designed to test FFA consumptionthat used palmitic acid or oleic acid dissolved in ethanol deter-mined that the O2 consumption with 80 mmol/L palmitic acidand 2 mmol/L oleic acid each (both from Sigma-Aldrich) ismaximal, and therefore, we used these concentrations in thefollowing experiments. In these experiments, we also found thatwhen used in combination palmitic acid and oleic acid increaseO2 consumption more than each of these components separately(data not shown).

In each experiment, we used CLL cells, normal B cells, orHUVECs at a concentration of 2 to 3 � 106 cells/mL. The cellswere incubated with a minimum essential medium (MEM) withHank's salts and L-glutamine (Life Technologies) or with PBSmedium (Invitrogen) for 48 to 72 hours in tightly sealed T25tissue culture flasks (Corning) at 37�C in the presence or absenceof palmitic acid or oleic acid. In control experiments, CLL cellswere incubated in PBS with or without ethanol. The O2 meterprobe was placed in the flask, and the reading allowed stabilizing.Then, the dO2 level was recorded. The probe was cleaned before it

Aberrant, STAT3-Driven LPL Mediates CLL Metabolism

www.aacrjournals.org Mol Cancer Res; 13(5) May 2015 945




was reused. Measurements of dO2 were repeated at least threetimes for every data point. We used the Student t test when oneexperimental condition was compared to nontreated (controls)and one-way ANOVA when 2 experimental conditions werecomparedwith controls. Statistical analyseswere performed usingGraphPad version 5.

Transfection of CLL cells with LPL siRNAFive microliters of siPORT NeoFX agent and 50 pmol of

either siRNA-targeting LPL (Applied Biosystems) or the FAM-labeled siRNA targeting the human glyceraldehyde 3-phos-phate dehydrogenase (GAPDH; Life Science Technologies)were each diluted in 50 mL of OPTI-MEM I and then mixedtogether and incubated at room temperature for 10 minutes. Atotal of 5 � 106 cells suspended in 0.2 mL of OPTI-MEM Imedium containing the siRNA and transfection agent wereincubated at room temperature. After 1 hour of incubation,

transfections were performed by electroporation (Bio-Rad Lab-oratories), and then the cells were cultured in complete RPMI1640 medium. Transfection efficiency was calculated on thebasis of the GFP-conjugated siRNAmeasured by flow cytometry(Becton, Dickinson and Company).

Transfection of MM1 cells with LPL promoter fragments andluciferase assay

LPL promoter fragments were transfected into MM1 cells byelectroporation as previously described (19, 20). Each constructincluded the luciferase reporter gene and the fragment either143 bp upstream of the transcription start site (TSS) of the LPLgene, a region that includes one putative STAT3 binding site, or333 bp upstream of the LPL gene TSS, a region that includes twoputative STAT3 binding sites. The luciferase activity of unsti-mulated or IL6-stimulated MM1 cells was assessed 48 hoursafter transfection using the Dual-Luciferase Reporter Assay

Figure 1.Lipid vacuoles are detected in bone marrow CLL cells. A, CLL patients' bone marrow aspirate smears stained with Oil Red O imaged using light microscopy showleukemia cells with stained inclusion bodies. B, TEM showing numerous lucent vacuoles 100 to 500 nm in diameter (black arrows) scattered in the cytoplasmof a CLL cells. Enlarged micrographs of the areas in the boxes (left) are depicted in the right plot. The white arrow points to a 30-nm peroxisome adjacent thenuclear membrane. C, TEM images of normal B cells. Unlike in CLL cells, lipid vacuoles are not seen in the cytoplasm of normal B lymphocytes. Cell regionssuspected to contain vacuoles (black boxes, left) were enlarged and, as shown in the right plot, did not contain lipid vacuoles.

Rozovski et al.

Mol Cancer Res; 13(5) May 2015 Molecular Cancer Research946




System (Promega) and the SIRIUS luminometer V3.1 BertholdDetection Systems (Titertek-Berthold). The luciferase activity ofeach of the human LPL promoter constructs was determined bycalculating the constructs' luciferase activity relative to theactivity of the Renilla luciferase produced by the pRL-SV40control vector.

Chromatin immunoprecipitation assayThe chromatin immunoprecipitation (ChIP) assay was per-

formed according tomanufacturer's of the SimpleChIP EnzymaticChromatin IP Kit (Cell Signaling Technology) as previouslydescribed (20). The primers to amplify the human LPL promoterwere F': AGC AAT GAG GTA TGT GTG TAG and R: CTA CAT CATTAT CAG GGT TAC, which generate a 144-bp product that coversthepromoter regionflanking 1 to 144bpupstreamof LPL; F': GAGATTGAAACTGAAGCACTGandR': TGCCCATTGCACTTGATTGTG, which generate a 83-bp product that covers the promoterregion flanking 250 to 333 bp upstream of LPL; and F': ATT TCTTCA GCA GGG TTT GCC and R': AAA CTA TGG GAT TCC TAGGGG, which generate a 111-bp product that covers the promoterregion flanking 563 to 674 bp upstream of LPL.

Infection of CLL cells with GFP-conjugated lentiviral STAT3shRNA

The supernatant of 293T cells, cotransfected with GFP-lentivi-rus STAT3-shRNA (shRNA) or GFP-lentivirus empty vector andthe packaging vectors pCMVdeltaR8.2, was used to infect CLL cellswith STAT3-shRNA or the empty vector as previously described(14). Briefly, CLL cells (5 � 106/mL) were incubated in 6-wellplates (Becton Dickinson) in 2 mL DMEM supplemented with10% FCS and transfected with 100 mL of viral supernatant.Polybrene (10 ng/mL) was added to the viral supernatant at aratio of 1:1,000 (v/v). Transfection efficiency was measured after48 hours and was found to range between 30% and 60%[calculated on the basis of the ratio of propidium iodide (PI)–negative/GFP-positive cells].

RNA purification and quantitative reverse transcription PCRRNA was isolated using an RNeasy purification procedure

(QIAGEN Inc.). RNA quality and concentration were analyzedwith a NanoDrop spectrophotometer (ND-1000; NanoDropProducts). Five hundred nanograms of total RNA was used inone-step quantitative reverse transcription PCR (qRT-PCR) withthe sequence detection system ABI Prism 7700 using TaqMangene expression assays (all from Applied Biosystems) for STAT3,ROR1, c-Myc, cyclin D1, p21, VEGF-c, RPL30, and LPL according tothe manufacturer's instructions. Samples were run in triplicate,and relative quantification was performed using the comparativeCT method (20).

Apoptosis assayThe rate of cellular apoptosis was analyzed using double

staining with a Cy5-conjugated Annexin V kit and PI (BD Bios-ciences) according to the manufacturer's instructions. Briefly, 1�106 cells were washed once with PBS and resuspended in 200 mLbinding buffer with 0.5 mg/mL Annexin V–Cy5 and 2 mg/mL PI.After incubation for 10 minutes in the dark at room temperature,the samples were analyzed on a FACSCalibur flow cytometer (BDBiosciences). Cell viability was calculated as the percentage ofAnnexin V–positive cells.

ResultsLipid-like vacuoles were detected in CLL cells but not in normalB cells

In reviewing bone marrow biopsies of patients with CLL, weidentified clear-appearing vacuoles in the cytoplasm of CLL butnot normal bone marrow cells. Because clear-appearing inclu-sion vacuoles are typically those of stored lipids, we stained CLLbone marrow smears from two CLL patients with Oil Red O. Asshown in Fig. 1A, Oil Red O staining confirmed that lipiddeposits are present in CLL bone marrow cells (Fig. 1A). Toconfirm that these lipid deposits were present within the cells,we used TEM and found that the lipid vacuoles visualized byTEM were present in the cytoplasm of 95% of CLL peripheralblood cells (Fig. 1B) but not in normal B cells obtained fromhealthy individuals (Fig. 1C).

LPL was detected on the surface and in the cytosol of CLL cellsSeveral reports have suggested that CLL cells, like other lipid

vacuole–containing cells (e.g., adipocytes andmyocytes; refs. 21–23), express LPL (3, 8, 24). To confirm this observation, weperformedWestern blot analysis on low-density peripheral bloodcells from 5 CLL patients. As shown in Fig. 2A, we detected LPLprotein in all five CLL patients' samples but not in normal B cells.Then, using confocal microscopy, we confirmed this observationand found that LPL was present on the surfaces and in thecytoplasm of CLL cells (Fig. 2B).

Normal B cells

B2B11 2 3 4 5

CLL patient #

HeLa

pSTAT3 (Ser727)

STAT3

LPL (53 Kd)

ββ-Actin

A

Evans blueLPL Merge

Evans blueCD19 Merge

B

Figure 2.LPL is detected in CLL cells but not in normal B cells. A, Western blot analysisof lysates from five CLL cells and two normal B cells detected LPL andpSTAT3 in CLL cells but not in normal B cells. STAT3was detected in normal Bcells but at levels lower than those in CLL cells. B, confocal microscopicimages (�400) of freshly isolated CLL cells stained with anti-CD19and anti-LPL antibodies for 1 hour. LPL was detected on cell surfaces andcytoplasm of CLL cells.






A

PalmiticControlacid

P = 0.007

PalmiticControlacid

Oleicacid

Normal B cellsPBS

OleicControlacid

P = 0.001

0.85

0.90

0.95

1.00

0.85

0.90

0.95

1.00

Rel

ativ

eO

2co

nce

ntr

atio

nR

elat

ive

O2

con

cen

trat

ion

Palmiticacid

Control Oleicacid

P < 0.0001

P = 0.001

0.85

0.90

0.95

1.00

0.85

0.90

0.95

1.00

Control

ETOH PA OA

CLL cells

CLL cells

and P

A

CLL cells

and O

A

0.85

0.90

0.95

1.00

1.05B

Rel

ativ

eO

2co

nce

ntr

atio

n

*

*****

GAPDH

LPL siRNA

Annexin V

PI

Patient 1

70%1%

13% 16%

76%1%

6% 17%

17%0.6%

39%43%

Patient 2

15%0.7%

49%

LPL siRNA

36%

GAPDH

C

D

LPL-siRNAGAPDHDel

ta a

po

pto

sis

rate

(Bef

ore

/aft

er t

ran

sfec

tio

n) P = 0.03

E

–7

–6

–5

–4

–3

–2

–1

0

1

2

Rel

ativ

e fo

ld c

han

ges

GAPDH

LPL

LPL

18S

LPL- GAPDHsiRNA

0.96

0.98

1.00

Non-transfected

LPL-siRNAGAPDH

P = 0.001

NS

Rel

ativ

eO

2co

nce

ntr

atio

n

100

80

60

40

20

0

Rozovski et al.





FFAs increase the metabolic rate of CLL cellsThe presence of lipid vacuoles in the cytoplasm of CLL cells

suggested that, like adipocytes and myocytes, CLL cells utilizelipids as a cellular energy source. Active metabolism increases O2

consumption and, as a result, decreases the levels of dO2 in thecells' culture medium. Therefore, to estimate levels of CLL cellmetabolism, wemeasured the levels of dO2 in the medium of theCLL cells incubated in the presence or absence of palmitic acid oroleic acid. After 48 hours of incubation with or without glucose-free media, the levels of dO2 were significantly lower in thepresence of palmitic acid or oleic acid than in the absence ofeither FFA (Fig. 3A). In contrast, incubation of normal B cells withpalmitic acid or oleic acid did not change the dO2 levels in theculturemedia of normal B cells (Fig. 3A) orHUVEC cells (data notshown), suggesting that CLL cells, but not normal B cells, metab-olize FFAs. To determine whether the decrease in dO2 resultedfrom increased cellular metabolism, we performed an additionalexperiment in which wemeasured dO2 in the presence or absenceof CLL cells. An insignificant decrease in dO2 was observed in theabsence of cells. However, the addition of CLL cells significantlydecreased dO2 and the addition of FFA induced the most signif-icant decrease in dO2 levels, suggesting that increased cellularmetabolism induced a major reduction in dO2 levels (Fig. 3B).

LPL provides CLL cells with survival advantageAlthough LPL is universally overexpressed in CLL cells, LPL's

mRNA and protein levels were reported to be higher in high-riskCLL(9). To test whether LPL provides CLL cells with survivaladvantage, we transfected CLL cells with LPL-shRNA. While aconsiderable overlap in cell viability between cells treated withLPL-shRNA and controls was observed, LPL knockdown signifi-cantly reducedCLL cell viability (Fig. 3CandD)andabrogateddO2

consumption in the presence of palmitic acid, suggesting that LPL-siRNA reduced the capacity of CLL cells as to oxidize FFA (Fig. 3E).

STAT3 activates the LPL promoter in MM1 cellsBecause STAT3 is constitutively phosphorylated (14) and LPL is

aberrantly expressed in CLL cells (3, 8), we wondered whetherSTAT3 activates the transcription of LPL. Using the TFSEARCHdatabase (25), we identified two GAS-like elements that are

known putative STAT3 binding sites (26)within 400 bp upstreamof the LPL TSS. To determine whether STAT3 activates the LPLpromoter, we usedMM1 cells. IL6 induces the phosphorylation ofSTAT3 in various cell types, includingMM1 cells (14, 27, 28), thusprovidinguswith apSTAT3-inducible system. IncubationofMM1cells with IL6 induced STAT3 phosphorylation and upregulatedLPL protein levels in a dose- and time-dependent manner(Fig. 4A).

To assess the capability of each putative STAT3 binding site toactivate the LPL promoter activity, we transfected MM1 cells withthe luciferase reporter gene driven by fragments of the LPLpromoter (Fig. 4B, top). As shown in the lower plot of Fig. 4B,the promoter activity was detected only in MM1 cells transfectedwith the 333-bp fragment and not in those transfected with the143-bp fragment, suggesting that the GAS-like element locatedbetween bp –280 and bp –294 but not the one between bp –86and bp –95 upstream of the TSS is an active STAT3 binding site.Moreover, whenMM1 cells transfected with the 333-bp promoterfragment were incubated with IL6, the promoter activity wasmarkedly increased (Fig. 4B).

To decipher this observation, we used a ChIP assay. As shownin Fig. 4C, only primer 2, corresponding to the–333bp to–250bpsequence, but not primer 1 (downstream of primer 2) or primer 3(upstream of primer 2), amplified DNA that coimmunoprecipi-tatedwith anti-STAT3 antibodies (Fig. 4C). To determine whetherpSTAT3-LPL promoter binding activates the transcription of LPL,we transfectedMM1 cells with STAT3 siRNA, incubated themwithIL6 for 2 hours, and assessed LPL and various other STAT3-regulated genes' mRNA levels using qRT-PCR. As shown in Fig.4D, STAT3 siRNA downregulated mRNA levels of LPL and theSTAT3-regulated genes STAT3, Bcl2, c-Myc, and p21/WAF1. Inaddition, transfection of MM1 cells with STAT3-siRNA, but notwith scrambled siRNA or GAPDH, downregulated STAT3 proteinlevels by 60% and LPL protein levels by 70% (Fig. 4E), suggestingthat STAT3 binds to the LPL promoter, activates the LPL gene, andinduces the production of LPL protein in MM1 cells.

STAT3 activates the LPL promoter in CLL cellsAfter establishing that STAT3 activates the LPL promoter in

MM1 cells, we sought to determine whether STAT3 activates the

Figure 3.Palmitic acid and oleic acid increase CLL cells' metabolism. A, CLL cells were incubated with MEM in the presence or absence of 80mmol/L palmitic acid (left top) oroleic acid (right top) in sealed tissue culture flasks. In a separate experiment, CLL cells were incubated with PBS in the presence or absence of FFA (left bottom). Theculture media dO2 concentration was assessed before and after 48 hours of incubation. All control cultures contained ethanol at the same concentration asin palmitic acid and oleic acid. To compare dO2, we used the difference in 02 before and after the incubation (inmg/L). The relative difference in dO2 before and afteradding FFA is depicted after the dO2 in the controls was set to 1. Similar experiments with normal B cells (right bottom) showed no change in the culturemedia dO2 concentration. The mean and SEM from 3 different patients for each condition are represented by the bars. B, dO2 concentration was measured after 48hours incubation of PBS (control), ethanol (ETOH; at the concentration present in palmitic acid and oleic acid), palmitic acid (PA), or oleic acid (OA) with orwithout CLL cells. Marked reduction in dO2 after 48 hourswas observed only when CLL cells were added to culture. � , P¼ 0.02; ��, P¼ 0.002; �� , P < 0.0001. C, flowcytometry analysis of CLL cells from 2 patients. Depicted are analyses of CLL cells from 2 different CLL patients transfected with LPL-siRNA or with GAPDH(transfection control). The percentages of viable cells are shown in the left bottom quadrant (Annexin V/PI-negative) of each panel. D, spontaneous apoptosisrate was recorded from CLL cells of 7 CLL patients before and 72 hours after transfecting the cells with LPL-siRNA or with GAPDH (transfection control).Significant increase in apoptosis rate in cells transfectedwith LPL-siRNAwasobserved. Thedata are depicted as delta apoptosis rate before and after transfection. Toassess the differences in apoptosis rates of cells transfected with LPL-siRNA and GAPDH, we used the Student t test with delta apoptosis as the dependentvariable. E, LPL knockdown abrogates oxygen consumption in the presence of palmitic acid. CLL cells were transfected by electroporation with LPL-siRNA or withFAM-labeled GAPDH or left untreated. LPL-siRNA transfection efficiency in the CLL cells ranged from 35% to 50%. Left top, PCR gel electrophoresis showingreduction in the LPL transcript level after treatment with LPL-siRNA. Left bottom, RNA expression after LPL-siRNA transfection as shown by qRT-PCR. LPLexpressionwasfive times lower in cells transfectedwith LPL-siRNA than in cells transfectedwithGAPDH. Right, untreated cells or cells transfectedwith LPL-siRNAorwithGAPDHwere incubated in thepresence of palmitic acid. After 48hours, thedO2 concentrationwasmeasured. Shownare themean andSEMof three experimentsusing cells from 3 patients. The dO2 level in the culture medium of the LPL siRNA–transfected cells was significantly higher than the dO2 levels in either control.NS, not significant.






HeLa 0 0.3 1 2 3 4

1 1.4 1.9 2.2 2.1 1.8

1 1.4 1.8 1.8 0.9 0.8

STAT3

LPL (53 Kd)

Fold

pSTAT3 (Tyr705)

Fold

Time (h)

0 5 10 15 20

IL6 (ng/mL)

1 1.4 1.8 1.4 1.2

1 1.5 2.1 1.6 1.6

STAT3

LPL (53 Kd)

Fold

pSTAT3 (Tyr705)

Fold

HeLa

A

ATG LPL

–298 CTGAGTTTCTTGGAAATTTGG –278

–95 TTCTCAGAAA –86

–400 bp

–333 bp

–143 bp

Luc

Luc

IL6

Ctrl

Relative luciferase activity (RLU/s X1,000)

0.070.060.050.040.030.020.010

B

Primer 1 (–674 ― –563 bp)

Primer 2 (–333 ― –250 bp)

Primer 3 (–144 ― + 1 bp)

Input

STAT3 Abs.

Cont. IL6

C D 2

–2

–4

–6

–8

–10

–12

–14

0 CTRL

STAT3 Bcl2 c-Myc p21 LPL

Fo

ld c

han

ge

STAT3

b-Actin

Fold

LPL

1 0.8 0.4 1.4

Fold1 1.1 0.3 0.9

E

Rozovski et al.





transcription of LPL in CLL cells. To that end, we performed ChIP.As shown in Fig. 5A, we found that anti-STAT3 antibodies coim-munoprecipitated DNA of the LPL promoter and of the STAT3-regulated genes STAT3, c-Myc, p21, VEGF-c, andROR1. As inMM1cells, primers of the LPL promoter binding site 2, but not site 1 or

3, amplified the STAT3 coimmunoprecipitated DNA (Fig. 5A,right), suggesting that the GAS-like element 280 bp upstream ofthe LPL coding region is an active STAT3 binding site in CLL.

We then sought to determine whether STAT3 activates LPL inCLL cells. We transfected CLL cells with a lentiviral STAT3 shRNA

Input STAT3 IgG

Primer 1 (–674 ― –563 bp)

Primer 2 (–333 ― –250 bp)

Primer 3 (–144 ― +1 bp)

c-Myc

p21

STAT3

VEGF-c

ROR1

RPL30

Input STAT3 IgGA

B C

0

2

4

6

8

10

12

14

16

Patient1

Primer 1

Primer 2

Primer 3

Fo

ld c

han

ge

Patient2

STAT3 Bcl2 c-Myc Cyclin D p21 VEGF LPL

CTRL

42

0–2–4

–6

–8–10–12

–14–16–18

Fo

ld c

han

ge

STAT3

b-Actin

Fold

LPL

Fold

Control

Empty

vect

or

STAT3-sh

RNAHeL

a

1 0.9 0.2

1 1 0.2

Figure 5.STAT3 activates the LPLpromoter in CLLcells. A, ChIP assay. CLL cell proteinextract was incubated without or withanti-STAT3 antibodies, and DNA wasextracted from chromatin fragments. Asshown in the left plot, anti-STAT3antibodies coimmunoprecipitated DNAof the STAT3 target genes c-Myc, p21,STAT3, VEGF-c, and ROR1 but not of theribosomalRPL30 gene (used as negativecontrol). As in Fig. 4C, "Input" denotesDNA extracted fromnonimmunoprecipitated CLL cellchromatin fragments (negative control)IgG is the isotype of the anti-STAT3antibodies. The right top panel depictsChIP of CLL cells. As shown, STAT3coimmunoprecipitated DNA that wasamplified with primers designed toamplify site 2 but not primers designedto amplify site 1 or site 3 of the LPLpromoter regions. The right bottompanel depicts results of two separateexperiments analyzed using qRT-PCR.Similar to the results depicted in the righttop panel, STAT3 coimmunoprecipitatedDNA was significantly amplified withprimer 2. B, CLL cells were transfectedwith STAT3-shRNA or with an emptyvector. Compared with cells transfectedwith empty vector (CTRL), the cells thatwere transfected with STAT3-siRNAexpressed significantly lower levels ofSTAT3-regulated genes including LPL. C,Western blot analysis of CLL cellstransfected with STAT3 shRNA or emptyvector showed that compared with anempty vector, STAT3 shRNAdownregulated STAT3 and LPL proteinlevels by 80%.

Figure 4.STAT3 activates the LPL promoter in MM1 cells. A, detection of pSTAT3 and LPL in IL6-stimulated MM1 cells. MM1 cells were incubatedwith increasing concentrationsof IL6 (0 to 20 ng/mL) for 2 hours (left), and with 10 ng/mL of IL6 for 0 to 4 hours (right). Cell lysates underwent Western blot analysis with anti-tyrosinepSTAT3, anti-STAT3, and anti-LPL antibodies. HeLa cells incubatedwith IL6 for 4 hourswere used as positive controls in each panel. Incubationwith IL6 increased thelevels of tyrosine pSTAT3 and LPL in a dose- and time-dependent manner. B, on the basis of the presence and locations of GAS-like elements in the LPLpromoter (top), we transfected MM1 cells with truncated forms of the LPL promoter and the luciferase reporter gene (left bottom). In the right bottom plot, thehorizontal bars show themean� SEM for luciferase activity levels of transfectedMM1 cells incubatedwithout orwith 20ng/mL IL6. C, ChIP assay. DNAobtained fromchromatin fragments of MM1 cells incubated without or with IL6, before (input) or after coimmunoprecipitation with anti-STAT3 antibodies, was analyzedusing primers directed at three GAS-like elements located betweenþ1 bp and –674 bp upstream of the LPL gene TSS. DNA coimmunoprecipitated with anti-STAT3antibodies could be amplified by with primer 2 but not 1 or 3. The amplification of the DNA from IL6-treated cells was stronger than that from untreated cells. D,transfection with STAT3 siRNA. MM1 cells were transfected with STAT3 siRNA using electroporation. Transfection efficiency, calculated by assessing thelevel of intracellular GFP-conjugated siRNA,was 50%. The cellswere incubatedwith IL6 for 2 hours, and then RNAwasextracted and qRT-PCR performed to determinethe levelsof theSTAT3-regulatedgenesSTAT3,ROR1, c-Myc, cyclinD1,p21, andLPL. Theexperimentwas repeated three times.Themeanand theSEMofmRNA levelsaredepicted. As shown, a 12-fold decrease in the LPL transcript level and 2- to 8-fold decreases in STAT3-regulated transcript levels compared with the controlwere observed. E, CLL cells were transfected with STAT3 siRNA, scrambled siRNA, or GAPDH. Cellular protein was extracted and analyzed by Western blot analysis.






(transfection efficiency, 50%) or with an empty vector and quan-titated LPL and STAT3-regulated gene mRNA levels by usingrelative qRT-PCR. As shown in Fig. 5B, transfection with STAT3shRNA reduced the mRNA levels of LPL and the STAT3-regulatedgenes STAT3, Bcl2, c-Myc, cyclin D1, p21/WAF1, and VEGF. Fur-thermore, unlike the empty vector, STAT3 shRNA downregulatedSTAT3 and LPL protein levels by 80% (Fig. 5C). Taken together,our findings suggest that STAT3 binds and activates the LPLpromoter and induces the expression and production of LPL.

DiscussionIn this study, we found that CLL cells, unlike normal B lym-

phocytes but similar to adipocytes and myocytes, store lipids incytoplasmic vacuoles and are capable ofmetabolizing stored FFAsin an LPL-dependent manner.

Traditionally, CLL has been characterized by an accumulationof immunologically abnormal, long-lived lymphocytes (29).However, data generated in the past decade showed that approx-imately 1%of CLL cells are regenerated daily (5). Various cells usedifferent strategies to provide energy to fuel proliferation (30).One such strategy, used physiologically by adipocytes and myo-cytes, is the generation of cytoplasmic lipid stores that serve as areadily available energy source. This strategy has been adopted byvarious cancer cells. For example, the "starry sky" pattern, char-acteristically found in Burkitt's lymphoma, is caused by an abun-dance of intracellular lipid vacuoles used as an energy source inthis highly aggressive lymphoma (31). We found that CLL cells,similar to Burkitt's lymphoma cells but unlike normal B lympho-cytes, store lipids in a form of cytoplasmic lipid vacuoles. Wecouldnot study lymphnodeCLL cells.However, becauseCLL cellstraffic between the lymph nodes blood and bonemarrow (1), it isreasonable to assume that lymph node CLL cells carry similarfeatures. Remarkably, it was found that the gene expression profileof CLL cells is skewed toward the expression of genes usuallyexpressed inmuscle and fat tissue (32). It is therefore likely that toadjust for cellular survival and a proliferation rate higher than intheir cell of origin, CLL cells adopted the strategy of mammalianmuscle cells and adipocytes, which store intracellular lipids andproliferate at similar rates (33).

Similar to adipocytes, CLL cells express LPL on their surface andin their cytoplasm and store lipids in cytoplasmic vacuoles.However, the functional significance of the expression of LPL inCLL cells is not entirely clear. Overexpression of lipase activity–associated genes (34) and increased lipase activity were found inCLL cells (34). Conversely, other investigators suggested that LPLis catalytically inactive in CLL cells (35) and that LPL knockdowndidnot affect the survival ofCLL cells (36).Here,we show that LPLprovides CLL cells with survival advantage. Transfection of CLLcells with LPL-siRNA increased CLL cell apoptosis rate by anaverage of 32%. Whether this effect is induced by an abrogationof the catalytic or noncatalytic function of LPL remains to bedetermined.

FFAs, the product of triglyceride hydrolysis by LPL, are the fuelused for oxidative phosphorylation, and are also required toprompt the enzymatic machinery needed for their own metabo-

lism. FFAs bind the PPAR-activated alpha (PPARa) which trans-locates to the nucleus and induces the transcription enzymes thatare needed for fatty acid oxidation (37). Remarkably, PPARa wasfound to be expressed by CLL cells, and CLL cell palmitic acidoxidation rate was similar to the oxidation rate typically found infat-burning cells (38).

Our previous studies suggested that the unique gene signatureof CLL is driven in part by constitutively activated STAT3 (19,20, 39, 40). In the current study, we show that STAT3 binds to theLPL promoter and activates the transcription of LPL. Transfectionof CLL cells with STAT3-shRNA significantly downregulated LPLmRNA and protein levels, suggesting that the transcription of LPLin CLL cells is STAT3 dependent. STAT3 is not the only transcrip-tion factor that induces LPL gene expression. Abreu and colleagues(41) suggested that in CLL patients with unmutated IgHV micro-environment-induced demethylation contributes to the increasedexpression of LPL in CLL. Nonetheless, our data suggest that thesurvival advantage provided by constitutively activated STAT3(14) is mediated in part by the contribution of STAT3 to the CLLcells' metabolism.

Taken together, our findings suggest that CLL cells store lipidvacuoles, produce LPL, and adapt their metabolism to utilizeintracellular stored lipids for energy production in an LPL-depen-dent manner, a process that is driven by STAT3.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: U. Rozovski, C. Bueso-Ramos, M.J. Keating, Z. EstrovDevelopment of methodology: S. Grgurevic, C. Bueso-Ramos, D.M. Harris,P. Li, Z. LiuAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): U. Rozovski, C. Bueso-Ramos, D.M. Harris, P. Li,Z. Liu, P. Jain, W. Wierda, J. Burger, A. FerrajoliAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): U. Rozovski, C. Bueso-Ramos, D.M. Harris, P. Li,S. O'Brien, M.J. KeatingWriting, review, and/or revision of the manuscript: U. Rozovski, P. Jain,W. Wierda, J. Burger, S. O'Brien, N. Jain, A. Ferrajoli, M.J. Keating, Z. EstrovAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): C. Bueso-Ramos, D.M. Harris, J.Y. WuStudy supervision: Z. Estrov

AcknowledgmentsThe authors thank Sarah Bronson of the Department of Scientific Publica-

tions at The University of Texas MD Anderson Cancer Center for editing thearticle.

Grant SupportThis study was supported by a grant from the CLL Global Research Foun-

dation. TheUniversity of TexasMDAndersonCancer Center is supported in partby the NIH through a Cancer Center Support Grant (P30CA16672).

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received July 23, 2014; revised February 17, 2015; accepted February 24,2015; published OnlineFirst March 2, 2015.

References1. Chiorazzi N, Rai KR, Ferrarini M. Chronic lymphocytic leukemia. N Engl J

Med 2005;352:804–15.2. Damle RN, Ghiotto F, Valetto A, Albesiano E, Fais F, Yan XJ, et al. B-cell

chronic lymphocytic leukemia cells express a surface membrane


Rozovski et al.




phenotype of activated, antigen-experienced B lymphocytes. Blood2002;99:4087–93.

3. Klein U, Tu Y, Stolovitzky GA, Mattioli M, Cattoretti G, Husson H, et al.Gene expression profiling of B cell chronic lymphocytic leukemia reveals ahomogeneous phenotype related to memory B cells. J Exp Med 2001;194:1625–38.

4. Tangye SG, Avery DT, Deenick EK, Hodgkin PD. Intrinsic differences in theproliferation of naive and memory human B cells as a mechanism forenhanced secondary immune responses. J Immunol 2003;170:686–94.

5. Chiorazzi N. Cell proliferation and death: forgotten features of chroniclymphocytic leukemia B cells. Best Pract Res Clin Haematol 2007;20:399–413.

6. Mead JR, Irvine SA, Ramji DP. Lipoprotein lipase: structure, function,regulation, and role in disease. J Mol Med (Berl) 2002;80:753–69.

7. Goldberg IJ. Lipoprotein lipase and lipolysis: central roles in lipoproteinmetabolism and atherogenesis. J Lipid Res 1996;37:693–707.

8. Rosenwald A, Alizadeh AA, Widhopf G, Simon R, Davis RE, Yu X, et al.Relation of gene expression phenotype to immunoglobulin mutationgenotype in B cell chronic lymphocytic leukemia. J Exp Med 2001;194:1639–47.

9. Heintel D, Kienle D, ShehataM, Kr€ober A, Kroemer E, Schwarzinger I, et al.High expression of lipoprotein lipase in poor risk B-cell chronic lympho-cytic leukemia. Leukemia 2005;19:1216–23.

10. Oppezzo P, Vasconcelos Y, Settegrana C, Jeannel D, Vuillier F, Legarff-Tavernier M, et al. The LPL/ADAM29 expression ratio is a novel prognosisindicator in chronic lymphocytic leukemia. Blood 2005;106:650–7.

11. Kaderi MA, Kanduri M, Buhl AM, Sevov M, Cahill N, Gunnarsson R, et al.LPL is the strongest prognostic factor in a comparative analysis of RNA-based markers in early chronic lymphocytic leukemia. Haematologica2011;96:1153–60.

12. Wang X, Crowe PJ, Goldstein D, Yang JL. STAT3 inhibition, a novelapproach to enhancing targeted therapy in human cancers (review). IntJ Oncol 2012;41:1181–91.

13. Frank DA, Mahajan S, Ritz J. B lymphocytes from patients with chroniclymphocytic leukemia contain signal transducer and activator of transcrip-tion (STAT) 1 and STAT3 constitutively phosphorylated on serine residues.J Clin Invest 1997;100:3140–8.

14. Hazan-Halevy I, Harris D, Liu Z, Liu J, Li P, Chen X, et al. STAT3 isconstitutively phosphorylated on serine 727 residues, binds DNA, andactivates transcription in CLL cells. Blood 2010;115:2852–63.

15. Carracedo A, Cantley LC, Pandolfi PP. Cancer metabolism: fatty acidoxidation in the limelight. Nat Rev Cancer 2013;13:227–32.

16. Xu Y, Ikegami M, Wang Y, Matsuzaki Y, Whitsett JA. Gene expression andbiological processes influenced by deletion of Stat3 in pulmonary type IIepithelial cells. BMC Genomics 2007;8:455.

17. Bozzola JJ. Conventional specimen preparation techniques for transmis-sion electron microscopy of cultured cells. Methods Mol Biol 2007;369:1–18.

18. Ferrajoli A, Faderl S, Van Q, Koch P, Harris D, Liu Z, et al. WP1066 disruptsJanus kinase-2 and induces caspase-dependent apoptosis in acute mye-logenous leukemia cells. Cancer Res 2007;67:11291–9.

19. Li P, Grgurevic S, Liu Z, Harris D, Rozovski U, Calin GA, et al. Signaltransducer and activator of transcription-3 induces MicroRNA-155 expres-sion in chronic lymphocytic leukemia. PLoS One 2013;8:e64678.

20. Li P, Harris D, Liu Z, Liu J, Keating M, Estrov Z. Stat3 activates the receptortyrosine kinase like orphan receptor-1 gene in chronic lymphocytic leu-kemia cells. PLoS One 2010;5:e11859.

21. Gonzales AM, Orlando RA. Role of adipocyte-derived lipoprotein lipase inadipocyte hypertrophy. Nutr Metab (Lond) 2007;4:22.

22. MerkelM, Eckel RH, Goldberg IJ. Lipoprotein lipase: genetics, lipid uptake,and regulation. J Lipid Res 2002;43:1997–2006.

23. Pradines-Figueres A, Vannier C, Ailhaud G. Lipoprotein lipase stored inadipocytes and muscle cells is a cryptic enzyme. J Lipid Res 1990;31:1467–76.

24. Ruby MA, Goldenson B, Orasanu G, Johnston TP, Plutzky J, Krauss RM.VLDL hydrolysis by LPL activates PPAR-alpha through generation ofunbound fatty acids. J Lipid Res 2010;51:2275–81.

25. Heinemeyer T, Wingender E, Reuter I, Hermjakob H, Kel AE, Kel OV, et al.Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL.Nucleic Acids Res 1998;26:362–7.

26. Aaronson DS, Horvath CM. A road map for those who don't know JAK-STAT. Science 2002;296:1653–5.

27. Berishaj M, Gao SP, Ahmed S, Leslie K, Al-Ahmadie H, Gerald WL, et al.Stat3 is tyrosine-phosphorylated through the interleukin-6/glycopro-tein 130/Janus kinase pathway in breast cancer. Breast Cancer Res2007;9:R32.

28. Leu CM, Wong FH, Chang C, Huang SF, Hu CP. Interleukin-6 acts as anantiapoptotic factor in human esophageal carcinoma cells through theactivation of both STAT3 and mitogen-activated protein kinase pathways.Oncogene 2003;22:7809–18.

29. Dameshek W. Chronic lymphocytic leukemia–an accumulative diseaseof immunologically incompetent lymphocytes. Blood 1967;29:Suppl:566–84.

30. Cairns RA, Harris IS, Mak TW. Regulation of cancer cell metabolism. NatRev Cancer 2011;11:85–95.

31. Ambrosio MR, Piccaluga PP, Ponzoni M, Rocca BJ, Malagnino V, OnoratiM, et al. The alteration of lipid metabolism in Burkitt lymphoma identifiesa novel marker: adipophilin. PLoS One 2012;7:e44315.

32. Bilban M, Heintel D, Scharl T, Woelfel T, Auer MM, Porpaczy E, et al.Deregulated expression of fat and muscle genes in B-cell chronic lympho-cytic leukemia with high lipoprotein lipase expression. Leukemia 2006;20:1080–8.

33. Neese RA, Misell LM, Turner S, Chu A, Kim J, Cesar D, et al. Measure-ment in vivo of proliferation rates of slow turnover cells by 2H2Olabeling of the deoxyribose moiety of DNA. Proc Natl Acad Sci U S A2002;99:15345–50.

34. Pallasch CP, Schwamb J, Konigs S, Schulz A, Debey S, Kofler D, et al.Targeting lipid metabolism by the lipoprotein lipase inhibitor orlistatresults in apoptosis of B-cell chronic lymphocytic leukemia cells. Leukemia2008;22:585–92.

35. Mansouri M, Sevov M, Fahlgren E, Tobin G, Jondal M, Osorio L, et al.Lipoprotein lipase is differentially expressed in prognostic subsets ofchronic lymphocytic leukemia but displays invariably low catalyticalactivity. Leuk Res 2010;34:301–6.

36. Porpaczy E, Tauber S, Bilban M, Kostner G, Gruber M, Eder S, et al.Lipoprotein lipase in chronic lymphocytic leukaemia - strong biomarkerwith lack of functional significance. Leuk Res 2013;37:631–6.

37. Rakhshandehroo M, Knoch B, Muller M, Kersten S. Peroxisome prolifera-tor-activated receptor alpha target genes. PPAR Res 2010;2010:pii:612089.

38. Spaner DE, Lee E, Shi Y, Wen F, Li Y, Tung S, et al. PPAR-alpha is atherapeutic target for chronic lymphocytic leukemia. Leukemia. 2012;27:1090–9.

39. Liu Z, Hazan-Halevy I, Harris DM, Li P, Ferrajoli A, Faderl S, et al. STAT-3activates NF-kappaB in chronic lymphocytic leukemia cells. Mol CancerRes 2011;9:507–15.

40. Badoux X, Bueso-Ramos C, Harris D, Li P, Liu Z, Burger J, et al. Cross-talkbetween chronic lymphocytic leukemia cells and bonemarrow endothelialcells: role of signal transducer and activator of transcription 3. Hum Pathol2011;42:1989–2000.

41. Abreu C, Moreno P, Palacios F, Borge M, Morande P, Landoni AI, et al.Methylation status regulates lipoprotein lipase expression in chroniclymphocytic leukemia. Leuk Lymphoma 2013;54:1844–8.






2015;13:944-953. Published OnlineFirst March 2, 2015.Mol Cancer Res Uri Rozovski, Srdana Grgurevic, Carlos Bueso-Ramos, et al. Acid Metabolism in CLL CellsAberrant LPL Expression, Driven by STAT3, Mediates Free Fatty

Updated version

10.1158/1541-7786.MCR-14-0412doi:

Access the most recent version of this article at:

Material

Supplementary

http://mcr.aacrjournals.org/content/suppl/2015/03/04/1541-7786.MCR-14-0412.DC1

Access the most recent supplemental material at:

Cited articles

http://mcr.aacrjournals.org/content/13/5/944.full#ref-list-1

This article cites 41 articles, 16 of which you can access for free at:

Citing articles

http://mcr.aacrjournals.org/content/13/5/944.full#related-urls

This article has been cited by 8 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mcr.aacrjournals.org/content/13/5/944To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-14-0412

http://mcr.aacrjournals.org/content/suppl/2015/03/04/1541-7786.MCR-14-0412.DC1

http://mcr.aacrjournals.org/content/13/5/944.full#ref-list-1

http://mcr.aacrjournals.org/content/13/5/944.full#related-urls

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/13/5/944


Documents

Aberrant LPL Expression, Driven by STAT3, Mediates Free ... · U. Rozovski and S. Grgurevic contributed equally to this article. Corresponding Author: Zeev Estrov, The University