Upload
others
View
4
Download
0
Embed Size (px)
Citation preview
A Systems Approach to Understanding Mechanisms
of Drug Induced Mitochondrial Toxicity
Thesis Submitted for the Degree of Doctor of Philosophy (PhD)
By
Ashley John Broom B.Sc. (Hons)
(CID:00725856)
Supervision
Professor Alan R Boobis OBE - Imperial College London
Professor Timothy W Gant - Public Health England
Doctor Jonathan Lyon - GlaxoSmithKline
Imperial College London
Department of Medicine
August 2015
ii
Declaration of Originality
I (Ashley John Broom), hereby declare that the data and information contained within this thesis
is, to the best of my knowledge, original and all work of others is adequately referenced.
Copyright Declaration
The copyright of this thesis rests with the author and is made available under a Creative
Commons Attribution Non-Commercial No Derivatives licence. Researchers are free to copy,
distribute or transmit the thesis on the condition that they attribute it, that they do not use it for
commercial purposes and that they do not alter, transform or build upon it. For any reuse or
redistribution, researchers must make clear to others the licence terms of this work.
iii
Acknowledgements
I am truly indebted to a vast number of people for their help, support and motivation over the past
four years. Please bear with me!
First of all I would like to thank my funding bodies (the Medical Research Council CASE award
programme and GlaxoSmithKline) for providing the opportunity to complete this PhD project.
Secondly, I would like to acknowledge the tremendous support I have received from my
industrial manager, Jon Lyon and colleagues in GlaxoSmithKline’s Safety Assessment (SA)
facility in Ware. Jon has had to calm me down, pick me up and coach me through, for which I
will always remain very thankful and appreciative for his patience and his trust in me. A massive
thank you must also go to the other SA “Mito-Team” (Gino, Jimbo, Dave and Angie) who were
all such fantastic company and a pleasure to work with (often until the early-hours of the
morning)! I especially thank Gino for his company on the infamous trip to Philadelphia where
work had to be suspended due to Hurricane Sandy in October 2012. On the other side of the pond,
I would also like to thank Jimmy Mangum, Catherine Hu and Kevin French for their support. I
would also like to acknowledge other members of the Investigative Preclinical Toxicology group.
The CPT team (Anita, Graeme and Chloe) for their guidance with cell culture and Dave Baker for
drinking beer and playing snooker with me! Elsewhere at GlaxoSmithKline, I must thank Paul
McGill and Ian Francis for their excellent electron microscopy support, the Laboratory Animal
Sciences and Histopathology team for their diligent animal experimentation, Mitul Gandhi for his
help with lactate/pyruvate analyses and the Drug-Metabolism and Pharmacokinetics groups for
performing the drug-concentration toxicokinetic analyses.
I also owe a debt of gratitude to my academic supervisor Alan Boobis, whose intellect and
unwavering support have been both admired and appreciated respectively. Furthermore, I would
like to thank Tim Gant who originally gave me this opportunity and who was so welcoming and
supportive during my 18 month stint in his laboratories in Oxfordshire. This project would not
have been possible without you both.
Away from science, I would like to say a massive thank you to my Mum, Dad and sister, Kathryn
for their love and encouragement. I am forever indebted to you for kindly letting me move home
during the process of writing this thesis. The Channel Islands (Jersey) was certainly an
atmosphere conducive to writing, despite the draw of Beauport Bay, The Watersplash Bar and El-
Tico ribs! I would also like to apologise to my friends who I have somewhat neglected over the
past four years… I hope I can make up for this soon.
Finally a big thank you to my girlfriend Laura for her love and support throughout thesis
complications, gene-chip malfunctions, cell-culture contaminations etc... But most of all just for
being there. I promise to be there for you too.
iv
Abstract
A Systems Approach to Understanding Mechanisms of Drug Induced
Mitochondrial Toxicity
Ashley J Broom, Imperial College London, Department of Medicine
Mitochondria are important to the pharmaceutical industry. Mitochondrial perturbation is central
to the aetiology of many poorly treated human diseases (e.g. neurodegenerative diseases, diabetes
and cancer) and hence mitochondria are increasingly becoming therapeutic targets. However,
drug-induced mitochondrial toxicity (DIMT) has also gained recognition as a significant cause of
safety related attrition (including multiple post-market withdrawals). The present work ultimately
aimed to discern the mechanisms downstream of DIMT in vitro and in vivo with two tool
compounds which act via inhibition of the mitochondrial electron transport chain (ETC)
(GSK932121A) or via uncoupling of mitochondrial oxidative phosphorylation (GSK2617971A).
The first objective was to compare mitochondrial functional responses between in vitro (treatment
of mitochondria isolated from control animals or in vitro cell lines) and in vivo scenarios using
oxygen consumption rate (OCR) and calcium retention capacity (CRC) assays. The direction of
change in these assays was often different between the in vitro and in vivo situation. Whilst
seemingly contradictory, these differences reflect an adapted state in vivo which results from the
initial insult in combination with compensatory changes made by the tissue to maintain energy
production. In contrast, only the initial, unconfounded, response to treatment is observable in
vitro. Integration of both is key to the future risk assessment of mitochondrially-active drug
candidates.
The second objective was to use a systems approach to build candidate adverse outcome
pathways (AOP)/modes of action (MOA) for both tool compounds. AOP/MOAs were constructed
based on key events observed in vivo. With both compounds, effect on body temperature,
increased lactate/pyruvate ratio, gene expression changes indicative of a fasted state (induction of
gluconeogenic genes) and mitochondrial ultrastructure effects were key events observed in the
adverse outcome. Future work using additional compounds with mitochondrial activities would
help validate the proposed AOP/MOAs.
The third objective was to highlight markers of underlying mitochondrial perturbation with utility
for future pre-clinical monitoring in the absence of overt DIMT. A number of mitochondrial
functional changes (e.g. effect on CRC) were observed prior to the onset of overt toxicity in vivo,
with both compounds and these endpoints have potential use in tailored future studies with
mitochondrially-active drug candidates.
These findings add to the knowledgebase on DIMT, particularly with regard to the candidate
AOP/MOAs which have been postulated. This will facilitate the selection of more sensitive and
functional endpoints for use in future toxicology studies with drugs where mitochondrial
impairment is suspected.
v
Table of Contents
Acknowledgements ......................................................................................................................... iii
List of Tables ................................................................................................................................... xi
List of Figures ............................................................................................................................... xiii
List of Abbreviations .................................................................................................................... xvii
1.0. General Introduction ........................................................................................................... 1
1.1. The Importance of Drug-Induced Mitochondrial Toxicity .................................................... 2
1.2. Introduction to Mitochondria ................................................................................................. 3
1.3. Mitochondrial Structure and Genome .................................................................................... 4
1.4. Mitochondrial Function ......................................................................................................... 7
1.4.1. Mitochondria: Energy Production ............................................................................... 7
1.4.2. Mitochondria: ROS ................................................................................................... 10
1.4.3. Mitochondria: Cell Death .......................................................................................... 11
1.5. Mechanisms of DIMT .......................................................................................................... 12
1.5.1. Direct inhibitors of OXPHOS: .................................................................................. 14
1.5.2. Inhibitors of mitochondrial substrate oxidation: ....................................................... 20
1.5.3. ROS generation: ........................................................................................................ 21
1.5.4. Inducing mitochondrial permeability transition: ....................................................... 21
1.5.5. Oxidation and Mutations of mtDNA, or Inhibition of mtDNA Synthesis: ............... 23
1.5.6. Multiple Mechanisms ................................................................................................ 24
1.6. Methods of Detecting DIMT ............................................................................................... 24
1.7. Challenges and Complexities ............................................................................................... 30
1.8. The use of a Systems Approach ........................................................................................... 33
1.9. Tool Compounds Studied .................................................................................................... 34
1.9.1. GSK932121A (Complex III Inhibitor) ...................................................................... 35
1.9.2. GSK2617971A (OXPHOS Uncoupler) .................................................................... 37
1.10. Thesis Rationale and Aims .................................................................................................. 38
vi
2.0. Materials and Methods ...................................................................................................... 41
2.1. Animals ................................................................................................................................ 42
2.1.1. GSK932121A Studies – GlaxoSmithKline, Ware, Hertfordshire UK ...................... 42
2.1.2. GSK2617971A Study – GlaxoSmithKline, Upper Merion, Pennsylvania, USA ...... 42
2.2. In Life Clinical Observations ............................................................................................... 43
2.3. Preparation of Dosing Solutions .......................................................................................... 43
2.3.1. GSK932121A Studies – GlaxoSmithKline, Ware, Hertfordshire UK ...................... 43
2.3.2. GSK2617971A Study – GlaxoSmithKline Upper Merion, PA, USA ....................... 43
2.3.3. Formulation of compounds for in vitro experiments ................................................. 44
2.4. Measurement of Blood Gasses and Bicarbonate .................................................................. 44
2.5. Blood Sampling ................................................................................................................... 45
2.5.1. Preparation of plasma from whole blood samples .................................................... 45
2.6. Measurement of GSK932121A and GSK261971A Concentration in Plasma ..................... 46
2.7. Body Temperature Measurements ....................................................................................... 46
2.8. Isolated Mitochondrial Methods .......................................................................................... 47
2.8.1. Isolation of Mitochondria .......................................................................................... 47
2.8.2. Assessment of Protein Concentration ....................................................................... 49
2.8.3. Assessment of Mitochondrial Bioenergetics using the Seahorse XF24 Analyser ..... 49
2.8.4. Calcium Retention Capacity Assay ........................................................................... 51
2.8.5. Mitochondrial Membrane Potential Assay ................................................................ 53
2.8.6. Complex III Activity Assay ...................................................................................... 53
2.9. Cell Culture Techniques ...................................................................................................... 54
2.9.1. HepG2 Cell Culture and Media Composition ........................................................... 54
2.9.2. Assessment of Cytotoxicity....................................................................................... 56
2.9.3. Analysis of Whole Cell Bioenergetics in HepG2 Cells............................................. 56
2.9.4. In vitro Compound Wash out Experiment ................................................................ 58
2.10. Imaging and Histology......................................................................................................... 59
2.10.1. TEM Analysis of Isolated Mitochondrial Pellets ........................................... 59
2.10.2. TEM Analysis of HepG2 Cells....................................................................... 59
2.10.3. TEM Analysis of Liver................................................................................... 60
2.10.4. Light Microscopy of Liver ............................................................................. 60
vii
2.11. Western Blot ........................................................................................................................ 60
2.12. Reduced / Oxidised Glutathione Assay ............................................................................... 61
2.13. Measurement of Lactate / Pyruvate in Plasma ..................................................................... 62
2.14. Measurement of Lactate in Cell Culture Media ................................................................... 62
2.15. Total RNA Extraction .......................................................................................................... 63
2.15.1. HepG2 Lysate Preparation ............................................................................. 63
2.15.2. Rat Liver Tissue Homogenate Preparation ..................................................... 64
2.15.3. Total RNA Extraction .................................................................................... 64
2.16. RNA Quantification and Assessment of Integrity ............................................................... 65
2.16.1. Quantification Using the NanoDrop Spectrophotometer ............................... 65
2.16.2. Assessment of RNA Integrity ......................................................................... 65
2.17. Transcriptional Profiling using Affymetrix Genechip Microarrays ..................................... 66
2.17.1. Generation of Sense Strand cDNA ................................................................. 66
2.17.2. Fragmentation and Labelling of cDNA Template ......................................... 67
2.17.3. Hybridisation, Wash and Staining of Affymetrix Genechips ......................... 68
2.17.4. Scanning of Genechips and Statistical Analysis of Microarray Data ............. 68
2.17.5. Pathway Analysis ........................................................................................... 69
2.17.6. Compound Connectivity Mapping ................................................................. 69
2.18. TaqMan RT-PCR Analysis from In vitro Samples .............................................................. 70
2.18.1. Gene Panel ..................................................................................................... 71
2.18.2. First Strand cDNA Synthesis ......................................................................... 72
2.18.3. TaqMan RT-PCR ........................................................................................... 72
2.18.4. RT-PCR Statistical Analysis .......................................................................... 73
2.19. Global Metabolomics Profiling ........................................................................................... 73
3.0. Mechanisms of DIMT – GSK932121A Induced Complex III Inhibition ...................... 75
3.1. Introduction ......................................................................................................................... 76
3.1.1. Chapter Aims ............................................................................................................ 76
3.2. Results ................................................................................................................................. 77
3.2.1. Confirmation of Respiratory Chain Inhibition .......................................................... 77
3.2.2. Acute Dose In Vivo Study (Non Mitochondrial Endpoints) ..................................... 80
3.2.3. Acute Dose In Vivo Study (Mitochondrial Endpoints) ............................................. 86
viii
3.2.4. Transcriptomics ......................................................................................................... 90
3.3. Discussion ............................................................................................................................ 92
3.3.1. Summary ................................................................................................................... 96
4.0. A Metabolomics Approach to Understanding Mechanisms of Drug-Inudced Respiratory
Chain Inhibition ................................................................................................................. 98
4.1. Introduction ......................................................................................................................... 99
4.1.1. Chapter Aims .......................................................................................................... 100
4.1.2. Study Design ........................................................................................................... 100
4.1.3. Metabolomics Data Visualisation ........................................................................... 101
4.2. Results and Discussion ...................................................................................................... 102
4.2.1. In Life Effects and Comparison of Endpoints to Chapter 3 Study .......................... 102
4.2.2. Effect of GSK932121A on Total Metabolites in the Liver and Plasma .................. 105
4.2.3. Metabolomics: Complex III inhibition has a prominent impact on plasma TCA cycle
intermediates ........................................................................................................... 106
4.2.4. Metabolomics: Complex III Inhibition causes an increase in glycogenolysis and
glycolysis ................................................................................................................ 108
4.2.5. Metabolomics: Complex III inhibition has an effect on mitochondrial FA oxidation
……………. ................................................................................................. 111
4.2.6. Metabolomics: Complex III Inhibition has an effect on amino acid catabolism ..... 115
4.2.7. Metabolomics: Inhibition of Complex III Causes Increased Levels of Hepatic Oxidative
Stress ...................................................................................................................... 118
4.3. Further Discussion ............................................................................................................. 121
4.3.1. Metabolomics .......................................................................................................... 121
4.4. Summary…. ...................................................................................................................... 121
5.0. Integration of GSK932121A Data into an AOP/MOA ................................................. 123
5.1. Introduction – AOP/MOA of GSK932121A Toxicity ....................................................... 124
5.2. Key Events: Complex III Inhibition .................................................................................. 126
5.3. Possible Key Events: Complex III Inhibition .................................................................... 128
5.4. Associated Events .............................................................................................................. 131
5.5. Modifying Factors ............................................................................................................. 135
5.6. AOP/MOA of Respiratory Chain Inhibitors ...................................................................... 135
5.7. Summary ...................................................................................................................... 136
ix
6.0. Mechanism of DIMT– GSK2617971A Induced Uncoupling of OXPHOS .................. 138
6.1. Introduction ....................................................................................................................... 139
6.1.1. Chapter Aims .......................................................................................................... 140
6.2. Results ............................................................................................................................... 140
6.2.1. Confirmation of the Uncoupling Activity of GSK2617971A ................................. 140
6.2.2. Acute Dose In vivo Study With GSK2617971A – Non Mitochondrial Endpoints . 144
6.2.3. Acute Dose in vivo Study with GSK2617971A – Mitochondrial Endpoints .......... 147
6.2.4. Identifying Mechanisms of Toxicity following OXPHOS Uncoupling in vivo using
Transcriptomics ....................................................................................................... 154
6.3. Discussion .......................................................................................................................... 159
6.4. Summary ............................................................................................................................ 165
7.0. The Effect of Sub-Cytotoxic Concentrations of GSK932121A and GSK2617971A in vitro
and Comparison with a Bioinformatically Selected ‘Similar’ Chemical .................... 166
7.1. Introduction ....................................................................................................................... 167
7.1.1. Experimental Aims ................................................................................................. 168
7.2. Results ............................................................................................................................... 169
7.2.1. Identifying Effectual Sub-Cytotoxic Concentrations .............................................. 169
7.2.2. In Vitro Lactate Generation .................................................................................... 174
7.2.3. RT-PCR – Metabolic Switch Gene Panel ............................................................... 179
7.2.4. In vitro Electron Microscopy .................................................................................. 188
7.2.5. Compound Connectivity Mapping .......................................................................... 190
7.3. Discussion .......................................................................................................................... 198
7.3.1. Mitochondrial Toxicity, Cytotoxicity and Lactate Generation ............................... 198
7.3.2. Gene Panel Discussion ............................................................................................ 200
7.3.3. The Link Between Azacyclonol and GSK932121A and GSK2617971A ............... 202
7.3.4. Summary ................................................................................................................. 204
8.0. Thesis Discussion ............................................................................................................... 206
8.1. Manifestation of Mitochondrial Toxicity in vitro versus in vivo ............................ 207
8.2. The Use of a Systems Approach to Generate AOP’s .............................................. 209
8.3. Markers of DIMT in the Absence of Overt Toxicity .............................................. 212
8.4. Future Work ............................................................................................................ 215
8.5. Summary ................................................................................................................. 216
x
REFERENCES ................................................................................................................................ 218
APPENDIX I – STRUCTURAL ASSESSMENT OF ISOLATED MITOCHONDRIAL FRACTIONS ......... 237
APPENDIX 1.1: Transmission Electron Microscopy .................................................................. 237
APPENDIX 1.2: Western Blot ..................................................................................................... 240
APPENDIX II – FUNTIONAL ASSESSMENT OF ISOLATED MITOCHONDRIAL FRACTIONS ........... 243
APPENDIX III – CONCENTRATION OF GSK932121A IN ISOLATED LIVER MITOCHONDRIA OF RATS
TREATED WITH A 50MG/KG DOSE (CHAPTER 3) ............................................................... 246
APPENDIX IV: METABOLOMICS RAW DATA ................................................................................ 247
APPENDIX V: METABOLON PLASMA LACTATE ANALYSIS ........................................................... 251
xi
List of Tables
TABLE 1.1: Examples of assays used in the pharmaceutical industry for the analysis of DIMT .. 29
TABLE 2.1: Overview of blood sampling methodologies. ............................................................ 45
TABLE 2.2: Media constituents for HepG2 cell culture. ............................................................... 54
TABLE 2.3: HepG2 cell seeding density and flask/plate details. ................................................... 55
TABLE 2.4: Serum free Seahorse assay media constituents .......................................................... 57
TABLE 2.5: Concentration of BOFA reagents loaded into the drug injection ports and final
concentration in the well.. ..................................................................................... 57
TABLE 2.6: Details of the five antibodies comprising the mitochondrial membrane integrity western
blot antibody cocktail (ab220414). ........................................................................ 61
TABLE 2.7: Details of the primers and probes used for in vitro RT-PCR experiments ................ 71
TABLE 4.1: Statistical summary of a plasma and liver metabolite changes. ............................... 106
TABLE 4.2: Impact of GSK932121A (50mg/kg) on plasma TCAi ............................................. 107
TABLE 5.1: Experimental and literature evidence of key events in the complex III AOP/MOA
including the plausibility of the relationships between the key events and remaining
uncertainties at each stage. .................................................................................. 127
TABLE 5.2: Evidence for, and remaining uncertainty surrounding PKE’s in the AOP/MOA of
complex III inhibition. ......................................................................................... 130
TABLE 6.1: Direction of change in protein coding gene expression in GSK2617971A treated rat
livers. ................................................................................................................... 154
TABLE 6.2: IPA network analysis (biological theme analysis) of top 32 protein coding genes
differentially altered in response to GSK2617971A (30 and 60mg/kg). ............. 156
TABLE 6.3: IPA-Tox analysis of top 32 protein coding genes differentially altered in response to
GSK2617971A. ................................................................................................... 158
TABLE 7.1: Genes selected for use in TaqMan gene-panel. ....................................................... 181
TABLE 7.2: Effect of GSK932121A and GSK2617971A on the intracellular levels of HepG2 cell
glycogen and lipid. .............................................................................................. 189
TABLE 7.3: Genes submitted for connectivity mapping analysis................................................ 191
TABLE 8.1: Representation of the relationships between Toxicity Pathways, Mode of Action
Pathways, Adverse Outcome Pathways, and Source to Outcome Pathways. ...... 211
APPENDIX TABLE 1.1: TEM Analysis of crude mitochondrial pellets isolated from five tissues of
high metabolic load. ............................................................................................ 239
xii
APPENDIX TABLE 2.1: Non-quantitative comparison between obtained RCR values for
mitochondria isolated from five tissues of high metabolic load and published RCR
values ................................................................................................................... 245
APPENDIX TABLE 3.1: Levels of GSK932121A in the mitochondrial fraction. ...................... 246
APPENDIX TABLE 4.1: Liver metabolomics raw data. ............................................................. 247
APPENDIX TABLE 4.2: Plasma metabolomics raw data. .......................................................... 250
xiii
List of Figures
FIGURE 1.1: Structure of a eukaryotic mitochondrion. ................................................................... 5
FIGURE 1.2: The mitochondrial respiratory chain. ......................................................................... 9
FIGURE 1.3: Graphical representation of mitochondria as a mediator of drug-induced toxicity....13
FIGURE 1.4: Schematic representation of drugs which have been implicated in inhibition of OXPHOS
either via direct inhibition of respiratory chain complexes I-IV or via chemical
uncoupling. ............................................................................................................ 17
FIGURE 1.5: Putative mPTP proteins in the OMM and IMM in normal physiological and
pathophysiological conditions. .............................................................................. 22
FIGURE 1.6: Chemical structure of GSK932121A. ...................................................................... 35
FIGURE 1.7: Schematic of the approach taken to manufacture a GSK932121A pro-drug ........... 37
FIGURE 1.8: Chemical structure of GSK2617971A. .................................................................... 38
FIGURE 2.1: The Seahorse Bioscience BOFA assay .................................................................... 50
FIGURE 2.2: Graphical representation of the CRC assay. ............................................................. 52
FIGURE 2.3: Graphical representation of the whole cell OCR assay for determination of bioenergetic
parameters. ............................................................................................................ 58
FIGURE 2.4: A typical lactate assay standard curve. ..................................................................... 63
FIGURE 2.5: Gel image and electropherogram output from Agilent 2100 Bioanalyser – Assessment of
RNA integrity. ....................................................................................................... 66
FIGURE 3.1: Complex III activity assay with GSK932121A. ....................................................... 78
FIGURE 3.2: Analysis of liver mitochondrial OCR following in vitro treatment of control liver
mitochondria with GSK932121A (measured using Seahorse XF24 analyser). ..... 79
FIGURE 3.3: Assessment of the mitochondrial CRC. ................................................................... 80
FIGURE 3.4: Relationship between core body temperature and plasma GSK932121A concentration.
............................................................................................................................... 81
FIGURE 3.5: Analysis of arterial blood gasses (p02 and pC02) and bicarbonate (HCO3) in whole blood
of animals treated with GSK932121A (50mg/kg). ................................................ 82
FIGURE 3.6: Effect of 50mg/kg GSK932121A on liver LM and TEM compared to VC. ............ 84
FIGURE 3.7: Effect of 50mg/kg GSK932121A on whole blood lactate:pyruvate ratio compared with
blood taken from VC animals ................................................................................ 85
xiv
FIGURE 3.8: Analysis of liver GSH, GSSG and ratio of GSH:GSSG following treatment of rats with
50mg/kg GSK932121A compared to vehicle control. ........................................... 86
FIGURE 3.9: Analysis of liver mitochondrial CRC following treatment of rats with GSK932121A in
vivo. ....................................................................................................................... 87
FIGURE 3.10: Analysis of liver mitochondrial bioenergetics using the Seahorse XF24 analyser
following treatment of rats with GSK932121A in vivo ........................................ 89
FIGURE 3.11: PCA of Affymetrix transcriptomics data (from liver of GSK932121A and VC animals)
highlighting relationship between degree of experimental data separation and plasma
drug concentration. ................................................................................................ 91
FIGURE 3.12: Correlative analysis of gene copy number for 4 significantly altered genes and
GSK932121A plasma concentration. .................................................................... 92
FIGURE 4.1: Metabolomics data visualisation. ........................................................................... 102
FIGURE 4.2: Effect of 12.5mg/kg and 50mg/kg GSK932121A on body temperature, blood
lactate:pyruvate ratio and isolated liver mitochondria CRC and OCR ................ 104
FIGURE 4.3: Schematic representation of the glycogenolysis, glycolysis and PPP. ................... 108
FIGURE 4.4: GSK932121A causes a dose dependent reduction in liver starch/glycogen intermediates
at a 4 hour time point. .......................................................................................... 109
FIGURE 4.5: Effect of GSK932121A treatment on key glycolysis metabolites in the liver of
GSK932121A and VC treated animals ................................................................ 110
FIGURE 4.6: Schemiatic representation of the carnitine shuttle and ketogenesis........................ 112
FIGURE 4.7: Effect of GSK932121A on plasma free carnitine................................................... 113
FIGURE 4.8: Effect of GSK932121A on plasma and liver BHBA and plasma FA-acylcarnitine levels
............................................................................................................................. 114
FIGURE 4.9: Schematic representation of α-ketobutyrate and α-hydroxybutyrate involvement in the
supply of carbon sources to the TCA cycle. ........................................................ 115
FIGURE 4.10: Effect of GSK932121A on plasma and liver BCAA’s ......................................... 117
FIGURE 4.11: Effect of GSK932121A on plasma AKB and its downstream metabolite AHB over a 4
hour time course .................................................................................................. 118
FIGURE 4.12: Effect of GSK932121A on oxidative stress and anti-oxidant stress response in the liver.
............................................................................................................................. 120
FIGURE 5.1.: Key events in the AOP/MOA for complex III inhibition. ..................................... 126
FIGURE 5.2: PKE’s in the AOP for complex III inhibition ......................................................... 129
xv
FIGURE 5.3: Hybrid AOP/MOA including key events, possible key events and associated events in
the toxicological progression of complex III inhibition related toxicity.............. 132
FIGURE 6.1: Comparison of the OXPHOS uncoupling activity of GSK2617971A to 2,4-DNP in
control isolated liver mitochondria. ..................................................................... 142
FIGURE 6.2: Assessment of the mitochondrial CRC following in vitro treatment of control liver
mitochondria with GSK2617971A and 2,4-DNP. ............................................... 143
FIGURE 6.3: Relationship between core body temperature and plasma GSK2617971A concentration)
............................................................................................................................. 145
FIGURE 6.4: Effect of GSK2617971A treatment on blood lactate: pyruvate ratio. .................... 146
FIGURE 6.5: TEM analysis of kidney sections of rats treated with 60mg/kg GSK2617971A and VC.
............................................................................................................................. 147
FIGURE 6.6: Analysis of kidney and liver mitochondrial bioenergetics using the Seahorse XF24
analyser following treatment of rats with GSK2617971A in vivo . ..................... 149
FIGURE 6.7: Reversibility of the uncoupling effect of GSK2617971A demonstrated in vitro in HepG2
cells...................................................................................................................... 150
FIGURE 6.8: Analysis of mitochondrial ΔΨ (JC-1) in liver and kidney mitochondria from animals
treated with GSK2617971A compared to VC………………………………….151
FIGURE 6.9: Analysis of mitochondrial CRC in kidney and liver mitochondria isolated from
GSK2617971A treated rats and VC .................................................................... 153
FIGURE 6.10: PCA analysis of global hepatic transcriptional data pre and post statistical refinement.
............................................................................................................................. 155
FIGURE 6.11: Proposed AOP/MOA for mitochondrial OXPHOS uncoupling in vivo. .............. 164
FIGURE 7.1: Analysis of HepG2 mitochondrial OCR following acute in vitro treatment with
GSK932121A (measured using Seahorse XFe96 analyser). ................................ 170
FIGURE 7.2: The effect of GSK932121A on HepG2 cytotoxicity (LDH) .................................. 171
FIGURE 7.3: Effect of GSK2617971A (OXPHOS uncoupling) on HepG2 cell metabolism (OCR and
ECAR). ................................................................................................................ 172
FIGURE 7.4: Effect of GSK2617971A on HepG2 cell cytotoxicity ............................................ 173
FIGURE 7.5: Effect of glucose concentration on the generation of lactate in HepG2 cell supernatant
following treatment with Oligomycin and Antimycin A ..................................... 176
FIGURE 7.6: Effect of sub-cytotoxic concentrations of GSK932121A and GSK2617971A on HepG2
cell lactate generation up to 8 hours. ................................................................... 178
FIGURE 7.7: Heat map showing the effect in HepG2 cells of GSK932121A on a selection of pertinent
genes involved in the response to DIMT. ............................................................ 184
xvi
FIGURE 7.8: Heat map showing the effect in HepG2 cells of GSK2617971A on a selection of
pertinent genes involved in the response to DIMT. ............................................. 187
FIGURE 7.9: Exemplar volcano plot for GSK2617971A / GSK932121A connectivity map and top ten
connected compounds. ........................................................................................ 193
FIGURE 7.10: Effect of azacyclonol on mitochondrial OCR in both HepG2 cells and isolated control
liver mitochondria. .............................................................................................. 194
FIGURE 7.11: Effect of azacyclonol on both HepG2 cell lactate generation and on the intracellular
level of glycogen clusters and lipid droplets. ...................................................... 196
FIGURE 7.12: Heat map showing the effect in HepG2 cells of azacyclonol on a selection of pertinent
genes involved in the response to DIMT. ............................................................ 197
FIGURE 8.1: Graphical representation of the relative metabolic states of potential target patient
populations and the commonly used preclinical animal species. ......................... 214
APPENDIX FIGURE 1.1: Assessment of mitochondria isolated from 5 rodent tissues via Western
blot.. ..................................................................................................................... 241
APPENDIX FIGURE 2.1: RCR values obtained for mitochondria isolated from liver, kidney, heart,
skeletal muscle and brain rat tissues. ................................................................... 244
APPENDIX FIG.5.1: Plasma lactate measured by Metabolon following treatment of rats with
12.5mg/kg and 50mg/kg GSK932121A. ............................................................. 251
xvii
List of Abbreviations
ΔΨ - Membrane potential
2-DG - 2-deoxyglucose
2,4-DNP - 2,4-dinitrophenol
AHB - α-hydroxybutyrate
AKB - -ketobutyrate
ADP - Adenosine diphosphate
AOP - Adverse outcome pathway
ATP - Adenosine triphosphate
BHBA - 3-hydroxybutyrate
BOFA - Basal, oligomycin, FCCP, antimycin A
CCCP - Carbonyl cyanide m-chlorophenyl-hydrazone
cDNA - Complementary deoxyribonucleic acid
CoA - Coenzyme A
CRC - Calcium retention capacity
cRNA - Complementary ribonucleic acid
Ct - Cycle threshold
DIMT - Drug-induced mitochondrial toxicity
DMSO - Dimethyl sulfoxide
DNA - Deoxyribonucleic acid
dNTP - Deoxynucleotide triphosphates
ECAR - Extracellular acidification rate
EDTA - Ethylenediaminetetraacetic acid
EGTA - Ethylene glycol-bis (2-aminoethylether)-N,N,N’,N-tetraacetic acid
ETC - Electron transport chain
FA - Fatty acid
FAD - Flavin adenine nucleotide
FCCP - Carbonyl cyanide-4-(trifluoromethoxy)phenylhydrazon
FDA - Food and drug administration
FTIH - First time in human
gDNA - Genomic deoxyribonucleic acid
GSH - Reduced glutathione
GSSG - Oxidised glutathione
xviii
HEPES N-2.hydroxyethylpiperazine-N’-2-ethanesulfonic acid
IMS - Inter-membrane space
IRS - Insulin receptor substrate
LDH - Lactate dehydrogenase
IP - Intraperitoneal
IPA - Ingenuity pathway analysis
IVT - In vitro transcription
LD50 - 50% lethal dose
Me2
- Divalent metal ion
MOA - Mode of action
mPTP - Mitochondrial permeability transition pore
mRNA - Messenger ribonucleic acid
NAD+/NADH - Nicotinamide adenine dinucleotide oxidised / reduced
NRTI - Nucleotide reverse transcriptase inhibitors
NSAID - Non-steroidal anti-inflammatory drug
mw - Molecular weight
OCR - Oxygen consumption rate
OD - Optical density
OXPHOS - Oxidative phosphorylation
PBS - Phosphate buffered saline
PCA - Principle component analysis
PDK - Pyruvate dehydrogenase kinase
PKE - Possible key event
PPP - Pentose phosphate pathway
RCR - Respiratory control ratio
RMA - Robust multichip average
RNA - Ribonucleic acid
ROS - Reactive oxygen species
rRNA - Ribosomal ribonucleic acid
RT-PCR - Real time – polymerase chain reaction
SARM - Selective androgen receptor modulator
Sod2 - Superoxide dismutase 2
TBST - Tris buffered saline with Tween 20
TCA/TCAi - The citric acid cycle / intermediates
VC - Vehicle control
1
1.0. GENERAL INTRODUCTION
2
1.1. The Importance of Drug-Induced Mitochondrial Toxicity
“Failures to predict adverse drug reactions have immense financial implications, result in adverse human
suffering and erode in trust of regulatory and pharmaceutical processes” [1].
The importance of drug-induced mitochondrial toxicity (DIMT) was realised when a number of
nucleoside reverse transcriptase inhibitors (NRTIs, used for the treatment of HIV) were withdrawn from
the market, due in part to deleterious effects on mitochondrial function [2]. Since then, a number of drugs
have been reported to affect mitochondrial function with consequent adverse clinical reactions,
necessitating Food and Drug Administration (FDA) black box warnings and drug withdrawals. An
example is the first-in-class 2,4-thiazolidinedione anti-diabetic drug troglitazone, which had to be
withdrawn from the market in 2000 due to delayed onset idiosyncratic hepatotoxicity which was later
linked to adverse effects on mitochondrial function [3].
Mitochondria are important to the pharmaceutical industry. Mitochondrial toxicity is increasingly
implicated in the aetiology of adverse drug reactions. Drugs from diverse chemical and therapeutic
classes are known to undermine mitochondrial function and despite multiple clinical examples of
mitochondrial toxicity, there remains no regulatory requirement to discharge the risk of mitochondrial
effects as part of the pre-first time in human (FTIH) toxicology package [4]. This is not necessarily
surprising as any regulatory requirement to discharge mitochondrial liability would represent a dynamic
shift in drug safety assessment away from where the International Conference on Harmonisation of
Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH) is at present (i.e.
assessing and identifying apical endpoints) and towards identifying key molecular events. Efforts have
been made in industry in terms of in vitro preclinical screening for mitochondrial activity but there have
been few rigorous efforts to correlate in vitro findings with in vivo functional endpoints or with
conventional measures of toxicity. Improved in vivo assessment of mitochondrial function could facilitate
the development of safer medicines but methods are currently underdeveloped and invalidated for
practical application in preclinical studies [5]. The overall goal remains to identify and manage
mitochondrial toxicity from the earliest possible point in drug development and support the safe
progression of molecules, which may interact with mitochondria, to the market.
3
Despite the potentially potent effect of drugs which cause DIMT, mitochondria are increasingly seen as
attractive targets for pharmacological intervention (i.e. therapeutic targeting of sub-optimal mitochondria)
due to their central role in the mechanism of many common human diseases; e.g. as treatments for
metabolic disorders (e.g. diabetes), neurodegenerative disorders, COPD and cancer. Given the diversity of
metabolic pathways potentially affected by altering mitochondrial function, development of
mitochondrial-targeting medicines clearly requires judicious safety assessment and risk management [5,
6]. Methods to assess drug-induced modulation of mitochondrial processes in vivo require particular
attention. It is however important to acknowledge that, whilst a change in direction of a mitochondrial
endpoint may be desirable (e.g. inhibition of the mitochondrial permeability transition pore, mPTP), a
change in the other direction (i.e. potentiation of the mPTP) might be undesirable. The availability of
quantitative measures of this activity are particularly useful in both situations.
This thesis focusses on the assessment of DIMT and correlates results obtained from in vivo studies to
those obtained from in vitro studies. In vivo studies were performed using a systems toxicology approach
in order to identify biochemical mechanisms downstream of DIMT and to generate adverse outcome
pathways (AOP).
1.2. Introduction to Mitochondria
Mitochondria, from the Greek mito (thread) and chondros (grains) are energy producing organelles that
exist in the cytoplasm of eukaryotic cells. Mitochondria perform a variety of important functions
including adenosine triphosphate (ATP) synthesis, calcium signalling/homeostasis, fatty acid (FA)
metabolism, apoptosis initiation, regulation of cellular proliferation and biosynthesis of heme, pyrimidine
and steroid structures [7].
Mitochondria were discovered in the late 19th century by Robert Alttman. They were originally called
“bio-blasts” and described as "elementary organisms" living inside cells and carrying out vital functions
[8]. Upon visualisation by electron microscopy in 1952, they were described as a collection of cytosolic
free-floating individual vesicles forming thread-like structures inside cells [9, 10]. Just a year later in
1953, the oxidation capacity of mitochondria was revealed by discovering that specific staining of
mitochondria by Janus Green B was due to the capacity of cytochrome oxidase to reoxidise the dye [11].
The following two decades saw a spate of discoveries relating to the role of mitochondria in cellular
4
respiration and oxidative phosphorylation (OXPHOS). Key discoveries included demonstration of the
membranous localisation of the respiratory chain [12], demonstration of energy coupling between
electron transport and ATP synthesis [13] and reconstitution of OXPHOS and related reactions [14].
Mitochondria are now widely acknowledged to be dynamic, pleomorphic structures constantly
undergoing fission and fusion, with these processes tightly regulated by cellular stimuli and bioenergetic
need [15]. Fission and fusion events allow the exchange of organelle content such as proteins, solutes,
lipids and deoxyribonucleic acid (DNA) [16]. A wide body of evidence now suggests that impairment of
the mitochondrial capacity is implicated in a number of human diseases and neuropathies [17].
The numbers of mitochondria in a cell vary widely depending on the cell type, owing to the differing
degrees of reliance on cell sustainability and metabolic load [18]. Within a cell, the distribution of
mitochondria is unequal, depending on the cellular energetic or metabolic demands; for example, in
cardiac cells, mitochondria are localised to the contractile apparatus, whilst in a sperm cell they are
wrapped tightly around the motile flagellum [19].
1.3. Mitochondrial Structure and Genome
Mitochondria are highly compartmentalised organelles with two membranes, an outer mitochondrial
membrane (OMM) rich in cholesterol / porin molecules and an inner mitochondrial membrane (IMM)
rich in cardiolipin. These membranes functionally separate two distinct regions, the intermembrane space
(IMS) and the water-containing matrix (shown in Fig.1.1). Mitochondria can only be visualised in detail
using an electron microscope and are usually roughly ovoid but they may assume a filamentous shape or a
vesicular form.
The OMM comprises two lipid bilayer membranes and contains many aqueous pores permeable to all
ions and molecules up to 14 kDa [20]. This makes the IMS chemically equivalent to the cytosol with
respect to the small molecules it contains. In contrast to the OMM, the IMM is impermeable to ions and
polar molecules but contains many protein transporters spanning the membrane. Furthermore, the IMM is
virtually devoid of cholesterol and is rich in cardiolipin (which binds the proteins of the ETC) [21]. The
content of the matrix is dependent upon the availability of the transport proteins in the IMM to facilitate
the import/export of molecules such as ATP/ADP which are transported via the adenosine nucleoside
5
translocator (ANT). The impermeability of the IMM allows an electrochemical gradient to be maintained
and this gradient provides the proton motive force for ATP generation. Maintaining the integrity of the
IMM is critical for mitochondrial function. The IMM is the most common target for mitochondrial
toxicants. Many xenobiotics damage mitochondria either by increasing the permeability of the IMM or by
inhibiting transport proteins within it. Furthermore, many drugs have a very high affinity for cardiolipin
and thereby preferentially bind to the IMM and affect important organelle processes.
FIGURE 1.1: Structure of a eukaryotic mitochondrion: Electron microscopy image of a mitochondrion. Arrows show the key
structural regions of the mitochondria, the outer mitochondrial membrane (OMM), the inner mitochondrial
membrane (IMM), the intermembrane space (IMS), the matrix and the cristae. Image taken from [http://imgbuddy.com/mitochondria-microscope.asp] – Accessed 09 June 2015.
The IMM is invaginated forming structures known as cristae which greatly increase its total surface area
for maximal ATP production. These cristae contain clusters of five protein complexes (complex I, II, III,
IV and V) which are involved in a process known as oxidative phosphorylation (OXPHOS) where
electron transport is tightly coupled to ATP synthesis [22].
OMM
IMS
Cristae
Matrix
IMM
6
The mitochondrial matrix contains the vast majority of mitochondrial proteins, including those involved
in fatty acid (FA) β-oxidation, haem/steroid synthesis and the tricarboxylic acid (TCA) cycle. The
mitochondrial matrix also contains several copies of mitochondrial DNA (mtDNA) with the number of
copies varying according to cell-type [6].
Mitochondria are the only organelles outside the nucleus that contain their own genome. A single DNA
polymerase (polymerase-gamma, pol-γ) with base excision repair activity ensures the replication of
mtDNA. Although pol-γ is a nuclear derived protein, its only known function is the replication of mtDNA
and therefore any mutation or inhibition of this enzyme will manifest only in effects on mtDNA. The
mtDNA shows substantial similarity to bacterial genomes (e.g. circular, unenclosed and lacking histones)
leading to the theory that mitochondria were originally free-living aerobic bacteria that were then
engulfed by eukaryotic cells more than a billion years ago [23]. The bacterial origin of mitochondria has
implications for the drug discovery process as drugs designed to impair bacterial protein synthesis may
have the potential to cause an adverse effect in the host’s mitochondrial ribosomes [24]. Mammalian
mitochondrial ribosomes (55S) differ from bacterial (70S) and cytoplasmic ribosomes (80S) in terms of
weight and molecular structure. Mitochondrial ribosomes are encoded in nuclear genes and imported into
mitochondria where they assemble with mitochondrially transcribed rRNAs into ribosomes responsible
for the translation of the 13 mitochondrial mRNAs encoding essential OXPHOS proteins [25].
mtDNA is maternally inherited and is present as several copies within the mitochondrial matrix. The
mitochondrial genome consists of a small circular chromosome and each copy of mtDNA encodes 13
proteins, as well as 22 tRNA’s and 2 rRNA’s [26]. Whilst the proteins encoded by mtDNA are essential
for OXPHOS, the majority of mitochondrial proteins are encoded by the nuclear genome and transported
into the organelle by the means of protein localisation signalling and transporter molecules [27].
Mutations in mtDNA can cause serious disorders (mitochondrial-diseases) such as neuropathy, ataxia and
retinitis pigmentosa (NARP), Leber hereditary optic neuropathy (LHON) and myoclonic epilepsy with
ragged red fibres (MERRF) [28]. Not all mitochondrial diseases are due to mutations in mtDNA with
some arising as a result of mutation in the nuclear genome. Moreover, polymorphic variations can give
rise to a situation known as heteroplasmy, where each cell can have copies of both mutated mtDNA and
wild-type DNA [29]. Unlike nuclear DNA, mtDNA is not protected by histone proteins and is located in
close proximity to sites where reactive oxygen species (ROS) are routinely generated. This increases the
7
susceptibility of mtDNA to ROS-related oxidative damage. Also, some DNA repair processes are less
efficient for mtDNA compared with nuclear DNA and as such the mutation rate is estimated to be at least
10-20 times higher [30].
1.4. Mitochondrial Function
1.4.1. MITOCHONDRIA: ENERGY PRODUCTION
Mitochondrial energy production is achieved by electron transfer in the respiratory chain, using a process
known as OXPHOS. Approximately 95% of ATP is generated during aerobic (i.e. consuming oxygen)
respiration by mitochondria. Mitochondria are also the site for other metabolic pathways, most notably
the β-oxidation of FA’s and the TCA cycle.
Glucose is broken down in the cytosol during glycolysis (shown in Fig.4.3 in chapter 4), yielding a net
gain of 2ATP molecules, 2 nicotinamide adenine dinucleotide (NADH) molecules and pyruvate. Under
aerobic conditions, pyruvate is transferred to the mitochondrial matrix where it is converted to acetyl
coenzyme A (acetyl CoA) by pyruvate dehydrogenase [31]. In the mitochondrial matrix the TCA cycle
occurs whereby a series of enzyme-mediated chemical reactions occur with the objective of oxidising
acetyl CoA to produce molecules capable of supplying electrons to the mitochondrial respiratory chain or
replenishing molecular intermediates for other pathways. In brief, the output of the TCA cycle is the
formation of 2CO2, 3NADH, 1GTP and 1FADH2. Additionally succinate formed in the cycle can be
oxidised by complex II of the mitochondrial respiratory chain (see Fig.1.2).
An alternative way of generating energy via OXPHOS is by using lipids which are stored in the form of
FA’s in triglycerides. FA’s are degraded via catabolism in the mitochondrial matrix via a process known
as β-oxidation. The process involves the extraction of several units of acetyl CoA by oxidation. The
triglycerides are hydrolysed by lipases resulting in glycerol and FA. Glycerol can follow the glycolytic
pathway while FA’s are processed via β-oxidation, wherein dehydration, hydration and oxidation occur to
convert FA’s into several products used in mitochondrial metabolism including succinyl-CoA, which
enters the TCA cycle.
8
In addition, the mitochondrion is the site at which the terminal steps of amino acid catabolism occur
resulting in the production of acetyl CoA. Acetyl-CoA is therefore a convergence point for many
catabolic pathways and enters the TCA cycle where energy rich electrons, abstracted from the oxidation
of substrates, are used to reduce nicotinamide adenine dinucleotide (NAD+ to NADH) and flavin adenine
dinucleotide (FAD+ to FADH2). These high energy electrons (reducing equivalents) are then transferred
to the IMM where they enter the electron transport chain (ETC)[32].
NADH is oxidised by complex I (NADH:ubiquinone reductase) and the released energy is used to reduce
ubiquinone and produce an electrochemical proton gradient. The majority of substrates produced via the
TCA cycle (i.e. resulting from dietary fats, glucose and amino acids) are oxidised by this route meaning
that this is the main entry point for channelling electrons into the ETC. Meanwhile the reduced form of
FAD (FADH2), a prosthetic group within complex II (succinate dehydrogenase), also donates electrons to
ubiquinone [33]. This means that the second entry point of the respiratory chain is complex II-III
(cytochrome bc1 complex) wherein complex III oxidises the reduced ubiquinol, promotes the generation
of an electrochemical proton gradient by pumping protons across the IMM and reducing the water soluble
carrier protein cytochrome c. Cytochrome c is attached to the cytosolic side of the IMM and serves as an
electron carrier between complex III and IV. Complex IV (cytochrome oxidase) directly reduces
molecular oxygen to water and further contributes protons to the electrochemical proton gradient.
As described above the transfer of electrons down an energy gradient is concomitant with the process of
proton pumping from the matrix to the IMS by complexes I, III and IV resulting in the generation of an
electrochemical (proton-motive) gradient i.e. the mitochondrial membrane potential (∆Ψ) [34] . The
energy contained in the electrochemical gradient is utilised by complex V (ATP synthase) to make ATP
from adenosine diphosphate (ADP) and inorganic phosphate. The overall rate of electron transport in the
respiratory chain of mitochondria is regulated by the amplitude of the electrochemical potential (known as
respiratory control). This is beneficial as under physiological conditions the decrease in proton gradient is
due to the metabolic demand of the mitochondrion, and as a result an immediate stimulation of oxygen
consumption (increased ETC activity) is observable. This means that the rate of respiration is therefore
intrinsically coupled to the rate of metabolism. An overview of the ETC and OXPHOS system is shown
in Fig.1.2 below.
9
FIGURE 1.2: The mitochondrial respiratory chain: High-energy electrons derived from reduced substrates are transferred
through several multi-protein complexes to molecular oxygen. This provides the energy to move protons across
the inner mitochondrial membrane with ATP synthase utilising this energy to generate ATP. [H+- protons, Q- ubiquinone]. Image not scaled.
Mitochondria are unique among cellular organelles, in that they can build up a ΔΨ of -180 to -220 mV.
On particular occasions (e.g. when the IMM becomes permeable or in the presence of a proton/ion-
ophore) the ΔΨ can be completely dissipated resulting in ATP depletion and an increase level of
mitochondrial oxygen consumption (i.e. increased ETC output). A futile proton cycle then ensues, as
protons bypass the F0F1 subunit of ATP synthase causing production heat [35]. This process is known as
mitochondrial uncoupling and can be protein dependent (e.g. in the presence of an uncoupling protein or
UCP) or protein independent (requiring the presence of an ionophore or cationic lipid). ATP synthesis is
therefore tightly coupled to electron transport with ATP synthase capable of converting energy from the
electrochemical gradient into chemical bond energy in either direction [36].
Mitochondria are able to respond to a certain level of direct or indirect stress by utilisation of an innate
respiratory reserve capacity. Reserve capacity is used to describe the amount of extra ATP that can be
produced via OXPHOS at times of sudden increases in energy demand [37]. There are likely to be
differing sensitivities to drug treatment in individuals based on age/genetics/co-medication etc. that alters
the reserve mitochondrial capacity. Furthermore, the reserve capacity can often mask potential
drug/mitochondrial interactions until the cell has a requirement to utilise that reserve capacity (e.g. under
10
conditions of stress) [38]. Effects may therefore not be seen until much later after exposure, a
phenomenon recognised with cardiotoxicity. The mechanisms, by which the mitochondrial reserve
capacities become compromised, are not well elucidated or understood [39].
1.4.2. MITOCHONDRIA: ROS
The normal process of electron transport is associated with some low level leakage of electrons which are
directly donated to molecular oxygen. This results in the formation of reactive oxygen species such as
superoxide which can react with, and damage, phospholipids, proteins and mtDNA [40]. Although the
superoxide anion has limited chemical reactivity, it can be converted into more highly reactive species for
example hydrogen peroxide (H202) and more particularly the hydroxide radical via Fenton chemistry [41].
Approximately 2-4% of the total oxygen consumed by mitochondria is not totally reduced to water and
results in the formation of ROS. Under normal physiological conditions cells are able to counteract the
harmful effects of ROS by several anti-oxidant defence systems including mitochondrial superoxide
dismutase, glutathione peroxidase, peroxiredoxin (which utilises thioredoxin to counteract the effect of
hydrogen peroxide) glutathione reductase, α-tocopherol and cytochrome c [42]. Furthermore, the
methionine residues of mitochondrial proteins are able to prevent the oxidation of protein cysteine
residues, inducing the formation of methionine sulphoxide and thus maintain protein functionality [43].
However when production of ROS exceeds the capacity of the anti-oxidant defence systems, oxidative
stress ensues.
The main sources of ROS are complex I (primary source due to having the most reducing capacity) with
complex III, monoamine oxidase and complex IV also contributing to burden. Mitochondrial proteins
which are localised around the ETC (located primarily in the matrix or acting as IMM transporters) are
constantly in danger of being impaired by oxidative stress [44]. Furthermore, impairment of complex I
and complex III by oxidative stress can result in increased ROS generation from these sites and then a
vicious cycle ensues [45]. In addition, chemical inhibition of the respiratory chain at multiple sites further
increases the production of superoxide anions and as such drug-induced ROS generation may be a key
player in the AOP of mitochondrial targeting compounds [46].
Loss of regulation of cellular calcium concentrations can also increase the production of superoxide
anions by the mitochondrial respiratory chain. Calcium is able to bind to the phospholipid/cardiolipin rich
11
IMM which induces both a conformational and functional alteration in membrane function in turn
facilitating electron leak from the respiratory chain [47].
1.4.3. MITOCHONDRIA: CELL DEATH
Mitochondria have been demonstrated to play a crucial role in the cell death pathways, apoptosis and
necrosis.
Necrosis describes the processes whereby cells suffer damage that results in increased cellular volume,
aggregation of chromatin, disorganisation of the cytoplasmic contents, loss of plasma membrane integrity
and loss of cellular functionality. During the progression of necrosis, most of the cell contents are
released, causing damage to neighbouring cells, an increase in localised inflammation and irreversible
damage to the surrounding tissue. Necrosis was always believed to be caused by passive disturbance;
however, recent studies have suggested it can be regulated although in both scenarios, mitochondria have
been heavily implicated in the control of necrosis. Cell death by necrosis can occur due to activation of
the mitochondrial permeability transition (MPT) which comprises collapse of the proton motive force, a
decrease in ATP production and an increase in ATP hydrolysis via F0F1-ATP synthase running in reverse
(i.e. hydrolysing ATP in order to maintain the ΔΨ, resulting in ATP depletion) [48]. Furthermore, it has
been described that cell swelling during necrosis, due to alterations in the cytoskeleton and inhibition of
the Na+/K
+ pump) is caused by impaired cellular respiration and loss of ΔΨ [49].
Apoptosis, a form of programmed cell death, is a process by which cells are eliminated from the body
during embryonic development, tissue homeostasis, normal cell turnover and following cell injury. In
brief, apoptosis can result from two independent routes (intrinsic and extrinsic). During the extrinsic
pathway, apoptosis is triggered by ligand-induced activation of death receptors at the cell surface, such as
TNFR, CD95/Fas and TRAIL-R1/R2. The intrinsic apoptotic pathway heavily involves the mitochondria,
either as initiators or propagators of the apoptotic signal.
An early event during intrinsic apoptosis is the release of cytochrome c from the IMM of the
mitochondria into the cytosol. Cytochrome c then binds apoptotic protease activating factor (Apaf-1) and
procaspase-9 promoting the formation of the heptameric apoptosome and the resultant activation of a
group of cysteine proteases called “caspases”[50]. Caspases are categorised into initiators (caspase-2,-8,-
12
9, 10), effectors (caspase-3,-6,-7) and inflammatory (caspase-1,-4,-5) and they function to coordinate
programmed cell death via chromatin condensation, DNA fragmentation and membrane blebbing [51].
Furthermore under certain apoptotic conditions (e.g. mitochondrial swelling) mitochondria release
proteins such as cytochrome c (release mentioned above), Smac/DIABLO and the apoptosis inducing
factor (AIF). AIF is then targeted to the nucleus where it binds to DNA, stimulating chromatin
condensation and DNA breakdown [52]. Protein release from the mitochondria is a complex process and
includes the oligomerisation on the OMM of the pro-apoptotic proteins Bax and Bak (pro-apoptotic Bcl2
proteins), which form a cytochrome c permeable channel. It is also now known the MPT pore (mPTP) can
regulate calcium induced apoptosis and as such, the alteration in the calcium signal reaching mitochondria
and/or the combined impact of apoptotic agents or pathological conditions (i.e. oxidative stress) can
induce a profound alteration of mitochondrial structure, function and downstream cell death. This is
highlighted by the work of Zamzami and colleagues who demonstrated that mitochondrial fragmentation
during apoptosis was closely related to the collapse in ΔΨ, with this collapse being considered the point
of no return in the apoptosis cascade [53].
1.5. Mechanisms of DIMT
Drugs can interfere with mitochondrial function in many different ways. Given the structural and
functional complexities of mitochondria it is unsurprising that many of these interactions can lead to
DIMT. The mechanisms involved are reviewed below (Fig.1.3).
13
FIGURE 1.3: Graphical representation of mitochondria as a mediator of drug-induced toxicity: Mechanisms include not only direct inhibition or uncoupling of ETC and
OXPHOS but also inhibition of transport or oxidation of substrates, of the mPTP as well as molecular targets of mitochondrial biogenesis (i.e. inhibition of
mtDNA replication, transcription and translation, and import or post-translational processing of proteins). The result is either inhibition/uncoupling of the
respiratory chain directly, an indirect failure to generate and assemble functional substrate for the ETC or induction of cell death pathways. All of which lead to
ATP depletion and cellular bioenergetic deficit. Image taken and adapted from [27].
14
1.5.1. DIRECT INHIBITORS OF OXPHOS:
Drugs that interfere with OXPHOS include both inhibitors of the distinct complexes of the ETC and
uncoupling agents. Acute poisoning of the respiratory chain classically presents signs and symptoms such
as muscle weakness, fatigue, hypotension, confusion and nausea. The inhibition of the ETC and
consequential inability to utilise oxygen at cytochrome oxidase causes cytotoxic hypoxia despite normal
or above average blood oxygen. In contrast, uncouplers of OXPHOS from ETC function (caused by
dissipation of the electrochemical proton gradient) induce disproportionate oxygen consumption.
Uncouplers also cause ATP depletion and metabolic acidosis, but classically, little or no effect on blood
oxygen is observed; The free energy of substrate oxidation is liberated as heat resulting in fever [20].
Complex I is the most susceptible of the ETC complexes to drug-induced malfunction. More than 60
different types of natural and synthetic compounds can perturb mitochondrial complex I activity including
pesticides, neurotoxins, and antibiotics. It has been suggested, following rigorous structure activity
relationship (SAR) studies that, generally compounds with complex I inhibitory activity have modular
similarity to ubiquinone [54, 55]. Inhibitors of complex I can be broadly classified into one of three
categories, namely, compounds that inhibit at the level of the NADH-flavin interface (such as rhein),
complex I and III non-specific quinolone antagonists (such as myxothiazol) and finally, specific and
potent inhibitors of complex I such as rotenone.
Complex II (succinate dehydrogenase) is less commonly studied in terms of its role in
pharmacotoxicology. This is unexpected considering that recent research has revealed a role for complex
II in many roles independent to cell metabolism, such as succinate signalling, ischaemic preconditioning,
ROS generation and ageing [56]. Complex II is experimentally inhibited using malonate or 3-
nitroproprionic acid, but is also inhibited by a number of foloruoquinilones, fungicides, diazoxide and
chloramphenicol (although many are not specific to complex II). Other compounds which affect
mitochondrial complex II include the anticancer-drug etoposide, arsenic trioxide, cisplatin and menadione
[57].
Complex III is the second membrane spanning protein complex of the ETC. The sensitivity of various
species to complex III inhibition varies significantly and as such, complex III inhibitors have been
explored for use as anti-malarials, fungicides and anti-cancer drugs. Importantly the inhibition of complex
15
III of the mitochondrial chain (leading to ATP-depletion) is not the only harmful effect of these
molecules. The generation of ROS following chemical inhibition of complex III likely contributes to the
subsequent cellular and tissue toxicity. Inhibitors of complex III are generally categorised according to
the site of action and these are outlined below.
Group I – Quinol antagonists encompassing a β-methoxyacrylate group that block the process of
ubiquinol oxidation (e.g. myxothiazol, strobilurines and oudemasins).
Group II – Contain a 6-hydroxyquinone fragment and block electron transfer to cytochrome c1 and
thus inhibit the reduction of cytochrome b1 (e.g. undecylhydroxydioxobenzothiazole, UHDBT).
Group III – Impede electron transfer from heme to a quinone or semiquinone molecule at the Qi site
of complex III (e.g. antimycin A and funiculosin).
Inhibitors of the Qi site of complex III such as antimycin are specific for the cytochrome-bc1 complex
whereas naturally occurring Qo site inhibitors are less specific and possess a ubiquinone-like structure
which often causes co-inhibition of complex I (albeit with significantly lower potency than the inhibitory
effect they exert on complex III). Zinc ions are also acknowledged to inhibit the mitochondrial respiratory
chain via complex III. Zinc binds reversibly and with high affinity to the Qo site of the cytochrome-bc1
complex and is able to inhibit oxygen consumption with high potency. Other mono- and di-valent metal
cations, such as, Hg2+
, Ag+, Cu
2+ and Cd
2+ have been shown to inhibit mitochondrial complex III although
with lower efficiency [20].
Complex IV is a heme/copper terminal oxidase that exploits cytochrome c as an electron donor. Complex
IV inhibitors have also been categorised into four distinct groups: (A) heme-binding inhibitors that are
non-competitive with both oxygen and cytochrome c (e.g. azide, cyanide and sulphide), (B) inhibitors
competitive with oxygen (e.g. carbon monoxide and nitric oxide) that are reversible, (C) inhibitors which
are competitive with cytochrome c (e.g. polycations) and (D) non-competitive inhibitors which do not
affect the heme-groups (e.g. phosphate ions and alkaline pH) [20].
Complex V (ATP-synthase) uses the electrochemical proton gradient to synthesise ATP from ADP and
inorganic phosphate. The enzyme is able to operate in either direction, for example under some conditions
it can work as an ATPase to hydrolyse ATP and generate the proton gradient. ATP synthase is well
conserved evolutionarily and as such many of its known inhibitors are of natural origin (mostly fungal).
16
Many antibiotics/mycotoxins were isolated because of their selective and potent toxicity against other
fungi (e.g. aurovertins A, leucionstatins A+B and the classical inhibitors of mitochondrial ATP-synthase,
oligomycin A-D). Injection of the ATP-synthase inhibitor oligomycin into rats causes inhibition of
oxygen consumption, and severe lactic acidosis with little to no change in arterial blood oxygen levels.
These mycotoxins all bind to either the F1 or the F0 subunit of the enzyme to block proton conduction.
The acute 50% lethal dose (LD50) values from both IP and subcutaneous injection are in the region of 1-
10mg/kg in rats and mice [58, 59]. Other compounds and classes of compounds have shown acute
inhibitory activity against mitochondrial ATP-synthase, though with less potency than the mycotoxins
described above. These include, local anaesthetics [60], paraquat [61], the β-adrenergic receptor
antagonist propranolol [62] and organotin composites [63].
Examples of drugs that inhibit the mitochondrial respiratory chain (either via direct ETC complex
inhibition or mitochondrial uncoupling) are shown in Fig.1.4 below.
17
FIGURE 1.4: Schematic representation of drugs which have been implicated in inhibition of OXPHOS either via direct
inhibition of respiratory chain complexes I-IV or via chemical uncoupling. Image taken and modified from [http://watcut.uwaterloo.ca/webnotes/Metabolism/rchainOverview.html] – Accessed 29th May 2015.
Uncoupling of OXPHOS is considered to be a common characteristic of anti-inflammatory agents with
an ionisable group such as the non-steroidal anti-inflammatory drugs (NSAIDs) diclofenac, aspirin,
nimesulide and indomethancin. All of these drugs, despite being taken routinely across the world, exert an
uncoupling effect at concentrations corresponding to their pharmacological doses [64, 65]. In their review
written in 2000, Wallace & Starkov suggest that the term uncoupling should encompass any energy-
dissipating process which competes for energy with routine mitochondrial functions, and thus induces a
metabolically futile wasting of energy. They explain that this description encompasses any drug-induced
enhancement of any energy-consuming mitochondrial function (such as ion, metabolite or protein
transport) as well as the classic idea of uncouplers (the dissipation of the proton gradient and impact on
ATP production) [20]. Typically uncouplers of OXPHOS provoke a loss of mitochondrial ΔΨ, a
Aurovertin A leucionstatins A+B
Oligomycin A-D
Tamoxifen Lidocaine
Paraquat
Propranolol
Azide
Cyanide Sulphide
Carbon monoxide
Nitric oxide
Myxothiazol Strobilurins
Oudemasins
UHDBT Funiculosin
Antimycin A
Zinc ions
Malonate
3-nitroproprionic acid
Diazoxide Chloramphenicol
Rhein Flutamide
Myxothiazol
Aurachins Rotenone
Rolliniastatin-1
Phenformin/Metformin
FCCP/CCCP 2,4-DNP
NSAIDS e.g. Diclofenac
Gramicidin Valinomycin
FFA
Tolcapone Phenols/Amides
H+
H
+
Uncoupling of
OXPHOS
18
reduction in mitochondrial ATP production, increased levels of substrate oxidation and increased heat
production. Uncouplers can be broadly categorised into the following:
Lipophilic weak acids – The majority of compounds processing protonophoric activity are lipophilic
weak acids with an acid-dissociable group and strong electron withdrawing moieties. Examples of
uncouplers in this group include carbonyl cyanide phenylhydrazones and salicylanilides. Compounds
such as carbonyl cyanide p-triflouromethoxy-phenyl-hydrazone (FCCP) and cyanide meta-
chlorophenylhydrazone (CCCP) are possibly the most frequently used uncouplers in the laboratory. In
mice, FCCP and CCP induce rapid rigor mortis and death after IP injection with LD50 values of 32
and 40µmol/kg respectively.
Substituted phenols – The best represented and most studied class of uncouplers are the substituted
phenols, including the highly toxic 2,4-dinitrophenol (2,4-DNP). Used in the 1930’s as a weight loss
drug, numerous 2,4-DNP-associated side effects were recognised and it was eventually withdrawn
from the market [5]. Although not licensed as a drug, 2,4-DNP is still occasionally used as a fat
burning agent to this day, and numerous fatalities per year are still attributed to dinitrophenol
poisoning [66], with signs and symptoms including hyperthermia, malaise, dyspnea, respiratory
failure and ultimately death. Its potency is highlighted by an LD50 of just 141µmol/kg in mice [67].
SAR studies have confirmed that substituted phenols uncouple via the protonophoric mode of action
(MOA), and revealed important correlations between the uncoupling activity and physicochemical
properties such as hydrophobicity, acidity and lipid membrane stability [68].
Salicylanilide (2-hydroxy-N-phenylbenamide) derivatives – The salicylanilides have been widely used
as anticestodal, antinematodal and antihelminithic drugs despite being protonophoric uncouplers of
mitochondrial OXPHOS. The mechanism of uncoupling is similar to that of other A- protonophores.
SAR relationships with 28 salicylanilide derivatives revealed that both hydrophobicity and electron-
withdrawing potential were required for uncoupling to take place [67].
Free fatty acids (FFAs, both endogenous and exogenous) – FFAs have long been known to be
efficient uncouplers of mitochondrial OXHOS. Studies have shown that the adenine nucleotide
translocator (ANT) is involved in the uncoupling action of FFAs. Many pathologies are associated
with the accumulation of free long-chain FA’s in affected tissues and the effect of this accumulation
19
on mitochondrial function can be devastating, rapidly increasing local temperature generation and
oxygen consumption at the expense of substrates for oxidation.
Ionophores – Ionophores are compounds of various chemical structures that are capable of
transporting small ions across a lipid membrane. Ionophores have been reviewed in [69, 70] and
generally are sub-categorised based on their physicochemical properties or their mechanism of ion
transport. Channel-type ionophores (e.g. gramicidin A, D and S) are generally short amphiphilic
peptides that form channels in lipid membranes. These channels can be selective toward small ions
such as protons or K+ depending on the peptide, the membrane structure and conditions. The resulting
increase in permeability toward protons and K+ effectively collapses the ΔΨ in mitochondria, due
either to proton cycling or electrophoretic K+ transport. Carrier type ionophores (e.g. valinomycin and
nigericin) are able to form neutral or charged lipid soluble complexes with an ion to facilitate its
electrophoretic transport or electroneutral exchange with protons across the IMM. Furthermore,
calcimycin can form a lipid-soluble complex with Me2+
to transport divalent cations across lipid
membranes by means of electroneural Me2+/
2H+ exchange. Dissipation of the calcium gradient
establishes a futile energy-dissipating cyclic flux of calcium.
Cationic uncouplers (e.g. the cyanine dye triS-C4(5)) – This category of OXPHOS uncouplers
comprises compounds that uncouple mitochondria by increasing membrane permeability to ions [71].
The mechanism of toxicity requires the presence of inorganic phosphate and it is likely that the Pi-
dependent compounds affect the physical integrity of the mitochondrial membranes.
Alternate electron acceptors – These compounds greatly diminish the efficiency of energy conversion
by disrupting the prescribed pathway of electrons down the ETC and as a result increase the oxidation
of substrates and divert excess energy to wasteful heat production. Terminal electron acceptors (those
which are capable of being reduced by an electron carrier of the ETC) intercept electrons from the
ETC and participate in futile redox cycling, whereby the compound is reduced at the expense of
energy derived from substrates. Alternate electron acceptors (or electron-shunts), such as adriamycin,
paraquat and a number of naphthoquinones, accept electrons and then feed them back to the
respiratory chain at higher redox potential. This allows electrons to bypass a portion of the ETC
excluding it from energy generation. Typically the secondary electron acceptor that completes the
redox cycle is a terminal complex of the ETC and not molecular oxygen. A classic example of an
20
alternate electron acceptor is the antineoplastic agent doxorubicin (adriamycin). With a redox
potential of -320mV doxorubicin is a good alternate electron acceptor from mitochondrial complex I,
which then forms the reduced semiquinone free radical intermediate. The oxidation of mitochondrial
glutathione, induction of the mPTP and the oxidation of cardiac mtDNA highlight the importance of
mitochondrial redox cycling as a critical pathway in the mechanism of doxorubicin induced
cardiotoxicity. Furthermore, naphthoquinones represent another important class of alternate electron
acceptors that redox cycle on the mitochondrial respiratory chain. This area of research has been
extensively studied in the laboratories of Tim Gant with SAR studies indicating that a univalent redox
potential of approximately -180mV being the primary determinant of whether naphthoquinones are
good redox cyclers [72]. Furthermore, the rates of free radical generation correlate with the degree of
mitochondrial toxicity and the extent of cytotoxicity [73]. Despite the detrimental toxicity associated
with alternate electron acceptors, electron shunts have been used therapeutically to bypass respiratory
chain dysfunction (i.e. shunting electrons from complex I to complex IV). A key example of this is
the use of menadione to treat mitochondrial encephelomyopathies, which are frequently characterised
by cytochrome bc-1 deficiency. Menadione enables electrons to bypass the dysfunctional portion of
the chain and significantly improves the bioenergetic deficiency caused by these disorders leading to
significant improvement in neurological and muscular performance [74].
1.5.2. INHIBITORS OF MITOCHONDRIAL SUBSTRATE OXIDATION:
Compounds causing inhibition of substrate oxidation are, for the most part, structural mimics of the
natural substrate and thus act via competitive inhibition of the respective reaction [75]. Inhibition of
substrate oxidation interferes with the generation and delivery of reducing equivalents to the respiratory
chain. As a result, inhibitors of mitochondrial substrate utilisation ultimately cause metabolic deficit
similar to that of direct ETC inhibitors and therefore tissues with high metabolic rates are most sensitive
to inhibitors of substrate oxidation. An example includes the inhibition of FA oxidation by valproic acid
and salicylic acid [76]. Likewise, fluoroacetate and fluoroacetamide represent structural analogues which
condense with oxaloacetate to form fluorocitrate, a potent inhibitor of the TCA cycle enzyme aconitase
[77]. It is important to acknowledge that inhibitors of mitochondrial substrate oxidation include inhibitors
of both enzymes within the metabolic pathways and transport proteins required for substrate delivery to
the mitochondrial matrix [78]. For example, etomoxir (a potent inhibitor of carnitine palmitoyl-transferase
1) was withdrawn from late stage clinical trials due to cardiac toxicity and heart failure [79, 80].
21
1.5.3. ROS GENERATION:
In the IMM, ROS, particularly superoxide radicals, can be generated by complex I, iron sulphur protein,
complex II, complex III, cytochrome oxidase and monoamine oxidase. As described in the previous
section, generation of ROS such as superoxide, H2O2 and hydroxyl radicals (that escape the antioxidant
defence mechanisms of the cell) act via the peroxidation of phospholipids in the biological membranes
and cause oxidative damage to DNA and proteins, as a result, spreading damage beyond the confounds of
the organelle. The damaging action of ROS in the central nervous system has been implicated in
Alzheimer’s and Parkinson’s diseases [81]. A plethora of drugs can induce mitochondrial toxicity via
direct ROS production (by interfering with complex I/III etc.) or indirectly via inducing mPTP induction,
disrupting the respiratory chain, uncoupling OXPHOS, damaging mtDNA and subsequent protein
synthesis or by impeding/depleting the cellular antioxidant pool [82]. Likewise many drugs have been
developed as antioxidants (e.g. coenzyme Q10). Deliberately targeted to mitochondria, these molecules
have been applied therapeutically in different congenital OXPHOS disorders.
1.5.4. INDUCING MITOCHONDRIAL PERMEABILITY TRANSITION:
The mitochondrial permeability transition pore (mPTP) resides in the IMM which (under normal
physiological conditions) is impermeable to all, but a few, selected metabolites and ions. Under
conditions of stress mitochondria can undergo permeability transition (i.e. pore opening) which in general
terms encompasses a sudden, non-selective increase in IMM permeability to all solute of a molecular
mass less than 1500 KDa (see Fig.1.5 below). Upon opening of the mPTP, low molecular weight
substrates and water can freely penetrate the mitochondrial matrix resulting in mitochondrial swelling,
loss of ΔΨ, outer membrane rupture and the release of cytochrome c into the cytosol (leading to the
initiation of cell-death pathways). It is this triggering of cell death which underlies the toxicity of t-butyl-
hydroperoxide, valproic acid and the hepatotoxicity of diclofenac. Further examples of xenobiotics or
endogenous factors which can induce permeability transition include the steroid hormone
dehydroepiandrosterone, naproxen, salicylic acid and the neurotoxin MPP+ [53]. Importantly, modulation
of the mPTP tends to occur via binding to a particular component of the pore such as ionidamine binding
to the adenine nucleotide transloacse (ANT) [6].
22
FIGURE 1.5: Putative mPTP proteins in the OMM and IMM in normal physiological and pathophysiological conditions. [CK – creatine kinase, HK - hexokinase, Bcl-2 – BAX – BCL2-associated X protein, PBR - peripheral
benzodiazepine receptor (since renamed Translocator Protein), AIF – apoptosis inducing factor, BAK – BCL2
antagonist/killer, Cyclo D – cyclophillin D]. Image drawn based on figure published in [83]. Image not scaled.
ANT is one of the principle components of the mPTP. Further examples of drugs which inhibit this
protein include agaric acid and atractyloside and these agents lead to substrate depletion, decreased ATP
output and generation of ROS. Importantly, other drugs such as cyclosporine and Ro 68-3400 have the
opposite effect by inhibiting the mPTP. As well as its use as an immunosuppressant, cyclosporine has
become a pivotal tool compound for experimental studies into the function and control of the mPTP [84].
Furthermore therapeutic groups are investigating the utility of inhibiting the mPTP for the treatment of
neurodegenerative disorders [85] and ischemia reperfusion injury [86] / myocardial preconditioning [87].
23
1.5.5. OXIDATION AND MUTATIONS OF MTDNA, OR INHIBITION OF MTDNA SYNTHESIS:
The disruption of nuclear genes important for mitochondrial homeostasis can lead to autosomal inherited
disease. Over 110 specific mutations of mtDNA have been described [88]. Further, inhibition of mtDNA
synthesis and/or DNA oxidation is a key characteristic of the toxicity of many antiretroviral drugs.
The thymine analogues zidovudine and stavudine, the adenosine analogue didanosine, the cytosine
analogues zalcitabine and lamivudine and the guanine analogue abcavir are nucleoside reverse
transcriptase inhibitors (NRTI) used to prevent the replication of the human immunodeficiency virus
(HIV). These analogues are recognised by the host DNA polymerases before binding and preventing
elongation of the replicating strand (resulting in truncated and unstable replicons). Toxicity is associated
with the fact that mitochondria contain just a single DNA polymerase (Pol-γ) which has a high affinity
nature for these nucleoside analogues [89]. The resulting truncated and unstable mtDNA is responsible
for mtDNA depletion observed post-NRTI therapy and this not only leads to a decrease in mitochondrial
abundance but mitochondria which do survive lack many of the mtDNA-encoded protein subunits
essential to the ETC complexes [90].
A small number of acquired immunodeficiency disorder (AIDS) patients have suffered adverse outcomes
as a result of mitochondrial toxicity, caused by long term anti-retroviral therapy that includes
hyperlactaemia, sensory neuropathy and liver steatosis. In rare cases, NRTI-induced lactic acidosis, liver
failure or pancreatitis has been fatal. Furthermore, mtDNA depletion has been demonstrated in the liver
of HIV patients with both stavudine and zalcitabin NRTI’s inducing time/concentration-dependent
mtDNA depletion [91].
Crucially, if a large proportion of the mtDNA present is mutated the mitochondria will become
dysfunctional, although retain the ability to replicate via biogenesis. This results in the spreading of the
mutation and may be behind the persistent and cumulative nature of mitochondrial toxicity [92]. As
mammalian cells contain between 2000-5000 copies of the mitochondrial genome, toxicity from mtDNA
damage or depletion only becomes apparent gradually with chronic treatment. As a result of the problems
with the HIV drugs however, the FDA now require all antiviral submissions in this therapeutic class to
include assessment of the effect on mtDNA [93].
24
ROS generated during OXPHOS has been shown to induce oxidative DNA damage including single- and
double-strand breaks, abasic sites and base damages. Due to the close proximity of mtDNA to the
respiratory chain, mtDNA has demonstrated a higher susceptibility (than nuclear DNA) to damage such
as 8-oxoguanine [94].
In addition to effects directly to mtDNA, another well-established mode of toxicity is via drug-
interference with mitochondrial protein synthesis (i.e. the translation of mtRNA). Mitochondria contain
their own enzymatic machinery required to translate protein from mtDNA encoded RNA molecules with
the ribosomal proteins distinctly different to those in the cytosol which decode the nuclear genome.
Inhibition of protein synthesis is believed to result from binding to mitochondrial ribosomes with higher
affinity than ribosome-RNA binding. Examples include linezolid [95], chloramphenicol [96] and some of
the tetracycline antibacterial medicines [97].
1.5.6. MULTIPLE MECHANISMS
A major problem relating to the assessment of DIMT is the fact that many drugs likely induce
mitochondrial dysfunction via a number of different mechanisms. A classic example is the anti-epilepsy
medication valproic acid that inhibits mitochondrial FA β-oxidation (by both sequestering coenzyme A
and inactivating β-oxidation enzymes via electrophilic metabolites) and induces mitochondrial
permeability transition [98, 99]. A second example is the anti-anginal drug, amiodarone which has been
shown to inhibit mitochondrial complexes I, IV and V, uncouple OXPHOS and inhibit FA oxidation
[100]. Furthermore both the anti-psychotic drug chlorpromazine, and the anti-cancer drug flutamide, both
uncouple OXPHOS and inhibit mitochondrial ETC complex I. It is therefore clear that to identify and
assess DIMT pre-clinically, a battery of endpoints should be analysed which encompasses the array of
potential mechanisms of mitochondrial toxicity. Furthermore, a wide dose range should always be
assessed.
1.6. Methods of Detecting DIMT
No single assay can identify all mechanisms of DIMT. A range of assays, spanning multiple
mitochondrial endpoints, is therefore required. It is important that attempts to assess DIMT are
25
multifaceted in scope and take into account the distinct mechanisms by which drugs can interfere with the
coordinated regulation of intermediary metabolism and energy production by the cell [101].
Model systems for studying mitochondrial toxicity include whole cells maintained in culture, isolated
mitochondria, tissue sections (for histopathological markers) and sub-mitochondrial particles. The system
used is largely dependent upon the assay being performed however is of pivotal importance when relating
findings to potential events in vivo. It is essential to understand the limitations of the systems being used
and take due consideration of these limitations when interpreting the findings. For example, whilst used
widely in the study of mitochondrial function/dysfunction the following limitations are associated with
the use of isolated mitochondrial fractions:
Reports in the literature suggest that only around 30% of the total mitochondrial pool can be
isolated by differential centrifugation [102].
Compromised structural integrity following manual homogenisation of tissue and presence of
cellular debris in the mitochondrial fraction.
Disintegration of mitochondrial-cytoskeletal networks and heterogeneous branching of organelles
[21].
Ex vivo dosing of mitochondria with compounds, provokes an exaggerated response as the drug is
not subjected to metabolism and does not have to penetrate the cell thus having unrestricted
access to the mitochondria.
It was recently discovered that many subunits of the OXPHOS system are phosphoproteins.
Furthermore it was suggested that these and other mitochondrial phosphoproteins could be the
substrates of protein kinase A and protein kinase C amongst others [103]. If a compound has an
effect on a kinase which regulates the activity of the OXPHOS complexes, this effect may not be
observed in isolated mitochondria if the affected kinase is not of mitochondrial localisation.
Furthermore it is important to determine the quality of mitochondrial preparations being used. This can be
achieved by determination of the respiratory control ratio (RCR), calculated as the rate of respiration in
the presence of ADP divided by the rate obtained after the expenditure of ADP. Typical RCR values can
range from 3-12.5 depending upon the age of the donor, species, substrate choice and organ [104] (see
appendix 2).
26
Many of the in vitro experiments described below (table 1.1), such as the oxygen consumption and ATP
assays, are performed in immortalised cell lines, grown in glucose-containing medium. For ease of
culturing, it is routine practice to use immortalised cells lines for pre-clinical screening activities however
these have a preference for synthesising ATP via glycolysis when grown in glucose-conditioned media
[105]. This phenomenon is named the Crabtree effect and, due to reduced reliance on OXPHOS for
energy production, makes identification of mitochondrial toxicants challenging [106]. In order to
overcome this, cells can be grown in a medium containing galactose as opposed to glucose which forces
the cells to rely on mitochondria for their ATP synthesis and are therefore more susceptible to DIMT with
compounds which either inhibit the ETC or uncouple mitochondrial OXPHOS [107].
High throughput methods (e.g. oxygen sensitive probes) have been developed with the ultimate objective
of allowing company and research laboratories to perform large-scale screening of compounds which
interfere with mitochondrial processes (Table 1.1 below describes assays regularly used in the detection
of mitochondrial dysfunction in the drug-safety arena). This table is by no means exhaustive as
mitochondria affect such a wide variety of cellular events. For example analysis of proteins involved in
cell signalling pathways may provide information about mitochondrial function but is not a regularly used
assay.
In vitro techniques using cell culture or isolated mitochondria are commonly used to evaluate the effects
of drugs on mitochondria. These methods will remain crucial for target elucidation, for example,
distinguishing effects on the ETC (oxidation) from effects on phosphorylation efficiency (uncoupling)
[108]. It seems unlikely however, that in vitro assessment can adequately define the relevance of
mitochondrial dysfunction in vivo, especially with enough confidence to adequately monitor safety or
assess risk. Furthermore, traditional drug safety methodologies may be insufficient. Standard endpoints
used for safety testing in preclinical and clinical development, such as clinical signs, histopathology,
haematology and clinical chemistry are very important for detecting compounds with unintended effects,
but they are relatively imprecise and insensitive for detecting alterations in mitochondrial function. For
drugs that have some level of in vitro mitochondrial activity, it is anticipated that safety studies may need
to be augmented with more specialised or targeted evaluations
Specific in vivo endpoints are likely required in the future in order to improve understanding of DIMT in
vivo. This may include the analysis of isolated mitochondrial fractions from treated animals [109],
27
specialist imaging techniques such as positron emission tomography (PET) [110] or enhanced nuclear
magnetic resonance (NMR) techniques, such as magnetic resonance spectroscopy (MRS) [111]. The ideal
assessments for use in drug development would be non-invasive and demonstrate a good degree of target
organ specificity, predictivity and clinical translatability [5]. At present however, these assessments are
only implemented when mitochondrial toxicity is a limiting factor in the development of a candidate drug
and are not routine. Further work is therefore required in order to validate and develop such endpoints and
to understand their capability and limitations.
28
Assay or Endpoint Model System(s) Technology / Methodology Comments
Morphological analysis Fixed tissue/isolated
mitochondrial pellet
/protein isolate.
Electron microscopy Glutaraldehyde fixation and subsequent steps to sectioning and uranyl acetate/lead-citrate staining.
Western blot Separation of protein via SDS-PAGE and transfer to nitrocellulose membrane. Probing with
antibodies against various mitochondrial structural/bioenergetic proteins followed by secondary
antibody detection and chemoluminescent visualisation.
Respiration (oxygen
consumption)
Cells or isolated
mitochondria
Clarke type electrode Polarographic procedure using mitochondria suspended in sucrose EDTA/EGTA solution with
substrates and specific ETC inhibitors at 25-30°C (stirring). ADP/0 ratio can be calculated (mol ADP
phosphorylated per mol oxygen atom consumed)
Oxygen sensitive probes (Luxcel /
Seahorse Biosciences)
O2 quenchable fluorophores measure oxygen consumption in a multi-well microplate.
Seahorse technology produces a transient micro-chamber within which oxygen is measured
following sequential injections of mitochondrial compounds. BOFA analysis (Basal, ADP,
Oligomycin, FCCP, Antimycin A) facilitates calculation of multiple respiratory parameters such as
RCR, respiratory reserve capacity, proton leak, non-mitochondrial respiration, basal respiration and
respiration at an uncoupled state.
Calcium retention
capacity (CRC)
Isolated
mitochondria
Calcium green 5-N, Arsenazo III
specific ion electrode/ fluorescent
spectrophotometer.
Changes in absorbance spectrum at wavelength pair 675-685nm (ASZ III) or calcium Green
fluorescence (505nm/531nm) denote calcium fluxes following substrate stimulation.
Mitochondrial ΔΨ Cells or isolated
mitochondria
JC-1, TMRM, TMRE, NAO, RH-
123. Fluorescent spectrometric
reader.
Fluorescent markers which accumulate in the matrix and are released when the ΔΨ is decreased. A
number of fluorescent dyes are commercially available (e.g. JC-1, TMRM etc.)
mPTP/mitochondrial
Swelling
Isolated
mitochondria
Spectrophotometer (JC-1 /
TMRM) +KH2P04 to induce
swelling
Swelling is recorded spectrophotometrically at 540nm using succinate energised mitochondria.
ATP levels Cells and fresh
frozen tissue
High energy phosphate analysis
(AMP, ADP + ATP)
Determination of high energy phosphate content in immediately snap frozen tissue / cells (scraped
into perchloric acid) by HPLC.
ATP quantification, cell ATP
luminescent titre.
Inorganic phosphate determination / Firefly luciferin/luciferase system. Determination of ATP using
cell-based luminescence system. Measurement of "glow-type" luminescent signal.
ROS Cells in culture,
isolated
mitochondria,
frozen tissue.
DCFDA luminol probe Hydrolysed from CM-H2-DCFDA inside cell and reacts with ROS to form fluorescent DCF (503-
529nm).
GSSH/GSSG ratio. Determination
of antioxidant status.
Determination of glutathione in its reduced (GSH) and oxidised state (GSSG) can be analysed by
mass spectrometry or via absorbance in many different biological samples (cells, mitochondria,
blood)
Superoxide dismutase assay
(SOD)
Catalyses conversion of superoxide radicals to hydrogen peroxide via redox cycling. Analysis of
SOD activity using a 96 well colorimetric assay.
29
TABLE 1.1: Examples of assays used in the pharmaceutical industry for the analysis of DIMT.
Flow cytometry techniques.
Multiple tags (Thiolite Green/
Cell Tracker Orange, Mitosox
Red, Rhodamine 123, CM-
H2DCFDA, H2DCFDA, Xfect)
Thiolite Green / Cell Tracker Orange – GSH + ROS = GSSG. Thiolite Green is a sensor for
measuring thiol compounds. (GSH depletion)
MitoSox Red – Oxidation of MitoSox Red reagent by superoxide produces red fluorescence.
Rhodamine 123 – binds to mitochondrial membranes and inhibits transport processes such as the
ETC. Fluorescence proportional to the dissipation of mitochondrial ΔΨ.
CM-H2DCFDA / H2DCFDA – ROS generation. DCFH-DA hydrolysed by esterases to DCFH,
DCFH + ROS->DCF (fluorescent product measured).
Xfect protein transfectant - DNA damage (γ H2AX, DNA double strand break response biomarker)
Gene Expression – RT-PCR
(Taqman/Cybr green analysis)
Panel of oxidative stress biomarkers on a low density gene-array or TaqMan gene card. RNA-cDNA
from cells or tissues.
Gene
expression/mtDNA
content and deletion
Fresh frozen tissue RT-PCR, Microarray technology RNA isolation from snap frozen tissue or cells. Reverse transcription of RNA to cDNA prior to
analysis of mitochondrial gene expression using real time quencher/fluorescent TaqMan technology.
Alternatively to measure mtDNA depletion determine the copy number of a mitochondrial gene (e.g.
cytochrome c oxidase) relative to a nuclear-DNA housekeeper (e.g. β-actin)
Mitochondrial complex
activity (I-V)
Isolated
mitochondria
Mitochondria energised with
appropriate substrates and product
dependent changes in absorbance
are monitored.
Complex I activity measured as a rotenone-sensitive decrease in NADH concentration at 340nm
Complex II-III activity is measured by a succinate-dependent antimycin-A sensitive reduction of
cytochrome c at 550 nm
The rate at which cytochrome c is oxidised, represents the Vmax of the reaction performed by
complex IV.
Citrate synthase activity Cells / snap frozen
tissue.
Spectrophotometry. Citrate synthase is involved in the TCA cycle and widely used as a measure of mitochondrial mass.
Citrate synthase drives the reaction of acetyl CoA and oxaloacetate to form CoA. The production of
CoA was monitored by the reaction with DTNB and the increase in absorbance at 412nm. The Vmax
rates, when linear are normalized to the protein concentration of samples.
Lactate/Pyruvate Assay Cells (E.g. HepG2) Mass spectrometry [NADH]/[NAD+] is in equilibrium with [lactate]/[pyruvate] in the cytoplasm and extracellular space.
Methods are available to measure [NAD+] accurately; however quantifying NADH accurately is a
challenge. Quantifying [pyruvate] and [lactate] in culture media is a surrogate for measurement of
[NAD+] and [NADH]. Measurement of lactate:pyruvate also provides a measure of cellular
glycolytic activity.
Blood (serum) Clinical pathology analyser
Intracellular
triglyceride
accumulation/
Cells Colorimetric assay – biochemical
analyser.
A change in the intracellular triglyceride content of cells provides an indication of potential changes
in the mitochondrial bioenergetic function or βoxidation. Triglyceride reagent (Randox) determines
intracellular triglyceride levels through a colorimetric method based on enzymatic degradation of
triglycerides.
Metabolites Cells, tissue, blood,
biological fluids etc.
NMR, mass spectrometry Global metabolomics has allowed for a systems level analysis of mitochondrial toxicity. Permits the
identification of a chemical fingerprint allowing the identification of metabolic toxicological
pathways or to identify biomarkers of mitochondrial dysfunction.
30
1.7. Challenges and Complexities
Despite the wide range of assays regularly being used to detect mitochondrial perturbation in vitro, many
challenges remain.
1. Lack of robust in vivo methods for detecting DIMT – As described above, reliance upon traditional
drug development methods may be insufficient in detecting mitochondrial perturbation in vivo. It is
important to distinguish between the detection of an adverse effect due to mitochondrial toxicity
(apical effect) and effects on mitochondria that will lead to toxicity (i.e. an AOP). Current methods
were designed preferentially to identify and assess apical endpoints (e.g. increased blood lactate
concentration due to DIMT) whereas the move is now to develop an AOP strategy (i.e. identification
of reduction in respiratory reserve capacity which may cause toxicity due to mitochondrial
dysfunction, i.e. an upstream event in AOP). This move will enhance the predictive ability of drug
safety scientists in R&D.
Meanwhile however, standard endpoints used for safety testing (e.g. clinical signs, histopathology,
haematology, serum biochemistry etc.) are relatively imprecise and insensitive for detecting
alterations in mitochondrial function. For drugs that perturb mitochondrial function, development
studies may need to be supplemented with more specialised or targeted evaluations; however, these
novel approaches are under-developed and un-validated for use in preclinical toxicology studies.
Furthermore there have been no rigorous efforts to correlate in vitro and in vivo functional endpoints
with conventional measures of efficacy and toxicity. As a result, drug safety scientists are currently
unable to answer difficult questions from drug discovery groups such as;
- Which changes or what magnitude of mitochondrial perturbation in vitro is required to cause
adverse in-life toxicity and thus prompt potential candidate-termination?
- By how much do I need to reduce the in vitro effects on mitochondria to justify replacing the
lead molecule with a new candidate?
- Which endpoints from the in vitro or in vivo battery of assays are most relevant to assess the
safety of drug candidates?
Ultimately, the complexity of DIMT in vivo makes performing risk assessments a major challenge.
Progress is required to enable the design of more efficient pre-clinical studies with more sensitive and
specific measures of mitochondrial function, especially when in vitro activity has been noted.
31
2. Lack of suitable animal models to detect mitochondrial dysfunction: Routine pathology and
clinical chemistry performed post drug administration in rodent models have so far proved relatively
insensitive to DIMT. Mitochondrial capacity decreases with age or lack of exercise, suggesting that
aged, sedentary rodents may be more appropriate and representative models for studying DIMT rather
than young, active animals. Research has demonstrated that rodents which were selected to be low
capacity runners, had reduced mitochondrial content, reduced oxidative capacity and were more
prone to hepatic injury than their control counterparts [112]. Although various mouse models are
available which exhibit impaired mitochondrial function, few have been used in the pharmaceutical
industry for toxicology studies. One exception that has seen modest use however is the phenotypically
normal superoxide dismutase 2 (Sod2+/-
) mouse. Heterozygous for the mitochondrial antioxidant
manganese Sod2, this model shows increased levels of oxidative stress. An example of its utility was
demonstrated when Sod2+/-
mice showed signs of hepatotoxicity post-treatment with troglitazone with
no marked changes observed in the wild-type group [113]. The effect of oxidative stress has also been
explored in a study of mutant Drosophila melanogaster with reduced Sod2 expression, where the
authors describe reduced mitochondrial aconitase activity and shorter life spans than wild type flies
[114]. Toxicological investigations in Drosophila are rarely used however, in drug development due
to translatability issues. Other mouse models which have been shown to have impaired mitochondrial
function include, the mtDNA deletion mito-mouse [115], the ANT-/-
mouse [116], the mutant pol-γ
mouse [117] and the Tim23+/-
mouse which lacks a translocase for the IMM [118]. These models
remain largely untested and un-validated for use as tools in the assessment of DIMT.
3. Persistence of mitochondrial aberration: While many assays exist to characterise the effect of a
drug on mitochondrial function they do not address why the effect is latent (e.g. the delayed-onset
liver and heart toxicity after treatment with troglitazone). As mitochondria undergo continuous
replacement through division the most rational hypothesis for persistent perturbation is via
compound-associated/ROS-dependent damage to the mtDNA which is then passed onto daughter
mitochondria during replication. Whilst next generation sequencing approaches have vastly improved
our understanding of mitochondrial diseases few data have been generated on drug-mtDNA
interaction and DNA damage accumulation.
4. Lack of in silico methods to predict DIMT: In silico methods to predict DIMT are still in their
infancy, largely due to the large number of mechanisms by which a compound could impair
32
mitochondrial function. However some progress around classification of compounds based on
physicochemical properties is emerging. For example, studies have identified that many
protonophoric uncouplers contain characteristic acidic dissociable groups, electron withdrawing
moieties and large hydrophobic groups (e.g. 2,4-DNP, FCCP, benzimidazoles and even some non-
steroidal anti-inflammatory drugs (NSAID)) [119]. Furthermore, Zhang et al in 2009 discussed the
potential to predict DIMT in silico and whilst promising prediction accuracies (~77% ) were reported,
the compound test set used was relatively small and to date no comprehensive analysis downstream of
a high throughput screen has been published [120]. Further work is clearly required in order to
identify whether compounds which target mitochondria or impart a particular effect on mitochondrial
function, share a common set of physicochemical properties.
5. Lack of validated biomarkers for identifying DIMT in patients and/or preclinical species: In
2006, the FDA along with other organisations set up a biomarkers consortium to search-for and
validate new pathological markers (critical path initiative). To date there are no validated biomarkers
of DIMT and in fact, the CPI has resulted in very few validated/qualified biomarkers of any type.
Recent attempts have however included the use of mtDNA encoded proteins in peripheral fat and
peripheral blood mononuclear cells (PBMC’s) from HIV-positive individuals on anti-retroviral
therapy [121] and the use of blood transcriptomic markers (genes involved in OXPHOS) of drug
induced liver injury [122]. Furthermore, circulating acylcarnitine metabolites have been suggested as
good biomarkers of hepatotoxicity related to mitochondrial dysfunction in vivo [123]. Blood lactate
has also been suggested as a good circulating biomarker of mitochondrial dysfunction however its
presence in the systemic circulation is likely a secondary adaptation to perturbed energy production,
takes time to manifest and is largely unspecific (i.e. can be due to generalised liver injury, steatosis,
diabetes etc.). All of these candidates have shown proof-of-concept; however, they require stringent
validation prior to use in preclinical safety-studies.
6. Conclusively attributing mitochondrial dysfunction to particular drugs: Demonstrating that
in vitro observations predict in vivo outcomes pre-clinically and then conclusively predict clinical
outcomes in humans (taking into account cross-species concordance) is inherently challenging.
Hallmarks of mitochondrial toxicity are not easily translatable into the patient population.
Additionally the hypothesised biomarkers of mitochondrial dysfunction are relatively non-specific,
i.e. there is no certainty that observations are attributable to an adverse drug reaction as opposed to
33
other influences (e.g. the condition itself, inflammation, poor tissue perfusion etc). Despite this
caveat, easily translatable endpoints between pre-clinical and clinical studies should be sought. For
example, whilst isolated mitochondria are still a valuable tool in the understanding of particular
mechanisms of DIMT perhaps the routine use of isolated tissue mitochondria to assess preclinical
toxicity is not be a progressive approach (i.e. due to the inherent lack of tissue availability in human
trials)? It is however important to acknowledge that the era of searching for single protein biomarkers
which are specific, translatable and measurable may potentially be over or at least in decline. It is
likely that a tailored selection of specific investigations is required. Alternatively, there is great
interest in certain types of novel biomarkers such as miRNA species and these will continue to be
evaluated.
1.8. The use of a Systems Approach
Where limited understanding exists in terms of the mechanisms downstream of a toxicological event a
principle method of investigating the response is the use of a systems approach. Whilst the job of a
toxicologist is to understand and ultimately predict the adverse effect of chemicals in a biological system,
this task is incredibly complicated due to the inherent complexity of biological systems. Furthermore,
observational toxicology has certain limitations such as the difficulty in developing effective in vitro
assays, in developing informative biomarkers and the problems involved in designing out structural
liabilities based on SAR. The true value of a systems approach is therefore the ability to build an
AOP/MOA which focuses on the identification of the key events, their quantitative inter-relationships and
human relevance.
The field of systems toxicology (i.e. a systems approach) is relatively new, with the term coined for the
first time in 2003 [124]. The definition of what encompasses systems toxicology does however vary
greatly in the literature. The concept of a “systems approach” is still often confused with the field of
systems biology, where computational and mathematical modelling is a central aspect. A systems
approach is more reliant on the integration of data from multiple disciplines/endpoints (including both
targeted and non-targeted investigations) to improve mechanistic understanding, search for biomarkers
and identify the most sensitive endpoints for different types of toxicological event. In contrast, systems
biology/toxicology relies on the modelling of global ‘omics’ data and using mathematical algorithms to
drive predictions. The use of both approaches have been integral to the shift in emphasis in both drug-
34
safety science and in biomedical research away from investigating single cells in isolation and towards
studying the true complexity of biological systems [125].
A systems approach encompasses the integration of classical toxicology (e.g. pathology, clinical
chemistry etc.) with both novel methods of evaluation and the quantitative analysis of molecular changes
occurring across multiple layers of biological organisation. Tailored approaches therefore need to be
combined with global analyses in order to gain an understanding of both the local effects of xenobiotics
on hypothesised outcomes and the emergent/systems level effects [126].
The selected endpoints for analysis should be dictated by the aims of the experiment or as a result of any
known understanding of the molecule’s AOP, and as a result, be tailor-made to the specific adverse
reaction observed. Whether the effect is observed within a single cell, organ, or at the level of the whole
organism dictates the depth of the system and thus the approach to be taken (i.e. this drives how complex
or niche the system needs to be). In toxicology, the effect being studied is often at the organism level (i.e.
an adverse in life effect) and although targeted evaluations remain pivotal to improve mechanistic
understanding at a particular target site/organ, these need to be anchored to the adverse effect.
Alternatively, the toxicological event may be a histopathological lesion in a single tissue and therefore the
system reduces considerably in size, although one must be cautious that this is not an over-simplification
(inter-organ/tissue effects may be important). Either way, due to the extent of biochemical cellular
responses following drug-induced perturbation of cellular processes, a systems approach will likely
always entail the use of global methods. As a result and key to identifying the fundamental mechanisms
of dysfunction is careful analysis of these data using interaction networking and biological theme
analyses.
1.9. Tool Compounds Studied
Two molecules (no longer in active development within GlaxoSmithKline) were chosen to study
mechanisms of DIMT, based on their potent and selective effect on mitochondrial function. Furthermore,
the mechanisms by which they affect mitochondrial function (respiratory chain inhibition and uncoupling)
are commonly observed in preclinical assessment of drugs for mitochondrial activity. These compounds
are introduced in section 1.9.1 and 1.9.2 below.
35
1.9.1. GSK932121A (COMPLEX III INHIBITOR)
GSK932121A (shown in Fig.1.6 below) is a 4(1H)-pyridone molecule that was in development as an anti-
malarial medicine. In FTIH trials, GSK932121A was well tolerated however adverse toxicity was
observed in pre-clinical studies with a pro-drug of GSK932121A, designed to increase oral
bioavailability. This toxicity profile was later observed using GSK932121A itself when dosed IP (to
provide similar systemic exposure levels to those achieved with pro-drug). These data resulted in
GSK932121A’s termination from development due to a potentially narrow therapeutic index [127].
FIGURE 1.6: Chemical structure of GSK932121A (mw: 425.786). This pyridone molecule was designed for the treatment of
the Plasmodium falciparum malaria infection.
Mitochondria are seen as an attractive target for anti-infective medicines. Due to the integral function
mitochondria play in cellular biochemistry a sound therapeutic approach is to induce mitochondrial
dysfunction in the infectious species (e.g. parasite), whilst avoiding crossover to the mammalian target.
This approach has shown proof of principle by the atovaquone/proguanil (GlaxoSmithKline’s Malarone)
combination therapy, used today as a treatment of multi-drug-resistant malaria. The drug works via
inhibition of the Qo site of the cytochrome bc1 complex thus inhibiting mitochondrial electron transport.
As the ETC is located in the plasma membrane in prokaryotes as opposed to within the mitochondria in
eukaryotes it is hypothesised that drugs will effect mitochondrial processes with much higher potency in
prokaryotic systems and thus provide a wide therapeutic window.
Similar to atovaquone, GSK932121A is a selective inhibitor of the mitochondrial ETC. As described by
Bueno and colleagues in 2012, GSK932121A inhibits the plasmodial cytochrome bc1 complex in the low
nanomolar range (IC50= 0.007µM). GSK932121A is significantly more potent against the P.falciparum
NH
O
CH3
OH
Cl
O
O F
FF
36
target compared to mammalian cytochrome bc1 isolated from either human HEK293 cells (IC50= 0.4µM,
57x less potent) or rat H9C2 cells (IC50= 0.6µM, 86x less potent). In whole cells the trend continued,
wherein, cytotoxicity was observed at significantly higher doses in mammalian derived HepG2 cells
(IC50=10µM) and H9C2 cells (IC50=14µM) compared to plasmodium derived cultures (3D7A and
FCR3A) which both showed an IC50 for cytotoxicity of 0.006µM. This represents between a 1600-2400x
higher potency against plasmodium cells compared to mammalian cells, suggesting a potentially wide
therapeutic margin, based on in vitro data.
FTIH study with GSK932121A: There was no evidence of dose-limiting toxicity in oral pre-clinical
studies and therefore GSK932121A was progressed to a FTIH study. The purpose of the FTIH study was
to evaluate the safety and tolerability of the parent drug GSK932121A in comparison with placebo and to
investigate the pharmacokinetics of the compound in man. Eight healthy adult male subjects received
single doses of GSK932121A parent (3mg, n=4 or 30mg, n=4) with four separate subjects receiving
placebo alone. GSK932121A was well tolerated.
The pro-drug approach: Improved bioavailability causes an adverse toxicological profile: Despite
excellent solubility, GSK932121A demonstrated non-linear pharmacokinetics in preclinical species with
decreased oral bioavailability at high doses of the solid dosage form. In attempts to improve the oral
bioavailability of GSK932121A a pro-drug approach was investigated. A water soluble phosphate ester
pro-moiety was attached to the C6-CH2-OH hydroxyl as shown in Fig.1.7 below. Water soluble phosphate
esters increase solubility and stability and undergo rapid bio-conversion (by endogenous membrane
bound alkaline phosphatases) causing the release of high concentrations of the parent drug. Early
indications in rats showed an approximately 10-fold greater oral bioavailability of the pro-drug at high
dose compared with the parent alone. Due to this outstanding physiochemical and pharmacokinetic
profile, the pro-drug of GSK932121A was progressed into full pre-clinical testing as a backup for the
parent GSK932121A candidate.
37
FIGURE 1.7: Schematic of the approach taken to manufacture a GSK932121A pro-drug. (A) A water soluble phosphate
ester was added to the C6-CH2OH group of GSK932121A in order to improve both stability and solubility for
the purposes of increasing oral bioavailability. (B) The resulting pro-drug showed increased bioavailability and
improved PK profile but the increased systemic exposure levels resulted in acute toxicity consistent with
mitochondrial impairment, which led to GSK932121A’s termination due to a potentially narrow therapeutic index. Diagram adapted from [127].
During these pre-clinical studies unexpected, acute toxicity was observed in rats after oral administration
of the pro-drug. The toxicity was characterized by hypothermia, cardiovascular abnormalities and at high-
doses, sudden death. Upon further investigation, the severe, acute toxicity exhibited by the pro-drug could
be replicated by the parent compound alone following IP administration, which induced similar exposure
levels to those achieved with the pro-drug given orally. One hypothesis was that the toxicity observed in
rats was due to inhibition of the mammalian bc1 mitochondrial complex by GSK932121A. FTIH studies
with GSK932121A were put on hold and the compound later terminated despite its good tolerability
profile at the two dose levels tested. A package of investigative work was initiated to explore the acute
toxicity caused by GSK932121A within which the present work (chapters 3-5) forms an integral first
stage.
1.9.2. GSK2617971A (OXPHOS UNCOUPLER)
Unlike GSK932121A (described above), GSK2617971A was withdrawn from active development early,
during the preclinical stage. GSK2617971A is a pyrazole compound which was designed as a selective
androgen receptor modulator (SARM) for the treatment of cachexia (muscle wastage). GSK2617971A
A B
38
(Fig.1.8) has shown potent uncoupling activity in vitro and is acutely toxic in vivo in rats, when dosed at
60mg/kg–100mg/kg. GSK2617971A was terminated early in development following observations of
toxicity in oral dose range finding (DRF) tolerability studies.
FIGURE 1.8: Chemical structure of GSK2617971A (mw: 371.118). This pyrazole molecule was designed as a selective
androgen receptor modulator (SARM) intended for the treatment of cachexia.
Since GSK2617971A’s termination from development, it has been used as a tool molecule for the study
of DIMT. As compounds with some degree of OXPHOS uncoupling activity are regularly identified in
preclinical screening, it was imperative to gain further understanding of its mechanism of toxicity in vivo,
in order to better inform discovery groups of the potential safety liability of this class of mitochondrial
toxicant (chapter 6). Furthermore, adverse effects caused by uncoupling of OXPHOS have been observed
in the clinical situation following administration of medicines such as doxorubicin and therefore
improved mechanistic understanding of this class of mitochondrial toxicant is translatable to effects
observed in patients.
1.10. Thesis Rationale and Aims
Mitochondria are increasingly seen as attractive targets for pharmacological intervention due to their
central role in the mechanism of many common human disorders (e.g. as treatments for metabolic
disorders, neurodegenerative diseases and cancer). On the flipside, DIMT is gaining recognition in the
pharmaceutical industry as a major cause of safety related attrition and a number of high profile drug
withdrawals have been linked to deleterious effects on mitochondrial function (e.g. troglitazone,
nefazodone and cervistatin). The potent effects of many of these compounds underscore the potential
39
risks associated with drugs causing mitochondrial toxicity. Improved methods to assess mitochondrial
function would therefore aid both risk assessment of mitochondrially acting compounds but also assess
the impact of drugs deliberately targeted to mitochondria for therapeutic purposes with the direction of
change in a number of mitochondrial assays potentially being pivotal to assessing either pharmacological
potential (e.g. inhibition of the mPTP to prevent aberrant cell death) or toxicity (e.g. potentiation of the
mPTP).
The inherently complex nature of mitochondrial pathophysiology (notably the array of different
mechanisms by which a compound can effect mitochondrial function) means there is currently a lack of
understanding on how best to foresee, understand or accurately assess the risk of compounds which effect
mitochondrial function. The major challenge is in relation to understanding DIMT in vivo and whilst the
past decade has witnessed advances in the development and integration of in vitro assays to aid pre-
clinical screening of mitochondrial agents, efforts to correlate the resultant data with in vivo outcomes are
limited [1]. What is clear is that improved knowledge of the downstream toxicities associated with
mitochondrial dysfunction would better enable toxicologists to provide informed advice to discovery
groups, that are facing the prospect of potentially developing a drug which has some level of
mitochondrial activity in vitro or de-selecting a molecule based on adverse mitochondrial effects.
Furthermore, to date, few comprehensive AOP’s exist where the molecular initiating event (MIE) is a
drug-interaction with a major mitochondrial process. The benefits of AOP’s to drug safety assessment
scientists includes (but is not limited to), the ability to predict potential toxicological effects of other
candidates showing similar in vitro activity, the ability to monitor the progress of an adverse drug
reaction, the potential to identify early biomarkers and the ability to design more intelligent investigative
safety studies which are tailored for mitochondrially-active therapeutics in development (i.e. both those
targeted to mitochondria or those which may produce toxicity by affecting mitochondria).
The overall aim of this project was to use a systems approach to better understand mechanisms of
mitochondrial toxicity both in vitro and in vivo. The overall hypothesis being that mitochondrial toxicity
leads to a specific and quantifiable AOP that can be used in drug development to better understand and
assess the risk caused by DIMT in the pre-clinical setting. Two GlaxoSmithKline compounds with known
mitochondrial activity (GSK932121A and GSK2617971A) were used in order to develop AOPs for
toxicity due to drug-induced respiratory chain inhibition and OXPHOS uncoupling respectively. These
compounds, which are no longer in active development, were chosen as a), the drugs are potent and
40
selective mitochondrial toxicants and b) respiratory chain inhibition and OXPHOS uncoupling are
frequently observed molecular initiating events in the preclinical analysis of drugs for mitochondrial
activity. The overall aim of the thesis was broken down into a series of objectives.
1. To test the hypothesis that in vitro assessment of mitochondrial function (i.e. in vitro cell lines or in
vitro testing of drugs on naïve isolated mitochondria) provides information on key events relevant to
the in vivo effects and therefore is useful in detecting mitochondrial toxicity for preclinical hazard
identification. The rationale was to show that in vitro testing is a suitable means of assessing key
events for DIMT.
2. To assess the utility of using a systems toxicology approach in order to understand the underlying
AOPs downstream of mitochondrial perturbation in vivo. Systems toxicology encompasses the
integration of classical toxicology (e.g. pathology, clinical chemistry etc.) with, a) novel methods of
evaluation, in this case functional mitochondrial changes and b) with the quantitative analysis of large
networks of molecular changes occurring across multiple layers of biological organisation (in this
case transcriptomic and metabolomic assessments). It was hypothesised that this systems approach
would enable the development of AOP’s for two mechanisms of DIMT (respiratory chain inhibition
and OXPHOS uncoupling).
3. To identify markers of DIMT at sub-toxic doses (or prior to the onset of overt toxicity) based on the
AOPs developed and to help in AOP development. The literature describes a number of examples
whereby a drug is withdrawn from the market due to toxicity which was not evident throughout pre-
clinical and clinical trials (e.g. troglitazone). It has been hypothesised that this is due to underlying
damage to mitochondria which was not detected at the preclinical stage as mitochondrial functional
changes have historically not been assessed. Mitochondria are able to respond to a certain level of
direct or indirect stress (due to a reserve capacity) and this mitochondrial-resilience prevents the
immediate onset of toxicity early in drug development. Markers of mitochondrial perturbation
occurring at sub-toxic doses would be of immense value to monitoring the potential long term safety
of molecules with some degree of mitochondrial activity in vitro but which are generally well
tolerated. Furthermore, markers of mitochondrial effects at sub-toxic dose-levels helps in the
development of AOP’s (as described in objective 2) by enabling primary effects to be distinguished
from consequential effects.
41
2.0. MATERIALS AND METHODS
42
2.1. Animals
All in vivo studies in rats were ethically reviewed and carried out in accordance with the Animals
(Scientific Procedures) Act 1986 and the GSK Policy on the Care, Welfare and Treatment of Animals. All
regulated procedures (i.e. dosing, implanting of microchip, and taking blood samples) were performed by
personal license holders in GlaxoSmithKline’s Safety Assessment and Laboratory Animal Sciences
departments.
2.1.1. GSK932121A STUDIES – GLAXOSMITHKLINE, WARE, HERTFORDSHIRE UK
Female Crl:CD(SD) rats were obtained from Charles River Laboratories UK (Margate, Kent) and were
housed under controlled environmental conditions (19-23°C, 55% ± 10% relative humidity, 12h dark-
light cycles), with free access to both water and 5LF2 EURodent Diet (Purina Mills International, St
Louis, MO, USA). All animals were implanted with an intrascapular Plexx microchip (Plexx B.V., Elst,
The Netherlands) on arrival for the purposes of identification and body temperature measurement.
Animals were acclimatised for at least 12 days prior to dose administration, and were 10 to 14 weeks old
on the day of dosing (~270-350g).
2.1.2. GSK2617971A STUDY – GLAXOSMITHKLINE, UPPER MERION, PENNSYLVANIA, USA
Male Crl:Wi (Han) rats were obtained from Charles River Laboratories (Charles River Laboratories Inc.,
Stone Ridge, NY, USA) and were housed under controlled environmental conditions (64-79°F, 30-70%
humidity and 12h dark-light cycles). Rats were offered 5002 Certified Rodent Diet (PMI Nutrition
International, Richmond, IN, USA) and filtered tap water ad libitum. All animals were implanted with an
intrascapular Plexx microchip (Plexx B.V., Elst, The Netherlands) on arrival for the purposes of
identification and body temperature measurement. Animals were acclimatised for one week and were 10-
12 weeks old on the day of dosing (~200-350g).
43
2.2. In Life Clinical Observations
In all studies that included the dosing of rodents with test substances, strict in-life monitoring was
performed to both ensure animal wellbeing (by reducing suffering) and closely monitor the effect of drug
treatment. Animals were checked for adverse effects immediately post-dose and then at approximate 15
minute intervals (in line with body temperature measurement). Animals were checked in accordance with
GlaxoSmithKline Safety Assessment’s project license and adverse effects were recorded directly onto
Provantis V9.0 data management system (Instem, Staffordshire UK). A scoring metric of slight, moderate
and severe was recorded alongside notification of the adverse event. Animals were killed immediately for
ethical reasons if any adverse event was graded severe. Grading of the severity of clinical signs was
performed by experienced animal technicians alongside the facilities named animal care and welfare
officer (NACWO), with the in-house veterinary surgeon on standby.
2.3. Preparation of Dosing Solutions
All doses and concentrations are expressed in terms of the parent compound.
2.3.1. GSK932121A STUDIES – GLAXOSMITHKLINE, WARE, HERTFORDSHIRE UK
A nanomilled, spray-dried formulation of GSK932121A (49.5% w/w), containing mannitol (44.5% w/w),
hydroxypropylmethylcellulose Pharmacoat 603 (5% w/w) and sodium lauryl sulphate (1% w/w) was
suspended in sterile water for IP administration. A dose of either 12.5mg/kg or 50mg/kg was selected
based on data generated in previous GSK932121A single-dose tolerability studies. A single dose of either
12mg/kg GSK932121A, 50mg/kg GSK932121A or vehicle (described above, minus test article) was
administered IP to female rats at a dose volume of 10 mL/kg.
2.3.2. GSK2617971A STUDY – GLAXOSMITHKLINE, UPPER MERION, PA, USA
Animals were separated into three groups (vehicle control (VC), low dose and high dose). Groups
comprised n=6 with the exception of the low dose which had n=2 due to extenuating study circumstances.
GSK2617971A was suspended in 30% koliphor/70% water vehicle. Vehicle control (VC) animals
received koliphor/water alone. Doses of 30mg/kg and 60mg/kg were selected for this study based on
44
findings from earlier studies in rats that demonstrated that both doses provoked adverse signs with the
30mg/kg dose being well tolerated up to 24 hours. A dose of 100mg/kg has been shown to be lethal by 8
hours. A single dose of 30 mg/kg, 60mg/kg or VC was administered by gavage via the oral route to male
rats at a dose volume of 10mL/kg.
2.3.3. FORMULATION OF COMPOUNDS FOR IN VITRO EXPERIMENTS
All compounds were formulated in dimethyl sulfoxide (DMSO) either within advised solubility ranges (as
obtained from MSDS data sheets) or at a standard top concentration of 10mM. DMSO was used at a final
concentration of 0.1% for cell culture experiments (to prevent cytotoxicity) or 0.5% for experiments using
isolated mitochondria (shown to have no direct effect on mitochondrial function). Stocks in DMSO were
stored at room temperature and out of direct sunlight for up to one year.
2.4. Measurement of Blood Gasses and Bicarbonate
Blood gas analysis was performed by Dr Jeffrey Ambroso (GlaxoSmithKline, Safety Assessment, RTP,
NC, USA). For blood gas analysis (pO2, pCO2 and HCO3) separate groups of animals underwent surgery
to place vascular access ports at the site of blood collection. The jugular artery was isolated, cannulated
(catheter entered approximately 2 cm into the jugular artery) and the catheter secured in place with
ligatures of non-absorbable suture material (Ti-cron, Medline Industries Inc., IL, USA). A 2ml saline
flush was given at the jugular surgical site prior to wound closure using absorbable suture material (PDS,
Ethicon Ltd, NJ, USA). After surgery a one week recovery period was permitted prior to administration
of test substance or VC as previously described (section 2.3.1 and 2.3.2). Whole blood samples (0.3mL
volume) were collected via vascular access ports into heparinized syringes. Blood was sampled at 5 to 6
hours post dose (dependent on the observed clinical signs). All blood samples were analysed using a
Roche OPTI CCA Blood Gas Analyser (Opti Medical System Inc., GA, USA), according to
manufacturer’s recommendations, within 2 hours of collection for pCO2, pO2 and HCO3. Data are
expressed as a percentage of baseline (pre-dose) measurement values.
45
2.5. Blood Sampling
Blood samples were taken in all of the in vivo studies for analysis of multiple parameters. Details of the
blood sampling methodologies are described in table 2.1 below.
In vivo study and
chapter
Site and details of
blood collection
Volume of blood
collected (mL)
Anti-coagulant and storage Endpoint
All studies (chapters
3, 4, 5 and 6)
Puncture of
abdominal aorta
under isoflurane
anaesthesia.
0.3 EDTA microtainer, centrifuged to
prepare plasma (see section 2.5.1
below) and frozen on solid carbon
dioxide. Samples were stored at -
20°C prior to analysis
Toxicokinetics
All studies (chapters
3, 4, 5 and 6)
Puncture of
abdominal aorta
under isoflurane
anaesthesia.
0.1 0.1mL of blood added directly to
0.4mL of 0.4M perchloric acid and
vortexed to ensure thorough mixing
of blood/acid. Samples frozen on
solid carbon dioxide and then stored
at -80°C prior to analysis.
Lactate/
Pyruvate
GSK932121A
metabolomics study
Jugular venepunture
for in-life samples
and puncture of
abdominal aorta
under isoflurane
anaesthesia for
terminal samples.
0.4 EDTA microtainer, centrifuged to
prepare plasma (see section 2.5.1
below) and flash frozen in liquid
nitrogen. Samples stored at -80°C
prior to analysis.
Global
Metabolomics
Profiling
TABLE 2.1: Overview of blood sampling methodologies. Detail of blood sampling methodologies, employed on all in vivo
studies described herein including the site of collection, the volume collected, the nature of the anti-coagulant, the storage conditions of the blood and the endpoint for which the blood was used for.
2.5.1. PREPARATION OF PLASMA FROM WHOLE BLOOD SAMPLES
Plasma forms the liquid component of whole blood and makes up ~55% of total blood volume [128].
Within a whole blood suspension, the plasma compartment normally contains the blood cells and is
regularly used for biochemical analyses. Plasma was prepared from whole blood samples using the
method described below.
Whole blood (typically between 0.2mL and 0.4mL) was collected into ethylenediaminetetraacetic acid
[EDTA] microtainers (#365974, Becton Dickinson and Co, New Jersey, USA) and stored on ice until the
end of autopsy procedure. All blood samples were then centrifuged for 3 minutes at 6000g following
which the plasma supernatant compartment was removed and placed into pre-labelled polypropylene
46
tubes using a graduated pipette. Plasma samples were then immediately frozen on solid carbon dioxide
and stored at -20°C prior to analysis.
2.6. Measurement of GSK932121A and GSK261971A Concentration in
Plasma
GSK932121A and GSK2617971A levels were assessed in rat plasma (EDTA anticoagulant) by LC-
MS/MS following protein precipitation. Levels of both drugs were quantified against a standard curve and
normalised to a GSK932121/GSK2617971 [13
C6] internal standard. The lower limit of quantification
(LLQ) was 10ng/mL using a 25µL aliquot of rat plasma. Briefly, protein was precipitated by adding 25µL
of rat plasma to 200µL acetonitrile (plus internal standard working solution) with subsequent vortex
mixing. Samples were then centrifuged for 10 minutes at 3000g and the supernatant transferred to a fresh
Eppendorf tube. A sample volume of 2µl was then injected onto a Waters Aquity UPLC (Waters, Elstree,
Hertfordshire, UK) connected to a SCIEX API4000 mass spectrometer (SCIEX, MA, USA) running in
positive-ion mode employing the Turbo-Ionspray source. A 50 x 2.1mm BEH C18 1.7µm, (Waters)
column was maintained at 50°C (solvent A: HPLC grade water 0.1% v/v formic acid, solvent B:
Acetonitrile) with a flow rate of 0.8mL/min. A gradient from 10% to 80% solvent B was employed over
1.30min followed by a re-equilibration time of 0.7mins yielding a total run time of 2 minutes.
2.7. Body Temperature Measurements
All animals were implanted with a Plexx (Plexx B.V., Elst, The Netherlands) microchip for the purposes
of identification and body temperature measurement. IPTT-300 programmable temperature transponders
(#11059, Plexx) were implanted subcutaneously and without anaesthetic. Body temperature or ID
readings were taken using a DAS-7007 S IPT/IPTT straight reader (#11087, Plexx) and DAS Host
Software (#11064, Plexx) was used to link animal ID with temperature readings. Data were recorded
telemetrically.
47
2.8. Isolated Mitochondrial Methods
2.8.1. ISOLATION OF MITOCHONDRIA
Mitochondria were isolated from selected rat tissues as described below.
Liver and Kidney Mitochondria: Mitochondria were prepared using the Qproteome Mitochondria
Isolation kit (Qiagen, Limburg, Netherlands) according to the manufacturer’s instructions. Briefly, 1.3g of
liver or 1 whole kidney was homogenised in ice cold lysis buffer using a Qiagen Tissue Ruptor. The
homogenate was incubated on an end-over-end shaker for 10 minutes at 4°C prior to centrifugation at
1300g for 13 minutes. The resulting pellet was resuspended in disruption buffer firstly by gentle pipetting
and secondly using a Dounce homogenizer (4 strokes at 200rpm). The resulting lysate was centrifuged at
1000g for 13 minutes with the resulting supernatant washed and pelleted twice at 6000g for 13 minutes.
The crude mitochondrial pellet was finally resuspended in Incubation Buffer B (130mM sucrose, 50mM
KCl, 2.5mM KH2P04 and 5mM N-2.Hydroxyethylpiperazine-N’-2-Ethanesulfonic Acid [HEPES], pH7.4
with KOH).
Skeletal Muscle Mitochondria: Mitochondria were prepared as described in [129] with minor
modifications. Briefly, the gastrocnemius muscle block was removed from one hind limb of the animal.
Visible tendons and ligaments were removed before the tissue was minced finely using dissection
scissors. The tissue was washed using phosphate buffered saline (PBS) supplemented with 10mM
ethylenediaminetetraacetic acid [EDTA], before suspending in PBS+10mM EDTA +0.05% trypsin for 30
minutes. The tissue was pelleted at 200g for 5 minutes to remove trypsin from solution and resuspended
in Isolation Buffer 1 (67mM sucrose, 50mM Tris/HCl, 50mM KCl, 10mM EDTA, and 0.2% w/v FA-free
BSA, pH 7.4). The tissue was homogenised using a Dounce homogeniser powered by an overhead motor
(7 strokes at 1200rpm) before first filtering through a wide pored mesh (200μm) to remove connective
tissue and secondly centrifuging at 900g for 10 minutes. The resulting supernatant was centrifuged at
8500g for 10 minutes and the pellet resuspended in Isolation Buffer 2 (250mM sucrose, 5mM ethylene
glycol-bis (2-aminoethylether)-N,N,N’,N-tetraacetic acid [EGTA], and 10mM Tris/HCl; pH 7.4). A final
centrifugation at 8500g for 10 minutes produced the mitochondrial-enriched pellet which was
resuspended in 0.25ml of Incubation Buffer B.
48
Brain Mitochondria: Mitochondria were prepared as described in [130] with minor modifications.
Briefly, the whole brain was excised fresh, weighed and homogenised directly in a Dounce homogenizer
powered by an overhead motor (9 strokes at 300rpm) in isolation medium (IM) (225mM sucrose, 74mM
mannitol, 1mM EGTA and 5mM HEPES, pH7.4 with KOH). The homogenate was split into two and
centrifuged twice (separately) at 1,300g for 3 min before re-centrifuging the pooled supernatants at
21,000g for 12 minutes. The resulting pellet was resuspended in 15% Percoll (GE Healthcare, UK)
diluted in IM and layered slowly above a pre-prepared secondary gradient of 40% and 24% Percoll. The
Percoll density gradients were centrifuged for 8 minutes at 30,750g with no braking to prevent disruption
of the Percoll bandings. All material banding at the interface of the 24% and 40% gradient was removed
and re-centrifuged in IM (minus EGTA) at 55,000g. Mitochondria were located at the bottom of the
centrifuge tube as a liquid mass with approximately 1mL of mitochondria removed for downstream
processing.
Heart Mitochondria: Mitochondria were prepared as described in [131]. Briefly, the heart was excised
fresh and weighed before being finely minced using dissection scissors to ~1mm3 sections. Aortic tissue,
fat and clotted blood were removed from the suspension and the tissue rinsed thoroughly in ice cold
Washing Medium (0.3M Sucrose, 10mM HEPES, 0.2mM EDTA, pH 7.2 with KOH) to remove
remaining blood. The tissue was then washed a further three times in washing medium on a filter before
being placed into 2.5mg/mL trypsin (Sigma #T8003) solution for 6 minutes prior to homogenisation using
a Dounce homogeniser powered by an overhead motor (6 strokes at 400rpm). The homogenate was then
left for a further 6 minutes in trypsin before undergoing a second homogenisation (4 strokes at 400rpm).
The trypsin was then deactivated using trypsin inhibitor from soy bean (Sigma #T9128). The suspension
was filtered through a nylon filter (25µm pore size) to remove remaining connective tissue. The filtrate
was then centrifuged first at 600g for 15 minutes and second the supernatant was centrifuged at 8500g for
15 minutes. The pellet was then washed three times with 1mL washing buffer before resuspension and re-
centrifugation at 8500g for 15 minutes. The resulting pellet was then resuspended in 20mL of isolation
medium (0.3M sucrose, 10mM HEPES, 0.2mM EDTA + 1mg/ml fatty acid free BSA, pH 7.2. with KOH)
and centrifuged at 9000g for 15 minutes. The final crude mitochondrial pellet was suspended in 0.5mL of
Incubation Buffer B and stored on ice for immediate use.
49
2.8.2. ASSESSMENT OF PROTEIN CONCENTRATION
Protein content was measured using a bicinchoninic acid (BCA) protein assay kit (Pierce, Rockford, IL,
USA) according to manufacturer’s recommendations. Briefly, a 1:20 dilution of mitochondrial isolate was
prepared in CHAPS hydrate. The protein suspension was vortexed before centrifuging at 12000g for 2
minutes. A volume of 25µL of sample or bovine serum albumin (BSA) standard (0µg/mL - 2000µg/mL)
was pipetted into a clear bottomed 96 well plate in triplicate. 200µL of working reagent was added to
each well and the plate was incubated for 15 minutes at 37°C prior to reading. Absorbance was measured
at 562nm on a FlexStation3 microplate reader (Molecular Devices, Sunnyvale, CA, USA). A standard
curve was prepared and used to determine the protein concentration of each unknown sample.
2.8.3. ASSESSMENT OF MITOCHONDRIAL BIOENERGETICS USING THE SEAHORSE XF24
ANALYSER
To assess bioenergetic parameters, i.e. ETC function and OXPHOS coupling, in isolated mitochondria,
the Seahorse XF24 Extracellular Flux Analyser (Seahorse Biosciences, Billerica, MA) was utilised. The
XF24 Seahorse platform utilises a disposable sensor cartridge that has 24 fluorescent sensors which
measure the oxygen concentration in the well containing isolated mitochondria in a 24 well plate. The
sensor cartridge also contains 24 pH probes for measurement of glycolytic function (extracellular
acidification rate, ECAR), however as mitochondria in isolation do not contain a cytoplasmic
compartment (and as such the capacity for glycolysis), ECAR measurements were only made in whole
cells in culture. Oxygen consumption rate (OCR) is measured in a transient 2-7µL “micro-chamber”
formed immediately above the mitochondrial layer enabling small changes in oxygen to be detected. The
fluorescence sensors are connected to a fibre-optic wave guide that delivers light which excites the
oxygen sensors at 530nm. The resulting florescence signal is emitted at 650nm and is detected by photo-
sensitive detectors in the XF24 instrument [132]. Within the disposable sensor cartridge are four drug-
injection ports which enable the user to inject substrates, inhibitors etc. throughout the course of the
experiment and visualise, in real-time, the effect on cellular bioenergetics (Fig.2.1). With isolated
mitochondria the principle assay used is a basal, oligomycin, FCCP, antimycin A (BOFA) assay which
enables the user to determine drug-related effects on a number of respiratory parameters such as ATP-
linked OCR, maximal uncoupled respiration and proton leak.
50
FIGURE 2.1: The Seahorse Bioscience BOFA assay: The Seahorse Bioscience BOFA assay analyses the effect of drug
treatment on ETC function. (A) Mitochondria are seeded into a 24 well plate and centrifuged to ensure
adherence. The mitochondrial monolayer is energised with substrate (and exposed to drug if performing an in
vitro treatment of control mitochondria). The plate is then inserted into the XF24 analyser and subjected to
pneumatic and sequential injections of tool-compounds from the assay ports A-D (previously loaded into the
XF assay cartridge at optimised concentrations) which modulate ETC function. (B) The effect of drug treatment
can be determined on a number of respiratory states (black text), or on calculated respiratory parameters (orange
text), e.g. proton leak, respiratory control ratio (RCR, gold standard measure of mitochondrial health) and maximal uncoupled respiration.
A significant proportion of time was devoted to the optimisation of BOFA assay parameters from
mitochondria isolated from five rodent tissues. OCR was monitored in the 24 well plate format as
previously described [133]. Briefly, sequential measurements of basal respiration, state 3, state 4 and
T im e (m in s )
OC
R (
pm
ols
/min
)
" B a s a l
R e s p ira t io n "
" S ta te 3 "
" S ta te 4 o "
" S ta te 3 u "
IN J E C T P O R T A
A D P
IN J E C T P O R T B
O lig o m yc in
IN J E C T P O R T C
F C C P
IN J E C T P O R T D
A ntim ycin A
P R O T O N L E A K
A T P -L IN K E D O C R
S ta te 3 / S ta te 4 o
= R E S P IR A T O R Y
C O N T R O L R A T IO
(R C R )
M A X IM A L
R E S P IR A T IO N
B
A
51
uncoupled driven respiration were made through real-time additions of reagents through the drug-
injection ports. Accordingly, (concentrations expressed as final concentrations and optimised as
recommended by manufacturers) ADP (5mM for all mitochondria except for 10mM with heart
mitochondria), oligomycin (2µM), FCCP (4µM) and antimycin A (4µM) were loaded into the 4 injection
ports of the XF Assay Cartridge and sequentially injected into each well throughout the assay.
Mitochondria were diluted to a concentration of either 10µg protein/well (liver and skeletal muscle
mitochondria), 7.5µg protein/well (brain mitochondria) or 2µg protein/well (heart and kidney
mitochondria), in MAS-1 buffer (220mM mannitol, 70mM sucrose, 10mM KH2PO4, 5mM MgCl2, 2mM
HEPES, 1mM EGTA and 0.2% BSA in sterile water, pH 7.2 adjusted with KOH) supplemented with
either 10mM succinate (liver, kidney and skeletal muscle mitochondria) or 10mM malate/glutamate (heart
and brain mitochondria). Mitochondria were seeded at a volume of 50µL into each well of an XF24 V7
microplate and centrifuged for 20 minutes at 2000g (4°C). Following centrifugation, 450µL of MAS-1
buffer, supplemented with 10mM succinate and 2µM rotenone (liver, kidney and skeletal muscle
mitochondria) or 10mM malate / glutamate (heart and brain mitochondria), were added to each well. The
mitochondria were viewed briefly under a microscope to ensure consistent seeding/adhesion and then
placed at 37°C for 8 minutes prior to loading into the XF24 analyser. Following a 12 minute equilibration,
two baseline measurements were made using a 30 second mix, 4 minute measure cycle. Reagents were
then sequentially injected into each well with a further 30 second mix, 1 minute wait, 4 minute measure
cycle between each injection.
The direct effect on OCR of compounds was also examined by treating freshly isolated mitochondria in
vitro following the above procedure with the following modification. A six point concentration range of
the drug to be evaluated, or 0.5% DMSO control, was added to the mitochondria following centrifugation
thereby constituting a 20 minute pre-measurement incubation period at 37°C.
2.8.4. CALCIUM RETENTION CAPACITY ASSAY
The calcium retention capacity (CRC) assay analyses the effect of drugs on the triggering of the mPTP.
Mitochondria play a key role in regulating intracellular calcium concentrations during both normal and
pathological states [134]. However, excess calcium is able to trigger the mPTP, characterised by a non-
selective increase in the permeability of the inner mitochondrial membrane [135, 136]. mPTP activity is
52
affected by compounds that interfere with mitochondrial function and this can be monitored by
measurement of CRC in mitochondrial isolates. Mitochondria from all five tissues were optimised for use
in this assay both in the presence of drug (i.e. for in vitro examination of the direct effect of drugs on
potentiation of calcium-induced mPTP) and in the absence of drug (i.e. analysis of mitochondria isolated
from treated and control rats in vivo). The CRC assay is summarised in Fig.2.2 below.
FIGURE 2.2: Graphical representation of the CRC assay. The CRC assay analyses the effects of drug treatment on the
triggering of the mPTP. Mitochondria are mixed with a calcium sensitive dye (Arsenazo III, ASZIII) which
upon the addition of a bolus dose of calcium binds and increases optical density (OD). When mitochondria are
energised by a substrate (either succinate, in the presence of rotenone to prevent electron backflow or a complex
I substrate i.e. pyruvate) they begin to uptake calcium (reduction in OD) until reaching permeability transition. The pore is then triggered and calcium is re-released.
Incubation Buffer B was used as the main CRC assay buffer for mitochondria isolated from all tissues.
Buffer B was used both to dilute mitochondria to the appropriate concentration and to prepare the
Arsenazo III dye mixture (calcium-sensing dye). Buffer B contains 130mM sucrose, 50mM KCl, 2.5mM
KH2P04 and 5mM HEPES, pH7.4 with KOH.
The CRC of freshly isolated mitochondria was determined as previously described [137] with minor
modifications. Briefly, mitochondria were suspended at 0.2mg/ml (liver, heart, skeletal muscle and brain
mitochondria) or 0.6mg/ml (kidney mitochondria) in Incubation Buffer B, supplemented either with
MITOCHONDRIA +
ASZIII
+Ca2+
+ SUBSTRATE
(i.e. succinate)
CRC = ΔOD
Compounds that decrease CRC are likely to
cause mitochondrial dysfunction (e.g. Ca2+
uptake inhibitors, uncouplers and ETC
inhibitors)
Compounds that increase CRC are likely to
be direct/selective MPT inhibitors
53
100µM Arsenazo III, 2.5µM rotenone and 1µg/mL oligomycin (liver, kidney and brain mitochondria) or
in Incubation Buffer B with Arsenzo III alone (heart and skeletal muscle mitochondria) in each well of a
96 well microplate. Absorbance was measured every 2 seconds at 650nm in a FlexStation3 microplate
reader (Molecular Devices, Sunnyvale, CA, USA). After approximately 1 minute of reading, calcium was
added (1µmol/mg mitochondrial protein) shortly followed by the addition of 10mM succinate (liver,
kidney and skeletal muscle mitochondria), 10mM malate/glutamate (brain mitochondria) or 2mM
pyruvate (heart mitochondria) as the mitochondrial substrate. The CRC was calculated as the difference in
optical density (∆OD) between the point at which mitochondria were energised and undergoing MPT
(highlighted in Fig.2.2 above).
The direct effect on CRC of compounds was also examined by treating freshly isolated mitochondria
from a control rat in vitro following the above procedure with the following modification. Drugs were
added over a concentration range, alongside a 0.5% DMSO VC and 1µM cyclosporine A (mPTP
inhibitor) to the mitochondrial suspension prior to reading. The cyclosporine A control was used to ensure
drug-induced modulation of CRC was detectable in the system used.
2.8.5. MITOCHONDRIAL MEMBRANE POTENTIAL ASSAY
Mitochondrial membrane potential (ΔΨ) was analysed in freshly isolated mitochondria using the Sigma
Aldrich isolated mitochondria staining kit (CS0760) according to manufacturer’s recommendations. The
kit is based on mitochondrial staining using the 5,5′,6,6′-tetrachloro-1,1′,3,3′-
tetraethylbenzimidazolocarbo-cyanine iodide (JC-1) dye. In normal cells, the JC-1 dye concentrates in the
mitochondrial matrix where it forms red fluorescent aggregates. Any event that dissipates the ΔΨ
prevents accumulation of JC-1 dye in the mitochondria. The dye is detected fluorometrically at 490nm
(excitation) and emission wavelengths of 590nm (JC-1 aggregate) and 532nm (JC-1 monomer) using a
FlexStation3 microplate reader (Molecular Devices, Sunnyvale, CA, USA).
2.8.6. COMPLEX III ACTIVITY ASSAY
The effect of GSK932121A on mitochondrial complex III was assessed in bovine heart mitochondria
using the Mitosciences Complex III Activity Assay Kit (Abcam, Cambridge, UK #ab109905) and
54
following manufacturer’s guidelines. Measurement of the conversion of cytochrome c from its oxidised to
reduced form was made at 550nm using a Spectramax plus 384 spectrophotometer (Molecular Devices,
Sunnyvale, CA, USA). Data were expressed in mOD/min.
2.9. Cell Culture Techniques
2.9.1. HEPG2 CELL CULTURE AND MEDIA COMPOSITION
The human hepatocellular liver carcinoma cell line (HepG2) was originally purchased from BIOCAT and
originated from a 15 year old adolescent Caucasian male. Cells were adapted to long term culture in
modified DMEM medium as described below. Cells were cultured in galactose-conditioned modified
DMEM according to table 2.2 below.
Constituent Cat Number Final Concentration
DMEM (with glutamine, without
pyruvate and glucose)
Invitrogen #11966 N/A
Heat Inactivated FBS, EU Approved
Origin: South America
Invitrogen #10500-064 10%
Galactose* Sigma #G075 10mM
HEPES Invitrogen #15630 5mM
Glutamax Invitrogen #35050 2mM
Sodium Pyruvate Sigma #S8636 100µM
Gentamicin Gibco #15750-045 5µg/mL
TABLE 2.2: Media constituents for HepG2 cell culture - * A stock of 0.5M galactose was prepared in DMEM media, passed
through a sterile filter and aliquots frozen at -20°C for up to 6 months.
Cell culture work was performed in a class II microbiological safety cabinet using sterile plastic ware.
Cells were maintained/incubated at 37°C within a humidified atmosphere with 95% air and 5% CO2
Cell Revival: Upon resuscitation, one vial of cells (frozen at 1x106 cells/mL) was flash thawed in a water
bath at 37°C (for approximately 2 minutes or until no ice crystals were visible) before cells were
transferred into a T80cm2 flask containing 25mL of pre-warmed culture media and placed into an
incubator to adhere for 24 hours. The following day the media was changed to remove residual DMSO
55
(used as a cryoprotectant to prevent cell ablation) from the freezing medium. Subsequently the media was
changed every 3 days and cells were passaged once per week according to the method outlined below.
Cell Passaging: To passage cells, medium was removed and cells were washed with 20mL of PBS (at
room temperature). Three-mL of 0.05% Trypsin-EDTA (Life Technologies #25300062) was added to the
cells and the flask returned to the incubator for 5 minutes. The flask was then gently tapped to detach
remaining cells before 10mL of culture medium was added to the flask to deactivate the trypsin. Cells
were centrifuged at room temperature for 5 minutes at 1200 rpm and the supernatant was discarded. The
pellet of cells was resuspended in 10mL of fresh complete media and passed through an 18G blunt-ended
needle 5 times to disperse aggregated cells and generate a single celled population. Cells were counted
using a haemocytometer (a 1:5 dilution of cells in culture media was routinely used to reduce the number
of cells and improve counting efficiency) and seeded as described below. Cells were routinely maintained
in T175cm2 flasks with morphology and growth rate regularly assessed by light microscopy. The seeding
densities used throughout this thesis were optimised stringently using cell-density titrations. Table 2.3
below details the seeding densities used both in routine cell maintenance (i.e. in T80 and T175 flasks) and
in both 96 and 12 well plates.
Flask / Plate Well size Supplier Seeding
Density
Time until 70-80%
Confluent
T80cm2 Flask 80cm2 Nunc (Thermo Scientific # 178905) 1x106 7 Days
T175cm2 Flask 175cm2 Nunc (Thermo Scientific # 178883) 3x106 6-7 Days
96 Well Plate 0.32cm2 Corning (Sigma # CLS3596) /
Seahorse Bioscience # 101085-004
2x104 24 hours
12 Well Plate 3.8cm2 Corning (Sigma # CLS3513) 2.5x105 48 hours
TABLE 2.3: HepG2 cell seeding density and flask/plate details. Seeding densities were optimised throughout the project. Cell
density titration experiments aimed to identify the best condition for the assay in question in relation to cell
density and confluency and therefore densities are not reflective of the size of the well/flask.
Cryopreservation of HepG2 Cells for maintaining Stocks: Over time it was important to maintain a
batch of frozen cells. During a passage cycle and immediately following trypsinisation, cells were
resuspended in freezing medium containing 90% FBS (Invitrogen #10500-064) and 10% DMSO. Cells
were then counted and 1mL aliquots (at a density of 1x106 cells/mL) were transferred to labelled
cryovials (alternatively, 4 x 1ml aliquots from a 175cm2 flask or 1 x 1ml aliquot from a 80cm
2 flask were
cryopreserved). Vials were then placed in a Mr Frosty (controlled temperature freezing container filled
with iso-propanol, Sigma Alrdich, #C1562) which was placed at -80°C for 24h. The frozen vials were
56
then transferred to a liquid nitrogen freezer for long-term storage. When freezing a batch of cells, one
vial of cells was revived after several days to ensure the freezing process had been successful and the cells
remained viable.
2.9.2. ASSESSMENT OF CYTOTOXICITY
The LDH Cytotoxicity Detection Kit (Roche Diagnostics, Basel, Switzerland #11644793001) was used to
assess LDH leakage into cell culture medium following treatment with compounds and respective DMSO
controls (as recommended by the manufacturer) on a SpectraMax Plus 384 plate reader (Molecular
Devices, Sunnyvale, CA, USA). Data were expressed as a percentage of leaked LDH against total LDH
(leaked values + Cell Lytic lysed samples) with 1% v/v Triton X-100 used as a positive control inducer of
cytotoxicity.
2.9.3. ANALYSIS OF WHOLE CELL BIOENERGETICS IN HEPG2 CELLS
Whole cell bioenergetics/cell metabolism was assessed using the Seahorse XFe96 Analyser (Seahorse
Bioscience, Billerica, USA) essentially as described by [138] and [139] with minor modifications. The
method described below is similar to that described in section 2.8.3 above although for cell culture
analysis the XFe96 analyser was utilised as oppose to the XF24. Additionally, with whole cells the
Seahorse Analyser permits the analysis of both OCR (measure of ETC/OXPHOS) and ECAR (measure of
glycolysis) providing an indication of the metabolic state of cells in culture. Again, drug injection ports
allow the effect of compounds/inhibitors/substrates on whole cell bioenergetics to be assessed.
Briefly, HepG2 cells grown in galactose-conditioned DMEM media (as described in section 2.9.1) were
plated into an XF96 cell culture plate (Seahorse Bioscience # 101085-004) at 2x104 cells per well and
incubated at 37°C (5% CO2) for 24 hours. Following incubation, cells were removed from the incubator
and the media was replaced with 175µL of serum-free assay media (table 2.4 below). Assay media was
prepared fresh on the day of the assay and warmed to 37°C prior to the pH being adjusted to pH 7.4 with
KOH.
57
Constituent Concentration Supplier #Part Number
XF Base Media N/A Seahorse Bioscience # 102353-100
L-Glutamine 2mM Life Technologies #25030-081
Sodium Pyruvate 1mM Sigma #P2256
Glucose 10mM Sigma #G8270
TABLE 2.4: Serum free Seahorse assay media constituents
Following media replacement, cells were placed into a 37°C incubator (no CO2 supplementation) for one
hour. During this incubation a dose response of the compound of interest was prepared in serum free
assay media. Oligomycin, FCCP and antimycin A/rotenone were also prepared at the concentrations
below (table 2.5) in serum free media, enabling the analysis of multiple bioenergetic parameters.
Compounds were added into the injection ports at increasing concentrations as additions are sequential
(therefore to maintain a consistent volume of 25µL in each port, the working concentration of compound
increased by 1X following each injection).
Compound Concentration in Well Final Concentration Volume in Well Following
Addition (µL)
Compound X
8X (dependent on dose
response)
Dependent on dose
response chosen
200
Oligomycin 9X (18µM) 2µM 225
FCCP 10X (2.5µM) 0.25µM 250
Antimycin A / Rotenone 11X (11µM) 1µM 275
TABLE 2.5: Concentration of BOFA reagents loaded into the drug injection ports and final concentration in the well.
Concentrations of oligomycin, FCCP and antimycin A/rotenone were optimised as recommended by the manufacturer.
Using a multichannel pipette and the supplied XFe96 cartridge loading guide, 25µL of compound X (port
A), Oligomycin (port B), FCCP (port C) and antimycin A/rotenone (port D) were loaded into the assay
cartridge which was then loaded into the XFe96 analyser for calibration. After the cells had been
incubated for one hour and the cartridge calibration was complete, the cells were loaded into the XF e96
analyser to undergo a 12 minute equilibration period. Following equilibration, three 3 minute basal
measurements were made prior to injection of the compound of interest through port A. The protocol then
ensued with three 1 minute mix, 3 minute measure, 1 minute mix cycles between each respective
injection. For whole cells in culture, bioenergetic parameters were calculated as shown in Fig.2.3 below.
58
FIGURE 2.3: Graphical representation of the whole cell OCR assay for determination of bioenergetic parameters. Respective bioenergetic parameters were calculated in pmol/min as shown.
2.9.4. IN VITRO COMPOUND WASH OUT EXPERIMENT
In order to assess the reversibility of drug effects on mitochondrial OCR, the experiment described above
(section 2.9.3.) was performed with the following modification. Following injection of the compound of
interest from port A of the XFe96 assay cartridge and subsequent capture of compound related effect on
basal OCR, the cell plate was removed from the analyser. Cells were immediately washed 3 times with
fresh XF assay media (37°C, pH7.4) with a final volume of 200µL left in the well. Cells were placed for
approximately 30 minutes into a 37°C incubator (no CO2 supplementation) whilst the XFe96 analyser was
re-calibrated. Basal OCR was immediately re-analysed in the XFe96 analyser to assess whether the effect
of the drug was persistent. Data were expressed as a percentage of the 0.1% DMSO control for both pre
and post-compound wash out.
T im e (m in s )
OC
R (
pm
ol/
min
)
0 2 0 4 0 6 0 8 0
0
5 0
1 0 0
1 5 0
2 0 0
R esp ira to ry
R e s e rv e
C a p a c ity
B a s a l
N o n -m ito c h o n d r ia l
r e s p i r a t io n
P ro to n L e a k
A T P
P r o d u c t io n
L in k e d
O C R
M axim al
R esp ira tion
59
2.10. Imaging and Histology
2.10.1. TEM ANALYSIS OF ISOLATED MITOCHONDRIAL PELLETS
TEM analysis of isolated mitochondria is shown in Appendix 1.1. Isolated mitochondria were
resuspended at a concentration of 1mg/ml in 4% formaldehyde/1% glutaraldehyde and transferred to
1.5mL Eppendorf tubes. Mitochondria were centrifuged at 12000 rpm for 5 minutes in a bench-top micro-
centrifuge to form a solid pellet and left at room temperature for 48 hours. Pellets were processed into
Agar 100 resin (Agar Scientific, Essex, UK). Ultra-thin sections (approximately 90 nm thick) were then
prepared, stained with uranyl acetate and lead citrate and examined in a Hitachi H7500 transmission
electron microscope (one grid section per mitochondrial preparation). An AMT XR41 Digital Camera
System v 600.202 was used to capture TEM images. Micrographs were observed for mitochondrial
ultrastructure as well as the presence of other cellular debris/organelles. No scoring metric was used. Data
are shown in Appendix I. Electron microscopy analysis was performed by Ian Francis and Paul McGill
(GlaxoSmithKline, Safety Assessment Histopathology, Ware, UK).
2.10.2. TEM ANALYSIS OF HEPG2 CELLS
HepG2 cells were fixed in 4% Formaldehyde/1% Glutaraldehyde. Cell culture media (plus compound /
DMSO) was removed and replaced with 1mL of fixative per well (in a 12 well plate format). Cells were
then gently scraped and analysed using a bench top light microscope to ensure detachment of cells from
the cell-culture plate. Fixed cells from 3 replicate wells were subsequently pooled and transferred into a
15mL falcon tube where a further 3mL of fixative was added. Samples were then centrifuged at 1300g for
5 minutes to create a loose cell pellet. Following centrifugation, excess fixative was removed and the
loose cell pellet (~1.5mL) was left at 2-8°C for 48 hours.
Following incubation, HepG2 samples were post-fixed using reduced osmium thiocarbohydrazide
osmium (R-OTO method), and processed manually into Agar 100 epoxy resin (Agar Scientific, Essex,
UK) [140]. Ultra-thin sections were taken that were subsequently blinded and 100 cells/experimental
group were examined for any ultra-structural changes (including an assessment of lipid and glycogen
content and any mitochondrial changes), using a Hitachi H7500 transmission electron microscope,
operating at 80kV.
60
2.10.3. TEM ANALYSIS OF LIVER
Small blocks of the right lateral lobe of the liver were fixed in 4% formaldehyde/1% glutaraldehyde.
These were post-fixed in 1% aqueous osmium tetroxide and processed into Agar 100 resin (Agar
Scientific, Essex, UK). One m toluidine blue stained survey sections were prepared and examined by
LM to locate the areas of interest (such as the periportal region). Ultra-thin sections (approximately 90nm
thick) were then prepared, stained with uranyl acetate and lead citrate and examined in a Hitachi H7500
transmission electron microscope (one grid section per animal). The AMT XR41 Digital Camera System
v 600.202 was used to capture TEM digital images. No scoring system or blinding was implemented in
the analysis of TEM samples.
2.10.4. LIGHT MICROSCOPY OF LIVER
Formalin fixed samples of liver (≤ 4 mm in thickness) were post-fixed in a final working solution of 2.5%
potassium dichromate and 1% osmium tetroxide in distilled water for 8 hours at room temperature. The
osmicated tissue samples were rinsed in running water for 2 hours, processed to paraffin block and
sectioned at 5 microns. Tissue sections were stained with the routine hematoxylin and eosin (H&E)
method and evaluated using a routine severity scoring system (mild, moderate and marked). Two sections
per liver were initially analysed by group and then blind to confirm observations.
2.11. Western Blot
Western blot data is shown in Appendix 1.2. Mitochondrial protein was loaded onto NuPAGE Bis-Tris
mini gels (# NP3015, Invitrogen) at 10µg in 1X LDS Sample Buffer and 1X NuPAGE Sample Reducing
Agent and separated by SDS-PAGE at 200V for 35 minutes. Following electrophoresis, protein was
transferred to a nitrocellulose membrane using the iBlot Dry Blotting System (#IB1001, Invitrogen).
Following transfer, the membrane was blocked for 1 hour at room temperature in 5% FA-Free milk and
1X Tris buffered saline with Tween 20 [TBST] (#9997, Cell Signalling Technology, MA, USA). The
membrane was washed three times in TBST (agitated for 5 minutes between each rinse) prior to a 1 hour
61
incubation at room temperature with the primary antibody cocktail (shown below) at a dilution of 1/230 in
TBST (as recommended).
Mitochondrial Membrane Integrity WB Antibody Cocktail (#ab110414, Abcam, Cambridge, UK).
Contains the five mAbs shown in table 2.6 below targeting each of the primary structural units of the
mitochondrion
Protein Name
Structural Unit Working
Concentration
(µg/ml)
Individual
Catalogue
Numbers
Molecular
Weight
(KDa)
VDAC1/Porin
OMM
2 #ab14734 39
Cyclophillin D Matrix
2 #ab110324 21
Ubiquinol-Cytochrome C Reductase
Core Protein I (Complex III)
IMM 2 #ab110252 49
ATP5a (Complex Va)
IMM
4 #ab110273 53
Cytochrome C
IMS 0.1 #ab110325 12
TABLE 2.6: Details of the five antibodies comprising the mitochondrial membrane integrity western blot antibody
cocktail (ab220414).
The membrane was then washed as described above, before a further 1 hour incubation in Goat-Anti-
Mouse IgG Horseradish Peroxidase (HRP) linked secondary antibody (#ab6789, Abcam) at a dilution of
1/50000 in TBST. Following incubation the membrane was again washed as described above before
visualisation of protein banding using the Supersignal West Dura Chemiluminsecent Kit (Thermo
Scientific #34076) in a Bio-Rad Versa-Doc Imaging System (Bio-Rad, Hertfordshire, UK) according to
manufacturer’s recommendations.
2.12. Reduced / Oxidised Glutathione Assay
Measurement of total glutathione, GSH (reduced), GSSG (oxidised) and GSH: GSSG ratio was made
using the NWLSS Glutathione Assay Kit (Northwest Life Science Specialties, LLC) according to the
manufacturer’s protocol. Briefly, 25µL of whole blood was resuspended in 1mL of assay buffer. Protein
was pelleted by centrifugation following the addition of 100µL of metaphosphoric acid with collection of
62
the supernatant. Subsequent to further dilution (1:50-1:100 fold) the supernatant was used to measure
total glutathione. Following addition of the thiol reagent 5-5’-dithiobis[2-nitrobenzoic acid] (DTNB),
glutathione reductase and NADPH the plates were read at an absorbance of 405nm at 12 second time
intervals for 3 minutes (reduced glutathione, GSH) or 15 minutes (oxidised glutathione, GSSG), using a
Spectramax plus 384 spectrophotometer (Molecular Devices, Sunnyvale, CA, USA). GSSG levels were
assessed by removing an aliquot of the same supernatant and subsequently depleting the sample of GSH
via the addition of 10µL of 4N Sodium Hydroxide and 10µl of 500mM vinyl pyridine followed by a 1
hour incubation. Reduced levels of glutathione were calculated by subtracting the oxidised glutathione
value from the total glutathione value obtained from the original supernatant.
2.13. Measurement of Lactate / Pyruvate in Plasma
Blood was collected into perchloric acid as detailed above. Lactate was measured on a Siemens Advia
1650 clinical chemistry analyser (Siemens Healthcare Diagnostics, Surrey, UK) using a Lactate assay kit
(Randox Life Sciences, Crumlin, Northern Ireland) according to the manufacturer’s instructions. Pyruvate
was also measured on this analyser using reagents from Sigma-Aldrich. Pyruvate estimation was made by
measuring the reduction in absorbance at 340nm due to oxidation of NADH to NAD as previously
described [141]. Pyruvate concentration was established according to a standard curve of between 0 and
0.45mmol/L pyruvate. All data were recorded in mmol/L and presented as a ratio between lactate and
pyruvate.
2.14. Measurement of Lactate in Cell Culture Media
Lactate was measured in supernatant medium using a colorimetric assay originally described by [142] and
further used by [143]. The assay is based on the conversion of lactate to pyruvate by lactate
dehydrogenase (LDH) activity reducing nicotinamide adenine dinucleotide (NAD+) to its reduced form
NADH. In detail, NADH reduces N-methylphenazonium methyl sulphate (PMS) to PMSH which reduces
p-iodonitrotetrazolium violet (INT) to INTH. Briefly, 20µl of supernatant medium was incubated with
180µl of assay solution consisting of 86mM triethanolamine HCl, 8.6 M EDTA.Na, 3 mM MgCl2.6H20,
326nM PMS, 790nM INT, 7% ethanol, 0.4% Triton-X-100, 3.3mM β-NAD and 4U/mL LDH. After
incubating for 7 minutes in dark conditions, the absorption of the colour product (INTH) was measured at
63
490 nm in a Biotek Synergy HT microtitre plate reader (Biotek,Winooski, VT, USA). A lactate standard
curve (0-25mM) with a non-linear regression fit was used to determine lactate concentrations from treated
cells (see Fig.2.4 below). Data were expressed as a percentage of control.
FIGURE 2.4: A typical lactate assay standard curve. Data points marked with a light grey line of best fit included LDH to
initiate the assay whereas data marked with a black line lacked LDH (used as a negative control).
2.15. Total RNA Extraction
Total RNA extraction from rat liver tissue and HepG2 cell lysates was performed using the Promega SV
RNA Isolation System (#Z3105, Promega, Madison, WI, USA). HepG2 cell lysate and rat liver tissue
homogenates were prepared as described in section 2.15.1 and 2.15.2 below. RNA was then extracted in
the same way and as described in section 2.15.3.
2.15.1. HEPG2 LYSATE PREPARATION
Remaining culture media was removed using an aspirator and the cell monolayer was washed with PBS
(1mL/well in 12 well plate format). PBS was then removed and 175µL of SV Lysis Buffer was added to
64
each well prior to freezing the plate at -80°C. Upon thawing, the bottom of each well was scraped
thoroughly using a sterile cell culture scraper and triplicate wells were pooled into an RNAse/DNAse free
1.2mL Eppendorf tube. Genomic DNA (gDNA) was sheared by passing the lysate through a sterile 19G
blunt-ended needle (#300149, BD Biosciences, San Jose, CA, USA) five times and placed on ice. Lysates
were immediately processed to RNA extraction.
2.15.2. RAT LIVER TISSUE HOMOGENATE PREPARATION
Approximately 90mg of snap frozen liver tissue was added to 525µL of SV RNA Lysis buffer in a
Precellys Homogenisation Vial (#CK28, Precellys, Derbyshire, UK) and homogenised twice using the
Precellys 24 at 6500rpm for 60 seconds. The homogenates were placed on ice for 5 minutes to allow the
froth to settle before passing through a 19G blunt-ended needle to sheer gDNA. Tissue homogenates were
immediately processed to RNA extraction.
2.15.3. TOTAL RNA EXTRACTION
Total RNA was extracted according to manufacturer’s recommendations (Promega SV RNA Lysis
System). Briefly, 175µL of hepatocyte lysate or liver homogenate was added to 350µL of SV Dilution
Buffer and mixed by inversion 3 times. The mixture was heated for 3 minutes at 70°C and centrifuged for
10 minutes at 14,000g. The supernatant was transferred to a fresh RNase/DNase free 1.2mL Eppendorf
tube containing 200µL 95% v/v ethanol, loaded onto an SV RNA Isolation spin column assembly and
centrifuged at 14,000g for 1 minute. Liquid in the collection tube was discarded and 600µL of SV Wash
solution added to each spin column prior to centrifuging at 14,000g for 1 minute. The collection tubes
were again emptied and 50μL of SV DNase Incubation Mixture (prepared with 40μL of SV Yellow Core
Buffer, 5μL 0.09M MnCl2 and 5μL SV DNase I enzyme) was applied to the surface of each column
membrane and incubated at room temperature for 15 minutes to allow DNA digestion to proceed.
Following incubation, 200μL of SV DNase Stop Solution was added to each column and the spin column
assemblies were again centrifuged at 14,000g for 1 minute prior to washing with 600μL SV RNA Wash
solution and re-centrifuging at 14,000g for 1 minute. The collection tubes were again emptied, and a final
wash step was performed to remove ethanol carry-over by adding 250μL of SV RNA wash solution to
each spin column assembly and centrifuging at 14,000g for 2 minutes. The column within each SV RNA
Isolation Tube Assembly was transferred to a fresh 1.2mL RNase/DNase free Eppendorf tube and 100μL
65
of SV Nuclease Free Water applied to the membrane. Total RNA was then eluted by centrifuging the
column/tube assemblies at 14,000g for 1 minute. The columns were discarded and eluted total RNA
stored at -80°C until required.
2.16. RNA Quantification and Assessment of Integrity
2.16.1. QUANTIFICATION USING THE NANODROP SPECTROPHOTOMETER
RNA concentration and yield were determined by UV absorbance using the Nanodrop ND-1000
Spectrophotmeter (Wilmington, DE, USA) according to manufacturer’s recommendations. Briefly, the
absorbance of each total RNA sample was determined (in 2µL volume) at 260nm (peak nucleic acid
wavelength) and 280nm (protein wavelength) and normalised against an elution blank negative control.
The A260:A280 ratio was used to determine the level of protein contamination and a ratio of 1.8-2.2 was
considered acceptable for downstream analysis. RNA concentration was calculated using the 260nm
reading and a conversion factor based on the extinction coefficient for RNA (A260 of 1.0 = 40µg/ml for
RNA). RNA concentration was expressed as ng/µL.
2.16.2. ASSESSMENT OF RNA INTEGRITY
Quality assurance of RNA samples was performed using the Agilent 2100 Bioanalyser (Santa Clara, CA,
USA) and RNA 6000 Nano Chips (#5067-1511, Agilent) according to manufacturer’s recommendations.
Briefly, 550µL of RNA 6000 Nano Gel Matrix was passed through a spin column at 1500g for 10 minutes
and 65µL aliquots made. To one 65µL aliquot, 1µL of RNA 600 Nano Dye Concentrate was added and
thoroughly vortexed before centrifuging at 13,000g for 10 minutes. RNA samples (~4µL) were degraded
at 70°C for 3 minutes. Gel-dye mix (9μl), Agilent RNA 6000 Nano Marker (5μl), ladder (1μl) and
denatured samples (1μl) were pipetted into specific marked wells on the chip according to manufacturer’s
recommendations. Fully prepared chips were vortexed on an IKA vortexer at 2400rpm for 1 minute. The
chip was run using the Bioanalyser 2100 within 5 minutes. During the analysis, negatively charged RNA
molecules are separated according to size by migration towards an anode. Fluorescent dye molecules
make RNA detectable by laser scanning with size and concentration of RNA determined by fluorescence
detected. The Agilent 2100 software filters the data and presents the results as electropherograms or
densitometry plots (Fig.2.5). Assessment of RNA integrity is made by evaluation of the
66
separation/definition of the 18S and 28S ribosomal peaks (rRNA). RNA integrity is quantified by an
automatically generated RNA integrity number (RIN) which is scaled between 1-10 (with 10 being
considered an RNA sample of exceptional quality). RIN numbers are generated using Agilent (Santa
Clara, CA, USA) proprietary algorithms which base quantification on the entire electrophoretic trace of
the RNA samples as opposed to simply the ratio of the ribosomal bands. This includes the presence or
absence of degradation products. Samples not reaching the required RIN of ≥7.5 were re-processed (as
per the manufacturer’s guidelines).
FIGURE 2.5: Gel image and electropherogram output from Agilent 2100 Bioanalyser – Assessment of RNA integrity. (A)
Agarose gel image - Negatively charged RNA molecules are separated according to size using “lab on a chip”
technology and are resolved on agarose gels. The two bands relate to the 18S and 28S ribosomal subunits. (B)
Data can also be visualized on electropherograms where an RNA integrity number (RIN) is assigned based on
the separation and definition of the 18S and 28S peaks. Samples 1-3 correspond to RNA isolated from snap frozen control rat liver.
2.17. Transcriptional Profiling using Affymetrix Genechip Microarrays
2.17.1. GENERATION OF SENSE STRAND CDNA
Sense strand complementary deoxyribonucleic acid (cDNA) was generated from total RNA using the
Ambion Whole Transcript (WT) Expression Kit (#4411974, Life Technologies, Paisley, UK) according to
manufacturer’s recommendations. Briefly, 200ng of RNA was used to generate first-strand cDNA using
A B
67
primers containing a T7 promoter sequence before the resulting single stranded cDNA was converted to
double stranded cDNA which acts as a template for transcription. This reaction uses DNA polymerase
and RNase H to simultaneously degrade the RNA and synthesize first-cycle second-strand cDNA.
Antisense complementary ribonucleic acid (cRNA) is then synthesised and amplified by in vitro
transcription (IVT) using an RNA Polymerase which binds to the T7 promoter sequence which was
previously engineered into the template strand based on the procedure outlined in [144]. cRNA was
purified by removing enzymes, salts, inorganic phosphates and unincorporated nucleotides by magnetic
bead capturing (using isopropanol), washing and elution. cRNA yield was then determined using the
Nanodrop ND-1000 spectrophotometer as described above (2.16.1) before second-cycle sense-strand
cDNA was prepared by random primer reverse transcription of 10µg cRNA. This process also
incorporated dUTP at a fixed concentration which is required for DNA fragmentation described below
(section 2.14.2). RNase H was then used to degrade the remaining cRNA template before second cycle
sense-strand cDNA was purified using magnetic bead capturing (using ethanol), washing and elution.
Purified sense strand cDNA yield was then determined using the Nanodrop ND-1000 spectrophotometer
as described above (2.16.1).
2.17.2. FRAGMENTATION AND LABELLING OF CDNA TEMPLATE
Sense-strand cDNA was fragmented and labelled ready for Affymetrix genechip analysis using the
Affymetrix WT Terminal Labelling and Hybridization Kit (#901524, Affymetrix, Santa Clara, CA, USA)
according to manufacturer’s recommendations. Briefly, 5.5µg of sense-strand cDNA generated using the
Ambion WT Expression Kit (section 2.17.1) was fragmented using uracil DNA glycosylase (UDG) and
apurinic-apyrimidinic endonuclease 1 (APE 1) enzymes in order to remove dUTP residues from ssDNA
molecules and cleave phosphodiester backbones, thus leaving 3’-hydroxyl and 5’-deoxyribose phosphate
terminus fragments. The length of the fragmented DNA was assessed using the Agilent 2100 bioanalyser
(as described in section 2.16.2) with fragments ranging from 20-200 bases. Fragmented single-stranded
DNA was labelled by terminal deoxynucleotidyl transferase (TdT) with biotin allonamide triphosphate as
recommended.
68
2.17.3. HYBRIDISATION, WASH AND STAINING OF AFFYMETRIX GENECHIPS
The following procedure utilises the Affymetrix Hybridisation, Wash and Stain Kit (#900720,
Affymetrix) according to manufacturer’s recommendations. Briefly, fragmented and labelled DNA (from
section 2.17.2) was added to a hybridisation cocktail containing, 20X eukaryotic hyb-controls, 2X
hybridisation mix, control oligonucleotide B2, DMSO and nuclease free water (at concentrations defined
by Affymetrix). The hybridisation cocktail was heated at 99°C for 5 minutes and then 45°C for a further 5
minutes in a heat block before centrifuging at 14,000g for 1 minute. Affymetrix Rat Gene 2.0 Sense
Target (ST) Genechips (Format 100 #902125) were equilibrated to room temperature immediately before
use and 130µL of hybridisation cocktail was injected into the array though the septa on the reverse of the
chip. The arrays were then placed in a hybridization oven (with rotating arm) at 45°C (60rpm) for 17
hours.
Following hybridization, the array was vented and the hybridization cocktail removed. The probe array
was then refilled with 160µL (for format 100 arrays) of Wash Buffer A. The Affymetrix Fluidics Station
450 was primed using fluidics script PRIME_450 to expose the lines to all wash buffers and to rinse with
dH20. Stain cocktail 1 and 2 and array holding buffer were pipetted into 1.5mL eppendorf vials and
centrifuged at 14,000g for 30 seconds to remove air bubbles before being placed into positions 1-3 on the
Affymetrix Fluidics Station 450. Wash buffer A, Wash buffer B and dH20 were placed into reservoirs
with the respective fluidics lines inserted. Arrays were clamped into place and the fluidics script
FS450_0002 was run. When the wash/stain protocol was complete, arrays were ejected from the Fluidics
Station and inspected to ensure no bubbles were present (arrays were re-filled with wash buffer A if
bubbles required removing).
2.17.4. SCANNING OF GENECHIPS AND STATISTICAL ANALYSIS OF MICROARRAY DATA
The Affymetrix Genechip Scanner 3000 is controlled by the Affymetrix Genechip Command Console
(AGCC). The scanner was turned on ~10 minutes prior to scanning to warm the laser. In the AGCC,
autoloader function was selected. Arrays were firstly wiped clean using a non-abrasive tissue before
loading onto the scanner carousel (up to 30 at a time). Scanning was started by clicking “start scan” in the
AGCC. Once scanning was complete the hybridisation/scan image was inspected to ensure no gross scan-
errors could be detected. CEL.files were then transferred from the PC and differential gene expression
69
analysis was performed using Array Studio version 7.0 (www.omicsoft.com). Affymetrix data were
normalised using the robust multichip average (RMA) method [145] and differentially expressed genes
were defined as those with greater than 1.5 fold change in expression, at p<0.05.
2.17.5. PATHWAY ANALYSIS
In order to infer biological meaning from transcriptomic data, biological theme analysis was undertaken.
This analysis provides a functional view of the classes of genes and pathways significantly presented
within a data-set. Ingenuity Pathway Analysis (IPA, Ingenuity, Redwood City, CA, USA) was utilised
which is a proprietary analysis system that must be subscribed to (GlaxoSmithKline, Investigative
Preclinical Toxicology Access, 2013-2015). IPA segregates gene groups according to a level of
significance defined by the user. In the present study all network associations were defined by
experimentally-supported literature evidence. All genes with a fold change of ± 1.5x and p<0.05 were
submitted for pathway analysis. Alternatively, genes identified as being highly statistically significant
with regard to separating experimental variables (using a principle component analysis, PCA) were
inputted to IPA for more refined analyses. IPA generates a list of canonical pathways from the genes
significantly affected alongside toxicological pathways altered. IPA also contains an interaction
networking capability which enables visualisation of gene-connections within a given biological response.
This permits visualisation of particular biochemical networks with the effected genes highlighted.
Furthermore IPA provides an annotation of each mapped gene which vastly supports inference of
biological meaning from the computationally generated network without repeated interfacing with the
literature.
2.17.6. COMPOUND CONNECTIVITY MAPPING
Connectivity mapping is a process whereby novel pharmacological and toxicological properties can be
identified in small molecules by comparing their gene expression signatures with others in a database.
The technique also facilitates the identification of novel tool compounds which may mimic the biological
action of the user’s compound based on the genes which are differentially altered [146]. Compound
connectivity mapping was used to compare the gene signatures generated from Affymetrix microarray
analysis of GSK932121A and GSK2617971A treated animals (the query gene signature) to over 1000
compounds located in the Broad Institute expanded data set (reference dataset). This reference database
70
contains 6100 reference profiles characterised by different treatment conditions of each compound
(applied to 5 human cell lines). A pattern matching algorithm/similarity metric was used to quantify the
closeness of connection between the two biological states as a result of small molecule treatment. The
query gene signature was composed of a short list of differentially altered genes most relevant and
important to characterise the biological state arising following compound treatment (selection criteria of
genes used for connectivity mapping analysis described in section 7.2.5). The sscMap (Java Application)
was used essentially as described in [147]. Data were expressed as connection scores and p-values (-
Log10p).
2.18. TaqMan RT-PCR Analysis from In vitro Samples
Real-time quantitative PCR (RT-PCR) is a routinely used technique to measure gene expression. RT-PCR
is usually performed on a small subset of gene transcripts and is a relatively low cost and sensitive
profiling technique. In the case of TaqMan RT-PCR, the real time monitoring of PCR amplification of an
amplicon is monitored by the incorporation of a probe consisting of two fluorophores. When the probe is
either tethered or untethered to the template DNA and prior to polymerisation, the quencher fluorophore
(usually long wavelength coloured dye) reduces the fluorescence from the reported fluorophore (usually
short wavelength coloured dye) via fluorescence resonance energy transfer (FRET). The reporter dye is
located on the 5’ end of the probe and the quencher at the 3’ end. Once the TaqMan probe has bound to
its specific target piece of template DNA (and following denaturation at high temperatures), the primers
anneal to the DNA and Taq polymerase incorporates nucleotides which removes the TaqMan probe from
the template DNA. This polymerization separates the quencher from the reporter and allows the reporter
to emit its fluorescence which is then quantified internally. RT-PCR allows the time at which the level of
fluorescence passes a threshold level (known as the Cycle Threshold or Ct) to be determined. The higher
the copy number of the target gene, the faster the fluorescence passes the Ct, and thus, by comparing Ct
values for different reactions, it is possible to determine the relative gene expression between samples
71
2.18.1. GENE PANEL
TABLE 2.7: Details of the primers and probes used for in vitro RT-PCR experiments. Table shows the details for the 15 genes selected for RT-PCR analysis (G6pd used as the housekeeper/normaliser gene). All genes had a FAM-NFQ reporter/quencher. The context sequence describes the nucleotides to which the assay was targeted.
Gene
Symbol
Gene Name Assay ID Lot Number RefSeq
Accession No.
Context Sequence
Pck1 phosphoenolpyruvate carboxykinase 1 (soluble) Hs01572978_g1 1312055 NM_002591 TGACAACTGCTGGTTGGCTCTCACT
Chac1 ChaC, cation transport regulator homolog 1 (E. coli) Hs00225520_m1 1294249 NM_001142776 TGAAGATCATGAGGGCTGCACTTGG
Gapdh glyceraldehyde-3-phosphate dehydrogenase Hs02758991_g1 1317397 NM_001256799 GACTCATGACCACAGTCCATGCCAT
Ppargc1a peroxisome proliferator-activated receptor gamma,
coactivator 1 alpha
Hs01016719_m1 1308701 NM_013261 AAGGCAATTGAAGAGCGCCGTGTGA
Lpin1 lipin 1 Hs00299515_m1 1169040 NM_001261427 AGAGAAAGTGGTTGACATAGAAATC
Foxo1 forkhead box O1 Hs01054576_m1 1301006 NM_002015 GGCTGGAAGAATTCAATTCGTCATA
Hmox1 heme oxygenase (decycling) 1 Hs01110250_m1 1305084 NM_002133 TGCTCAACATCCAGCTCTTTGAGGA
Pdk4 pyruvate dehydrogenase kinase, isozyme 4 Hs01037712_m1 1316401 NM_002612 TTTAAGAATGCAATGCGGGCAACAG
Nr4a1 nuclear receptor subfamily 4, group A, member 1 Hs00374226_m1 1259635 NM_001202233 GGCTTCTTCAAGCGCACAGTGCAGA
G6pd glucose-6-phosphate dehydrogenase Hs00166169_m1 1295896 NM_000402 GGGTGCATCGGGTGACCTGGCCAAG
Nr4a2 nuclear receptor subfamily 4, group A, member 2 Hs00428691_m1 1290694 NM_006186 CTGGACTATTCCAGGTTCCAGGCGA
Irs2 insulin receptor substrate 2 Hs00275843_s1 1289193 NM_003749 CACGACGGTCACCCCCGTGTCCCCG
Nr4a3 nuclear receptor subfamily 4, group A, member 3 Hs00545009_g1 1241861 NM_006981 AAAGAAGTTGTCCGTACAGATAGTC
Ppara peroxisome proliferator-activated receptor alpha Hs00947536_m1 1302244 NM_001001928 GCTGCAAGGGCTTCTTTCGGCGAAC
Atf3 activating transcription factor 3 Hs00231069_m1 1310874 NM_001030287 CACAAAAGCCGAGGTAGCCCCTGAA
72
2.18.2. FIRST STRAND CDNA SYNTHESIS
Total RNA samples were reverse transcribed into first strand cDNA prior to RT-PCR analysis. 1µg of
total RNA was used to generate cDNA using the BioScript Reverse Transcriptase kit (Bioline #BIO-
27036) according to manufacturer’s recommendations. cDNA synthesis was carried out with (RT+) and
without (RT-) the BioScript reverse transcriptase enzyme, to enable substitution of gene expression data
caused by amplification of gDNA. Briefly, total RNA was diluted to a concentration of 125ng/µL in 8µL
of DEPC-treated water (1µg) and combined with 10mM deoxynucleotide triphosphates (DNTP) mix
(Bioline #BIO-39053) and 40µM Random Hexamers (Bioline #BIO38028) in RNase/DNase free PCR
strip tubes. The samples were incubated at 70°C for 5 minutes using a DNA Engine Tetrad PCR cycler
(MJ Research, Massachusetts, USA) and chilled for at least 1 minute on ice. 4µL of RT-Buffer, 1µL of
RiboSafe RNase Inhibitor (Bioline #BIO65027), 1µL of BioScript Reverse Transcriptase (200u/µL) and
4µL of DEPC-treated water was then added to each reaction in a master-mix and tubes centrifuged to
collect the contents at the bottom of the tubes. Samples were then incubated at 25°C for 10 minutes, 42°C
for 30 minutes and then the reaction was terminated at 85°C for 5 minutes. Following incubation,
reactions were cooled on ice, immediately diluted 1:15 with DEPC treated water and stored at -20°C until
required.
2.18.3. TAQMAN RT-PCR
TaqMan RT-PCR was performed in 384 well plates using the QuantStudio 6 Flex Real-Time PCR System
(Applied Biosystems, Life Technologies, Paisley, UK). Briefly, 9 µL of 1:15 diluted cDNA was loaded
into each well of a 384 well plate (n=3 biological replicates with two technical replicates per sample) and
the plate centrifuged at 300g for 2 minutes to collect the cDNA at the bottom of each well. 10µL of
TaqMan Universal MasterMix II With UNG (Applied Biosystems, Life Technologies #4440045) and 1µL
the PCR primers/probes for individual genes (table 2.7) were added to each well ensuring that both the 2X
MasterMix II and the 20X primers/probes were both at 1X final concentrations in the well (TaqMan
Universal MasterMix and the PCR primers/probes were combined and added to each well in one step to
reduce variability due to pipetting error). One gene per plate was analysed (16 genes) with all samples
included on each plate. Non-template controls (NTC’s) were included (~ 6 wells per gene) where DEPC-
treated water replaced the cDNA template.
Plates were sealed with MicroAmp optical adhesive film covers (Applied Biosystems, Life Technologies
#4311971) and the contents mixed thoroughly be inverting 3-4 times. Plates were centrifuged at 300g for
73
4 minutes to collect the reaction products at the bottom of each well. Plates were then placed into the
QuantStudio 6 Flex instrument and run at default running conditions, for 40 cycles, with detection set at
FAM-NFQ for the detection of amplification fluorescence.
2.18.4. RT-PCR STATISTICAL ANALYSIS
Cycle threshold (Ct) values were exported from the QuantStudio software as tab-delimited text files and
data were transferred to Microsoft Excel for downstream analysis. Ct values were converted to copy
numbers of each gene and the RT- value was substituted from the RT
+ value to correct for amplification
of gDNA. Averages of duplicate (technical replicate) wells were calculated and sample copy numbers
were then normalised by division against the housekeeper gene, glyceraldehyde-3-phosphate
dehydrogenase (Gapdh). Statistical significance was derived using analysis of variance (ANOVA) (n=3)
with post-hoc Dunnett’s test in TaqMan toolkit (Microsoft Excel plug-in).
2.19. Global Metabolomics Profiling
Liver and plasma samples were sent to Metabolon (Metablon Inc, Durham, NC, USA) on dry ice for
global metabolomics analysis. In brief, samples underwent a methanol extraction to remove the protein
fraction prior to being placed under a Zymark TurboVap (Biotage AB, Sweden) under nitrogen to remove
the organic solvent. Samples were then split into equal parts for analysis on the GC/MS, LC/MS/MS, and
polar LC platforms. For liquid chromatography (LC), the samples were stored under nitrogen overnight.
For gas chromatography (GC), the samples were dried under vacuum overnight. Bioanalytical methods
are briefly described below.
Please note: a pooled matrix sample, generated by taking a small volume of each experimental sample,
was used as a technical replicate throughout the metabolomic analysis. This pooled sample was used to
distinguish between biological and process derived variability and was randomly included amongst study
samples.
Ultrahigh Performance Liquid Chromatography/Mass Spectroscopy (UPLC/MS/MS): The LC/MS
portion of the platform was based on a Waters ACQUITY ultra-performance liquid chromatography
(UPLC) and a Thermo Scientific Q-Exactive high resolution/accurate mass spectrometer interfaced with a
heated electrospray ionisation (HESI-II) source and Orbitrap mass analyser operated at 35,000 mass
74
resolution. The sample extract was reconstituted in acidic or basic LC-compatible solvents, each of
which contained 8 or more injection standards at fixed concentrations. One aliquot was analysed using
acidic positive ion optimised conditions and the other using basic negative ion optimised conditions in
two independent injections using separate dedicated columns (Waters UPLC BEH C18-2.1x100 mm,
1.7µm). Extracts reconstituted in acidic conditions were gradient eluted from a C18 column using water
and methanol containing 0.1% formic acid. The basic extracts were similarly eluted from C18 using
methanol and water, however with 6.5mM ammonium bicarbonate. The third aliquot was analysed via
negative ionization following elution from a HILIC column (Waters UPLC BEH Amide 2.1x150 mm, 1.7
µm) using a gradient consisting of water and acetonitrile with 10mM ammonium formate. The MS
analysis alternated between MS and data-dependent MS2 scans using dynamic exclusion, and the scan
range was from 80-1000 m/z.
Gas Chromatography-Mass Spectroscopy (GC-MS): The samples destined for analysis by GC-MS
were dried under vacuum for a minimum of 18 h prior to being derivatised under dried nitrogen using
bistrimethyl-silyltrifluoroacetamide. Derivatised samples were separated on a 5% diphenyl/95% dimethyl
polysiloxane fused silica column (20 m x 0.18 mm ID; 0.18µm film thickness) with helium as carrier gas
and a temperature ramp from 60° to 340°C in a 17.5 min period. Samples were analysed on a Thermo-
Finnigan Trace DSQ fast-scanning single-quadrupole mass spectrometer using electron impact ionization
(EI) and operated at unit mass resolving power.
Metabolon proprietary software was used to match ions to an in-house library of standards for metabolite
identification and for metabolite quantitation by peak area integration. Metabolon maintains a library
based on authenticated standards that contains the retention time/index (RI), mass to charge ratio (m/z),
and chromatographic data (including MS/MS spectral data) on all molecules present in the library.
Biochemical identifications are based on three criteria: retention index within a narrow RI window of the
proposed identification, accurate mass match to the library ± 0.005 amu, and the MS/MS forward and
reverse scores between the experimental data and authentic standards. The MS/MS scores are based on a
comparison of the ions present in the experimental spectrum to the ions present in the library spectrum.
Peaks were quantified using area-under-the-curve. For studies spanning multiple days, a data
normalisation step was performed to correct variation resulting from instrument inter-day tuning
differences (pooled plasma). Essentially, each compound was corrected in run-day blocks by registering
the medians to equal one (1.00) and normalising each data point proportionately. As such all data
presented herein is expressed as scaled intensity of a median equal to 1.00.
75
3.0. MECHANISMS OF DIMT – GSK932121A INDUCED
COMPLEX III INHIBITION
76
3.1. Introduction
As outlined in section 1.9.1, GSK932121A was developed as a 4(1H)-pyridone antimalarial drug and is a
potent, reversible inhibitor of the mitochondrial respiratory chain complex III in Plasmodium falciparum
(cytochrome bc1 IC50 = 0.007µM). The molecule inhibits the same target in mammalian species but with
lower potency (two orders of magnitude less potent on the isolated protein target from rats and three
orders of magnitude less potent in intact rodent cells). Despite this difference in potency, GSK932121A
was withdrawn from development following FTIH trials, due to unexpected toxicology findings in rats,
when dosed via the intraperitoneal (IP) route or orally as a pro-drug to increase exposure. Cross-over
inhibition of mammalian complex III activity by GSK932121A was considered to be a possibility [127].
A package of investigative work was initiated to follow up on the toxicological findings and the possible
role of ETC inhibition. The work presented here describes initial aspects of this investigative program
whereby the conditions known to cause the acute toxicity were recreated in order to study the nature of
the toxic response.
The analyses presented here provide additional weight of evidence that the main mechanism of toxicity
with GSK932121A was mitochondrial complex inhibition and provide significant detail regarding the
profile of downstream effects of such inhibition, including molecular adaptive changes. This
comprehensive comparison of multiple endpoints also allows for better informed selection of endpoints
for future mechanistic investigative studies where mitochondrial toxicity or therapeutic mitochondrial
modulation is suspected and highlights the need to consider both in vitro and in vivo data together when
interpreting mitochondrial effects. Finally, the data presented is of significant value in developing an AOP
for mitochondrial ETC inhibition, and a follow-up study with earlier time points and a lower dose is
presented in chapter 4, to add further detail in this regard.
3.1.1. CHAPTER AIMS
The present chapter describes the first phase of an investigative program which was initiated to explore
the acute toxicity caused by GSK932121A, when dosed via the IP route of administration. In order to
investigate the adverse effects caused by GSK932121A the conditions which caused the aforementioned
acute toxicity were recreated. As such, the present chapter aimed to,
77
1. Analyse the effects of GSK932121A in vitro by treatment of isolated mitochondria from control
animals to provide mechanistic detail and to allow comparison with the in vivo data.
2. Profile the acute effects of GSK932121A in vivo, based on the likelihood that the observed
clinical signs in rat were due to complex III inhibition, via measurement of mitochondrial
function, liver glutathione levels, hepatic microscopy, blood gasses and lactate/pyruvate ratio
alongside gene expression profiling.
3.2. Results
3.2.1. CONFIRMATION OF RESPIRATORY CHAIN INHIBITION
The inhibitory effect of GSK932121A on the mammalian respiratory chain was assessed in vitro using a
complex III activity assay (as described in section 2.8.6). GSK932121A was tested using 9 concentrations
spanning the range 0.01nM to 100µM, to ensure accurate determination of an IC50. GSK932121A caused
a concentration-dependent reduction in complex III activity with an IC50 of 0.63µM (Fig.3.1). Data shown
correspond to mean ± SD of measurements obtained with bovine heart mitochondria minus the rates
obtained without mitochondria (negative control). The potency of GSK932121A on bovine heart
mitochondria complex III was approximately 4.6x less than that of the gold standard complex III inhibitor
antimycin A (IC50=136nm as indicated by Cayman Chemicals, data not shown). Furthermore, potency
was comparable to that obtained by Bueno et al (2012) for cytochrome bc1 inhibition in mammalian
species (IC50 = 0.4µM with isolated target from HEK293 cells and 0.6µM with the isolated target from
H9C2 cells) [127]. Further work is required to compare the effect of GSK932121A on mitochondrial
complex III activity to other classical complex III inhibitors, in order to accurately assess potency.
Furthermore, the selectivity of GSK932121A for the cytochrome bc1 complex should be assessed by
measuring its effect on the other respiratory chain complexes in isolation.
78
FIGURE 3.1: Complex III activity assay with GSK932121A. A concentration-dependent reduction in bovine heart
mitochondrial complex III activity was observed following GSK932121A exposure (IC50: 0.63µM). Data
shown in mean ± SD of change in OD rate (per minute) representing conversion of cytochrome c from its
oxidised to its reduced form (n=5).
Following confirmation of GSK932121A’s complex III inhibitory activity, the effect of GSK932121A on
other mitochondrial processes was assessed in vitro. Mitochondria were isolated from the liver of 3
control female Crl:CD (SD) rats and exposed to GSK932121A separately in vitro. Female rats were
chosen for comparability with the sex and species used in the corresponding in vivo study (outlined in
section 3.2.2 below) and as female rats have been shown to be more sensitive to GSK932121A toxicity
than males in previous tolerability studies. Following treatment, OCR and CRC were assessed in order to
better understand the direct effect of GSK932121A on mitochondria.
Exposure of isolated liver mitochondria from untreated rats to GSK932121A resulted in concentration-
dependent decreases in basal respiration (IC50: 9.5µM) and state 3 respiration (IC50: 5.8µM), characteristic
of a mid-respiratory chain inhibitor (Fig.3.2) Maximal respiratory rate and RCR were markedly reduced
at 100µM and 10µM, with only minor effects on respiratory chain function observed at lower
concentrations. It is however important to ackonowledge that maximal respiration is still stimulated by
FCCP with the 10µM concentration of GSK932121A. This data suggests partial inhibition of the
respiratory chain which is in contrast to the high level of potency observed in Fig.3.1. (IC50 : 0.63µM).
Further work is required to better understand the effect of GSK932121A on oxygen consumption ex vivo.
2 4 6
-2 0
0
2 0
4 0
6 0
L o g 1 0 C o n c e n tr a tio n
G S K 9 3 2 1 2 1 A (n M )
Co
mp
lex
II
I I
nh
ibit
or
y
Ac
tiv
ity
(m
OD
/min
)
79
FIGURE 3.2: Analysis of liver mitochondrial OCR following in vitro treatment of control liver mitochondria with
GSK932121A (measured using Seahorse XF24 analyser). (A) Exposure to 100µM GSK932121A (light
grey) caused a significant reduction in OCR at all respiratory states (p<0.001) and a reduction in basal, state 3
and state 3u respiration at 10µM (dark grey) was noted. No other concentration (data not shown) significantly
affected mitochondrial respiration compared to that with the 0.5% DMSO control (black). (B) GSK932121A
reduced basal OCR in a concentration-dependent manner [IC50 = 9.5µM], correlation, R2: 0.8937 (data is mean only, n=3).
CRC was calculated as the difference in OD between the point at which mitochondria are energised and
begin to take up a given bolus of calcium to the point of undergoing MPT. GSK932121A (100µM-1µM)
in vitro reduced the CRC in liver mitochondria from untreated animals in a concentration-dependent
manner with an IC50 of 1.36μM (Fig.3.3).
1 0 1 5 2 0 2 5 3 0 3 5-1 0 0
1 5 0
4 0 0
6 5 0
9 0 0
1 1 5 0
1 4 0 0
T im e (m in s )
OC
R (
pm
ols
/min
)
D M S O C o n tro l
10 M G S K 9 32 12 1A
100 M G S K 9 32 12 1A
A D P O lig o m y c in
F C C P
A n tim y c in
A
A B
80
FIGURE 3.3: Assessment of the mitochondrial CRC. Freshly isolated liver mitochondria from female control Crl:CD(SD) rats
were treated in vitro with GSK932121A. A concentration-dependent reduction in CRC was observed at 1µM,
10µM and 100µM of GSK932121A [IC50 = 1.36µM], correlation, R2=0.9031. Data shown is mean ± SD (n=3).
3.2.2. ACUTE DOSE IN VIVO STUDY (NON MITOCHONDRIAL ENDPOINTS)
Female Crl:CD (SD) rats were dosed (via the IP route) with either 50mg/kg GSK932121A (n=12) or
vehicle alone (n=12) and observed for a period of five hours (as described in section 2.1.1 and 2.3.1).
Female rats were used because previous tolerability studies using GSK932121A showed slightly more
marked in-life effects in female rats than in males. A dose of 50mg/kg was selected based on data
generated in previous GSK932121A single-dose tolerability studies where dose-limiting clinical signs
were noted in a proportion of the animals at approximately 5.5 hours post-dose. The aim of the
investigation was to follow-up on the toxicological issue which led to GSK932121A’s termination from
development and therefore the 50mg/kg dose (which replicated the dose known to cause acute toxicity)
was selected and a time-point of 5 hours was chosen (i.e. to induce mitochondrial derived toxicity whilst
minimising in-life effects).
Clinical Signs.
Significant inter-animal variability was noted in terms of both the severity and speed of onset of clinical
signs. Moderate clinical signs were observed approximately 3-5 hours post dose and included slight to
moderate piloerection, hunched posture, slightly irregular or deep abdominal breathing and mildly
81
subdued behaviour. Reduction in body temperature was noted in some animals approximately 1.5h post
dose, with body temperature continuing to fall by an average of 3.4°C by 5 hours post dose. The reduction
in body temperature over the course of the study was highly variable but was closely associated with the
plasma concentration of GSK932121A (R2 0.9063) (Fig. 3.4).
FIGURE 3.4: Relationship between core body temperature and plasma GSK932121A concentration. The correlation is
shown between reduction in core body temperature observed at 3.5-5 hours (dependent on observed clinical
signs) post treatment with GSK932121A (50 mg/kg) and plasma drug concentration (R2=0.9063, p<0.0001).
Two animals (circled) showed little reduction in body temperature but also had a very low systemic exposure (284-485ng/mL) to GSK932121A. These animals were excluded from all further analyses.
No body temperature reduction was observed in two females throughout the course of the treatment
period but in these animals the terminal plasma concentrations of GSK932121A were very low
(284ng/mL and 485ng/mL, respectively, with all other animals having exposures of ~10-35µg/mL). These
animals were therefore excluded from all further analyses. Reduction in body temperature also correlated
with adverse clinical signs, those animals with the greatest fall in body temperature showing the most
severe clinical effects.
82
Arterial Blood Gas (pO2 and pCO2) and Bicarbonate (HCO3)
GSK932121A at a dose of 50 mg/kg produced a significant increase in pO2 and a significant decrease in
pCO2 in arterial whole blood at approximately 5-6 hours post-dose (depending on observed clinical
signs)(Fig.3.5). These findings are suggestive of impaired mitochondrial respiration in GSK932121A
treated animals consistent with the mechanism of action (ETC inhibition). Bicarbonate (HCO3) was also
reduced in GSK932121A treated rats compared to VC (Fig.3.5) which suggests that metabolic acidosis is
occurring following respiratory chain inhibition in vivo. This may be as a result of increased lactate
production following a metabolic switch to glycolysis which will be presented in the next section.
FIGURE 3.5: Analysis of arterial blood gasses (p02 and pC02) and bicarbonate (HCO3) in whole blood of animals treated
with GSK932121A (50mg/kg). GSK932121A (50mg/kg – grey bars) caused a significant reduction in arterial
pCO2 and HC03 at 5 hours post-dose compared with VC (black bars). A significant increase in arterial pO2 was
also observed in GSK932121A treated animals. Results are mean ± SD (n=6) **p<0.01.
The Metabolic Shift: Light and Electron Microscopy
Key histological alterations in the liver following exposure to GSK932121A in vivo were identified by
light microscopy (Fig.3.6 A and B). Hepatocellular changes included an increase in periportal lipid
(microvesicular steatosis) highlighted by prominent osmium tetroxide staining in the livers of the treated
group. This is suggestive of a shift in metabolism within the liver towards glycolysis and/or a reduced
level of mitochondrial β-oxidation.
Electron microscopy was utilised in order to assess the effect of GSK932121A treatment on
mitochondrial ultrastructure. Mitochondria appeared swollen with a pale matrix with moderate to severe
% P
re
do
se
p O 2 p C O 2 H C O 3
0
5 0
1 0 0
1 5 0
2 0 0
V eh ic le C on tro l
5 0m g /k g G S K 9 321 21A
* *
* * * *
83
disorganisation of the cristae. Mitochondrial diameter increased from approximately 0.45µm to 0.55µm
on average and an increase in the number of condensed degenerating mitochondria was observed with
mitochondria often observed within phagosomes (Fig 3.6 C and D). Further to the increase in lipid
observed in LM analyses, a reduction in glycogen stores was evident in GSK932121A treated hepatocytes
(peri-portal region). This supports LM observations of changes suggestive of increased glycolytic
activity.
84
FIGURE 3.6: Effect of 50mg/kg GSK932121A on liver LM and TEM compared to VC. Panels A + B (200x magnification)
show H&E stained liver sections post-fixed in osmium tetroxide. (A) VC rat, note the rare hepatocytes that
contain a small number of osmium tetroxide-stained lipid droplets (black arrow depicted). (B) Rat treated with
50 mg/kg GSK932121A; note that the cytoplasmic droplets within hepatocytes are extensively and darkly
stained with osmium tetroxide which confirms the accumulation of neutral lipid. Panels C+D show electron
micrographs of rat hepatocytes from the right lateral lobe focussed on the mitochondria at 50,000X
magnification (Images shown are taken from peri-portal regions of the liver). (C) Mitochondria from VC
animal, with intact membrane structure and normal histology. Stores of glycogen are depicted by red arrows (D)
Mitochondria from GSK932121A treated animal which appear swollen with pale matrices and a significant
increase in the number of condensed degenerative mitochondria were observed (white stars). Glycogen stores (highlighted by red arrows in C) were reduced in animals treated with GSK932121A.
To confirm this metabolic shift (reported to be characteristic of mitochondrial dysfunction in vivo)
circulating lactate and pyruvate were measured in whole blood. Animals given 50mg/kg GSK932121A
*
B
C D
A
*
85
had higher blood lactate concentrations than controls (3.53-fold, p<0.001) and the lactate:pyruvate ratio
was also increased by 1.66-fold (p<0.01) (Fig. 3.7). Elevated lactate/pyruvate ratios are indicative of
deficiencies of the respiratory chain, tricarboxylic cycle or pyruvate metabolism. Change in
lactate:pyruvate ratio correlated with plasma exposure of GSK932121A as shown in Fig.3.7B (R2:
0.4689, p<0.05).
FIGURE 3.7: Effect of 50mg/kg GSK932121A on whole blood lactate:pyruvate ratio compared with blood taken from VC
animals. (A) GSK932121A (50mg/kg, n=10) treatment caused a statistically significant increase in blood
lactate:pyruvate ratio compared to blood taken from VC animals (n=12). ** p<0.01. (B) The correlation is shown between plasma GSK932121A concentration and blood lactate:pyruvate ratio (R2: 0.4689, p<0.05)
Ratio of Reduced Glutathione (GSH) to Oxidised Glutathione (GSSG)
GSK932121A, at a dose of 50mg/kg caused a statistically significant (54.6%) reduction in the
GSH:GSSG ratio in liver tissue at a terminal 5 hour time-point compared to VC animals (p<0.001)
(Fig.3.8C). The reduced GSH:GSSG ratio manifests due to a significant reduction in reduced GSH
compared to VC animals (p<0.05) and a significant increase in oxidised GSSG in the liver of treated
animals compared to VC (p<0.01) (Fig.3.8 A and B). This data suggests that treatment of rats with
50mg/kg GSK932121A for 5 hours causes increased levels of oxidative stress and a resulting reduction in
the glutathione antioxidant system, in the liver compared with time matched VC animals.
0 m g /k g 5 0 m g /k g
0
1 0
2 0
3 0
* *
G S K 9 3 2 1 2 1 A D o s e
La
cta
te:P
yr
uv
ate
Ra
tio
A B
86
FIGURE 3.8: Analysis of liver GSH, GSSG and ratio of GSH:GSSG following treatment of rats with 50mg/kg
GSK932121A compared to vehicle control. GSK932121A (50mg/kg – open bars, n=10) caused a significant
reduction in GSH (panel A), a significant increase in GSSG (panel B) and a significant reduction in GSH:GSSG
ratio (panel C) in the liver, compared with vehicle controls (0mg/kg - solid bars, n=12). Results are mean ± sd. *p<0.05, **p<0.01, ***p<0.001.
3.2.3. ACUTE DOSE IN VIVO STUDY (MITOCHONDRIAL ENDPOINTS)
Calcium Retention Capacity
In direct contrast to the effects of GSK932121A in vitro (Fig.3.3), the CRC of liver mitochondria isolated
from rats treated in vivo with 50mg/kg GSK932121A was increased, (Fig.3.9A, for clarity only means for
the kinetic data are shown). When calculated as delta-OD, the increase in liver mitochondria CRC
0 m g /k g 5 0 m g /k g
0
2 0
4 0
6 0
8 0
G S K 9 3 2 1 2 1 A D o s e
GS
H :
GS
SG
Ra
tio
* * *
A B
C
87
following GSK932121A treatment (n=10) was 79% (p<0.01) compared with mitochondria from control
animals (n=12), (Fig. 3.9B). These data demonstrate a desensitisation to calcium-induced mPTP opening
following in vivo treatment with GSK932121A. Increase in liver mitochondria CRC showed a mild
degree of correlation to the plasma concentration of GSK932121A (R2: 0.4939, p<0.05).
No effect was observed on CRC in mitochondria isolated from the heart or skeletal muscle of
GSK932121A treated animals in comparison with VC (p>0.05, data not shown). There was also no
correlation to plasma exposure levels of GSK932121A in these tissues. It is currently unknown whether
this was a result of lower plasma exposure levels in these organs and follow-up pharmacokinetic analyses
in multiple tissues are required.
FIGURE 3.9: Analysis of liver mitochondrial CRC following treatment of rats with GSK932121A in vivo. (A)
Mitochondria isolated from rats treated with 50 mg/kg GSK932121A (n=10, grey circles) displayed an
increased CRC compared to control animals (n=12, black squares) treated with vehicle alone. Data shown in
this kinetic trace are mean only (B) The increase in GSK932121A-induced CRC is displayed as increase in
ΔOD (difference in OD between point of succinate substrate addition and mitochondria undergoing permeability transition, i.e. lowest OD value before calcium release). Data shown is mean ± SD. ** p<0.01.
Mitochondrial Bioenergetics
In contrast to the effects seen in vitro, mitochondria isolated from the livers of rats treated in vivo with
GSK932121A, showed an increase in basal respiration of 30.3% compared to VC (p<0.001) (Fig. 3.10 A
0 5 0 1 0 0 1 5 0 2 0 0
0 .2
0 .4
0 .6
0 .8
1 .0
1 .2
1 .4
1 .6
T im e (s )
Ca
lciu
m
Re
ten
tio
n
Ca
pa
cit
y
Op
tic
al
De
ns
ity
(6
50
nm
)
* *
V eh ic le C on tro l
5 0m g /k g G S K 9 321 21A
G S K 9 3 2 1 2 1 A D o s e
Ca
lciu
m R
ete
nti
on
Ca
pc
ity
De
lta
-Op
tic
al
De
ns
ity
(6
50
nm
)
0 m g /k g 5 0 m g /k g
0 .0
0 .2
0 .4
0 .6
0 .8
1 .0
* *
A B
88
and B). A similar degree of increased respiratory demand is maintained throughout state 3 (27.5%,
p<0.01) and state 4 (28.4%, p<0.001), demonstrating increased background levels of oxygen consumption
linked to ATP production (Fig. 3.10 A and B). This increase in OCR further coincides with an 11.9%
(p<0.001) increase in proton leak across the inner mitochondrial membrane. Whilst increased proton leak
is suggestive of a decline in efficiency of the OXPHOS machinery, the percentage of total OCR linked to
ATP synthesis was the same in mitochondria from control and treated after normalisation to basal
respiration (Fig. 3.10 C). Furthermore the RCR (state 3/state 4 ratio), often used as a gold-standard
measure of general mitochondrial health, was not significantly altered between mitochondria isolated
from control (4.25) and GSK932121A treated (4.20) rats (p>0.05 – data not shown). FCCP was used to
uncouple mitochondria and determine the maximum respiration rate (often termed the maximal uncoupled
or state 3u respiration). This was reduced by 24.7% in mitochondria isolated from GSK932121A treated
rats (p<0.001) indicating a diminished maximal capacity for the ETC in the uncoupled state. This is
particularly visible in Fig.3.10C where normalisation of data to basal respiration highlights the maximal
OCR deficit following FCCP-induced uncoupling. Correlation analysis between the various respiratory
states and the plasma concentration of GSK932121A revealed only marginal correlation to plasma
exposure levels as shown in the R2 values in Fig 3.10B.
89
FIGURE 3.10: Analysis of liver mitochondrial bioenergetics using the Seahorse XF24 analyser following treatment of rats
with GSK932121A in vivo (A) Representative OCR data for liver mitochondria isolated from animals treated
with GSK932121A (grey line) or VC (black line). (B) Effect of GSK932121A treatment (grey bars) on basal,
state 3, state 4o, state 3u respiration and on proton leak, compared with VC (black bars). R2 values correspond
to the correlation between OCR and the plasma concentration of GSK932121A (C) Normalisation of OCR data
to basal respiration, demonstrating the lack of significant change in total ATP linked OCR (shaded box)
between mitochondria isolated from control (black line) and treated (grey line) animals and the reduction in
maximal uncoupled respiration. Data shown is mean ± SD (n=12 VC, n=10 GSK932121A treated). Each
biological replicate is the mean of 5 technical replicate wells / XF24 plate ** p<0.01, *** p<0.001
Overall mitochondria from rats treated in vivo with GSK932121A showed a loss of mitochondrial reserve
capacity (p<0.001, 74.47% reduction) calculated as the difference between state 3 and state 3u OCR
5 1 0 1 5 2 0 2 5 3 0
0
5 0 0
1 0 0 0
1 5 0 0
2 0 0 0
2 5 0 0
V eh ic le C on tro l
5 0m g /k g G S K 9 321 21A
T im e (m in s )
OC
R (
pm
ol/
min
)
A D P O lig o m y c in
F C C P A n tim y c in A
5 1 0 1 5 2 0 2 5 3 0 3 5
0
2 0 0
4 0 0
6 0 0
V e h ic le C o n t ro l
5 0 m g /k g G S K 9 3 2 1 2 1 A
T im e (m in s )
% O
CR
A D P O lig o m y c in
F C C P A n tim y c in A
B a s a l S ta te 3 S ta te 4 o S ta te 3 u P ro to n L e a k
0
5 0 0
1 0 0 0
1 5 0 0
2 0 0 0
2 5 0 0
V e h ic le C o n t ro l
5 0 m g /k g G S K 9 3 2 1 2 1 A
OC
R (
Pm
ol/
min
)
* * *
* *
* * *
* * *
* * *
R e sp ir a to r y s ta te
R2: 0 .0 6 7
R2: 0 .2 0 4
R2: 0 .1 2 6
R2: 0 .4 0 4
R2: 0 .0 8 2
A C
B
90
highlighting the potential for bioenergetic insufficiency should the cells require ATP levels beyond that
which can be manufactured at a basal level.
No significant effect on OCR was observed in mitochondria isolated from the skeletal muscle or heart of
GSK932121A treated animals compared to VC (p>0.05, data not shown). Isolated mitochondrial data
presented in section 3.2.3 therefore suggests that the liver might be a key target organ in response to
GSK932121A toxicity and no effects of GSK932121A was observed in skeletal muscle or heart
mitochondria (in terms of mitochondrial function). The suggestion that the liver is a key target organ will
be further explored in chapter 4.
3.2.4. TRANSCRIPTOMICS
Transcriptomic analysis was performed on liver samples from control and GSK932121A treated rats. The
entire raw gene-data (discussed herein) has been deposited in NCBI’s Gene Expression Omnibus (GEO)
and are accessible through GEO Series accession number GSE65374
(http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE65374). Affymetrix data was normalised using
the robust multichip average (RMA) method [145] and differentially expressed genes were defined as
those with greater than 1.5 fold change in expression, at p<0.05. These genes were examined using a
principal component analysis (PCA) and interestingly separation of data-points for treated animals from
those for VC, correlated well with plasma drug concentration, as shown in Fig.3.11 below.
91
FIGURE 3.11: PCA of Affymetrix transcriptomics data (from liver of GSK932121A and VC animals) highlighting
relationship between degree of experimental data separation and plasma drug concentration. PCA
analysis showing the breadth of data separation between VC (blue circles) and GSK932121A treatment (yellow
circles). Separation of data points in the PCA analysis appeared to correlate with plasma drug exposure levels
(expressed in µg/ml).
Following PCA analysis, these genes were subjected to IPA analysis (Ingenuity Systems, Redwood City,
CA). This analysis identified perturbation of pathways associated with the cellular response to glycogen
depletion, with glucocorticoid receptor signalling the most significantly up-regulated. Other pathways
identified were immunological (IL10, IL6 and Acute Phase response signalling) and activation of retinoic
acid receptor responsive genes (data not shown). The ratio of genes involved in each identified pathway
was low (less than 10%), for example for the glucocorticoid receptor signalling pathway 24/299 genes
were altered (8.02%). Consideration of these data alongside the observed increase in blood lactate and
observed depletion of cellular glycogen (TEM micrographs) did however prompt further analysis of genes
12.4µg/ml
14.4µg/ml
17.7µg/ml
18.5µg/ml
22.8µg/ml
21.4µg/ml
25.2µg/ml
24.7µg/ml
29.5µg/ml
32µg/ml
Vehicle Controls (n=12)
92
involved in the cellular response to glycogen depletion. Peroxisome proliferator-activated receptor
gamma coactivator 1-alpha (Ppargc1a) was upregulated 8.2-fold (p<0.001) and Forkhead box protein O1
(Foxo1) expression increased 1.6-fold. Ppargc1a and Foxo1 interact to coordinate the expression of genes
involved in gluconeogenesis, such as Pck1/PEPCK (1.9-fold; p<0.001) and Glucose-6-Phosphatase
(G6pd). Ppargc1a and Foxo1 expression levels both correlated well with GSK932121A plasma
concentrations (R2: 0.6587 and 0.7493 respectively) (Fig. 3.12). Insulin Receptor Substrate 2 (Irs2) and
Pyruvate Dehydrogenase Kinase 4 (Pdk4) expression levels, which were upregulated 4.8 and 2.2-fold
respectively, also correlated well with GSK932121A plasma levels (Fig.3.12).
FIGURE 3.12: Correlative analysis of gene copy number for 4 significantly altered genes and GSK932121A plasma
concentration. Correlation between terminal plasma GSK932121A concentration in treated rats and the copy
number of 4 hepatic gluconeogenic response genes, Foxo1 (dark grey crosses) (R2:0.7943), Pdk4 (orange
squares) (R2:0.7389), Ppargc1a (black circles) (R2:0.6587) and Irs2 (light grey triangles) (R2:0.5457). The
expression of all four genes was significantly increased compared to VC (p<0.001).
3.3. Discussion
It is important for successful drug development that we improve our understanding of how mitochondrial
toxicity is manifested in our preclinical test species. To this end, and as part of a mechanistic toxicology
investigation, the present study profiled the acute toxicity caused by a candidate molecule
93
(GSK932121A), suspected of causing acute toxicity by complex III inhibition in vivo. The work
highlighted the utility of a multi-system approach for detecting mitochondrial dysfunction in vivo, and
should aid other investigators in designing studies and selecting endpoints for future studies with
potentially mitochondrially active molecules. GSK932121A is a potent inhibitor of the mitochondrial
respiratory chain complex III in the target species, P. falciparum. It is two orders of magnitude less
potent on the isolated target from rats, and three orders of magnitude less potent in intact rodent cells
[127]. At the dose of GSK932121A used in the present study, the plasma concentrations achieved were
2-6 times above the IC50 in rodent cells and, consistent with this, it was acutely toxic. Blood gas analysis
in the present study confirmed inhibition of respiratory function highlighted by an increase in the levels of
arterial O2 and a reduction in arterial CO2. It remains likely that the animals are in a state of “cytotoxic
hypoxia”, characterised by effective oxygen deprivation (i.e. inability of cells to utilise oxygen as
opposed to impaired oxygen availability). This has been highlighted as a central cause of toxicity relating
to other respiratory chain inhibitors such as cyanide [148].
Body temperature changes have been reported with a range of mitochondrial toxins acting by different
mechanisms, for example, 2,4-DNP (mitochondrial uncoupling) causes hyperthermia [149] and 3-
nitroproprionic acid (complex II inhibition) causes hypothermia [150]. In the present study, hypothermia
was an early consequence of treatment of rats with GSK932121A, the magnitude of the response
correlating well with plasma levels of the drug, suggesting that respiratory chain inhibition was the
primary cause of the reduced thermal energy generation. Of the gross in-life measures, body temperature
appeared to be the most sensitive marker of mitochondrial impairment, at least when monitored internally
(core temperature) and measured regularly (15 minute intervals) via the implanted chips used in this
study. The liver is a major thermoregulatory organ in the rat [151] and therefore the reduction in body
temperature may be directly associated with disruption of mitochondrial function and morphology
changes noted in this organ. The value of monitoring body temperature demonstrated here, combined with
the ease of data collection when using implantable chips (which are primarily used for animal
identification), means that this endpoint would be suitable for consideration in all in vivo studies with
compounds suspected of having mitochondrial activity.
Lactic acidosis and an increase in hepatic lipid (steatosis) are common outcomes of mitochondrial
dysfunction [152], as observed with the early nucleoside reverse transcriptase inhibitors [153]. Both of
these outcomes were observed in this study. The increase in lactate/pyruvate ratio suggests an increase in
glycolytic metabolism and this is supported by the TEM evidence of glycogen depletion in the liver of
treated rats. Furthermore, the blood gas data was also suggestive of metabolic acidosis, with a reduction
94
in bicarbonate noted. Combined with body temperature, lactate levels are a potentially useful marker of
DIMT [143] and it has been suggested that a rise in blood lactate concentrations alongside a reduction in
core body temperature may be indicative of a generalised adverse event [154]. Further studies with
GSK932121A at sub-toxic doses are on-going and it will be interesting to see if lactate:pyruvate ratio can
be utilised as a marker of more mild underlying mitochondrial perturbation.
The switch in metabolism towards glycolysis, indicated by ultrastructural changes and blood lactate
levels, was also reflected in the gene expression findings. Foxo1 was up-regulated following
GSK932121A treatment and this gene has been shown to play a central role in the response to glycogen
depletion via activation of gluconeogenesis [155]. Foxo1 interacts with PGC1α to regulate the expression
of gluconeogenic genes by binding and activating promoter regions, for example, the PGC1α-dependent
transcription of Pepck [156]. Pepck catalyses the first committed step in gluconeogenesis via conversion
of oxaloacetate to phosphoenolpyruvate [157]. Foxo1 is also essential to the up-regulation of Pdk4 and
Irs2 in response to glycogen depletion and fasting and these were up-regulated in the present study [155].
This fasted/starvation-like transcriptional response has previously been associated with respiratory chain
deficiency and mitochondrial myopathy [158]. These gene findings demonstrate a potentially adaptive
response to reduced liver glycogen by activation of gluconeogenesis via Foxo1 mediated transcription.
With regard to the functional mitochondrial endpoints, specifically OCR and CRC in this study,
GSK932121A had effects both in vivo and in vitro, however the direction of change was not consistent. It
is unlikely that this difference is due to a metabolite of GSK932121A since it is known that there is
limited metabolism of the compound within the timescale applicable here. In vitro, GSK932121A reduced
basal mitochondrial OCR in HepG2 cells, entirely consistent with its proposed complex III inhibitory
activity and effects of other known respiratory chain inhibitors (shown in chapter 7) [6, 132]. The same
effect was observed when isolated liver mitochondria from naïve control rats were directly exposed to
GSK932121A. In contrast, the opposite was true with liver mitochondria isolated from rats treated with
GSK932121A in vivo, where basal OCR was seen to be increased. In the same vein, the CRC of isolated
liver mitochondria from naive control rats was reduced following direct exposure to GSK932121A, again
consistent with the effects of other known respiratory chain inhibitor compounds, but opposite to the
effect observed in mitochondria isolated from the livers of rats treated with GSK932121A in vivo.
It is clear then that the in vitro functional data are consistent with GSK932121A’s proposed complex III
inhibitory mechanism and published data regarding other tool ETC inhibitors. Likewise the body
temperature findings, LM/TEM, gene expression, blood lactate and gas analyses findings also point
95
convincingly to GSK932121A blocking mitochondrial complex activity as expected. So why are the
functional measures (OCR and CRC) obtained with the mitochondria isolated from animals treated with
GSK932121A in vivo seemingly at odds with the overall picture?
In terms of the OCR data, it may be that GSK932121A washes out during isolation of the liver
mitochondria from treated rats. However, here samples of isolated mitochondria from the in vivo
experiment were analysed for GSK932121A and appreciable levels were detected (appendix 3). The was
also a reduction in the maximal OCR following FCCP treatment and a clear effect in the CRC assay
(discussed below) in the mitochondria isolated from treated animals, arguing against a complete washout
of compound and reversal of effects during the isolation procedure. An alternate possibility is that the
increase in OCR reflects a compensatory increase in the overall ETC activity within the isolated
mitochondrial population as a result of increased proton leak due to ROS-induced mitochondrial damage.
Consistent with other respiratory chain inhibitors (i.e. antimycin a [159]), there was evidence for an
increase in oxidative stress in the livers of GSK932121A treated animals (significantly reduced GSH:
GSSG ratio), but for ROS-induced damage to be a causative factor in the observed OCR increase, this
would again rely on the de-inhibition of the ETC. A third possibility may be linked to stabilisation of the
mitochondria and this is discussed below.
Mitochondria play a key role in regulating intracellular calcium concentrations during both normal and
pathological states [134]. However, excess calcium is able to trigger the mPTP, characterised by a non-
selective increase in the permeability of the inner mitochondrial membrane [135, 136]. mPTP activity is
affected by compounds that interfere with mitochondrial function and this can be monitored by
measurement of CRC in mitochondrial isolates. Exposure in vitro to respiratory chain inhibitors typically
reduces the CRC of isolated mitochondria [160] and this is exactly what was observed with GSK932121A
(IC50 of 1.36µM, well below the plasma concentrations of GSK932121A achieved in the in vivo study,
~30-75µM). In contrast liver mitochondria isolated from GSK932121A treated rats showed a significant
and unexpected increase in CRC. It has been reported that the mPTP can be desensitised to calcium-
induced opening during times of myocardial infarction due to a reduction in pH [161]. It is possible that
the lactic-acidosis induced pH reduction, observed in rats treated with GSK932121A, may cause an effect
on the mPTP in vivo that persists and is maintained throughout the isolation procedure and CRC assay,
i.e. despite the mitochondria being prepared and the CRC assay being performed in neutral pH buffers.
Furthermore, the observed desensitisation of mPTP triggering could act to stabilise the mitochondria
during the stressful isolation process, resulting in a higher proportion of intact (non-permeabilised)
96
mitochondria per mg of measured protein; potentially explaining the increase in basal OCR level
observed with mitochondria from the treated animals.
Mitochondria are capable of responding to increased energy demand or stress by utilising their spare
respiratory reserve (i.e. the difference between basal respiration and maximal possible respiration rates)
[39]. Significant depletion of this reserve capacity has been noted in response to increased ROS, aging,
following drug exposure [162] and importantly, has been demonstrated to precede cell death [37]. One
consistent functional effect observed both in vitro and in vivo in this study was an apparent reduction in
the maximal respiration rate following GSK932121A exposure (i.e. uncoupled OCR following FCCP
injection). This raises the question of whether monitoring erosion of maximal respiratory capacity, in the
absence of overt clinical signs, could be a way to overcome a key limitation of current preclinical safety
testing with respect to detecting mitochondrial toxicity; namely the use of healthy young animals with
inherently high reserve capacity. This current pre-clinical model is at odds with the low underlying
metabolic reserves of many key patient groups who are often elderly, on co-medications, have co-
morbidities etc. A more detailed analysis of metabolic reserve capacity using doses of GSK932121A
below that which cause overt clinical signs would help to test this possibility and this is on-going.
3.3.1. SUMMARY
The conclusions that can be drawn from this initial study with GSK932121A are as follows…
1. The in vitro and in vivo data presented here support the proposition that GSK932121A
administered at 50mg/kg via the IP route causes acute toxicity in rats due to perturbation of
mitochondrial function, most likely via inhibition of the ETC.
2. Building understanding around the progression of toxicity from complex III inhibition to adverse
in vivo outcomes (clinical signs) required consideration of both the in vitro and in vivo data;
neither on its own would have been sufficient. The in vitro data informed on the likely molecular
initiating event and initial (non-confounded) respiratory response, whist the in vivo data provided
a view of the integrated state of the mitochondria in response to the initial insult plus the
compensatory adaptations made by the tissue and organism. The in vivo experiment also informed
on the final adverse outcomes and provided a platform to investigate specific molecular and
morphologic changes in a key tissue, for example, highlighting the role of the metabolic switch
97
gene Foxo1 and the downstream effectors PGC1α, Pepck, Pdk4 and Irs2 in the cellular response
to glycogen depletion in the liver.
The data presented here provides the ground work for developing AOPs around ETC inhibition and also
provides a platform for evaluating new methods for monitoring underlying mitochondrial perturbation.
Further work based on a systems approach is required in order to further understand the downstream
mechanisms and pathways [163], of which the metabolomics based follow-up investigation presented in
chapter 4 overleaf is part.
98
4.0. A METABOLOMICS APPROACH TO UNDERSTANDING
MECHANISMS OF DRUG-INUDCED RESPIRATORY
CHAIN INHIBITION
99
4.1. Introduction
GSK932121A was a late stage drug, destined for the market as a novel 4(1H)-pyridone anti-malarial
medicine with huge therapeutic potential, (i.e. due to the prevalence of malaria in the developing world).
GSK932121A acts via inhibition of mitochondrial electron transport at complex III. The molecule was
however withdrawn from development following observations of acute toxicity in rats at high plasma
exposure levels following administration either via the oral route as a pro-drug or via the IP route as the
parent compound alone.
Work outlined in chapter 3, described stage one of an investigative package which aimed to evaluate the
acute toxicity caused by compounds, including GSK932121A, with potent respiratory chain inhibitory
properties. The study revealed that, (in conjunction with the adverse in-life effects), respiratory chain
inhibition caused a switch in metabolism to glycolysis (leading to metabolic acidosis, hepatic steatosis
and liver glycogen depletion), rapid onset hypothermia and effects on mitochondrial ultra-structure and
function (although the direction of change in two commonly used mitochondrial assays was opposite to
that observed in vitro). Transcriptomics analysis also identified gene changes indicative of a fasted-like
state.
Although the initial study (described in chapter 3) was necessary to characterise the acute toxicity profile
of GSK932121A in vivo at a dose associated with the adverse outcome, the high dose single time point
experimental design made it a challenge to determine the events preceding overt clinical signs i.e.
difficult to assess primary from adaptive toxicity. It was therefore important to follow up these findings
with GSK932121A using a sub-toxic dose and earlier time points. Metabolomics was used to seek both
early and progressive biochemical markers of respiratory chain inhibition.
In order to correlate the early biochemical effects to a functional and well characterised effect, the study
parameters outlined in chapter 3 were repeated (i.e. an acute IP dose of 50mg/kg GSK9232121A over a 4
hour time point) with timed bleeds used for metabolite analyses in order to identify early biochemical
changes. A lower dose group of 12.5mg/kg GSK932121A (a dose which was previously reported to be
well tolerated) was included in order to identify markers of respiratory-chain inhibition which occur at
sub-toxic doses of GSK932121A and to facilitate the determination of pathways involved in underlying
mitochondrial adaptation and perturbation. Timed bleeds were taken as early as 30 minutes post dose in
attempts to identify the earliest possible markers of dysfunction.
100
Biochemical metabolites are sensitive indicators of homeostatic changes (whether induced by genetics,
the environment, drug treatment etc.). This makes them excellent candidates for biomarkers as they can
be easily measured and, if present in blood, are accessible and translatable to the clinical situation. In
addition, metabolites play a crucial role in the signalling and regulation of genes and proteins thus making
them an ideal complement to other ‘omics’ assessments. Finally, because metabolic pathways are
generally well understood and highly translatable across species, metabolomics data is often highly
actionable in terms of assessing potential safely liability using a top-down systems biological approach
[164]. Metabolites were mapped to their biochemical pathways and those that exhibited statistically
significant, time/dose-dependent; compound-related changes in comparison to the time-matched control
groups are herein discussed.
4.1.1. CHAPTER AIMS
The purpose of this study was to…
1. Confirm mitochondrial functional changes observed with GSK932121A in chapter 3 (with a
50mg/kg dose) and assess the effect of a well tolerated 12.5mg/kg dose on underlying
mitochondrial function and clinical measures.
2. Evaluate potential plasma and liver biomarkers of mitochondrial toxicity (specifically mid-
respiratory chain inhibition) using a global metabolomics approach and assess the pathways
implicated in the toxicological response to complex III inhibition via analysis of plasma
metabolites at progressive time points and liver metabolites at the terminal time point.
4.1.2. STUDY DESIGN
Crl:CD(SD) rats were exposed to GSK932121A essentially as described for chapter 3. Six or seven rats
per group were sampled for plasma prior to compound treatment (pre-dose) and then exposed to either
12.5mg/kg GSK932121A (n=7), 50mg/kg GSK932121A (n=7) or vehicle alone (n=6). The number of
animals for each group was based on the known potential for low systemic exposure levels using the IP
route of administration for this compound and to provide sufficient statistical power for metabolomics
assessment. Plasma samples were then taken at 0.5, 1, 2 and 4h with time-matched VC samples taken in
101
parallel. Terminal liver samples were also harvested at the end of each study for a total of 100 plasma
samples and 20 liver samples for analysis.
Plasma and liver samples were stored at -80°C and sent to Metabolon on dry ice for analysis (as described
in section 2.19). Liver tissue was also used to isolate fresh mitochondria in order to both confirm
mitochondrial function changes highlighted in chapter 3 (increase in basal OCR and increase in CRC) and
investigate whether these changes occur at a sub-toxic dose of GSK932121A. Blood toxicokinetics and
lactate/pyruvate analysis were also performed.
4.1.3. METABOLOMICS DATA VISUALISATION
Metabolomics data presented throughout section 4.2 below can be interpreted based on the schematic
shown in Fig.4.1 below. Plasma metabolite data is depicted using line charts to demonstrate the change in
scaled ion levels throughout the 4 hour time period (mean ± standard error). Liver metabolite data is
presented in the same y-axis scale although using a box and whisker plot to show the key statistical
parameters. All data is presented as a scaled intensity of the total ion counts for each metabolite whereby
the median ion level for each metabolite is equal to 1.00. Total ion counts were used as opposed to
absolute quantification to ensure that the relative quantitation of each biochemical is consistently made on
the parent ion for a specific platform (e.g. LC/neg, LC/pos, etc) and as it is the degree of change that
determines the outcome, not the absolute level. This method ensures the quantitation of each biochemical
is made consistently.
102
FIGURE 4.1: Metabolomics data visualisation. Visualisation of the study data in line or box plot format (A) Plasma data is
represented by line plots with mean ± standard error plotted. (B) Box plots are used to convey the spread of the
data with the middle 50% of the data represented by the boxes and the whiskers reporting the range of the data.
The solid line across the box represents the median value of the data while the + is the mean. All metabolomics data are scaled such that the median value measured across all samples was set to 1.0.
4.2. Results and Discussion
In chapter 3 a single acutely toxic dose of GSK932121A was used in order to relate the observed in-life
effects to functional effects. Whilst informative, this study design and dose were not designed to
distinguish primary events from secondary consequences (rather just to characterise the acute toxicity).
The first task of this follow-up study was to determine whether the key observations which occurred with
a 50mg/kg (toxic) dose occurred with a 12.5mg/kg (well tolerated) dose to determine more subtle low
dose effects of complex III inhibition in vivo.
4.2.1. IN LIFE EFFECTS AND COMPARISON OF ENDPOINTS TO CHAPTER 3 STUDY
The key observations made in chapter 3 with regard to the effect of GSK932121A in vivo were
hypothermia, increase in both basal respiration and CRC compared to VC animals and an increased blood
lactate:pyruvate ratio. The same endpoints were assessed in the present study.
Maximum of Distribution
Minimum of Distribution
Upper Quartile
Lower Quartile
Mean (+)
Median
-1 Standard Error
Mean
+1 Standard Error
A B Plasma – Line Plots Liver – Box and Whisker Plots
103
Using the 12.5mg/kg dose led to an expected lower plasma drug concentration than in the 50mg/kg study
outlined in chapter 3. The average plasma drug concentration was 4.45µg/mL (12.5mg/kg) compared with
18.3µg/mL at 50mg/kg in chapter 3. However here, the plasma concentration with the 50mg/kg dose was
markedly different to that in the previous study, with a plasma concentration of only 5.40µg/mL being
achieved in this follow up investigation. This data is striking as it shows that at 50mg/kg the animals had
3.4 times less exposure in the present study compared to the study described in chapter 3 (reason behind
this discrepancy remains unknown). Furthermore the plasma concentration of GSK932121A at 4-hours
post treatment with 50mg/kg was just 21% greater than that achieved with the 12.5mg/kg dose. The
difference in the toxicokinetics between the 12.5mg/kg and 50mg/kg group is however greater in liver
tissue where an average concentration of 3.38µg/mg was observed with 12.5mg/kg GSK932121A
compared to 7.67µg/mg with 50mg/kg GSK932121A (2.7x difference). Together these data highlights
that GSK932121A is rapidly deposited in the liver following IP dosing and suggests that animals in the
present study were exposed to less drug than in the initial study. Despite this lower internal exposure at
the 50mg/kg dose compared to the previous study described in chapter 3, the remainder of the results
presented in this chapter are from the new 50mg/kg study and its paired 12.5mg/kg dose.
Consistent with the significant reduction in plasma exposure levels (compared to that described in chapter
3), no adverse clinical signs were observed at either 12.5mg/kg or 50mg/kg GSK932121A. Despite this,
a significant reduction in body temperature was still observed in 50mg/kg animals compared to VC, with
an average temperature reduction of 2.8°C observed (p<0.01) (Fig.4.2A). No effect on body temperature
was observed at 12.5mg/kg (p>0.05, n=7). On this occasion reduction in body temperature showed no
correlation with GSK932121A plasma concentration (R2:0.3227, p>0.05) or liver concentration
(R2:0.5833, p>0.05). In contrast to results in chapter 3, no significant effect of GSK932121A treatment
was observed on whole blood lactate:pyruvate ratio with either 12.5mg/kg or 50mg/kg groups (Fig.4.2B),
compared to VC (p>0.05).
A statistically significant increase in liver mitochondria basal OCR was seen in mitochondria isolated
from both 12.5mg/kg GSK932121A (n=7, p<0.05) and 50mg/kg GSK932121A (n=7, p<0.01) groups
compared to VC (n=6) (Fig.4.2C). These data supports observations made in previous chapters and
further confirms the opposite effect of GSK932121A in mitochondria isolated from GSK932121A-treated
animals compared to in vitro treatment of control (not previously exposed) mitochondria. Similarly,
GSK932121A caused a statistically significant and dose dependent increase in CRC in mitochondria
isolated from the livers of both 12.5mg/kg (p<0.05, n=7) and 50mg/kg (p<0.01, n=7) animals compared
to VC (n=6) (Fig.4.2D). Again this supports previous observations in terms of the direction of change
104
observed between mitochondria isolated from animals treated with GSK932121A in comparison to in
vitro treatment of control mitochondria. These data support effects of GSK932121A on mitochondrial
function at doses which are well tolerated which lends credence to the hypothesis that altered
mitochondrial function is central to downstream toxicities as opposed to being a consequential effect.
FIGURE 4.2: Effect of 12.5mg/kg and 50mg/kg GSK932121A on body temperature, blood lactate:pyruvate ratio and
isolated liver mitochondria CRC and OCR. The data above shows the effect of 12.5mg/kg and 50mg/kg
GSK932121A on the endpoints deemed pertinent from chapter 3. These were re-tested in the present study to
assess the effect of a well tolerated 12.5mg/kg dose and to analyse the reproducibility of a 50mg/kg dose on
body temperature (A), blood lactate:pyruvate ratio (B) and isolated liver mitochondria OCR (C) and CRC (D). All data shown is mean ± SD (VC, n=6, 12.5/50mg/kg, n=7). p<0.05*, p<0.01**
G S K 9 3 2 1 2 1 A D o s e (m g /k g )
Ba
sa
l R
es
pir
atio
n
OC
R (
pm
ols
/min
)
V C 1 2 .5 5 0
0
1 0 0
2 0 0
3 0 0
4 0 0
*
* *
G S K 9 3 2 1 2 1 A D o s e (m g /k g )
La
cta
te:P
yr
uv
ate
Ra
tio
V C 1 2 .5 5 0
0
2 0
4 0
6 0
N S N S
A
C D
B
T im e (s )
Ca
lciu
m
Re
ten
tio
n
Ca
pa
cit
y
Op
tic
al
De
ns
ity
(6
50
nm
)
0 5 0 1 0 0 1 5 0 2 0 0
0 .4
0 .6
0 .8
1 .0
1 .2
1 .4
1 .6
V C
1 2 .5 m g /k g G S K 9 32 12 1A
5 0m g /k g G S K 9 321 21A
* **
105
It is important to acknowledge that lactate/pyruvate data generated using clinical chemistry methods
outlined in section 2.13 (and shown in Fig.4.2B) bared high degrees of similarity to the plasma lactate and
pyruvate measures made by Metabolon (see Appendix 5). Metabolomic data described below (and shown
in Appendix 5) showed a spike in plasma lactate both at 0.5 hours and 4 hours post-dose. The 50mg/kg
dose of GSK932121A showed a significant elevation in lactate at 4 hours with the Metabolon dataset
however, whereas the data shown in Fig.4.2B shows that the increase was merely trending.
4.2.2. EFFECT OF GSK932121A ON TOTAL METABOLITES IN THE LIVER AND PLASMA
A high-level statistical summary of the data obtained from the metabolomics analyses is shown in table
4.1 below. A total of 609 and 658 identifiable/named metabolites were detected in the plasma and liver
respectively. Metabolomics raw data (for the metabolites described in this chapter), can be found in
Appendix 4. Within the plasma, there was a dose dependent effect of compound treatment on the
metabolomic profiles observed in this study when compared to time-matched controls. The low dose of
GSK932121A (12.5mg/kg) elicited changes beginning at ~2 hours post treatment whilst the high dose of
GSK932121A (50mg/kg) had clear effects beginning at 1h post-treatment with some indication of
significantly altered metabolites as early as 0.5h (though the number of changes was limited at this time
point).
Similar to the plasma, the end of study liver samples also showed a more notable metabolomic impact
with high dose, at which there was a 294% increase in significantly altered metabolites compared to low
dose. The number of metabolite changes in the liver at 4 hours post-dose with both low dose and high
dose of GSK932121A was much lower than the number of significant alterations observed in the plasma
at the same time point. It is therefore possible that additional, non-hepatic effects of GSK932121A
contribute to the plasma metabolomic shift that was observed herein. This lack of corroboration between
the plasma and liver metabolome is evident elsewhere in the metabolomics data and therefore assessment
of other tissues such as muscle, lung, heart and kidney may be warranted.
106
-12.5mg/kg Significant Effect of 12/5mg/kg GSK932121A on Plasma Metabolites
Compared to Time Matched VC
Pre Dose
0.5 hours
1 hour
2 hours
4 hours
Significant up | down 51 | 8 30 | 17 4 | 34 55 | 30 54 | 55
Percentage change in significant
metabolites from pre dose (up
or down)
- -20% -36% +44% +85%
Percentage of total detected
metabolites changing (up or
down)
9.9% 7.7% 6.2% 14% 17.9%
TABLE 4.1: Statistical summary of a plasma and liver metabolite changes. Data shown represents change in statistically
significant metabolites in plasma following treatment with 12.5mg/kg GSK932121A (A) and 50mg/kg
GSK932121A (B) compared to time-matched VC samples. Effect of both 12.5mg/kg and 50mg/kg doses on
liver metabolites compared to VC is shown in table C. (green = significant reduction in expression, red =
significant increase in expression).
4.2.3. METABOLOMICS: COMPLEX III INHIBITION HAS A PROMINENT IMPACT ON PLASMA
TCA CYCLE INTERMEDIATES
Mitochondrial ETC function and TCA cycle energetics are intimately linked. Data shown below (Table
4.2) illustrate the impact that altering mitochondrial function at the level of complex III has on TCA
-50mg/kg Significant Effect of 50mg/kg GSK932121A on Plasma Metabolites
Compared to Time Matched VC
Pre Dose
0.5 hours
1 hour
2 hours
4 hours
Significant up | down 47 | 3 41 | 19 37 | 50 81 | 104 128 | 71
Percentage change in
significant metabolites from
pre dose (up or down)
- +20% +74% +270% +298%
Percentage of total detected
metabolites changing (up or
down)
8.2% 9.9% 14.3% 30.4% 32.7%
Effect of GSK932121A on Liver
metabolites compared to VC
GSK932121A Dose 12.5mg/kg 50mg/kg
Significant up | down
26 | 8 70 | 64
Percentage of total detected
metabolites changing (up or
down)
5.2% 20.4%
A
B
C
107
intermediates (TCAi) in the plasma. Acute treatment with 50mg/kg GSK932121A revealed a significant
increase in all plasma TCAi at 4 hours post dose with the exception of succinate (trending increase but
p>0.05) compared to VC. No effect on plasma TCAi was observed at 12.5mg/kg (data not shown). The
absolute levels of these TCAi in the plasma with a 50mg/kg dose were however relatively low, with
substantial effects noted only at 4 hours (and in conjunction with severe hypothermia). This is suggestive
that alterations in plasma TCAi may only occur at a late stage in the AOP following GSK932121A
administration or are secondary adaptive changes. This data suggests a delay in organ specific alterations
in TCA cycle energetics which requires time to significantly impact the circulating plasma TCAi.
TABLE 4.2: Impact of GSK932121A (50mg/kg) on plasma TCAi. Data shown represents fold change in TCAi compared to
time matched VC samples. Statistical significance is represented by colour (red = statistically significant
increase, green = statistically significant reduction).
Evaluation of terminal 4 hour liver TCAi did not reveal any major impact of compound on mitochondrial
TCA cycle function in the liver (data not shown), in contrast to observations in the plasma. These data
indicate that only higher dose/later stage mitochondrial dysfunction causes any change in TCA cycle
energetics highlighted by plasma biomarkers. Additionally, the general lack of TCAi change within the
liver suggested that the 4h plasma change may have originated in a non-hepatic target organ(s). Although
increases in released TCAi have been previously demonstrated in response to complex III inhibition
induced by antimycin A [165], the present data reveals this is not an early event and may either be a
secondary consequence of other tissues or a downstream event in the AOP.
With respect to the overt increase in plasma TCAi, multiple carbon energy sources would be expected to
become impacted by a loss of TCA cycle efficiency, glycogen metabolism including FA oxidation and
amino acid catabolism. The next three sections will evaluate the impact of GSK932121A on these energy
sources, both systemically (plasma) and in the liver.
Metabolite Pre Dose 0.5 Hours 1 Hour 2 Hours 4 Hours
Citrate 1.14 0.94 1.08 1.17 1.39
α-ketoglutarate 1.34 0.62 1.25 1.07 2.47
Succinate 1.77 1.18 0.69 0.71 2.74
Fumarate 1.51 1.22 1.02 1.07 4.35
Malate 1.57 1.22 1.07 1.09 5.06
108
4.2.4. METABOLOMICS: COMPLEX III INHIBITION CAUSES AN INCREASE IN GLYCOGENOLYSIS
AND GLYCOLYSIS
Consistent with observations made in chapter 3, metabolomics analysis revealed a prominent metabolic
switch in energy production, away from mitochondrial OXPHOS and towards glycogenolysis, glycolysis
and substrate level phosphorylation. When mitochondrial function was altered by GSK932121A, a
rapidly available alternative energy source would be from glycogen mobilisation and flow into glycolytic
metabolism at the level of glucose-6-phosphate as shown in Fig.4.3 below.
FIGURE 4.3: Schematic representation of the glycogenolysis, glycolysis and PPP. Biochemicals which showed significant
changes on treatment with GSK932121A in the present study are presented in red boxes.
A major biochemical outcome of GSK932121A treatment shown in chapter 3 was the significant
reduction in hepatocellular glycogen. Consistent with this observation a decrease in all liver
starch/glycogen intermediates was observed in GSK932121A treated animals in the present study. This
concentration dependent decrease in all liver glycogen was trending a decrease at the 12.5mg/kg dose and
109
reached statistical significance at 50mg/kg (Fig.4.4). Glycogen itself was however unchanged in the liver
of 12.5mg/kg GSK932121A treated animals. Reduction in glycogen levels therefore manifest only at
higher doses due to increased reliance on hepatic glycolysis (i.e. Reduction in glycogen is not a critical
event following GSK932121A treatment in vivo).
FIGURE 4.4: GSK932121A causes a dose dependent reduction in liver starch/glycogen intermediates at a 4 hour time
point. Data shown represents scaled intensity of the total ion counts for each metabolite whereby the median
ion is equal to 1. A significant reduction in maltohexaose (A), maltotriose (B) and maltose (C) was observed in
the liver of animals treated with 50mg/kg GSK932121A (n=7, orange) compared to VC (n=6, black). All
glycogen intermediates were trending a reduction at 12.5mg/kg (n=7). **p<0.01, ***p<0.001.
In line with the hypothesis of compensatory energy sourcing, the dramatic depletion of liver glycogen
intermediates correlated with a progressive increase in liver glucose-6-phosphate, the input level at which
increased glycogenolysis would be expected to impact glycolytic metabolism (Fig.4.5A). Additional
support for increased glycolytic compensation was given by a statistically significant decrease in liver
glucose levels, an elevation in the glycolysis intermediates 2-phosphoglycerate and phosphoenolpyruvate
(PEP) and a significant decrease in both pyruvate and lactate with high dose acute exposure (Fig4.5 D and
E). Importantly, while elevated glycolytic metabolism might be expected to result in elevated lactate
levels within the liver, it is known that the liver is able to utilise lactate as a non-carbohydrate fuel source
in order to generate glucose (gluconeogenesis) via the Cori cycle. This theory is supported by gene
expression changes presented in chapter 3 which highlight up-regulation of genes involved in
gluconeogenesis, i.e. Pck1, Foxo1 and PGC1α. The significant increase in lactate observed in the blood at
late time points in chapter 3 (despite trending increase this was not evident in the present study, likely due
M a lto s e
V C 1 2 .5 5 0
0
1
2
3
4
* * *
M a lto tr io s e
V C 1 2 .5 5 0
0
5
1 0
1 5
2 0
* * *
G S K 9 3 2 1 2 1 A D o s e (m g /k g )
M a lto h e x a o s e
Sc
ale
d
In
ten
sit
y
V C 1 2 .5 5 0
0 .0
0 .5
1 .0
1 .5
2 .0
* *
A B C
110
to lower drug exposure levels) is likely originating from the skeletal muscle although further work is
required to better understand its origins. Furthermore, the observation that GSK932121A caused a
significant increase in liver phosphoenolpyruvate (PEP) and a significant reduction in liver pyruvate/
lactate (with the 50mg/kg dose) is suggestive that the activity of pyruvate dehydrogenase kinase may be
inhibited. This would support observations made in chapter 3 which showed an increased level of Pdk4
gene transcription in liver tissue of rats treated with 50mg/kg GSK932121A compared to VC. Further
work is required to understand the effect of DIMT on both the activity and expression of the pyruvate
kinase family of enzymes and the associated upstream substrates.
FIGURE 4.5: Effect of GSK932121A treatment on key glycolysis metabolites in the liver of GSK932121A and VC treated
animals. Data shown represents scaled intensity of the total ion counts for each metabolite whereby the median
ion is equal to 1. Data represents the differential effect of a 12.5mg/kg (n=7, grey) or 50mg/kg (n=7, orange)
dose of GSK932121A on glucose-6-phosphate (A), 2-phosphoglycerate (B), phosphoenolpyruvate (C), pyruvate (D), lactate (E) and glucose (F) compared to VC livers (n=6, black). p<0.01**, p<0.001***
G lu c o s e 6 -P h o s p h a te
Sc
ale
d
In
ten
sit
y
V C 1 2 .5 5 0
0 .0
0 .5
1 .0
1 .5
2 .0
* * *
G lu c o s e
V C 1 2 .5 5 0
0 .0
0 .5
1 .0
1 .5
2 .0
* *
P h o s p h o e n o lp y r u v a e (P E P )
V C 1 2 .5 5 0
0 .0
0 .5
1 .0
1 .5* *
P y r u v a te
Sc
ale
d
In
ten
sit
y
V C 1 2 .5 5 0
0
1
2
3
4
5
* * *
L a c ta te
V C 1 2 .5 5 0
0 .0
0 .5
1 .0
1 .5
* *
G S K 9 3 2 1 2 1 A D o s e (m g /k g )
2 -p h o s p h o g ly c e r a te
V C 1 2 .5 5 0
0 .0
0 .5
1 .0
1 .5
* *
A B C
D E F
111
It is important to highlight that no biochemical involved in glycogenolysis or the glycolysis pathway was
affected at the well-tolerated 12.5mg/kg dose. Lactate has long been regarded as a useful biomarker of
mitochondrial dysfunction however the evidence obtained would suggest that the effect of complex III
inhibition on circulating lactate is only apparent at high doses and in conjunction with severe clinical
toxicity. It is currently unknown what level of mitochondrial dysfunction in vivo is required to provoke
significant effects on circulating lactate. Despite this, the current data improves understanding of the
effect of drug-induced respiratory chain inhibition on metabolic pathways in the liver. Further work
exploring glycogen depletion and lactate generation at sub-toxic doses will be presented in chapter 7.
4.2.5. METABOLOMICS: COMPLEX III INHIBITION HAS AN EFFECT ON MITOCHONDRIAL FA
OXIDATION
Elevation of plasma TCAi following high dose compound exposure indicated some level of altered
energy metabolism, and presuming liver is a major target of compound toxicity, one would anticipate that
altered hepatic FA -oxidation may be the primary impact in the acute exposure situation. It is important
to acknowledge that the general pathology relating to the effect of GSK932121A on cellular lipid relates
to an increase in hepatocellular lipid and as such the metabolomic footprint downstream of GSK932121A
may be likened to that described in studies following high fat diet feeding, observation of hepatic steatosis
or insulin resistance (type II diabetes mellitus) [166].
112
FIGURE 4.6: Schemiatic representation of the carnitine shuttle and ketogenesis. Biochemicals depicted in red were
differentially affected due to GSK932121A’s impact on FA β-oxdation.
Mitochondrial FA oxidation requires FA-conjugation with carnitine in order to facilitate transport across
the IMM for FA -oxidation to proceed (Fig.4.6 above). Consistent with increased FA conjugation (i.e.
attempts to increase mitochondrial substrate for β-oxidation) a significant reduction in plasma carnitine
(significant at 2h and 4h with low and high doses of GSK932121A) was observed compared to VC
(Fig.4.7). End of study liver carnitine was not significantly altered compared to control.
Ketogenesis
3-hydroxybutyrate (BHBA)
Carnitine
Fatty acylcarnitine
Fatty acylcarnitine
Carnitine
113
FIGURE 4.7: Effect of GSK932121A on plasma free carnitine. A significant reduction in free carnitine was observed in the
plasma of 12.5mg/kg (grey line, n=7) and 50mg/kg (orange line, n=7) treated animals at 2 and 4 hours
compared to VC animals (black line, n=6). Data shown represents scaled intensity of the total ion counts for
each metabolite whereby the median ion is equal to 1 with mean ± SE shown. *p<0.05, **p<0.01, ***p<0.001.
Consistent with the metabolic attempts to increase β-oxidation shown by significant reduction in free-
carnitine with escalating time and dose, an increase in a number of ketone bodies was observed. Efficient
FA -oxidation leads to the formation of acetyl-CoA, which is incorporated into the TCA cycle [167]. If
this process is perturbed, efficient FA oxidation is diverted into ketogenic FA metabolism, resulting in the
accumulation of ketone bodies (such as 3-hydroxybutyrate, BHBA) and the accumulation of upstream
FA-acylcarnitines [168-170]. In the current study, a significant increase in both plasma and liver BHBA
was observed compared to time matched VC animals (Fig.4.8 A and B). Increased levels of plasma
BHBA have been previously observed in individuals with diabetes-related fatty liver [171]. This occurred
alongside a significant increase in plasma long-chain acylcarnitines which lends further credence to the
hypothesis that mitochondrial FA -oxidation is altered with acute exposure (Fig.4.8 C, D and E). It is
however important to acknowledge a trending yet appreciable increase in the three fatty acylcarnitines
shown in Fig.4.8 at the pre-dose stage. Recent research has shown that elevations in the plasma
concentrations of FA-acylcarnitines reflect mitochondrial dysfunction associated with metabolic disease
states [168, 169, 172-175]. Furthermore, increased levels of circulating acylcarnitines have also been
investigated as biomarkers, specifically of mitochondrial dysfunction following drug induced liver injury
using acetaminophen [123]. Furthermore increased levels of circulating palmitoylcarnitine,
F r e e C a r n it in e
Sc
ale
d
In
ten
sit
y
0 .6
0 .8
1 .0
1 .2
1 .4
P re -D o se 0 .5 21 4
T im e (h o u r s )
** * *
* **
114
stearoylcarnitine and oleylcarnitine were observed in mice with increased levels of hepatic lipid after
being fed a high fat diet [176].
FIGURE 4.8: Effect of GSK932121A on plasma and liver BHBA and plasma FA-acylcarnitine levels. A significant increase
in plasma (A) and liver (B) BHBA was observed in 12.5mg/kg (n=7) and 50mg/kg (n=7) GSK932121A treated
animals compared to VC animals (n=6). Increases in the FA-acylcarnitines palmitoylcarnitine (C),
oleoylcarnitine (D) and stearoylcarnitine (E) was observed as early as 0.5 hours post dose with both 12.5mg/kg
(grey, n=7) and 50mg/kg (orange, n=7) line compared to VC animals (black, n=6). Data shown is mean ± SE. p<0.05*, p<0.01**, p<0.001***
Acylcarnitines are derivatives of long chain FA’s which are essential for the transport of FA into the
mitochondria [177]. Liver FA-acylcarnitines were not significantly affected by compound under any
treatment condition (data not shown). This apparent lack of change could reflect a more substantial
L iv e r
3 -h y d r o x y b u ty r a te
(B H B A )
V C 1 2 .5 5 0
0 .0
0 .5
1 .0
1 .5
2 .0
2 .5
*
G S K 9 3 2 1 2 1 A D o se (m g /k g )
P la s m a
3 -h y d r o x y b u ty r a te
(B H B A )
H o u r s (P o s t D o se )
Sc
ale
d
In
ten
sit
y
4
0
1
2
3
4
P re -D o se 0 .5 1 2
*
*
* *
P la s m a
P a lm ito y lc a r n it in e (C 1 6 )
Sc
ale
d
In
te
ns
ity
4
0 .0
0 .5
1 .0
1 .5
2 .0
2 .5
P re -D o se 0 .5 1 2
***
*
* *
P la s m a
S te a r o y lc a r n it in e (C 1 8 )
4
0 .4
0 .8
1 .2
1 .6
P re -D o se 0 .5 1 2
* * * **
* *
P la s m a
O le o y lc a r n it in e (C 1 8 )
H o u r s (P o s t D o s e )
4
0 .0
0 .5
1 .0
1 .5
2 .0
2 .5
P re -D o se 0 .5 1 2
**
* * * * * *
* *
C D E
A B
115
baseline concentration of FA-acylcarnitines in the liver (as the major lipid metabolising organ) when
compared to plasma baseline levels. Alternatively, this may reflect a shift from complete FA oxidation
with TCA cycle incorporation towards increased ketogenesis which would fit with the increase in both
plasma and liver BHBA. Similar to the discord between plasma and liver TCAi, the general lack of
consistency between plasma and liver FA-acylcarnitine levels suggests that other, non-hepatic effects of
the compound may contribute to plasma acylcarnitine accumulation. In any case, circulating
acylcarnitines may have potential as a biomarker of drug induced respiratory chain dysfunction with
increased expression levels observed at sub-toxic doses in vivo (12.5mg/kg) and as early as 0.5 hours post
dose. Overall, these data indicate a significant impact of acute compound exposure on mitochondrial FA
oxidation efficiency leading to increased ketogenesis.
4.2.6. METABOLOMICS: COMPLEX III INHIBITION HAS AN EFFECT ON AMINO ACID
CATABOLISM
There are multiple upstream carbon energy sources that may be altered with a significant perturbation in
mitochondrial TCA cycle efficiency. In addition to the predominant lipid source used by the liver, amino
acid catabolism might also be anticipated to show changes with decreased mitochondrial function
(Fig.4.9).
FIGURE 4.9: Schematic representation of α-ketobutyrate and α-hydroxybutyrate involvement in the supply of carbon
sources to the TCA cycle.
α-hydroxybutyrate (AHB) α-ketobutyrate (AKB)
116
A significant increase in the levels of several plasma and liver amino acids corroborated the hypothesis
that mitochondrial amino acid catabolism was impacted by GSK932121A. Of particular interest was the
notable increase in plasma branched chain amino acids (BCAA), 4 hours post-treatment with 50mg/kg
GSK932121A (Fig.4.10 A-C). No significant difference in plasma BCAA’s were observed following low
dose administration of GSK932121A compared to VC. Increases in a number of BCAA were also
observed in the liver at both 12.5mg/kg and 50mg/kg GSK932121A compared to VC (Fig.4.10D). These
data suggest that hepatic amino acid catabolism is affected despite absence of clinical signs and these
increases are only observed in the plasma at higher doses. Perturbations in BCAA metabolism have been
shown to correlate with metabolic disease and the underlying mitochondrial dysfunction that is manifest
in such disease states [170, 178-180]. Furthermore, increased levels of glycogenic and ketogenic amino
acids (valine and leucine respectively) have been observed in states of hepatic insulin resistance due to
fatty liver which is consistent with the pathological steatosis observed following GSK932121A treatment
[181]. Similarly to this observation, the exact three amino acids which were increased in the plasma in
this study (valine, leucine and isoleucine) were also significantly elevated in the plasma of human
diabetes-induced fatty liver patients suggesting impaired short term metabolic control [171] although the
exact mechanism for these elevations remains unknown.
117
FIGURE 4.10: Effect of GSK932121A on plasma and liver BCAA’s. To demonstrate the effect of GSK932121A on amino
acid catabolism the effect of compound treatment on the BCAA’s is displayed. A significant increase in plasma
valine (A), leucine (B) and isoleucine (C) was observed at 4 hours post dose with 50mg/kg GSK932121A
(orange line, n=7) compared to VC animals (black line, n=6). (D) A significant increase in liver BCAA’s was
also observed at both 12.5mg/kg (grey bars, n=7) and 50mg/kg (orange bars, n=7) compared to VC (black bars, n=6) 4-hours post dose with GSK932121A. All data displayed is mean ± SE. p<0.05*, p<0.01**, p<0.001***
Plasma concentrations of -ketobutyrate (AKB) and its alternative metabolite, α-hydroxybutyrate (AHB)
showed time and concentration dependent increases with acute exposure to GSK932121A (Fig.4.11).
Recent publications have shown that elevated AHB serves as a marker of insulin resistance, a condition
known to involve mitochondrial dysfunction [182-184] and provides one of the most notable markers of
increased amino acid catabolism in the current model system. Accumulation of AHB is postulated to
P la sm a I s o le u c in e
4
0 .5
1 .0
1 .5
2 .0
P re -D o se 0 .5 1 2
* *
P la s m a L e u c in e
H o u r s (P o s t D o s e )
4
0 .8
1 .0
1 .2
1 .4
1 .6
P re -D o se 0 .5 1 2
*
P la s m a V a lin e
Sc
ale
d
In
ten
sit
y
4
0 .8
1 .0
1 .2
1 .4
1 .6
P re -D o se 0 .5 1 2
*
Sc
ale
d
In
ten
sit
y
S e r ine T hr e o nine V a l ine Le uc ine Is o l e uc ine
0 .0
0 .5
1 .0
1 .5
2 .0
V eich le C on tro l
1 2 .5 m g /k g G S K 9 32 12 1A
5 0m g /k g G S K 9 321 21A
* *
* * *
* *
* ** *
N S
*
A B C
D
118
occur when levels of AKB exceed the rate of its catabolism to propionyl-CoA which appears to be the
case in the present study.
FIGURE 4.11: Effect of GSK932121A on plasma AKB and its downstream metabolite AHB over a 4 hour time course.
GSK932121A causes a significant dose and time dependent increase in AHB (A) and AKB (B) with both
12.5mg/kg (grey line, n=7) and 50mg/kg (orange line, n=7) compared to VC animals (black line, n=6). Data shown is mean ± SE of scaled intensity (median = 1) of total metabolite counts. p<0.05*, p<0.01**
Whilst the metabolomics data point towards an insulin-resistance / metabolic syndrome-like phenotype it
is important to acknowledge that, to date, no reports have appeared in the literature that an increase in
circulating or hepatic BCAA or in circulating levels of AHB/AKB are markers of DIMT.
4.2.7. METABOLOMICS: INHIBITION OF COMPLEX III CAUSES INCREASED LEVELS OF
HEPATIC OXIDATIVE STRESS
In addition to alterations in glycolytic metabolism shown in section 4.2.4, there was a notable shift in
hepatic intermediates of pentose phosphate pathway (PPP) metabolism that suggest, at least in part,
elevated glucose-6-phosphate was also being tapped as a source feeding PPP metabolism. PPP
metabolism is commonly increased to serve two major purposes: 1) increase nucleotide biosynthesis in
the context of elevated proliferation, or 2) increase the reducing NADPH equivalents necessary to reduce
oxidised glutathione (GSSG) to the major tissue antioxidant GSH [167, 185]. Sedoheptulose-7-phosphate
A B
119
was significantly elevated in the liver of animals with both low and high dose compound in the acute
setting (Fig.4.12A), consistent with an increase in PPP metabolism. In the current model of acute
compound-induced toxicity, this profile likely reflects an increased need to maintain antioxidant GSH
levels in the liver (versus increased nucleotide biosynthesis).
Cysteine-glutathione disulphide is a reported marker of oxidative stress [186]. Increased liver cysteine-
glutathione disulphide levels observed at both doses of the drug in the present study indicate elevated
hepatic oxidative stress with GSK932121A exposure (Fig.4.12B). Importantly, liver GSH levels were not
significantly diminished with low dose compound exposure, but were significantly decreased with acute
high dose compound treatment (Fig.4.12D). These data indicate a compound related increase in oxidative
stress with both low and high dose treatment, but an inability to maintain antioxidant GSH levels in the
acute high dose setting vs. low dose treatment. In line with this observation was a significant increase in
liver ophthalmate levels with low dose GSK932121A and a trending decrease in liver ophthalmate levels
with high dose exposure (Fig.4.12C). Ophthalmate is co-ordinately synthesised alongside glutathione
through the promiscuity of GSH biosynthetic enzymes [167, 185], but is typically a more stable marker of
GSH biosynthesis than GSH itself (particularly within a changing redox environment). Altered
ophthalmate levels suggested that GSH biosynthesis was appropriately up-regulated with low dose
exposure, but appeared compromised at 50mg/kg. This data is consistent with a two-hit paradigm in the
latter scenario, where altered energy metabolism could be coupled with significant impairment of a
crucial redox response in the liver of animals treated with high dose GSK932121A, thus contributing to
the observed toxicity.
120
FIGURE 4.12: Effect of GSK932121A on oxidative stress and anti-oxidant stress response in the liver. GSK932121A had a
significant effect on the liver oxidative stress markers cysteine glutathione disulphide (A) and sedoheptulose-7-
phosphate (B). (C) A transient increase in opthalmate was observed with 12.5mg/kg GSK932121A (grey, n=7)
which was significantly reduced at 50mg/kg (orange, n=7). Furthermore, 50mg/kg GSK932121A caused a
significant reduction in reduced GSH (D) and a significant increase in oxidised GSSG (E) compared to VC
(black, n=6). Data represented as scaled intensity whereby the median value is equal to 1.p<0.05*, p<0.01**, p<0.001***.
S e d o h e p tu lo s e -7 -p h o s p h a te
V C 1 2 .5 5 0
0
1
2
3
4
5
* * *
Sc
ale
d I
nte
ns
ity
C y s te in e -g lu ta th io n e
d is u lf id e
V C 1 2 .5 5 0
0 .0
0 .5
1 .0
1 .5
2 .0
*
*
G S K 9 3 2 1 2 1 A D o s e (m g /k g )
O p h th a lm a te
V C 1 2 .5 5 0
0 .0
0 .5
1 .0
1 .5
2 .0* *
G lu ta th io n e R e d u c e d
(G S H )
Sc
ale
d
In
ten
sit
y
V C 1 2 .5 5 0
0 .0
0 .5
1 .0
1 .5
2 .0
* *
G lu ta th io n e O x id is e d
(G S S G )
V C 1 2 .5 5 0
0 .0
0 .5
1 .0
1 .5
2 .0
* *
A B C
D E
121
4.3. Further Discussion
4.3.1. METABOLOMICS
Metabolomics analysis identified biochemical changes occurring as a result of respiratory chain inhibition
at both early time-points and at a sub-toxic dose of GSK932121A. The analysis demonstrated an increase
in plasma TCA cycle intermediates, increased levels of hepatic oxidative stress, impaired mitochondrial
β-oxidation / amino acid catabolism and an increased level of glycogenolysis. This metabolomic profile is
similar to that observed in metabolic syndrome, fasting, fatty liver and insulin resistance. Furthermore the
data outlined in this chapter correlates closely with clinical observations in patients with mitochondrial
diseases caused by mutation to mtDNA [187]. Many of these disorders manifest in respiratory chain
deficiencies and as such validate the translatability of the present work to patients with impaired
bioenergetic capacity and mitochondrial myopathies. Particularly acute are increases in acylcarnitines,
BCAA’s and ketone bodies and future work will no doubt explore the effect of DIMT on these
parameters further (i.e. during longer term dosing regimens).
The similarity of the metabolomics signatures in the present study to observations made in other studies
of mitochondrial dysfunctions opens the possibility of a mechanism-independent metabolite footprint
from generalized mitochondrial perturbation. This is supported by the authors of a recent review into the
metabolic and biochemical effects of mitochondrial dysfunction in vivo [188].
Furthermore, it is important to acknowledge the current study showed a delayed and diminished toxic
response to GSK932121A when compared to previous studies (outlined in chapter 3), i.e. 50mg/kg dose
showed no adverse clinical signs and significantly lower plasma exposure levels. This would suggest that
the response profiles may manifest earlier in a more typical scenario – thus providing the potential for
markers at 0.5h with acute high dose. Drug-induced observations in the present study are therefore
particularly sensitive in detecting underlying mitochondrial dysfunction as clinical signs were absent up
to the 4 hour time-point.
4.4. Summary
In this chapter I have detailed the effect of GSK932121A (complex III inhibition) on early biochemical
changes in plasma and liver. The following conclusions can be drawn for the experimental evidence in
this chapter…
122
With the exception of plasma lactate:pyruvate and clinical signs (no effect likely due to lower plasma
exposure levels of GSK932121A), the key observations made in chapter 3 were reproducible with a
50mg/kg dose in the present study. Furthermore it has been confirmed that increases in basal OCR
and increases in CRC occur 4-5 hours following administration with a well tolerated 12.5mg/kg dose
confirming they are primary effects of drug-induced respiratory chain perturbation and not secondary
events. This is especially apparent as no significant effect on body temperature was observed with a
12.5mg/kg dose.
Analysis of plasma metabolites at progressive time points and liver metabolites at the terminal time
point helped to identify key biochemical changes occurring as a result of GSK932121A treatment.
Most notable was the increase in liver glycogenolysis, FA import and oxidative stress alongside
impairment of amino acid catabolism and FA β-oxidation. These data suggest altered cell metabolism
of all available substrates with continued metabolic efforts to feed carbon sources into the TCA cycle
for generation of reducing equivalents, alongside substantial hepatic ROS production. Globally the
metabolomics data shows a degree of similarity to the metabolomics signature of metabolic syndrome
/ hepatic insulin resistance and of human-clinical mitochondrial diseases. This opens up the
possibility of a generalised metabolomic footprint of mitochondrial dysfunction although this requires
further investigation.
In future studies it remains important to take tissue samples at early time points in order to identify any
early biochemical / mitochondrial functional changes occurring at the tissue level. Validation work is also
required to assess the utility of measuring metabolomic markers (e.g. acylcarnitines or ketone bodies) as
biomarkers of mitochondrial dysfunction in vivo.
123
5.0. INTEGRATION OF GSK932121A DATA INTO AN
AOP/MOA
124
5.1. Introduction – AOP/MOA of GSK932121A Toxicity
The aim of this thesis was to use a systems approach to improve current understanding of the mechanisms
of DIMT. In essence, I attempted to devise AOP’s in order to detail the key events leading from the
molecular initiation event (MIE) to clinical toxicity. In any complex biological system there is however
more than one plausible pathway leading to an adverse outcome, which therefore complicates the task of
distinguishing key events from casual associated occurrences. This is especially pertinent within an
acutely stressed system where it is likely multiple biological mechanisms/pathways are involved, with
many events consequential as opposed to primary/causative. It is this multi-mechanism and multi-system
response which makes defining causation (according to Bradford Hill considerations) so difficult. For this
reason a hybrid AOP/MOA approach was taken to detail the integrated learning’s from chapters 3 and 4
with regard to the acute toxicity caused by respiratory chain inhibitors (using both data from the literature
and data generated with GSK932121A in rats). Whilst small differences exist between an MOA and an
AOP (i.e. an AOP goes out to the population level whereas an MOA does not) a hybrid AOP/MOA
enables the description of both parameters.
When building a hybrid AOP/MOA it was important to distinguish between four categories of event (see
below, not including the MIE and adverse outcome). This approach takes into account the uncertainties
surrounding each stage of the toxicological response and enables the AOP/MOA to develop gradually,
from known key events to events which are merely associated…
Key events (including the molecular initiating event if known): There should be good evidence that
these are causally related and necessary for the adverse outcome. A key event is an empirically
observable step or marker which is a necessary element of the MOA and is critical to the outcome.
Key events are measurable and reproducible.
Possible key events (PKE): Those events which are plausible but for which there is not yet clear
evidence.
Modifying factors: These can affect the progression or magnitude of a key event but are themselves
not essential for the outcome to occur.
Associated events: Processes occurring in parallel with the key events, but not involved in the
outcome.
There is likely to be little utility in generating single-compound AOP’s unless in-depth investigations are
required on a single compounds mechanism of action (i.e. if there is a late stage drug development issue).
125
It is therefore important to ensure data generated with GSK932121A is incorporated into a generalised
AOP for complex III inhibition taking into account data from the literature. Taking this into
consideration, key events (detailed in section 5.2) and possible key events (detailed in section 5.3) contain
occurrences which are not necessarily specific to GSK932121A but are characteristic of complex III
inhibition in general. Associated events (detailed in section 5.4) will then incorporate additional
observations made specifically with GSK932121A which require further analysis.
I will therefore start by identifying just the key events known to be causal in the toxicological response to
complex III inhibition (see Fig.5.1. below). The AOP/MOA will then be assembled based on possible key
events (PKE) and associated events with the uncertainties at each level discussed.
126
5.2. Key Events: Complex III Inhibition
FIGURE 5.1.: Key events in the AOP/MOA for complex III inhibition. Detailed are the key events (labelled 1-4) which are
observed downstream of the molecular initiating event (MIE) i.e. GSK932121A binding to the Qi site of cytochrome bc1 complex, to the adverse outcome (AO) in rats (moribund state/hypothermia).
The key events described in the above pathway clearly do not capture the complexity of the full response
to respiratory chain inhibition in vivo. To be considered key events however, observations must be
measurable, casually related (to each other and the outcome) and required for progression of the AOP.
Table 5.1 below, details the experimental evidence or literature support which confirms the occurrence of
Reduction in OXPHOS-dependent mitochondrial ATP
production and OCR
Molecular Initiating Event Inhibition of Cytochrome bc1 activity – Binding
to Qi site of complex III
Metabolic Acidosis
Increased systemic lactate and
reduced blood bicarbonate / pH
Animals Moribund
Reluctance to move, hypothermia and hunched posture
Increased hepatic glycolysis
Increase in non-mitochondrial energy production via
glycolysis. Reduction in cellular glycogen
1- MIE
2
3
AO
4
127
the key events (1-4, as labelled in Fig.5.1 above), and the plausibility for the relationship between the key
events, including any remaining uncertainty.
TABLE 5.1: Experimental and literature evidence of key events in the complex III AOP/MOA including the plausibility
of the relationships between the key events and remaining uncertainties at each stage. Key events are labelled 1-4 (and AO) according to the numbering in Fig.5.1 above.
KE Experimental evidence Literature support Key event relationship plausibility and uncertainties
1 -
MIE
Covalent binding of
GSK932121A to the Qi
binding site of the
cytochrome Bc1 subunit.
Proven in X-ray
crystallography study [189].
1-2+3: Literature and data suggests that inhibition of
cytochrome bc1 activity causes ATP depletion and a
metabolic switch to glycolysis due to inhibition of
OXPHOS.
1-AO: Reduction in ETC activity provokes loss of
temperature due to decreased metabolic rate.
Uncertainty – It is uncertain whether GSK932121A causes
reduction in mitochondrial oxygen consumption and ATP
production. It is likely this energy deficit promotes the
relationship to 2 and 4, rather than the MIE itself.
2 None Primary event following
respiratory chain perturbation is
a reduction in mitochondrial
oxygen consumption and a
reduction in mitochondrial ATP
synthesis following antimycin
A and myxothiazol treatment
[190]. This effect was also seen
using rotenone and cyanide
[191].
Difficulty in assessing and quantifying mitochondrial ATP
in vivo. To date no evidence of ATP depletion observed
however this may be as yields are supplemented by
glycolytic substrate level phosphorylation.
There is however strong evidence in the literature
supporting its inclusion as a key event and reduction in
OXPHOS activity (ATP and OCR output) is known to
cause a switch in metabolism to glycolysis (key event 3).
3 Reduction in liver
glycogen (TEM),
metabolomics evidence
of glycogenolysis,
transcriptomic evidence
of a liver fasted state.
Much evidence supporting
switch in energy production
[192]
3-4: Uncertainty – Lactate originating from other (non-
hepatic) organs and tissues such as the skeletal muscle?
Lactate likely being consumed by the liver for
gluconeogenesis via the Cori cycle?
4 Increase in blood lactate Clinical evidence of lactic
acidosis from mitochondrial
toxicants [193].
4-AO: Lactic acidosis widely acknowledged as a key event
in the progression of a mitochondrially toxic event and a
poor prognosis [194].
AO Severe and rapid onset
hypothermia observed in
vivo alongside other
clinical signs (e.g.
hunched posture,
reluctance to move etc).
Hypothermia noted
downstream of other
respiratory chain inhibitors
such as 3-nitropropionic acid
[150].
4-5: Hypothermia widely acknowledged as a key event in
the progression of sepsis like toxicity [163, 195]. Reduced
metabolic rate and temperature related effects on enzymatic
function.
Uncertainty - Is this of hepatic origin (liver is a key
thermoregulatory organ in rat) and is this a local event in
the short-term?
128
5.3. Possible Key Events: Complex III Inhibition
By adopting a hybrid “weight of evidence” based AOP/MOA approach it prevents the need to try and fit
all endpoints into a single AOP. This is beneficial as some pathways may be occurring in parallel and are
responsive as opposed to progressive (and as such do not fit the criteria as key events). These PKEs may
be important in terms of detection for risk assessment purposes or for understanding the adaptation to
mitochondrial perturbation but not enough evidence currently exists to definitively relate them to each
other or the adverse outcome.
It is important to acknowledge that the below possible key events are supported by data in the literature
using other tool complex III inhibitors (e.g. myxothiazol and antimycin A). This is especially important
as within any given in vivo study it is not always possible to measure every step in the progression of a
toxicological outcome. To date our knowledge is restricted to two studies and therefore gaps in our
understanding remain. Furthermore, it was intended to generate a hybrid AOP/MOA for complex III
inhibition and not GSK932121A toxicity which therefore requires additional data from other compounds
with similar in vitro activities.
Detailed below, in the same AOP as the key events were portrayed, are the observations where
experimental data or strong biological fundamentals suggest they are possibly important to the
progression of the AOP but there is not yet sufficient evidence to classify them as key events (Fig.5.2).
129
FIGURE 5.2: PKE’s in the AOP for complex III inhibition. Insufficient evidence currently exists to definitively include the
PKE’s (black text and lettered a-d) as key events (red text).
The events shown in black in Fig.5.2 above are categorised as PKE’s as not enough sufficient evidence
currently exists to definitely conclude they are essential to the progression of the AOP/MOA (i.e. unclear
whether they are casually related or whether they are a requirement in the progress of a toxicological
response towards an adverse event). These events are however generally considered in the literature
Molecular Initiating Event Inhibition of Cytochrome bc1 activity- Binding to
Qi site of complex III
Metabolic Acidosis
Increased systemic lactate and
reduced blood bicarbonate / pH
Animals moribund
Reluctance to move, hypothermia and hunched posture
Reduction in OXPHOS-dependent
mitochondrial ATP production and OCR
Increased oxidative stress
(reduced GSH / increased
GSSG)
Mitochondrial
structural damage
(e.g. swelling) and
mitochondrial
degeneration
(mitophagy)
Deep abdominal
breathing
(shortness of
breath)
(d)
(c)
(b)
(a)
AO
Increased blood
O2 / reduction
in Blood CO2 –
Inability to use
available O2
Increased hepatic glycolysis
Increase in non-mitochondrial
energy production via glycolysis
Reduction in cellular glycogen
130
and/or demonstrated downstream of GSK932121A to be potentially key to the AOP for complex III
inhibition although further studies are required in order to generate a weight-of-evidence for re-
categorisation as key events. Detailed in table 5.2 below, is both the evidence of their involvement in the
AOP/MOA for drug-induced respiratory chain inhibition and the remaining uncertainties at each stage.
PKE Evidence Uncertainty
a Blood gas data with 50mg/kg GSK932121A
demonstrates an increase in plasma 02 and
reduction in plasma CO2 compared to VC.
High level of certainty that this observation is due to
reduction in mitochondrial oxygen consumption. This
observation is however under-reported in the literature and as
such further work is required to assess whether this is
common to other complex III inhibitors.
b Experimental - Principle clinical observation with
the 50mg/kg dose was deep abdominal breathing /
respiratory depression at 4-5 hours post-treatment.
Literature evidence of hypoventilation and
respiratory depression in vivo with patients
suffering cyanide poisoning (cyanide is an ETC
inhibitor – complex iv) [196].
Patients with some degree of acidosis (key event 3) usually
increase breathing rate, however this is a compensatory effect
of increased blood CO2 which is not observed in the present
study.
Breathing rate could be as a result of temperature effects as
opposed to blood gas findings.
c Increase in oxidative stress marker cysteine
glutathione disulphide with low dose of
GSK932121A. Over time oxidative stress
overwhelms antioxidant response = Increase in
GSSG and reduction in reduced GSH.
Literature evidence of ROS generation following
respiratory chain inhibition [197].
High level of certainty that ROS generation is primary to the
MIE however uncertain what effect oxidative stress has in
downstream events i.e. lipid oxidation and DNA damage?
d Evidence of mitochondrial swelling and
degeneration at 50mg/kg GSK932121A at a
terminal time point. Mitochondria were often seen
engulfed within phagosomes.
Likely to be due to a combination of factors (i.e. ATP
depletion, drug binding) and not just caused by ROS.
Unsure whether key to the adverse outcome or just an
associated event?
TABLE 5.2: Evidence for, and remaining uncertainty surrounding, PKE’s in the AOP/MOA of complex III inhibition. PKE’s are labelled a-d according to the lettering shown in Fig.5.2 above.
131
5.4. Associated Events
Further to both the key events shown in Fig.5.1 and the PKE’s shown in Fig.5.2 are a number of
associated events which are likely occurring in parallel to the AOP, however are not likely essential to the
progression toward the adverse effect. Please note that the associated events described below are more
specific to the effects observed with GSK932121A and overlays the AOP/MOA developed in sections 5.2
and 5.3 above.
In the acute toxicological scenario the associated events are generally consequential adaptations, cellular
responses to the key events or mitochondrial effects where uncertainty remains (i.e. with regard to the
direction of change). These events may be extremely important in terms of chronic adaption to respiratory
chain inhibition however are not key to the AOP in an acute scenario. Associated events which have been
identified and their relationship to the key events and PKE’s are shown in Fig.5.3 and are briefly
described below.
132
Key events, Possible Key Events and Associated Events
FIGURE 5.3: Hybrid AOP/MOA including key events, possible key events and associated events in the toxicological
progression of complex III inhibition related toxicity. Key events (red), PKE’s (black) and associated events
(blue) are shown in order to detail the observable series of events leading from complex III inhibition to the adverse outcome (AO).
PGC1α-Foxo1 co-ordination
of gluconeogenesis via
activation of transcription
(e.g. Pck1, Irs2, Pdk4)
Increased FA import (increased
acylcarnitines / reduction in free
carnitine) and Impaired β-
oxidation
Ketogenesis
Impaired amino acid catabolism
(increase in BCAA)
De-sensitization of mPTP
(delayed triggering)
Unexpected increase in
basal OCR in isolated
mitochondria?
Continued metabolic activity to
generate reducing equivalents for
oxidative metabolism
Reduction in maximal
respiration (max
uncoupled OCR)
Animals moribund
Reluctance to move and hunched posture
Molecular Initiating Event Inhibition of Cytochrome bc1 activity – Binding to Qi site of
complex III
Increase hepatic glycolysis
Increase in non-mitochondrial energy
production via glycolysis
Reduction in cellular glycogen/glucose
Metabolic acidosis
Increased circulating lactate and reduced
blood bicarbonate / pH
Reduction in OXPHOS-dependent
mitochondrial ATP production and OCR
Increased oxidative stress
(Reduced GSH / Increased GSSG)
Mitochondrial structural
damage (e.g. swelling)
and mitochondrial
degeneration
(mitophagy)
Immune Response
Deep abdominal
breathing (shortness of
breath)
Increased blood O2 /
Reduction in blood CO2
Inability to use available 02
133
Unexpected increase in basal OCR in isolated mitochondria: An increase in basal OCR was observed
in isolated mitochondria from GSK932121A treated rats. This is in contrast to data in vitro (both HepG2
cells and control isolated mitochondria treatment) and the cause remains unknown (hypotheses described
in section 3.3). Whilst seemingly contradictory, these differences likely reflect an adapted state in vivo
resulting from the initial insult in combination with compensatory changes made by the tissue to maintain
energy production. Only the initial, unconfounded, response is observable in vitro. The increase was
however shown at a 4 hour time point with both 12.5mg/kg and 50mg/kg GSK932121A and as such is a
dose-dependent and sub-toxic marker of complex III inhibitory toxicity. All in vivo observations however
suggest that GSK932121A does cause a reduction in mitochondrial OCR/ATP synthesis in vivo (i.e.
blood gas findings, body temperature reduction etc). Increase in basal OCR in isolated mitochondria can
therefore only be labelled an associated event as the mechanisms remain unclear and it likely does not
represent what is occurring in vivo.
PGC1α-Foxo1 co-ordination of gluconeogenesis via activation of transcription (e.g. Pck1, Irs2,
Pdk4): Increased levels of both PGC1α and Foxo1 alongside their downstream effectors Pck1, Irs2 and
Pdk4 was observed in the liver of GSK932121A treated rats. These genes function to induce
gluconeogenesis, the process of generating glucose from non-carbohydrate sources. This process is
unlikely to be related to the adverse event as it is a consequence of drug-induced glycogenolysis and low
liver glucose levels. Gluconeogenesis is likely activated to increase levels of substrate and therefore does
not constitute a toxicologically progressive event.
Desensitisation / delayed triggering of mPTP: A dose dependent effect of GSK932121A was observed
on the triggering of the mPTP in isolated mitochondria. This has been attributed to the acidification of the
liver due to increased levels of glycolysis (a result of the metabolic switch to glycolysis). It has been
widely documented that a pH below 7 can inhibit the action of the mPTP [161]. Inhibiting the mPTP is
however generally a cyto-protective / anti-apoptotic effect and as such is likely a protective response and
not key to the progression towards the adverse effect. Furthermore, and similarly to the increase in basal
OCR described above, this observation was in contrast to in vitro observations and therefore enough
uncertainty exists to classify this as an associated event.
Reduction in maximal respiration rate (maximal OCR): An effect seen with 50mg/kg GSK932121A
was a reduction in the ability of the ETC to maximally increase activity (OCR) following dissipation of
mitochondrial ΔΨ. This data suggests that mitochondria may be unable to increase the activity of the ETC
should ATP be required beyond that which is produced at a basal level. This may be a key event in the
134
pathway towards the adverse outcome of GSK932121A-toxicity but to date it is unknown whether it is a
requirement for the adverse event to take place and how reduced maximal respiration manifests. It also
remains unclear how the reduction in maximal respiratory rate relates to overall ATP levels and whether
this is observed in vivo (as opposed to just in isolated mitochondria from treated animals). Its lack of any
downstream connection justifies its inclusion as an associated event as further data is required.
Continued metabolic activity to generate reducing equivalents for oxidative metabolism (increased
FA import, impaired β-oxidation, Ketogenesis, impaired amino acid catabolism): Metabolomics data
presented in chapter 4 has identified that cells and tissues (specifically hepatocytes) continue to drive cell
metabolism relating to amino acid catabolism and FA oxidation in order to generate reducing equivalents
for oxidative metabolism (despite acute respiratory failure). This is a cellular response to the reduction in
mitochondrial ATP production and likely has little impact on the progression of the toxicological
response towards the adverse outcome. Specific metabolites essential to these processes may however
prove useful biomarkers of respiratory chain dysfunction (e.g. acylcarnitines, ketone bodies or α-
hydroxybutyrate).
This exercise has highlighted that GSK932121A-related reduction in mitochondrial ATP synthesis and
oxygen consumption is absolutely central to the AOP/MOA. However it remains only a PKE due to the
present lack of experimental evidence. It is pivotal that future experiments focus on the effect of complex
III inhibition on ATP levels in vivo. This is not a trivial measurement however and to date investigation
into the effect of GSK932121A on high energy phosphate levels in vivo has been attempted using both
magnetic resonance spectroscopy (MRS) and high-performance liquid chromatography (HLPC) with
limited success. Furthermore, it is important that measurements are specific to mitochondrial ATP as it is
hypothesised that global high energy phosphates may be unaffected due to glycolytic compensation.
Immune response: Evidence for the activation of the immune system following GSK932121A treatment
is substantiated by data in the literature which shows that the inflammatory response is involved in the
toxic response to respiratory chain inhibitors in general. Experimentally, transcriptional up regulation of
genes involved in the control of inflammation both pro- and anti-inflammatory (IL-10, IL-6, Acute Phase
Protein Response) was observed in chapter 3. In addition, the literature reports a link between ROS
generation and immune response [198] and between immunostimulation and onset of acute toxicity [199].
It is however currently unknown whether transcriptional activation of immune response genes is
representative of increased protein levels (i.e. of cytokines, white blood cells, chemokine’s etc).
135
5.5. Modifying Factors
It is important to also acknowledge the involvement of modifying factors in the AOP/MOA of
GSK932121A toxicity. A modifying factor is an event which can affect the magnitude or progression of a
key event but is not itself essential to the adverse outcome. In the acute scenario differentiating modifying
factors from other events is extremely challenging as the rapid deterioration in health of the animals gives
only a narrow window to identify which endpoints constitute key events, associated events, modifying
factors etc. Furthermore modifying factors could easily be mistaken for key events as inherently, anything
which affects the magnitude of toxicity is clearly extremely important in terms of a toxicological
response. The real difficulty is determining whether they are essential to the outcome i.e. does the adverse
outcome still occur in the absence of the modifying factor? Does the adverse outcome manifest earlier or
with an increased level of severity when the modifying factor is present?
From close examination of the above AOP/MOA (Fig.5.1-5.3) it could be postulated that the immune
response for example, may be considered a modifying factor. Despite clear evidence which suggests the
involvement of immunostimulation in adverse clinical reactions, it is likely that impaired energy
metabolism would provoke the adverse outcome in the absence of the immune response. Importantly for
classification as a modifying factor, it is likely that the involvement of the immune response (i.e. pro-
inflammatory response, cytokine storm etc.) may increase the magnitude of the adverse effect but is likely
not a pre-requisite for the clinical manifestation of GSK932121A toxicity.
Further work clearly needs to focus on how events interact within the AOP to effect either progression or
magnitude as clearly not enough evidence currently exists in order to unequivocally identify modifying
factors in the AOP of GSK932121A toxicity.
5.6. AOP/MOA of Respiratory Chain Inhibitors
When attempting to assemble an AOP/MOA for a novel compound, an informative exercise is to assess
the similarity of the observations made to other compounds with similar mechanistic activities. The
difficulty in terms of GSK932121A is the paucity of data in the literature which describe the toxicological
effects of other respiratory chain inhibitors, at the toxic level, in vivo. Despite being unspecific to the
cytochrome bc1 complex the toxicological effect of compounds which inhibit the activity of other
respiratory chain complexes are likely to be similar. It is for this reason that the key comparator discussed
below is the complex IV inhibitor cyanide. The toxicity of the classical inhibitors used experimentally to
136
study the mitochondrial respiratory chain (i.e. antimycin A and rotenone) has yet to be fully examined in
vivo. Having said this, numerous in vitro studies have suggested that treatment with antimycin A causes a
collapse in ΔΨ, ATP depletion and increase ROS production [200]. One in vivo study which was specific
for complex III was with myxothiazol, however at the exposures tested the drug was well tolerated in
mice[201].
Like GSK932121A, the anti-androgen medication and inhibitor of mitochondrial complex I, nilutamide,
caused an inhibition of FA oxidation, however this was observed in isolated hepatocytes. In the same
study nilutamide also caused ATP depletion and early onset cytotoxicity which was not observed when
treated alongside glucose. This data suggests that, like with GSK932121A, the action of glycolysis in
maintaining ATP levels is a pivotal event downstream of treatment with nilutamide [202]. Furthermore,
nilutamide toxicity has been attributed to an increase in mitochondrial superoxide production and
oxidative stress [203].
Cyanide is an extremely toxic respiratory chain complex IV (cytochrome oxidase) inhibitor found in fire
and cigarette smoke but has also been used as a suicide/terrorist agent due to its potency. Like
GSK932121A, the mechanism of cyanide toxicity is based on chemical asphyxiation via effective oxygen
deprivation (i.e. inability of cells to use oxygen) and loss of cellular ATP [148]. Manifestations of cyanide
toxicity are similar to those of GSK932121A and include respiratory depression, increased blood
oxygenation, lactic acidosis and metabolic acidosis characterized by a pH of <7 and a reduction in
circulating bicarbonate levels [196]. Furthermore metabolomics studies identified an acute effect of
cyanide on bile acid metabolism and as such, and considering the potent effect of GSK932121A on liver
function, this should be explored in future studies with GSK932121A [204].
From undertaking this review it appears that the toxicological response to GSK932121A is comparable to
that of other respiratory chain inhibitors (independent of the site of inhibition). Clearly further work is
however required. Future experiments should aim to assess the toxicity of more respiratory chain
inhibitors in order to both validate the AOP/MOA and increase the confidence surrounding the
relationships between key events and the adverse outcome.
5.7. Summary
In this chapter I have attempted to create a hybrid AOP/MOA for complex III inhibition, which details the
toxicological series of events occurring between the MIE (drug binding to the Qi site of the cytochrome
137
bc1 complex) and the adverse effect (animals moribund/hypothermia). Key events and PKE’s detailed in
section 5.2 and 5.3 respectively identified the main mechanism-dependent effects anchoring the MIE to
the adverse outcome for complex III inhibition. The associated events in section 5.4 adds further
mechanistic details regarding compensatory/adaptive effects of GSK932121A which requires further
investigation (including analysis post-treatment with tool respiratory chain inhibitors) in order to
understand how they fit within the complex III inhibition AOP. In essence, further work is required in
order to validate the proposed AOP/MOA with other compounds which inhibit the mitochondrial
respiratory chain. With regard to GSK932121A, it is important to take tissue samples at early time points
in order to identify any early biochemical / mitochondrial functional changes occurring at the tissue level.
Validation work is also required to assess the utility of measuring metabolomic markers (e.g.
acylcarnitines or ketone bodies) as biomarkers of mitochondrial dysfunction in vivo.
Following on from this comprehensive “systems” based analysis of DIMT (related to respiratory chain
inhibition) it was decided to perform similar systems-based analyses of the toxicological effects of a
compound with OXPHOS uncoupling activity in vitro and in vivo. This analysis is detailed in chapter 6.
138
6.0. MECHANISM OF DIMT – GSK2617971A INDUCED
UNCOUPLING OF OXPHOS
139
6.1. Introduction
Uncouplers of OXPHOS inhibit the coupling between the mitochondrial ETC and ATP synthesis, by
dissipation of the proton gradient between the IMM and the matrix. Uncouplers (reviewed in section
1.5.1) cause protons to bypass the F0F1 subunit of ATP-synthase, causing the collapse of mitochondrial
ΔΨ and the production of heat [205, 206].
Generally, OXPHOS uncouplers collapse both the pH gradient and electrochemical potential across the
IMM, thereby stimulating substrate oxidation and oxygen consumption [27]. Classically, uncouplers often
represent weak, hydrophobic, organic acids [207]. Furthermore, NSAIDs often have this biochemical
characteristic, with many NSAIDs (such as diflunisal, mefenamic acid and flufenamic acid),
demonstrating uncoupling activity albeit it with low potency (i.e. doses which are unlikely to be clinically
relevant) [208, 209].
The risks associated with compounds that uncouple mitochondria are significant. 2,4-DNP is a classic
example. Used in the 1930’s as a weight loss drug, numerous 2,4-DNP associated side effects were
recognised and it was eventually withdrawn from the market [5]. Although not licensed as a drug, 2,4-
DNP is still misused as a fat burning agent, and numerous fatalities are still attributed to dinitrophenol
poisoning per year [66]. DNP’s potent effects underscore the potential risks associated with mitochondrial
uncoupling agents and emphasises the importance of understanding and assessing the risk of DIMT pre-
clinically.
As described in section 1.9.2, GSK2617971A is a pyrazole compound which was designed as a selective
androgen receptor modulator (SARM) for the treatment of cachexia (muscle wastage). GSK2617971A
has shown potent uncoupling activity in vitro and is acutely toxic in vivo when dosed at 60mg/kg.
GSK2617971A was terminated early in development following observations of adverse toxicity in pre-
clinical studies. Since GSK2617971A’s termination from development, it has been used as a tool
molecule for the study of DIMT. As molecules with some degree of OXPHOS uncoupling activity are
regularly observed during preclinical assessment of compounds for mitochondrial activity, it was
considered valuable to gain further understanding of its mechanism of toxicity in vivo, in order to better
inform discovery groups of the potential safety liability of this class of mitochondrial toxicant.
140
6.1.1. CHAPTER AIMS
The experimental aims of this chapter were…
1. To assess the toxicological profile of GSK2617971, in order to better understand the downstream
toxicological consequences of OXPHOS uncoupling in vivo and build an AOP/MOA of OXPHOS
uncoupling.
2. To further current understanding of how in vivo outcomes relate to data generated using ex vivo /
in vitro methods with molecules which uncouple mitochondrial respiration.
3. To identify endpoints which most sensitively detect the effect of OXPHOS uncoupling agents for
future studies involving compounds with this potential mechanism of action. It was especially
hoped to identify markers of mitochondrial dysfunction at sub-toxic doses of GSK2617971A.
6.2. Results
6.2.1. CONFIRMATION OF THE UNCOUPLING ACTIVITY OF GSK2617971A
In order to assess the uncoupling activity of GSK2617971A, isolated liver mitochondria from control rats
were directly exposed to increasing concentrations of the drug and basal OCR was assessed. The response
was compared to that with 2,4-DNP (selected as the comparator due to its history of adverse clinical
toxicity associated with OXPHOS uncoupling) in order to gauge the relative potency of GSK2617971A.
Uncoupling of OXPHOS generally causes an increase in OCR as the activity of the ETC increases due to
the drop in charge difference across the IMM, i.e. it attempts to compensate for the collapse in ΔΨ caused
by the uncoupler.
Isolated liver mitochondria from naïve male Crl:Wi (Han) rats (12-14 weeks of age) were separately
exposed to increasing concentrations of both GSK2617971A and 2,4-DNP following which, OCR was
measured using the Seahorse XF24 analyser (Fig.6.1A). The experiment was repeated on three occasions.
GSK2617971A induced a biphasic and dose-dependent increase in OCR with the peak response occurring
at 1µM that led to a 1000% increase in OCR compared to DMSO control (although the low dose of
0.01µM GSK2617971A also induced an average increase in OCR of over 150% compared to the DMSO
control). The uncoupling effect of GSK2617971A on isolated liver mitochondria was insensitive to
141
oligomycin, indicating compound-induced dissipation of the proton gradient following ATP-synthase
inhibition (Fig.6.1B). Uncoupling activity is often observed in a biphasic (bell shaped) dose response as at
high doses uncoupling agents can become toxic to the respiratory chain and ETC activity becomes
inhibited [210]. There is however contradictory reports in the literature as the inhibition of ETC activity at
high doses of uncoupler could be due to “non-specific toxicity” caused by binding to the IMM thus
inhibiting electron flow [295], or due to decreased substrate availability to drive respiration [296]. These
hypotheses are however in the whole cell scenario and therefore further investigations are required to
understand the kinetics of this dose-response relationship with uncoupling agents within isolated
mitochondria.
142
FIGURE 6.1: Comparison of the OXPHOS uncoupling activity of GSK2617971A to 2,4-DNP in control isolated liver
mitochondria. (A) Freshly isolated liver mitochondria from naive Crl:Wi (Han) rats were exposed to increasing
concentrations of GSK2617971A (0.001-100µM) or 2,4-DNP (0.1-100µM) and basal OCR was analysed. Data
was compared to basal OCR readings from a 0.5% DMSO control and is expressed as a percentage of this
control (mean ± SD, n=3). GSK2617971A (grey bars) induced a biphasic uncoupling of OXPHOS with peak
uncoupling activity stimulated at 1µM. 2,4-DNP (black bars) caused a significant increase in OCR at 50-100µM
(concentration of 0.01µM not tested). (B) Representative OCR trace showing the acute uncoupling effect of
GSK2617971A following ex vivo treatment of control isolated liver mitochondria. GSK2617971A (doses up to
5µM shown for clarity) caused a dose dependent and biphasic uncoupling effect compared to a 0.1% DMSO control (grey line), mean ± SD data is shown (n=3).
Taking into account the concentrations tested, GSK2617971A induced maximal respiration with
significantly higher potency than 2,4-DNP (over three orders of magnitude). Following these
observations, GSK2617971A was profiled in the CRC assay to assess direct impact on mPTP function
and calcium retention. The concentration range of GSK2617971A was modified based on the high
potency observed in terms of OCR, and a six point dose response (0.02-2µM) was assessed.
T im e (m in s )
OC
R (
pm
ols
/min
)
0 5 1 0 1 5 2 0 2 5 3 0 3 5
0
5 0 0
1 0 0 0
1 5 0 0
2 0 0 0
0 .01 M G S K 26 17 97 1A
0 .1 M G S K 26 17 97 1A
1 M G S K 26 17 97 1A
5 M G S K 26 17 97 1A
0 .1 % D M S O
A D P O ligom ycin
F C C P
A ntim ycin
A
A
B
143
Calcium Retention Capacity
GSK2617971A reduced the CRC in liver mitochondria from untreated animals in a concentration
dependent manner with an IC50 of 0.16μM (Fig.6.2). The reduction in CRC observed was strongly dose-
dependent in the concentration range assessed (R2:0.9918). The classical uncoupler 2,4-DNP also reduced
the CRC of control isolated liver mitochondria although only at doses above 10µM (IC50=46.7µM). In
terms of the dose required to inhibit CRC to 50% of that achieved by the 0.5% DMSO control,
GSK2617971A was 292-fold more potent than 2,4-DNP.
FIGURE 6.2: Assessment of the mitochondrial CRC following in vitro treatment of control liver mitochondria with
GSK2617971A and 2,4-DNP. Freshly isolated liver mitochondria from male control Crl:Wi (Han) rats were
treated in vitro with GSK2617971A (0.02-2µM) and 2,4-DNP (0.1-100µM) in order to assess the potency of the
drugs on succinate-driven CRC (ΔOD upon addition of succinate and undergoing MPT expressed as percentage
of DMSO control). [GSK2617971A IC50 =0.16µM, = R2: 0.9918]. [2,4-DNP IC50=46.7, correlation= R2: 0.7012]. Data shown is mean only (n=3).
In summary, GSK2617971A is a potent uncoupler of OXPHOS. A concentration of 1µM causes the
largest increase in OCR in control isolated liver mitochondria although substantial effects are noted down
to 0.01µM. GSK2617971A reduces the CRC of control isolated liver mitochondria in vitro down to
0.05µM (IC50: 0.16µM) in a strongly dose dependent manner. Both observations are evidence of the
substantial uncoupling capacity of the molecule. The observed responses show that GSK2617971A is
significantly more potent than the classical uncoupler, 2,4-DNP.
144
Following confirmation of GSK2617971A’s uncoupling activity, GSK2617971A was administered to
male Crl:Wi (Han) rats in order to assess the effect of OXPHOS uncoupling in vivo.
6.2.2. ACUTE DOSE IN VIVO STUDY WITH GSK2617971A – NON MITOCHONDRIAL
ENDPOINTS
Male Crl:Wi (Han) rats were dosed (via the oral route) with either 30mg/kg GSK2617971A (n=2),
60mg/kg GSK2617971A (n=6) or vehicle alone (n=8) for a period of four hours (as described in section
2.1.2 and 2.3.2). Doses of 30mg/kg and 60mg/kg GSK2617971A were selected based on data generated
in previous GSK2617971A single-dose tolerability studies where dose-limiting clinical signs were noted
in a proportion of animals dosed with 60mg/kg GSK2617971A at approximately 5 hours post-dose and
30mg/kg appeared well tolerated. The aim of the investigation was to follow-up on the acute toxicity
noted with the 60mg/kg dose and investigate any underlying functional effects in the well-tolerated
30mg/kg animals. Four hours was selected as the time point in order to induce the desired mitochondrial
effects whilst minimising in-life effects.
Clinical Signs
All animals given 60mg/kg GSK2617971A showed clinical signs between 2-4 hours post dose which
included slight to moderate piloerection, subdued behaviour, salivation and partially closed eyes.
Although not quantifiable, there appeared to be a strong correlation between the severity of clinical
observations at the time of necropsy, and the plasma concentration of GSK2617971A. Rapid increase in
body temperature was noted in all animals treated with 60mg/kg approximately 1.5 hours post dose with
body temperature continuing to rise by 2.68°C on average by 4 hours post dose. No increase in body
temperature or clinical signs were observed in the two animals dosed with 30mg/kg GSK2617971A up to
4 hours. Similar to observations made in chapter 3 (relating to decline in body temperature following
exposure to GSK932121A), the peak increase in body temperature following GSK2617971A
administration was closely associated with the terminal plasma concentration of GSK2617971A (R2
=
0.8198) (Fig.6.3) and the two animals at 30mg/kg that did not show an elevated body temperature had
lower plasma concentrations of GSK2617971A.
145
FIGURE 6.3: Relationship between core body temperature and plasma GSK2617971A concentration. The relationship is
shown between increase in core body temperature (expressed as increase in body temperature compared to a
pre-dose measurement) post treatment with GSK2617971A and plasma drug concentration. Two circled data-
points correspond to animals treated with 30mg/kg dose (n=2) where no significant increase in body
temperature was observed (<0.5°C increase). 60mg/kg (n=6) corresponds to un-circled data points (one animal
not displayed due to being found moribund – no sample available for concentration analysis). (R2=0.8198, p<0.001)
Lactate: Pyruvate
A significant increase in lactate:pyruvate ratio was observed in whole blood of animals given 60mg/kg
GSK2617971A compared to blood from VC animals (p<0.01**) (Fig.6.4). GSK2617971A, dosed at
60mg/kg, caused a 135.3% increase in lactate:pyruvate ratio which is indicative of increased glycolytic
metabolism. No effect on lactate or pyruvate was noted in animals dosed at 30mg/kg GSK2617971A
which, when taken into consideration with the lack of clinical signs/body temperature change, indicate
that 30mg/kg was a tolerated dose up to 4 hours in the present study.
146
V C 3 0 6 0
0
2 5
5 0
G S K 2 6 1 7 9 7 1 A D o s e (m g /k g )
La
cta
te:P
yr
uv
ate
Ra
tio
* *
N S
FIGURE 6.4: Effect of GSK2617971A treatment on blood lactate: pyruvate ratio compared to VC. Treatment of rats with
60mg/kg GSK2617971A causes an increase in lactate/pyruvate ratio (in whole blood) compared to VC blood
samples (p<0.01**, n=6, mean ± sd). No effect on lactate: pyruvate ratio was observed in animals treated with 30mg/kg GSK2617971A (n=2, mean ± range) compared to VC (p>0.05).
Changes to Mitochondrial Ultra-structure in the Kidney (TEM Analysis)
TEM was employed to assess the effect of OXPHOS uncoupling on mitochondrial ultra-structure and
general cell architecture. Small block sections of liver (median lobe) and kidney (cortex) tissue were fixed
in 4% formaldehyde/1% glutaraldehyde, although adverse fixation artefacts prevented the reading of liver
micrographs.
Treatment related effects were observed in kidney cortex tubular epithelial cells (Fig.6.5). Minimal to
mild mitochondrial swelling and increased lysosomal activity/residual bodies, many of which contained
mitochondrial-fragments (suggesting induction of mitophagy) were observed in 60mg/kg GSK2617971A
treated animals in comparison to VC (arrowed). Furthermore, disorganisation of the congregated
mitochondrial networks was noted and this is especially visible when comparing Fig.6.5B with Fig.6.5D.
No ultra-structural effects were observed in animals treated with 30mg/kg GSK2617971A (images not
shown).
147
FIGURE 6.5: TEM analysis of kidney sections of rats treated with 60mg/kg GSK2617971A and VC. Panels A and B
(10,000x & 25,000x magnification, respectively) show mitochondria from VC animal, with intact membrane
structure and normal histology. Note the orderly arrangement of mitochondria within the tubular epithelium.
Panels C and D (10,000x & 15,000x magnification, respectively) show mitochondria from GSK2617971A
treated animals (60mg/kg) which appear mildly swollen. Increased lysosomal activity is also observed in these
treated animals, highlighted by an increase in the number of residual bodies (depicted by red arrows). Disorganisation of mitochondrial networks / arrangement is also visible in treated sections.
6.2.3. ACUTE DOSE IN VIVO STUDY WITH GSK2617971A – MITOCHONDRIAL ENDPOINTS
Following administration of GSK2617971A (30mg/kg and 60mg/kg) or VC to Crl:Wi (Han) rats,
mitochondrial fractions were isolated from the left lateral liver lobe and left kidney using methods
described in section 2.8.1.
A B
C D
148
OCR Assessment (Seahorse Bioscience)
Mitochondria isolated from the liver and kidney of animals given 30mg/kg GSK2617971A showed no
significant change in OCR compared to VC (data not shown).
In contrast to the increase in OCR observed following treatment of mitochondria isolated from a naive rat
with GSK2617971A in vitro (Fig.6.1), mitochondria isolated from the kidney of rats treated in vivo with
GSK2617971A showed a reduction in basal OCR by an average of 27.1% compared to VC (Fig.6.6 A
and B). A significant reduction in OCR was further observed at state 3 (33.9% reduction), state 4 (25.8%
reduction) and maximal (state 3u) respiration (38.7% reduction).
No significant effect on OCR was observed in mitochondria isolated from the liver of GSK2617971A
(60mg/kg) treated rats compared to VC (Fig.6.6 C and D).
149
FIGURE 6.6: Analysis of kidney and liver mitochondrial bioenergetics using the Seahorse XF24 analyser following
treatment of rats with GSK2617971A in vivo. (A) Representative OCR data for mitochondria isolated from
the kidney of animals treated with GSK2617971A (grey line) or VC (black line). (B) GSK2617971A treatment
(grey bars) caused a reduction in basal, state 3, state 4o and state 3u respiration in the kidney compared with
VC (black bars). (C) Representative OCR data for mitochondria isolated from the liver of animals treated with
GSK2617971A (grey line) or VC (black line). (D) GSK2617971A had no effect on OCR at any respiratory state
in the liver compared to VC (p>0.05). Results shown are mean ± SD (GSK2617971A treated, n=6 and VC, n=8). *p<0.05, ** p<0.01, *** p<0.001.
The data shown in Fig.6.6 above was striking as mitochondrial uncouplers typically cause an increase in
OCR when treated directly (in vitro and ex vivo treatment) whereas mitochondria isolated from
OC
R (
pm
ols
/min
)
Ba sa
l R
e spir
a t ion
Sta
te 3
Sta
te 4
o
Sta
te 3
u
Anti
myc in
A
0
5 0 0
1 0 0 0
1 5 0 0
V e h ic le C o n t ro l
6 0 m g /k g G S K 2 6 1 7 9 7 1 A
* *
* * *
*
* *
5 1 0 1 5 2 0 2 5 3 0 3 5
0
2 5 0
5 0 0
7 5 0
1 0 0 0
1 2 5 0
1 5 0 0
V e h ic le C o n t ro l
6 0 m g /k g G S K 2 6 1 7 9 7 1 A
T im e (m in s )
OC
R (
pm
ols
/min
)
A D P O lig o m y c in
F C C P A n itm y c in A
T im e (m in s )
OC
R (
pm
ols
/min
)
5 1 0 1 5 2 0 2 5 3 0 3 5
0
5 0 0
1 0 0 0
1 5 0 0
2 0 0 0
2 5 0 0
A D P O lig o m y c in
F C C P
A n itm y c in
A
OC
R (
pm
ols
/min
)
Ba sa
l R
e spir
a t ion
Sta
te 3
Sta
te 4
o
Sta
te 3
u
Anti
myc in
A
0
1 0 0 0
2 0 0 0
3 0 0 0
A B
C D
150
GSK2617971A (liver and kidney) showed either no response or a reduction in OCR. One potential
hypothesis for this is that GSK2617971A may have been washed out of the mitochondrial preparations
during the isolation procedure and therefore had limited effects in these isolates. For this to be the case
however, we must assume that the effects of OXPHOS uncoupling on CRC and mitochondrial ΔΨ are
more persistent and are irreversible (or only very slowly reversible) upon removal of the drug. Though
further work is required, the data shown in Fig.6.7 confirms that the effect of GSK2617971A on OCR
(using Seahorse Bioscience technology) in vitro, can be reversed upon removal of the drug (i.e. the drug
and its effect can be “washed out”).
FIGURE 6.7: Reversibility of the uncoupling effect of GSK2617971A demonstrated in vitro in HepG2 cells. HepG2 cells
were exposed to increasing doses of GSK2617971A (0.1-10µM) and a biphasic dose response was observed on
basal OCR with a maximal respiratory rate noted at 1µM. Cells were then removed from the analyser, washed
with PBS and the medium was replaced with Seahorse XF assay medium minus GSK2617971A. Removal of
the compound reversed the uncoupling effect previously observed and no effect was observed in comparison with the 0.1% DMSO control. Data shown is mean ± SD (n=3).
Mitochondrial Membrane Potential
In order to further assess the effect of GSK2617971A on the ETC, mitochondrial ΔΨ was assessed using
JC-1 dye. This dye concentrates and aggregates in the mitochondrial matrix. Any event that dissipates the
ΔΨ (e.g. membrane damage or uncoupling) causes the dye to disperse out of the mitochondrial matrix and
form green fluorescent monomers. This change in fluorescence can be detected in a multi-plate format
fluorometrically.
151
A significant reduction in ΔΨ was observed in mitochondria isolated from the liver and kidney of animals
treated with both 30mg/kg and 60mg/kg GSK2617971A compared to VC (Fig.6.8). At 60mg/kg (n=6,
p<0.001) a 17.4% reduction in ΔΨ was observed in liver mitochondria and a 15.5% reduction was
observed in kidney mitochondria, meanwhile 30mg/kg (n=2) reduced ΔΨ by 30.7% (p<0.01) and 25.5%
(p<0.001) respectively.
This effect was observed despite the absence of any increase in OCR being observed in the Seahorse
BOFA assay in these two tissues (Fig.6.6). An increase in OCR would have been expected in any
mitochondria with a loss of ΔΨ due to increased ETC activity to drive proton motive force. This suggests
that the JC-1 mitochondrial ΔΨ assay is more sensitive in terms of detecting changes in ΔΨ caused by the
MOA of an OXPHOS uncoupler, compared to the Seahorse Bioanalyser.
FIGURE 6.8: Analysis of mitochondrial ΔΨ (JC-1) in liver and kidney mitochondria from animals treated with
GSK2617971A compared to VC. A significant reduction in mitochondrial ΔΨ was noted in mitochondria
isolated from the liver and kidney of both 30mg/kg (n=2, mean ± range, clear bars) and 60mg/kg (n=6, mean ±
SD, grey bars) GSK2617971A treated animals compared to VC (n=8, mean ± SD, black bars) is plotted. p<0.01 **, p<0.001 ***
L ive r K id n e y
0
5 0
1 0 0
1 5 0
2 0 0
2 5 0
V e h ic le C o n t ro l
3 0 m g /k g G S K 2 6 1 7 9 7 1 A
6 0 m g /k g G S K 2 6 1 7 9 7 1 A
RF
U
* * *
* * *
* *
* * *
152
Calcium Retention Capacity
Mitochondria isolated from the liver and kidney of GSK2617971A treated animals had a decreased level
of CRC compared to VC (Fig.6.9). These data are consistent with findings generated in vitro which show
that GSK2617971A directly reduced the CRC of naïve mitochondria from control animals (Fig.6.2).
Mitochondria isolated from the kidney of GSK2617971A treated animals showed a significant reduction
in CRC compared to VC animals. This reduction occurs in a dose dependent manner with 30mg/kg
provoking a 38% reduction (p<0.001***), whilst 60mg/kg reduced the CRC by 55.2% (p<0.001***)
(Fig.6.9). The reduction in CRC in the kidney appears to be as a result of earlier potentiation of mPTP
triggering following calcium pre-loading.
Similarly, mitochondria isolated from the liver of GSK2617971A treated animals (dosed at both 30mg/kg
and 60mg/kg) also showed a reduced CRC compared to mitochondria isolated from VC animals, reducing
the CRC by 66.6% and 65.8% respectively (Fig.6.9). The data shows a similar degree of inhibition in
calcium uptake between 30mg/kg and 60mg/kg despite no evidence of body temperature increase, clinical
signs, lactate generation or mitochondrial ultra-structure changes in animals given 30mg/kg
GSK2617971A.
153
FIGURE 6.9: Analysis of mitochondrial CRC in kidney and liver mitochondria isolated from GSK2617971A treated rats
and VC. Mitochondria isolated from the kidney (A) and liver (B) of rats treated with 30mg/kg GSK2617971A
(light grey, n=2) and 60mg/kg GSK2617971A (orange, n=6), showed a statistically significant reduction in
average CRC (calculated as the ΔOD between the point of energising with succinate and mitochondria
undergoing calcium induced permeability transition) compared to VC (black, n=6). Tables show average (±SD/Range) delta OD along with % reduction compared to VC. p<0.001***
Kidney Mitochondria
Group Delta
OD
(A650)
±
Standard
Deviation
(A650)
%
Reduction
Statistical
Significance
Control 0.76 0.21 - -
30mg/kg 0.47 Range: 0.15
38.04 ***
60mg/kg 0.34 0.03 55.21 ***
Liver Mitochondria
Group Delta
OD
(A650)
±
Standard
Deviation
(A650)
%
Reduction
Statistical
Significance
Control 0.51 0.09 - -
30mg/kg 0.17 Range:
0.006
66.60 ***
60mg/kg 0.18 0.01 65.77 ***
0 5 0 1 0 0 1 5 0 2 0 0
0 .5
1 .0
1 .5
2 .0
2 .5
V eh ic le C on tro l
3 0m g/kg G S K 26 179 71A
6 0m g/kg G S K 26 179 71A
T im e (s )
Ab
so
rb
an
ce
(A
65
0)
T im e (s )
Ab
so
rb
an
ce
(A
65
0)
0 5 0 1 0 0 1 5 0 2 0 0
0 .5
1 .0
1 .5
2 .0
A
B
154
6.2.4. IDENTIFYING MECHANISMS OF TOXICITY FOLLOWING OXPHOS UNCOUPLING IN VIVO
USING TRANSCRIPTOMICS
Global transcriptomic assessment was performed in the liver of GSK2617971A treated animals. The liver
was chosen for analysis due to the effects observed in this organ in terms of reduction in CRC and ΔΨ
and to allow comparative analysis to be undertaken between the gene expression signatures downstream
of both OXPHOS uncoupling (GSK2617971A – present chapter) and complex III inhibition
(GSK932121A- chapters 3-5). The aim of the transcriptomics was to identify downstream pathways or
cellular functions which are differentially affected by drug-induced OXPHOS uncoupling, compared to
VC and build these into an AOP. It was also hoped that early marker genes of OXPHOS uncoupling
activity might be identified.
GSK2617671A dosed at 30mg/kg caused 1250 gene transcripts to be differentially expressed (1.5 fold ±,
p<0.05) compared with VC of which 452 (36.16%) were protein coding. Despite the onset of severe
toxicity occurring at a dose of 60mg/kg GSK2617971A, fewer genes were differentially altered compared
to VC. 60mg/kg GSK2617971A caused the increase or decrease of 1019 gene transcripts (1.5 fold ±,
p<0.05) with 271 of those transcripts (26.59%) mapped to protein coding genes. Table 6.1 below shows
the direction of change in expression of protein coding genes across the study.
Direction of Change 30mg/kg GSK2617971A 60mg/kg GSK2617971A
Increased 169 (37.39%) 175 (64.58%)
Decreased 283 (62.61%) 96 (35.42%)
TABLE 6.1: Direction of change in protein coding gene expression in GSK2617971A treated rat livers.
PCA analysis of the data was performed using Qlucore Omics Explorer (OE) 3.0. 64-bit (Qlucore, Lund,
Sweden). The entire raw data set (following normalisation by the RMA method) was incorporated into
Qlucore OE and a PCA plot was generated (Fig.6.10A). This was based on data variance observed across
the entire array and limited separation of the data was visible (i.e. the PCA was unable to identify
principal components which suitably explain the variation of the raw data).
Qlucore OE facilitates the user to adapt the statistical parameters from a lenient to stringent statistical
significance, and identify the genes that best separate the experimental variables Qlucore OE is therefore
155
a useful tool both to identify the key components within large gene expression data sets (i.e. the most
significantly affected genes in terms of separating control vs treatment) and to visualise this effect within
a dynamic-PCA plot in real time.
A multi-group statistical comparison was employed between both 30mg/kg and 60mg/kg groups versus
the VC with the aim of separating GSK2617971A treatment (for both dose groups) in terms of the top 30-
40 gene transcripts. The user is then able to view the corresponding effect on the PCA plot (Fig.6.10B).
Using a variance level of 0.29, p≤0.05 and fold-change of 1.5x reduced the number of significant
variables to 67 of which 32 were protein coding genes.
FIGURE 6.10: PCA analysis of global hepatic transcriptional data pre and post statistical refinement. (A) PCA analysis of
the full raw data set which shows limited separation between VC (black circles), 30mg/kg GSK2617971A
(orange circles) or 60mg/kg GSK2617971A (grey circles). (B) Qlucore OE permits the user to adjust the
statistical stringency of the data-set. Upon refining the data (0.29 variance, p<0.05 and 1.5 fold change in
expression), only the most statistically significant gene expression changes are included in the PCA analysis
thus producing a more robust separation of control and treated data. Such analysis reduced the number of
significantly affected variables to 67, of which 32 were protein coding transcript (used in subsequent pathway analysis).
The 32 most statistically important protein-coding genes identified to best separate GSK2617971A
treatment from control (as determined by PCA analysis) were then selected for IPA analysis with the aim
of identifying key biological themes characteristic of GSK2617971A toxicity (as pathway analysis is
unbiased the theme analysis is not simply reflective of OXPHOS uncoupling). It was decided to input
B A
156
only the top most statistically significant genes into pathway analysis as submission of all genes
differentially expressed following GSK2617971A produced an unspecific pathway prediction (biased
towards most studied transcriptional responses e.g. tumourgenesis and neurodegenerative disorders). The
gene list was filtered by IPA based on known biological function and mapped into interaction networks
which were ranked quantitatively. These networks indicate functional association between genes which
were affected by GSK2617971A treatment and other known genes within a biological pathway (Table 6.2
below). This functional association is ranked by score with the top three biological functions associated
with each gene network provided.
Network
Rank
Genes in Network Score Focus Genes Biological Function
1 ADRB, Alp,ATF3, Cyclin A, CYP1A1, ERK1/2,
estrogen receptor, G0S2, GADD45B, GOT, GOT1,
Hdac, HSPB1, HSPH1, IGFBP1, IgG, IL1, IRS2,
JUN, KLF6 LDL, LPIN1, MAP2K1/2, MEF2, mir-
122, MT1E, PDGF BB, PEPCK, PPARGC1A,
RGS16, RNA polymerase II, SIK1, SLC38A2,
thyroid hormone receptor, Tnf (family)
47 16 Cell Death and
Survival, Lipid
Metabolism,
Molecular
Transport
2 ACOT13, AIP, CCDC64B, CHAC1, CHP1, CMSS1,
CTDNEP1, DAG1, ECI2, ETHE1, GCKR, Gstm3,
HNF4A, MEF2BNB-MEF2B, MID1, MID1IP1,
MT1E, MT1H, NDUFA1, NDUFB5, NDUFV1,
NECAP1, NUF2, P4HA1, POR, PPP1R3B, PWP1,
RAB30, SDS, SLC30A7, SRP19, TMC6, TRIP11,
TRMT61B, UBC
15 8 Cell Death and
Survival, Cellular
Assembly and
Organization,
Cellular
Compromise
3 ADRA2A, Akt, BTG2, CDKN2D, Cebpd, Cg,
CYP17A1, ERK, FSH, GPC1, Histone h4, Igf,
Insulin, Interferon alpha, Jnk, lipoxin A4, Mapk,
MT1E, NFkB (complex), P38 MAPK, Pdgf
(complex), PDK4, PI3K (complex), Pka,Pkc(s),
PTP4A1, RGS16, S1PR1, SRC (family), TCR,
TNFAIP2, tyrosine kinase, USP18, vitamin K1
15 6 Cell Morphology,
Cellular
Development,
Molecular
Transport
TABLE 6.2: IPA network analysis (biological theme analysis) of top 32 protein coding genes differentially altered in
response to GSK2617971A (30 and 60mg/kg). Direction of change is indicated by colour (Red= increased,
Green = decreased). Genes not coloured red or green have known (experimentally proven) interactions with
other members of the network. Scores are calculated from p-values (-log10p) and equate to the likelihood of the
focus genes (differentially changing in response to GSK2617971A treatment) being associated by chance. Biological function indicates the top three biological themes corresponding to each network.
The top ranked network (due to the high score value, i.e. low likelihood that focus genes changing in
GSK2617971A treated livers are associated in the network due to chance) relates to cell death and
survival, lipid metabolism and molecular transport cell functions. Biological functions which were
157
inferred with less confidence by second and third ranked networks also include cell death / survival, effect
on cell morphology, cellular compromise and cellular development.
Changes in genes such as Atf3, Irs2, Lpin1 and PGC1α (incorporated in the top rank network) were also
observed following GSK932121A treatment (shown in chapter 3) and this may be suggestive of
mitochondrial-toxicity signature genes. This concept will be explored further in chapter 7.
The 32 most significant protein coding transcripts which were altered by GSK2617971A treatment were
subjected to an IPA-Tox analysis (Table 6.3). This analysis compares the user’s gene signatures with
other sets of genes known to change when perturbed by particular compounds and go on to provoke
downstream pathology. The IPA-Tox-analysis describes adaptive, defensive, or reparative responses to
xenobiotic insult and was used to better understand the potential tox specific downstream pathways, as
suggested by gene expression analyses. Table 6.3 below includes a column which, where applicable, links
the toxicological pathways generated by IPA (and indicative of the gene signatures differentially altered)
to relevant observable effects which occurred in the current study and are presented in the current chapter.
158
TABLE 6.3: IPA-Tox analysis of top 32 protein coding genes differentially altered in response to GSK2617971A. Top 20
toxicity pathways or functions linked to the 32 gene signatures inputted following GSK2617971A treatment (30
& 60mg/kg). –log(p-value) shows significance that the focus gene is not simply included in the toxicity
pathway by chance. The ratio refers to the ratio of focus genes compared to total number of genes in the toxicity
pathway (IPA database). These ratios are low but this is largely due to the fact only 32 transcripts were
submitted for analysis. Any toxicity pathways arising from IPA-Tox analysis which is supported by other observations in this chapter are shown in orange with supporting evidence described.
Ingenuity Tox Lists -log (p-value) Ratio Focus genes Observable link to current study?
Acute Renal Failure Panel
(Rat) 5.23E00 6.45E-02
JUN, ATF3,
IGFBP1, MT1E
Evidence of renal toxicity (CRC,
OCR, TEM, ΔΨ )
Liver Necrosis/Cell Death 3.92E00 1.85E-02
JUN, GADD45B,
IGFBP1, MT1E,
PPARGC1A
Evidence of hepatic mitochondrial
toxicity (CRC and ΔΨ )
Nongenotoxic
Hepatocarcinogenicity
Biomarker Panel 3.06E00 9.09E-02 BTG2, MT1E No relevant measurement
Renal Proximal Tubule
Toxicity Biomarker Panel (Rat) 2.91E00 7.41E-02 IGFBP1, HSPB1
Evidence of renal toxicity (CRC,
OCR, TEM, ΔΨ )
Aryl Hydrocarbon Receptor
Signalling 2.57E00 1.88E-02
CYP1A1, JUN,
HSPB1 No relevant measurement
PXR/RXR Activation 2.31E00 2.99E-02
IGFBP1,
PPARGC1A No relevant measurement
Liver Proliferation 2.14E00 1.39E-02
JUN ,IGFBP1,
MT1E No pathology available
Increases Liver Steatosis 2.1E00 2.74E-02
LPIN1,
PPARGC1A No pathology available
p53 Signalling 2.01E00 2.02E-02 JUN, GADD45B No relevant measurement
Hepatic Fibrosis 1.86E00 2.08E-02 mir-122, IGFBP1 No pathology available
Decreases Permeability
Transition of Mitochondria and
Mitochondrial Membrane 1.85E00 1.43E-01 BTG2
Decrease in CRC noted in vitro and in
vivo
Mechanism of Gene Regulation
by Peroxisome Proliferators via
PPARα 1.85E00 2.11E-02 JUN, PPARGC1A No relevant measurement
Genes Downregulated in
Response to Chronic Renal
Failure (Rat) 1.75E00 1E-01 CYP1A1
Evidence of renal toxicity (CRC,
OCR, TEM, ΔΨ )
FA Metabolism 1.74E00 1.69E-02 CYP1A1, SDS
Increased levels of lactate (likely
corresponding effect on lipid
metabolism)
Decreases Respiration of
Mitochondria 1.7E00 9.09E-02 MT1E
Decrease OCR in kidney
mitochondria
Increases Renal Proliferation 1.66E00 1.56E-02 JUN, MT1E No relevant measurement
Cytochrome P450 Panel -
Substrate is a Xenobiotic
(Human) 1.56E00 5E-02 CYP1A1 No relevant measurement
Increases Depolarization of
Mitochondria and
Mitochondrial Membrane 1.53E00 5.88E-02 BTG2
Evidence of depolarization in kidney
and liver mitochondria (MMP)
Cardiac Hypertrophy 1.52E00 8.04E-03
JUN, ATF3,
PPARGC1A
No pathology or other relative
assessments available
Cardiac Fibrosis 5.43E-01 5.52E-03 ATF3
No pathology or other relative
assessments available
159
Of the top 20 pathways generated via IPA-Tox analysis (with the 32 protein coding genes most
significantly altered by GSK2617971A treatment used as the comparator), 8 of the pathways could be
supported by other experimental data presented in this chapter (40%). In these cases many of the
pathways identified by this method were very specific to the experimental data generated (e.g. decreases
in permeability transition of mitochondria and increased depolarisation of mitochondria). Caution must
however be advised as many of these Tox-pathway predictions are based on alterations in just a single
gene. Furthermore, this analysis is not suggesting that gene expression data in one tissue can predict a
toxic effect in another, just that (as a resource for toxicologists) the IPA-Tox analysis can identify gene-
signatures which are suggestive of certain toxic effects, independent of the tissue or organ. In the present
studies these suggestions were deemed fairly predictive and were substantiated by functional endpoints. I
believe further studies of this kind are required in order to better assess the true utility of the IPA package.
These data do however suggest that if the genes inputted for IPA analysis are first filtered to only the
most significant (i.e. in terms of separating control versus treatment) then the output from pathway
analysis appears to be more robust.
6.3. Discussion
Uncouplers of OXPHOS are a common class of mitochondrial toxicant seen in pre-clinical screening
[211]. Despite this, few studies have been reported which detail the AOP arising from drug-induced
OXPHOS uncoupling in vivo. Since they are a common class of mitochondrial toxicant, it is important to
understand their toxicological effect in vivo, in order to better advise discovery groups of the potential
risk involved with progressing such molecules and offer strategies to manage their development when
required. This is especially important considering OXPHOS uncouplers are considered attractive
therapeutic agents for the treatment of many disorders [212] including non-alcoholic fatty liver disease
[213], type 2 diabetes [214], ischemia reperfusion injury [215] and acute neurological injury [216].
To provide a benchmark for the evaluation of in vitro assays of mitochondrial dysfunction, the present
study investigated the MOA of the acute toxicity caused by an uncoupler of OXPHOS in rats. To
facilitate the assembly of an AOP, a single administration (mid and high dose) study which was likely to
cause an adverse outcome was performed in male Crl:Wi (Han) rats, and a systems approach was used to
detect downstream consequences.
160
Uncouplers of OXPHOS have been shown to cause hyperthermia in vivo. An example of this is the
hyperthermic response caused by 2,4-DNP which has been linked to fatal incidences in recent years
following the use of DNP as a dieting aid [149, 217, 218]. Hyperthermia has also been reported in vivo
following administration of other known uncouplers such as tolcapone [219]. This is not unexpected
considering uncoupling of OXPHOS is the fundamental mechanism of non-shivering thermogenesis in
brown adipose tissue [220]. Uncoupling proteins (UCP’s), specifically UCP1 (or thermogenin), decrease
the proton gradient generated by the ETC by increasing the permeability of the IMM to protons [221,
222]. In the present study, hyperthermia was an early consequence of treatment of rats with
GSK2617971A, the magnitude of the response correlating well with plasma levels of the drug suggesting
that drug-induced OXPHOS uncoupling is the primary cause of increased thermal energy generation.
Interestingly however, no effect on body temperature was noted at 30mg/kg GSK2617971A, despite
abnormalities in mitochondrial function noted at this dose. This observation is suggestive that OXPHOS
related hyperthermia is downstream in the AOP from mitochondrial effects such as reduction in ΔΨ and
CRC. It is likely that compensatory mechanisms are able to maintain whole body temperature regulation
following milder mitochondrial uncoupling and heat generation is confined to the tissue-level during the
early stages.
As discussed, 30mg/kg GSK2617971A did not affect either body temperature or provoke adverse clinical
signs up to four hours post dose but did cause a marked and statistically significant reduction in CRC and
ΔΨ in the liver and the kidney (also observed at 60mg/kg). Firstly, it is important to acknowledge that all
observations with 30mg/kg require validation because of the low number of experimental repeats (due to
study circumstances beyond control). Having said this, samples obtained for all endpoints at 60mg/kg
were taken at a time-point where the animals showed clinical signs but those at 30mg/kg were obtained
from animals which were to all appearances normal. This highlights that endpoints significantly altered
with a 30mg/kg dose (i.e. CRC and ΔΨ) are representative of underlying sub-toxic DIMT and that
endpoints significantly affected by the 60mg/kg dose group may be attenuated with the high level of
toxicity. Furthermore, this surprising observation suggests that membrane depolarisation and impaired
CRC does not necessarily cause an adverse clinical reaction and that these events most certainly occur at
lower toxicity (dose) levels than the observed increases in body temperature and effects on mitochondrial
ultra-structure.
Induction of MPT has been noted with other compounds with known uncoupling activity such as the
selective serotonin reuptake inhibitor sertraline [223] and the tyrosine kinase inhibitor regorafenib [224],
with both groups speculating that MPT induction was a key mechanism of hepatocyte injury. Further
161
work should explore whether reduction in CRC and ΔΨ observed in mitochondria isolated from animals
treated with 30mg/kg GSK2617971A is recoverable at later time points (i.e. due to turnover of the
mitochondrial pool through dynamic processes such as mitophagy and biogenesis) or whether a dose of
30mg/kg provokes adverse toxicity following repeated administrations. The present study does however
show a correlation between observations made in vitro and in vivo and demonstrates the potential utility
of the CRC assay, both as a potential screening aid and as an early marker of mitochondrial uncoupling.
One difficulty in assessing uncoupling-induced effects on OCR is the bell-shaped nature of the dose
response. A valid hypothesis for the limited effects observed in response to GSK2617971A treatment
using the Seahorse Bioanalyser is that the concentration of the drug in the plasma was high (~270µM and
~540µM with 30mg/kg and 60mg/kg respectively) and this high concentration is likely to be represented
in the tissues (drug tissue concentration data not available). The peak uncoupling response in vitro (in
terms of OCR) was observed at just 1µM and concentrations above this were toxic to the respiratory
chain.
Another feasible hypothesis is that GSK2617971A may have been washed out of the mitochondrial
preparations during the isolation procedure and therefore has limited effects in these isolates. For this to
be the case however, we must assume that the effects of OXPHOS uncoupling on CRC and mitochondrial
ΔΨ are more persistent and are irreversible (or only very slowly reversible) upon removal of the drug.
Data presented in this chapter (Fig.6.7) does however show that the effect of GSK2617971A can be
reversed upon removal of the drug; however this experiment was performed in vitro and further work is
required. This analysis does however raise questions about the utility of assessing direct effects on
mitochondrial function in in vivo studies by subcellular fractionation, although this “wash out” effect
would not apply to all compounds and other endpoints (e.g. CRC) look to be persistent. This observation
is however pertinent when considering it amongst other compromises already associated with isolating
mitochondria (i.e. representative of in vivo scenario, structural damage etc). Novel methods, such as using
primary cell isolates, and in vivo biomarkers, should continue to be evaluated as better ways of assessing
the effects of mitochondrial toxicants in vivo are sought.
An increase in lactate:pyruvate ratio was observed at 4 hours post-dose with 60mg/kg GSK2617971A.
Lactic acidosis has previously been noted following administration of uncouplers both in vitro and vivo
[225, 226]. Lactate is known to be a biomarker of mitochondrial dysfunction in vivo as energy
metabolism is switched to glycolysis in attempts to maintain ATP levels following perturbation of
OXPHOS, to the detriment of increased levels of local lactate generation (also shown in chapters 3-5
following complex III ETC inhibition). Alongside increases in lactate:pyruvate ratio, mitochondrial ultra-
162
structural observations were also observed at 60mg/kg (although unfortunately data was not obtained in
the liver). Ultra-structural observations noted in the present study were comparable to those induced in
vivo by the classical mitochondrial uncoupler 2,4-DNP [227] and the mild uncoupler, indomethacin [228].
When noted in preclinical studies, these observations (mitochondrial swelling and disorganisation of
mitochondrial networks) should in the future, alert drug safety scientists to the possibility that the
compound may have functional effects on mitochondria and thus prompt further investigations.
As there was no effect observed on lactate:pyruvate ratio or mitochondrial ultrastructure at 30mg/kg, it
appears these endpoints are only affected in conjunction with the adverse outcome and not at sub-toxic
doses (this will be further explored in chapter 7). Importantly however, as functional changes (such as
reduction in both ΔΨ and CRC) were observed in mitochondria isolated from 30mg/kg GSK2617971A
treated animals, we can say that increases in blood lactate and alterations in mitochondrial ultra-structure
occur downstream in the AOP. This may suggest that the point at which lactate is raised in whole blood
and/or when mitochondrial ultra-structure becomes affected, might be key pathological events
underpinning the onset of adverse clinical signs following OXPHOS uncoupling.
Microarray analysis was used to identify downstream pathways or cellular functions which were
differentially affected by GSK932121A treatment. Statistical parameters were adopted which helped to
reduce the number of differentially expressed genes to the top 32 most significant for separating the
experimental variables. These 32 genes were then subjected to both biological theme and IPA-Tox
analysis. Biological theme analysis identified that a number of genes affected by GSK2617971A
uncoupling belong to a network of transcripts involved in cell death and survival. Kuruvilla and
colleagues in 2003, explored the molecular events downstream of OXPHOS uncoupling in vitro and they
observed comparable transcriptional patterns with FCCP as observed here with GSK2617971A [229].
They suggest that an early consequence of uncoupling is DNA damage, characterised by changes in genes
such as Gadd153, Gadd45, p21/Waf1 and Fas, with consequences observed on cell cycle control and cell
death at later time points. These data correspond to gene expression data / biological theme analysis in the
present study which demonstrates transcriptional activation of genes such as Gadd45b and Jun alongside
identification of gene networks involved in cell death (although no absolute measure of cell death was
made). This observation opens up the possibility that the mechanisms underlying FCCP and
GSK2617971A toxicity may be comparable. Meanwhile, IPA-Tox analysis identified specific
toxicological events which correlated well to other functional data within the present study (e.g.
membrane depolarisation and reduction in mitochondrial respiration). Importantly however the levels of
confidence in these analyses are questionable when toxicological themes are generated based on alteration
of single genes.
163
Overall, data presented in this chapter (alongside evidence reported in the literature with other tool
mitochondrial uncouplers e.g. 2,4-DNP) enabled the assembly of a proposed AOP/MOA for OXPHOS
uncoupling in vivo (Fig.6.11). Whilst some endpoints do not fully-fit the AOP/MOA framework outlined
in chapter 5 (i.e. not measurable, causally related or too broad e.g. generalised mitochondrial
insufficiency) this is a starting point for further refinement in more focussed future studies. This AOP can
be referred to when molecules with uncoupling activity are identified in vitro, in order to aid selection of
the most robust endpoints for in vivo assessment or to better understand the potential safety liabilities of
this class of mitochondrial toxicant.
164
FIGURE 6.11: Proposed AOP/MOA for mitochondrial OXPHOS uncoupling in vivo. Events which are supported by
experimental data presented in this chapter (for GSK2617971A) and which are generally not reported (or are
under-reported) in the literature, are shown in blue boxes. Events which are reported widely in the literature for
OXPHOS uncouplers but which were either not observed or measured in the present study are shown in orange
boxes. Clear boxes show endpoints which are acknowledged in the literature and were observed in the present
study. It is anticipated that various key events in the AOP have consequences on uncoupling-induced toxicity
but in general it is considered that ATP depletion increased body temperature, increased substrate oxidation and lactic acidosis are the primary causative factors.
Uncoupling of OXPHOS
Adverse Clinical Observations
E.g. increased heart and respiratory rate, muscle rigor, malaise and dyspnea
Increase in body temperature Increase in blood lactate
Moribund State / Death
Effect on mitochondrial ultra-
structure mitochondrial swelling and
network disorganisation
Mitochondrial degeneration and
mitophagy
Increased substrate oxidation
(For ATP synthesis)
Increased expression of genes
involved in lipid metabolism Lpin1, mir-122,
Increase in glycolysis
Genes involved in glucose depletion Irs2, Pdk4, Pgc1α, Foxo1, Pepck
Mitochondrial insufficiency, energy deprivation and
reduced metabolic rate
Dissipation of Proton Gradient Reduction in mitochondrial ΔΨ
Potentiation of the MPT triggered by Ca2+
preloading
Depletion of mitochondrial ATP (via
OXPHOS)
Molecular Initiating Event
Interaction of compound with IMM
Protons bypass F0F1 subunit of ATP Synthase
Local heat
generation caused by
proton dissipation?
Increase in ETC activity (O2 consumption)
Transcriptomic signature of cell death and survival gene
network
Contribution of cell death to
toxicity in acute tox studies?
Decreased O2
consumption depending on drug
concentration
levels in tissues.
In literature – Not observed in
present study
Observed in present study with
GSK2617971A– Not in literature
In literature and present study
Key
165
6.4. Summary
To summarise, GSK2617971A was toxic when dosed at 60mg/kg to rats, with hyperthermia and adverse
clinical signs observed at 4 hours post-dose. A dose of 30mg/kg was well tolerated despite functional
changes in mitochondria being observed (reduction in ΔΨ and CRC), highlighting the utility of these
endpoints as possible early markers of mitochondrial uncoupling at sub-toxic doses.
In general, data generated in vivo correlated well with that produced by in vitro investigations suggesting
utility of these approaches for screening of uncoupling agents. The exception was the decrease in OCR
observed in mitochondria isolated from the kidney of rats treated with 60mg/kg GSK2617971A in vivo,
compared with the increase in OCR observed when control isolated mitochondria were treated directly
with GSK2617971A in vitro (although potential reasons for this discrepancy have been highlighted). At
higher doses, mitochondrial uncoupling caused ultra-structural changes to mitochondria in the kidney,
although analyses in other tissues are required. In addition there was an increase in blood lactate,
reflecting attempts to maintain ATP levels via glycolysis. It is likely that these effects, together with acute
hyperthermia are the principal causes of the acute toxicity observed downstream of OXPHOS uncoupling
in vivo.
Transcriptomics highlighted activation of gene-networks involved in cell death (although there was no
confirmation that this was actually occurring) and lipid metabolism with IPA-Tox analysis proving a
useful tool with regards to predicting toxicological outcomes (many of which were supported by data
within the study) using a selection of the most statistically significant gene changes. The major limitation
of IPA-Tox theme analysis was however, that conclusions were based around changes in just a small
number of genes. This chapter highlights the critical importance of using a systems approach to
understand and build AOP’s with the use of both higher (toxic) and lower (not overtly toxic) doses to aid
determination of upstream and downstream (primary/adaptive) effects.
The acute natures of the studies outlined in chapters 3-6 have however made identification of endpoints at
sub-toxic doses challenging (i.e. measures of underlying un-attenuated DIMT). Chapter 7 below, explores
potential underlying markers of DIMT both as biomarkers and to differentiate primary from adaptive
toxicological events.
166
7.0. THE EFFECT OF SUB-CYTOTOXIC CONCENTRATIONS
OF GSK932121A AND GSK2617971A IN VITRO AND
COMPARISON WITH A BIOINFORMATICALLY
SELECTED ‘SIMILAR’ CHEMICAL
167
7.1. Introduction
Systems toxicology investigations presented in chapters 3-6, have identified a range of endpoints which
are differentially affected by DIMT, specifically following respiratory chain inhibition and OXPHOS
uncoupling in vivo and a number of common observations were made. Most notable was a metabolic
switch to glycolysis, elevation in plasma lactate concentration, ultra-structural effects on mitochondria,
effects on mitochondrial function and similar patterns of hepatic gene expression including alterations to
genes involved in cell metabolism and cell stress. Taken together, these changes reflect the metabolic
adaptation in the liver to drug-induced compromise in ATP synthesis via the ETC / OXPHOS (be this via
inhibition of the mitochondrial complexes or uncoupling). Even with the use of well-tolerated doses of
both GSK932121A (12.5mg/kg used in chapter 4) and GSK2617971A (30mg/kg used in chapter 6), a gap
in the investigations completed to date is the difficulty in distinguishing primary from secondary events in
the resulting AOP’s for both drugs. Furthermore, it remained to be determined whether the observed
downstream effects (i.e. the metabolic switch) are specific cellular adaptations following mitochondrial
perturbation or common stress responses.
To address these questions a study was designed in vivo whereby animals would be killed at progressive
time points in order to analyse the effect of mitochondrial perturbation at the tissue level and thus
potentially determine the sequential order in which the key changes take place. Due to time and practical
constraints this wasn’t possible. As an alternative, the progression of events was explored in vitro and
importantly at concentrations of drug which were not grossly toxic to the cells. I was especially interested
in exploring the narrow window whereby compound-induced alterations in respiratory function were
observable, prior to the onset of gross cellular cytotoxicity. It was hoped this analysis would help to
determine both the order in which these fundamental events occur and the utility of in vitro systems in
terms of replicating the in vivo effects.
Furthermore, I wanted to better understand whether the transcriptional response to GSK932121A and
GSK2617971A in the liver was similar to that of any other previously studied compound and whether any
connected compound was a mitochondrial toxicant. It was hoped to identify other reference compounds to
further study mitochondrial toxicity and determine whether the endpoints being studied are common to
mitochondrial toxicants or whether they occur in response to compounds with different modes of action.
Importantly the cells used in this chapter were cultured in a media supplemented with galactose rather
than glucose. Human liver hepatocellular carcinoma cells lines (HepG2) are heavily reliant upon
168
glycolysis for energy production which has been shown to desensitise them to drug-induced
mitochondrial perturbation (a phenomenon reported in the literature as the Crabtree effect) [106]. This
effect can be circumvented by conditioning the HepG2 cells in galactose rather than glucose media and
thus increasing the cells reliance on OXPHOS for ATP-production. This occurs as oxidation of galactose
to pyruvate yields no net ATP, which forces cells to oxidize pyruvate (via OXPHOS) to survive. This
model has shown increased sensitivity for detecting drug-induced mitochondrial perturbation in the pre-
clinical setting [230]. This approach does however have certain limitations such as the reduced growth
rate and changes in the cellular and mitochondrial proteome.
7.1.1. EXPERIMENTAL AIMS
The experimental aims of the work outlined in this chapter were…
1. To identify the concentration range of GSK932121A and GSK2617971A where mitochondrial
function was compromised in the absence of gross cellular cytotoxicity. Using this narrow
concentration window would build confidence that any observed effect was due to the
perturbation of mitochondrial function as opposed to being secondary adaptive consequences to
cytotoxicity.
2. At the concentrations determined in (1), to assess the impact of DIMT on lactate generation,
mitochondrial ultrastructure and on a TaqMan gene expression panel consisting of genes pertinent
to the toxicological response of both compounds in vivo. Furthermore, to identify the order in
which these effects occur to be able to determine causal from consequential effects and thus
validate early molecular events reported in the proposed GSK932121A and GSK2617971A
AOP/MOAs.
3. To perform connectivity mapping analysis on liver transcriptomics data from GSK932121A and
GSK2617971A treated animals, and identify novel tool compounds which may mimic the
biological action of both drugs based on the genes which are differentially altered. Any connected
compounds would then be screened in the Seahorse analyser to assess any effect on mitochondrial
function and using the aforementioned in vitro methods to explore mechanistic similarity to both
GlaxoSmithKline compounds.
169
7.2. Results
7.2.1. IDENTIFYING EFFECTUAL SUB-CYTOTOXIC CONCENTRATIONS
The mitochondrial effects of GSK932121A and GSK2617971A were assessed in vitro. Following which,
any concentration of drug found to affect the mitochondrial (OCR) or glycolytic (ECAR) cellular
metabolism of HepG2 cells was assessed using a measure of cell viability. The objective was to identify
concentrations of both compounds which caused metabolic compromise but showed no signs of gross
cellular cytotoxicity.
GSK932121A – Complex III Inhibition
Exposure of HepG2 cells to GSK932121A in vitro (n=3) resulted in decreases in key bioenergetic
parameters, demonstrated using a mitochondrial stress test (Fig.7.1A). The response observed was typical
of a mid-respiratory chain inhibitor, i.e. reducing the amount of molecular oxygen consumed at
mitochondrial complex IV via inhibition of the ETC. Statistically significant and concentration-dependent
reductions in basal respiration and ATP-synthase linked respiration (concentrations of 7.5µM and above)
were observed alongside a reduction in maximal respiration (concentrations of 0.75µM and above)
following GSK932121A treatment in vitro (Fig.7.1B). OCR parameters were calculated as described in
([231]-supplementary). Concentrations of GSK932121A were chosen to match plasma drug
concentrations achieved in vivo (i.e. up to ~75µM). With statistically significant effects on respiratory
chain function noted as low as 0.75µM GSK932121A in HepG2 cells, cytotoxicity was assessed at
concentrations of 0.75µM and above.
170
FIGURE 7.1: Analysis of HepG2 mitochondrial OCR following acute in vitro treatment with GSK932121A (measured
using Seahorse XFe96 analyser). HepG2 cells were treated in vitro with GSK932121A (0.075µM-75µM, 15
technical replicates per plate) and OCR was assessed. A mitochondrial stress test was then performed in order to
assess the effect of GSK932121A on key bioenergetic parameters (n=3). (A) A representative graph of OCR
outputs from the XFe96 analyser of DMSO control (black line) and GSK932121A treated (various colours,
0.075µM-75µM) and the response to oligomycin, FCCP and Antimycin A /Rotenone (A/R). (B) Effect of
GSK932121A on basal respiration, ATP-linked respiration and maximal respiration. OCR parameters were
calculated as described in ([231]-supplementary). Data shown is mean ± SD (n=3), mid-point OCR. Significance stars depict reduction in OCR compared to DMSO control *p<0.05, **p<0.01, ***p<0.001.
Cytotoxicity was assessed using a LDH assay, at an 8 hour time point (Fig.7.2.). LDH leakage and light
microscopy analyses (not shown) were used as the measures of cytotoxicity in the present study as many
other cytotoxicity detection assays are in fact measures of mitochondrial activity (e.g.ATP assays, MTT
Tetrazolium assay) and as such may over-predict cytotoxicity to mitochondrial-acting compounds. This
time point was selected as subsequent in vitro experiments (section 7.2.2-7.2.4 below) were performed up
to a maximum of 8-hours post treatment (as I wanted to assess effects due to mitochondrial perturbation
OC
R (
pm
ol/
min
)
DM
SO
0.0
75
M
0.7
5 M
7.5M
37.5M
75
M
0
2 0
4 0
6 0
8 0
1 0 0
B a s a l R e s p ir a t io n
* * *
* * ** * *
A T P -L in k e d O C R
DM
SO
0.0
75
M
0.7
5 M
7.5M
37.5M
75
M
0
1 0
2 0
3 0
4 0
*
* *
* * *
DM
SO
0.0
75
M
0.7
5 M
7.5M
37.5M
75
M
0
5 0
1 0 0
1 5 0
2 0 0
M a x im a l R e s p ir a t io n
* * *
* * * * * * * * *
T im e (m in s )
OC
R (
pm
ol/
min
)
0 2 5 5 0 7 5
0
5 0
1 0 0
1 5 0
2 0 0
2 5 0
D M S O
0 .075 M
0 .75 M
7 .5 M
3 7.5 M
75 M
Oli
go
my
cin
FC
CP
A/R
A
B
171
using an acute experimental design as all aforementioned in vivo studies involved short periods of
exposure).
LDH was measured in spent media following an 8 hour treatment with GSK932121A or 0.1% DMSO
control. 1% (v/v) Triton-X-100 detergent (in cell culture media) was used as a positive control (as
described by [232]) and data were expressed as a percentage of leaked LDH compared to total LDH
(calculated from a lysed cell sample prepared used 200µL Cell Lytic per well (Sigma Aldrich, #C2978).
Significant effect on cell viability was observed at concentrations of 25µM, 50µM and 75µM
GSK932121A compared to a 0.1% DMSO control (p<0.001, n=3). No effect on LDH leakage was
observed at 0.75µM, 5µM or 10µM GSK932121A compared to the DMSO control (p>0.05).
FIGURE 7.2: The effect of GSK932121A on HepG2 cytotoxicity using an LDH leak/lyse assay. The cytotoxicity of
GSK932121A (at an 8 hour time point) was assessed in vitro in HepG2 cells by measurement of LDH leakage.
Triton-X-100 was used as a positive control and the effect on media alone (MC) was also measured. Data is
expressed as a percentage of LDH leaked compared to total LDH in the cells (i.e. lysed sample analysed following Cell Lytic treatment). Data is expressed as mean ± sd. ***p<0.001.
Concentrations of GSK932121A selected for further analysis therefore were 1µM, 5µM and 10µM. These
were the concentrations which were defined by experiment to be sub-cytotoxic up to an 8 hour time point
whilst causing a significant acute effect on respiratory chain function.
172
GSK2617971A – OXPHOS Uncoupling
The effect of GSK2617971A on HepG2 cell metabolic function was assessed using the Xfe96 analyser
(Fig.7.3 below). A significant increase in glycolytic metabolism (represented by increase in ECAR with
statistical significance depicted using # in Fig.7.3. below) was observed at doses of 0.1µM (p<0.05), 1µM
(p<0.001), 5µM (p<0.001) and 10µM (p<0.01) of GSK2617971A compared to a 0.1% DMSO control,
with a peak response observed at 5µM. The peak concentration in terms of effect on OCR was at 1µM
with an 80.2% increase in OCR observed compared to the DMSO control. A significant reduction in OCR
was observed following treatment with 50µM as GSK2617971A becomes toxic to the respiratory chain at
high concentrations (typical of a mitochondrial uncoupler and as shown in Fig.5.1 following ex vivo
treatment with GSK2617971A of control isolated liver mitochondria). As all concentrations tested had a
significant effect on metabolic function, all were analysed in the LDH leak/lyse assay to assess where the
onset of cytotoxicity occurs.
FIGURE 7.3: Effect of GSK2617971A (OXPHOS uncoupling) on HepG2 cell metabolism (OCR and ECAR). The effect of
increasing concentrations of GSK2617971A (0.1µM-50µM, + 0.1% DMSO control) on both OCR (y-axis) and
ECAR (x-axis) is shown. Statistical significance is highlighted using stars (*) for OCR and hash tags (#) for
ECAR. A bell shaped dose response was observed with both OCR and ECAR following GSK2617971A
treatment. Peak response in terms of ETC function (OCR) was observed at 1µM (p<0.001, n=3) and the peak
response relating to glycolytic activity (ECAR) was observed at 5µM GSK2617971A (p<0.001), compared to
DMSO control. */# p<0.05, **/## p<0.01, ***/### p<0.001.
173
Following an 8 hour exposure to either GSK2617971A (0.1µM-50µM), 0.1% DMSO control, media
alone (MC) or a 1% Triton-X-100 positive control, spent media was analysed for LDH leakage. A
significant increase in leaked LDH (indicating compound related cytotoxicity) was observed at 10µM
(p<0.05) and 50µM (p<0.001) GSK2617971A compared to DMSO alone (Fig.7.4). Despite no evidence
of LDH leakage with 5µM GSK2617971A, light microscopy evaluation identified a minor degree of
vacuolation in the HepG2 cell appearance which was absent at lower doses and in the DMSO control (not
shown). Taking this observation into consideration it was decided that 5µM would not be used in
subsequent investigations due to minor observations which could be considered adverse effects. Instead
doses of 0.1µM, 1µM and 2.5µM were selected for further analysis.
FIGURE 7.4: Effect of GSK2617971A on HepG2 cell cytotoxicity using an LDH leak/lyse assay. The cytotoxicity of
GSK2617971A (at an 8 hour time point) was assessed in vitro in HepG2 cells by measurement of LDH leakage.
Triton-X-100 was used as a positive control and the effect on media alone (MC) was also measured. Data is
expressed as a percentage of LDH leaked compared to total LDH in the cells (i.e. lysed sample analysed following Cell Lytic treatment). Data is expressed as mean ± SD (n=3), p<0.05*, p<0.001***
Having identified effective sub-cytotoxic concentrations of GSK932121A and GSK2617971A, these
concentrations were then tested in HepG2 cells for up to 8 hours to assess the effect on lactate generation,
mitochondrial/cellular morphology and gene expression.
174
7.2.2. IN VITRO LACTATE GENERATION
An increased level of blood lactate was observed in rats following treatment with both GSK932121A and
GSK2617971A in vivo. Mechanistically, mitochondrial perturbation causes an increase in lactate as cells
switch metabolism away from impaired mitochondrial OXPHOS and towards cytoplasmic glycolysis.
Glycolysis offers cells an opportunity to produce cellular ATP, independent of mitochondrial ETC
function via substrate level phosphorylation however the process is far less efficient and lactate
generation is a consequence of this response.
Preliminary Experiment: Prior to exploring the effect of both tool compounds on lactate generation in
vitro, it was important to perform a preliminary experiment to determine the optimum media glucose
concentration to ensure the cells had sufficient glycolytic substrate to optimise subsequent lactate
generation. As proof of concept, compounds which are known to increase lactate in vitro due to
mitochondrial inhibition were used. Oligomycin (2µg/mL) and antimycin A (1µM) were chosen with
concentrations based on evidence in the literature showing these concentrations induced the desired
lactate response [233].
In galactose-conditioned cell maintenance media alone, both oligomycin and antimycin A induced a
statistically significant increase in supernatant lactate at both 1 hour and 4 hours post treatment
(highlighted by # in Fig.7.5 below). However, the relative increase in lactate was significantly greater
when treatment was made alongside addition of increasing concentrations of glucose (2.5mM, 5.5mM and
11mM). The increase in lactate generation following oligomycin/antimycin A treatment in glucose
supplemented cells was significantly higher than the relative response in galactose alone at 1 hour with
11mM glucose (Fig.7.5A) and significantly higher than galactose alone with 2.5mM, 5.5mM and 11mM
glucose at 4 hours (Fig.7.5B). These data suggest that supplementing the media with glucose significantly
improves the lactate response to mitochondrial perturbation and this effect is enhanced both with time and
glucose concentration.
In order to ensure that the lactate generated was as a result of the exogenous glucose which was provided
(i.e. lactate produced de novo by the action of glycolysis) 2-deoxyglucose (2-DG), a potent glycolytic
inhibitor, was used. 2-DG is a competitive inhibitor of hexokinase and as such completely inhibits the
production of glucose-6-phosphate from glucose. In the present study, 50mM 2-DG (with the same
increasing concentrations of glucose) inhibited the lactate production which was observed following
oligomycin and antimycin A treatment with glucose supplementation (minus 2-DG). This data confirms
175
that the lactate produced following treatment with both mitochondrial toxicants is directly linked to the
levels of glucose supplemented to the cell maintenance media. As 2-DG blocks glycolysis at the level of
hexokinase (i.e. glucose conversion to glucose-6-phospate) it has no effect on galactose uptake into
glycolysis, as galactose enters the glycolysis pathway directly at glucose-6-phosphate (via glucose-1-
phosphate).
The effect of glucose treatment alone on lactate generation in galactose treated cells was also examined
with no significant increase observed (data not shown).
176
FIGURE 7.5: Effect of glucose concentration on the generation of lactate in HepG2 cell supernatant following treatment
with Oligomycin and Antimycin A. HepG2 cells were incubated for 1 hour (A) and 4 hours (B) with either
oligomycin (2.5µM) or Antimycin A (1µM) in galactose conditioned media provoking a statistically significant
increase in lactate (marked with an # and labelled as no supplements). Relative increase in lactate was however
significantly increased with both compounds whereupon oligomycin and antimycin A were treated alongside
increasing doses of glucose (in galactose conditioned media). 2-DG (50mM) inhibited antimycin A /
oligomycin induced lactate generation. Data is expressed as a percentage of the response elicited to a 0.1%
DMSO control. Data shown is mean ± sd (n=3), p<0.05*, p<0.01**, p<0.001***
Following analysis of the effect of glucose concentration on oligomycin and antimycin A induced lactate
generation, it was decided that 11mM of glucose would be supplemented to the cell maintenance media
upon treatment with both GSK932121A and GSK2617971A to ensure an optimal window for observing
treatment related effects on lactate generation. It was hoped that the addition of glucose, only at the time
% D
MS
O C
on
tro
l
No S
upple
men
ts
2.5
mM
Glu
5.5
mM
Glu
11m
M G
lu
2.5
mM
Glu
+ 2
DG
5.5
mM
Glu
+ 2
DG
11m
M G
lu +
2D
G
0
5 0
1 0 0
1 5 0
2 0 0
2 5 0
O ligom yc in (2 .5 M )
A ntim ycin A (1 M )
# #
* *
1 H O U R
%
DM
SO
Co
ntr
ol
No S
upple
men
ts
2.5
mM
Glu
5.5
mM
Glu
11m
M G
lu
2.5
mM
Glu
+ 2
DG
5.5
mM
Glu
+ 2
DG
11m
M G
lu +
2D
G
0
5 0
1 0 0
1 5 0
2 0 0
2 5 0
# #
* * *
*
* *
* * *
* * *
* * *
4 H O U R S
S u p p le m e n ts A d d e d T o G a la c to se C o n d it io n e d C e ll
M a in te n a n c e M e d ia
A
B
177
of compound-treatment, would provide the substrate required to facilitate metabolic switching (to a
detectable level using the methods available) but not negate the effects of culturing in galactose. Further
experimentation is however required to assess how long it takes for media supplementation (i.e. glucose
addition) to have a significant effect on underlying metabolic activities.
Assessment of lactate generation following treatment of HepG2 cells with sub-cytotoxic
concentrations of GSK932121A and GSK2617971A: The aim of the experiment was to analyse the
acute effect of GSK932121A/GSK2617971A on lactate generation (including speed of onset), both in
vitro and at sub-toxic concentrations. As such three concentrations of both GSK932121A (1, 5 and 10µM)
and GSK2617971A (0.1, 1 and 2.5µM) were tested over an 8 hour acute time-course. Supernatant
samples were taken at 1 hour, 2 hours, 4 hours and 8 hours post-treatment for analysis of lactate (as
described in section 2.14). Data shown is represented as a percentage of a 0.1% DMSO control (n=3).
A significant increase in lactate was observed at 4 hours post-treatment with 5µM (146.2% ±14.3,
p<0.05) and 10µM (170.6% ± 13.1, p<0.01) GSK932121A and at 8 hours post-treatment with 10µM
(147.8% ± 18.5, p<0.05) GSK932121A alone, compared to time matched DMSO controls (Fig.7.6A). No
effect was observed with either dose at 1 hour or 2 hours post-treatment. No effect on lactate was
observed at 1µM GSK932121A at any time point (p>0.05).
Only a minor effect on lactate production was observed following uncoupling of OXPHOS with
GSK2617971A in vitro (Fig.7.6B). A significant increase in lactate was only observed at 2.5µM
GSK2617971A at the 8-hour time point (138.3% ± 5.7, p<0.05, n=3) compared to a time matched 0.1%
DMSO control. No effect was seen at lower concentrations or earlier time points.
178
FIGURE 7.6: Effect of sub-cytotoxic concentrations of GSK932121A and GSK2617971A on HepG2 cell lactate generation
up to 8 hours. (A) Effect of GSK932121A (1µM, 5µM and 10µM) and (B) GSK2617971A (0.1µM, 1µM and
2.5µM) on lactate concentration in HepG2 cell media up to 8 hours post treatment. All data is expressed as a
percentage of time matched DMSO control lactate concentration and plotted as mean ± SD (n=3). p<0.05*, p<0.01**
These data show that lactate is increased in HepG2 cells at concentrations of both GSK932121A and
GSK2617971A which are not grossly cytotoxic to the cells, at 4-8 hours post-treatment. To further
investigate the early biochemical effects of complex III inhibition and OXPHOS uncoupling in vitro and
using well tolerated concentrations, gene expression profiling was used. A gene panel was assembled
G S K 9 3 2 1 2 1 A
T im e (h o u r s )
Su
pe
rn
ate
nt
La
cta
te
(%
D
MS
O C
on
tro
l)
0
0
5 0
1 0 0
1 5 0
2 0 0
1 M G S K 9 32 12 1A
5 M G S K 9 32 12 1A
10 M G S K 9 32 12 1A
1 2 4 8
*
* *
*
G S K 2 6 1 7 9 7 1 A
T im e (h o u r s )
0
0
7 58 0
1 0 0
1 2 0
1 4 0
1 6 0
0 .1 M G S K 26 17 97 1A
1 M G S K 26 17 97 1A
2 .5 M G S K 26 17 97 1A
1 2 4 8
Su
pe
rn
ate
nt
La
cta
te
(% D
MS
O
Co
ntr
ol)
*
A
B
179
based on data obtained in vivo with both compounds. As the main metabolic event observed in the
proposed AOP of both compounds was the switch towards glycolysis, the genes selected primarily
involved cellular glycolytic function alongside genes involved in lipid metabolism, gluconeogenesis and
cell stress responses.
7.2.3. RT-PCR – METABOLIC SWITCH GENE PANEL
The aim of this work was to identify early gene expression changes occurring as a result of subtle
complex III inhibition and OXPHOS uncoupling in vitro (i.e. at sub-cytotoxic concentrations). The same
experimental conditions, as described above for the lactate assay, were repeated to enable comparisons to
be drawn between gene expression alterations and onset of lactate stimulation. Identification of genes
responding early following exposure to these compounds may provide the opportunity to, a) better
understand the early mechanisms of toxicity following the molecular initiating event for both drugs, and
b), identify any potential “marker genes” which could be measured in future studies to assess potential
underlying changes in mitochondrial function.
As described above, a gene panel was assembled based on in vivo microarray data with both compounds
in rat liver. The gene panel was selected in a supervised manner, which enabled selection of genes
pertinent to the mechanisms under investigation. This was deemed preferable to selecting genes based on
statistical significance (i.e. an unsupervised approach) as this method does not account for the known
fundamental mechanisms. Table 7.1 below describes the genes selected for analysis in this experiment.
180
Gene
symbol
Gene name Fold change
and stat sig
following
complex III
inhibition
(50mg/kg)
(GSK932121A)
Fold change
and stat sig
following
OXPHOS
uncoupling
30mg/kg and
60mg/kg
(GSK2617971A)
Headline summary of
biochemical function
Reason for inclusion
in gene-panel
NR4a1 Nuclear receptor
subfamily 4, group a,
member 1
5.42x***
1.27x
1.76x*
Ligand-independent
transcription factors which
function as immediate or
early response genes. Key
transcriptional regulators of
hepatic glucose and lipid
homeostasis. Key review
can be found in [234].
Upregulated with both
compounds in vivo
and heavily linked to
cell metabolism in the
liver. NR4a2 Nuclear receptor
subfamily 4, group a,
member 2
2.69x** 1.25x
2.00x**
NR4a3 Nuclear receptor
subfamily 4, group a,
member 3
5.22x*** 1.24x
2.26x*
Ppargc1a
(PGC1α)
Peroxisome
proliferator-activated
receptor gamma,
coactivator 1 alpha
8.18x*** 1.05x
3.76x***
Transcriptional co-activator
and central co-ordinator of
gluconeogenesis and
mitochondrial biogenesis in
the liver [235, 236].
Upregulated with both
compounds in vivo
and heavily linked to
cell metabolism in the
liver.
Foxo1 Forkhead box 01
1.56x* 1.59x*
2.08x*
Forkhead transcription
factor. Plays pivotal role in
glucose metabolism and the
action of insulin on
glucogenic processes [237].
Upregulated with both
compounds in vivo
and heavily linked to
cell metabolism in the
liver.
Pck1 Phosphoenolpyruvate
carboxykinase 1
1.94x** 1.22x
1.48x*
Rate limiting step in
gluconeogenesis – Converts
oxaloacetate to
phosphoenolpyruvate
(substrate for
gluconeogenesis) [157].
Upregulated with both
compounds in vivo –
Linked to
gluconeogenesis
G6pd Glucose-6-phosphate
dehydrogenase -1.05x -1.38x
-1.28x
Catalyses reaction between
glucose (in the form of G6p)
and 6-
phosphogluconolactone in
the PPP.
No change observed
in vivo but key gene
involved in
glycolysis/PPP
Irs2 Insulin receptor
substrate 2
4.78x*** 1.41x
3.37x***
Irs2 is phosphorylated by the
Insulin receptor during
signal transduction and plays
subsequent role in glucose
metabolism in the liver
[238].
Upregulated with both
compounds in vivo
and heavily linked to
cell metabolism in the
liver.
Pdk4 Pyruvate
dehydrogenase
kinase isozyme 4
2.22x** 1.17x
3.76x**
Inhibits pyruvate
dehydrogenase complex by
phosphorylation which
prevents pyruvate
conversion to acetyl-coA.
Pyruvate instead converted
to oxaloacetate for
gluconeogenesis. [239]
Upregulated with both
compounds in vivo
and heavily linked to
cell metabolism in the
liver.
181
Hmox1 Heme oxygenase 1
2.22x** -1.04x
3.06x***
An essential enzyme in
heme catabolism, cleaves
heme to form biliverdin,
which is subsequently
converted to bilirubin by
biliverdin reductase, and
carbon monoxide. Involved
in cytoprotection to
hepatocyte injury in vivo
[240].
Upregulated with both
compounds in vivo
and heavily linked to
the response to
physiological stress.
Lpin1 Lipin 1
4.65x*** 1.15x
3.30x**
Controls the metabolism of
FAs at different levels.
Phosphatidate phosphatase
enzyme which catalyses the
conversion of phosphatidic
acid to diacylglycerol during
triglyceride biosynthesis.
Acts as a nuclear
transcriptional coactivator
for PGC1α /Ppar-α to
modulate lipid metabolism
gene expression [241].
Upregulated with both
compounds in vivo
and heavily linked to
liver cell metabolism.
Ppar-α Peroxisome
proliferator-activated
receptor alpha
1.01 1.27x
1.88x**
Among other functions,
Ppar-α plays a role in
regulating lipid metabolism
via Lpin1 and PGC1α during
periods of fasting or
increased FA supply [242].
Upregulated
following
GSK2617971A
treatment in vivo and
heavily involved in
the Lpin1/PGC1α
control of lipid
metabolism.
Chac1 Chac, Cation
Transport Regulator
Homolog 1
12.72x*** -1.08x
1.62x*
Pro-apoptotic component of
the unfolded protein
response pathway by
mediating the
pro-apoptotic effects of the
ATF4-ATF3-DDIT3/CHOP
cascade
Upregulated with both
compounds in vivo
and linked to cell
stress response.
Atf3 Activating
transcription factor 3
8.73x*** 1.28x
5.36x***
Transcriptional repressor
and induced by many stress
signals. Plays a role in
downstream signalling of the
unfolded protein response
pathway and in control of
gluconeogenic Pck1
expression in the liver [243]
Also involved in EIF2
kinase stress pathway
following amino acid
starvation [244].
Upregulated with both
compounds in vivo
and linked to cell
stress responses.
TABLE 7.1: Genes selected for use in TaqMan gene-panel. The table describes the genes which were incorporated into a
custom TaqMan gene-panel aimed at identifying early gene expression signatures downstream of mitochondrial
perturbation in vitro. Genes were selected based on observations in vivo and the effect of both GSK932121A
and GSK2617971A on the induction of all genes is indicated (fold change, and statistical significance, p<0.05*,
p<0.01**, p<0.001***). The proposed mechanism of action for each gene is provided alongside the main justification for use in this gene panel.
182
The focus of the gene panel was largely on the metabolic adaptation which occurred downstream of
mitochondrial perturbation induced by both molecules, however a small number of genes involved in cell-
stress responses (i.e. Chac1 and Atf3) were also included. This experiment was performed alongside the
lactate investigation described above. As such, GSK932121A, GSK2617971A and a 0.1% DMSO control
were introduced to a confluent monolayer of HepG2 cells in cell maintenance media supplemented with
11mM glucose. After 1 hour, 2 hours, 4 hours and 8 hours, the cell media was removed and cells were
lysed with RNA Lysis Buffer (Promega SV RNA Isolation Kit). Triplicate wells were pooled and the
experiment was repeated on three separate occasions (n=3). Data was represented in a heat map format
with statistically significant alterations in gene expression following GSK932121A (Fig.7.7) and
GSK2617971A (Fig.7.8) treatment compared to the 0.1% DMSO control shown.
GSK932121A (Complex III Inhibition) – Gene Panel Data (Fig.7.7)
The NR4A Gene Family: GSK932121A (complex III inhibition) caused a significant induction of the
nuclear receptor 4-alpha genes Nr4a1 and Nr4a3 over the time course with Nr4a1 upregulated with all
concentrations at 4 hours and with 5µM and 10µM at 8 hours (p<0.01). Nr4a3 was significantly elevated
at 2 hours with 5µM GSK932121A (1.7x, p<0.01) and then with 5µM and 10µM at 4 hours (1.58x and
2.12x respectively) and finally with all concentrations at 8 hours post treatment (p<0.001). These data
indicate that effect of GSK932121A on induction of the NR4a genes has a trend towards being more
time-dependent than dose dependent. Despite efficient target amplification, no effect on Nr4a2 compared
to the 0.1% DMSO control was observed throughout the study.
PGC1α/Foxo1 Gene Expression: GSK932121A induced a consistent increase in gene expression of
PGC1α and Foxo1 which are known as metabolic switch/master regulator genes. The increase in
expression of both genes was highly significant at 1 hour post treatment with all concentrations, compared
to the DMSO control (p<0.01). An increase in PGC1α expression (with all concentrations of
GSK932121A) was then observed throughout the time course with the exception of with 0.1µM
GSK932121A at a 4 hour time point (trending increase but p>0.05). At later time points (4 hour and 8
hour), Foxo1 expression was only increased with the higher doses of 5µM and 10µM GSK932121A
however data for both genes suggests they play a key role in the control of cell metabolism following
complex III inhibition in vitro.
PGC1α-Foxo1 Effectors: As anticipated, the downstream effector genes of PGC1α and Foxo1 were
generally induced later in the time course than Foxo1 and PGC1α. However, a significant induction of
Pck1 (involved in the rate limiting step of gluconeogenesis) was observed at all concentrations at 1 hour
183
post treatment compared to the DMSO control. Pdk4 was also increased at 1 hour with 5µM
GSK932121A however a significant reduction in expression was observed with 10µM GSK932121A,
which makes interpretation of data with Pdk4 challenging at early time points. G6pd was increased at
1µM (p<0.01) and 10µM (p<0.05) although data with this gene appeared highly variable. Only minor
effects on the downstream effector genes were observed at 2 hours post-treatment with the exception of
Pck1 which remained significantly elevated with all concentrations compared to the DMSO control. At 4
hours post-treatment a significant increase in the expression of Irs2 was observed with all concentrations
and with high fold-changes (2.1x with 5µM and 6.6x with 10µM GSK932121A). The activation of Irs2
was however temporary as no effect was noted at 8 hours. GSK932121A caused only minor effects on
Pdk4 and Hmox1 expression at 4 hours, with a slight reduction in the expression of both genes. At 8
hours post-treatment a significant increase in the expression of Hmox1 and G6pd was observed at all
concentrations suggesting that induction of these genes occurred later or downstream to the observed
increase in Foxo1, PGC1α and Pck1 expression.
Lpin1-Ppar-α and the stress response genes Atf3 and Chac1: Induction of Lpin1 (involved in
activating FAO) was observed at 4 hours post treatment with both 5µM and 10µM GSK932121A (1.64x
and 2.98x respectively). This increase preceded a respective increase in both Lpin1 and Ppar-α at 8 hours
post-treatment with all concentrations of GSK932121A compared to DMSO control. This suggests that
transcriptional activation of Lpin1/Ppar-α mediated FAO was delayed and was a later consequence of the
action of GSK932121A although Lpin1 expression preceded that of Ppar-α. Similarly, a significant
reduction in the expression of two genes involved in the cell stress/unfolded protein response (Chac1 and
Atf3) was observed at 1 hour and 2 hour post-treatment with GSK932121A. Increases in the expression of
both genes appeared however to be time dependent with all concentrations of GSK932121A inducing a
significant increase in the expression of both genes by 8 hours.
These data show that treatment with well tolerated concentrations of GSK932121A caused an early
increase in the regulator genes PGC1α, Foxo1 and Pck1. Transcriptional effects on other genes appear to
be time dependent rather than dose dependent and include induction of Nr4a1/3, Gdpd, Hmox1, Lpin1,
Ppar-α, Chac1 and Atf3.
184
GSK932121A (Complex III Inhibition) – Gene Panel Data
FIGURE 7.7: Heat map showing the effect in HepG2 cells of GSK932121A on a selection of pertinent genes involved in the response to DIMT. Data shown represents a
heat map of statistically significant changes in the expression of a number of genes following GSK932121A treatment in vitro. Experiments were repeated on
three occasions (n=3) and fold change (and statistical significance) was calculated against a 0.1% DMSO control. Any changes in gene expression where p<0.05 are shown (in either direction).
Key:
185
GSK2617971A (OXPHOS Uncoupling) – Gene Panel Data (Fig.7.8)
Like observations made with GSK932121A, the OXOHOS uncoupling agent GSK2617971A caused a
time dependent increase in the expression of most genes over the time course studied. At 1 hour post
treatment 9 of the 14 genes on the panel had lower levels of expression than the corresponding 0.1%
DMSO control. Most notably, there was a significant reduction in both of the stress response genes,
Chac1 and Atf3, with all concentrations of GSK2617971A. Furthermore, a reduction in the expression of
Nr4a1/3 at 0.1µM and 2.5µM GSK2617971A was observed alongside reductions in Irs2, Hmox1, G6pd,
Lpin1 and Ppar-α, especially with the 2.5µM concentration. However, as observed with GSK932121A,
the expression of regulator genes PGC1α and Foxo1, alongside Pck1 (gene encoding the rate limiting
enzyme involved in gluconeogenesis) was increased with all concentrations.
At 2 hours post treatment with GSK2617971A, (with the exception of Pck1 which remained
transcriptionally up-regulated) all downstream effector genes of the action of PGC1α / Foxo1 (Hmox1,
Pdk4, Irs2, G6pd) were unchanged compared to control. Likewise the expression of Chac1 and Atf3
remained reduced compared to the DMSO control. A significant increase in expression was however
observed with Lpin1 at 1µM (p<0.01, 1.2x) and 2.5µM (p<0.01, 1.7x) and these data suggest early
transcriptional activation of FAO genes. At 2 hours a significant increase in the expression of Nr4a1 at
0.1µM and 1µM was observed although no effect was seen with 2.5µM.
The transcriptional response to GSK2617971A remained fairly subtle at the 4 hour time point with many
genes involved in the cell stress response, activation of FAO and glycolytic / gluconeogenic processes not
significantly changed compared to DMSO control. However, when compared to data at 1 and 2 hours
where many of these genes had significantly reduced expression levels compared to control, it may be
inferred that the expression of these genes was in fact gradually increasing. Like observations noted with
GSK932121A, the expression of Irs2 was maximally induced at 4 hours with fold changes of 5.1, 7.6 and
13.5 observed with 0.1µM, 1µM and 2.5µM respectively (p<0.001). Despite an increase in the expression
of Foxo1 persisting with 0.1µM and 1µM GSK2617971A, a reduction in the expression of PGC1α was
observed with 1µM and 2.5µM GSK2617971A and it was apparent that the transcriptional activity of
these regulator genes was starting to decline.
186
At 8 hours post-treatment with GSK2617971A (the only time-point in which an increase in lactate was
observed), a statistically significant induction of Atf3, Lpin1, Ppar-α, Hmox, G6pd, Pck1 and Nr4a3 was
observed with either all GSK2617971A concentrations or with 1µM and 2.5µM. This data represents a
more similar pattern of gene expression to observations made in vivo. At 8 hours post treatment the
expression of both PGC1α and Foxo1 was not significantly altered compared to control highlighting a
reduction in the expression of these co-ordinators of the metabolic response. No effect on Pdk4 was
observed throughout the study at any time points or with any concentration of compound.
187
GSK2617971A (OXPHOS uncoupling) – Gene Panel Data
FIGURE 7.8: Heat map showing the effect in HepG2 cells of GSK2617971A on a selection of pertinent genes involved in the response to DIMT. Data shown represents a
heat map of statistically significant changes in the expression of a number of genes following GSK2617971A treatment in vitro. Experiments were repeated on
three occasions (n=3) and fold change (and statistical significance) was calculated against a 0.1% DMSO control. Any changes in gene expression where p<0.05 are shown (in either direction).
Key:
188
The following conclusions can be drawn from the gene expression data with both compounds…
PGC1α, Foxo1 and Pck1 were the earliest response genes studied in this experiment and were
induced at 1 hour post-treatment with both GSK932121A and GSK2617971A. In response to
complex III inhibition these genes remain constitutively active over the 8 hour time course whereas
following OXPHOS uncoupling expression of these genes gradually declines.
In general the expression of the majority of genes is more time-dependent than dose dependent. This
is highlighted by the down-regulation in many genes in the panel at early time points and increases in
expression at late time points. This is especially pertinent with regards to the effect of both
compounds on Chac1 and Atf3, the FAO induction genes, Lpin1 and Ppar-α, as well as Hmox1 and
G6pd.
The transcriptional activity of Irs2 appears to be transient with a significant elevation of expression
observed at 4 hours post-treatment with both compounds and little effects observed at other time
points.
The nuclear receptor 4-alpha genes, Nr4a1 and Nr4a3, appear to play a role in downstream adaptation
to DIMT, also in a time dependent manner (up to 8 hours) although no effect was observed with
Nr4a2 throughout the experiment.
7.2.4. IN VITRO ELECTRON MICROSCOPY
Another key observation noted in vivo with both compounds was the effect of DIMT on mitochondrial
ultrastructure (both GSK932121A and GSK2617971A) and on the levels of cellular glycogen / free lipid
in hepatocytes (GSK932121A alone). TEM investigations to date have however only been performed at
late time points and largely in conjunction with severe clinical toxicity. The present work sought to
investigate the effects of low concentrations of both GSK932121A (complex III inhibition) and
GSK2617971A (OXPHOS uncoupler) on HepG2 cell ultra-structure with a particular emphasis being
placed on mitochondrial structure and cellular glycogen / lipid levels.
An important consideration of this experiment was however that TEM analysis is costly and low
throughput. Concentrations and time-points selected for analysis were therefore based on effects seen on
lactate generation and gene expression (sections 7.2.2 and 7.2.3 above) and as such were concentrations
where effect on HepG2 cell structure was most likely to be observed. Taking this into account, the effect
189
of GSK932121A on HepG2 cell ultrastructure was assessed at 4 hours and 8 hours post-treatment with
5µM and 10µM concentrations. TEM analysis was performed on GSK2617971A treated cells only at 8
hours and with 1µM and 2.5µM concentrations. Following compound treatment (and at the defined time
point), cells were prepared for TEM analysis as described in section 2.10.2. HepG2 cells were assessed
for mitochondrial morphological abnormalities compared to a time-matched 0.1% DMSO control.
Glycogen and lipid content was assessed (per 100 cells) by counting those containing glycogen clusters
and those which contained more than 1 lipid droplet. Data is shown below in Table 7.2.
Compound and
Concentration
Time Point (Hours
post dose)
% of Cells with
Glycogen clusters
% of Cells with Lipid
droplets
DMSO Control (0.1%) 4 26 16
GSK932121A (5µM) 4 9 21
GSK932121A (10µM) 4 10 9
TABLE 7.2: Effect of GSK932121A and GSK2617971A on the intracellular levels of HepG2 cell glycogen and lipid. (A)
The percentage of cells (per 100 cells counted) containing glycogen clusters and >1 lipid droplet was assessed
following a 4 hour treatment with 5µM or 10µM GSK932121A. (B) The same assessment was made at 8 hours
post treatment with GSK932121A (at the same concentrations as in A) and with 1µM or 2.5µM GSK2617971A.
Whilst providing an interesting insight the lack of experimental repeats makes drawing experimentally
and statistically significant conclusions from the TEM data a challenge. The data shown in Table 7.2
should therefore be viewed as preliminary. At 4 hours post treatment, a reduction in the percentage of
cells containing glycogen clusters was observed following treatment with 5µM and 10µM GSK932121A.
Inconsistent with in vivo observations however was the reduction in cells containing lipid droplets with
10µM GSK932121A. At 8 hours post-treatment with GSK932121A, reductions in glycogen levels were
again observed with 10µM GSK932121A. As cultured cells are more reliant on glucose for cell
metabolism (as opposed to fatty acid), perhaps this explains the lack of lipid accumulation.
A reduction in glycogen stores was also observed with 1µM GSK2617971A at 8 hours although this was
a concentration which showed no effect on lactate generation in vitro and under the same experimental
Compound and
Concentration
Time Point (Hours
post dose)
% of Cells with
Glycogen clusters
% of Cells with Lipid
droplets
DMSO Control (0.1%) 8 21 19
GSK932121A (5µM) 8 25 20
GSK932121A (10µM) 8 12 14
GSK2617971A (1 µM) 8 12 13
GSK2617971A (2.5 µM) 8 22 12
A
B
190
conditions and no effect was observed with 2.5µM. A moderate reduction in lipid levels was observed
with GSK2617971A at both 1µM and 2.5µM however it is presently unknown whether this is a
significant observation (although it would fit with the hypothesis of increased substrate utilization
following OXPHOS uncoupling).
Mitochondrial Morphology
In the same survey sections, the effect of both GSK932121A and GSK2617971A on mitochondrial
morphology was assessed. Analysis of TEM micrographs (data not shown) supports observations made
in vivo which suggest that mitochondrial structural changes occur only at higher exposure levels and at
concentrations which provoke adverse effects. To confirm this (and to validate that mitochondrial ultra-
structural effects can be detected with these compounds in vitro), mitochondrial morphology would need
to be assessed following in vitro treatment with higher concentrations of both drugs, which are grossly
cytotoxic, however time, budget and experimental throughput constraints prevented such analysis in the
present study.
7.2.5. COMPOUND CONNECTIVITY MAPPING
Compound connectivity mapping was performed using SScMap (statistically significant connections’
map) program as described in [146, 147]. It was hoped to identify other molecules with similar
downstream transcriptomic profiles to those of GSK932121A and GSK2617971A, which therefore, may
also modulate mitochondrial function. These could then be used as tools in order to validate observations
made to test if changes are mechanism specific rather than compound-dependent. The 34 most
statistically significant, differentially regulated protein coding genes following GSK932121A treatment
and the 32 most significant genes for GSK2617971A were input into SScMap. These genes were the most
contributory to the separation of experimental variables via principal component analysis (i.e. effect of
drug treatment on gene expression in rat livers). The most significant genes were determined using
Qlucore OE (as described in section 6.2.4). Only the most statistically significant gene alterations were
selected for comparison to avoid connection with other compounds based on marginally changed genes.
Table 7.3 below shows the genes which were submitted to compound connectivity mapping categorised
into their reported cellular function. Common genes which were altered as a result of administration of
both compounds are highlighted in red.
191
TABLE 7.3: Genes submitted for connectivity mapping analysis. The most statistically significant genes in terms of
separating VC gene expression from GSK932121A (34 genes) and GSK2617971A (32 genes) treatment are
shown. Genes have been separated according to biological function (according to the NCBI, Entrez database –
accessed April 2015). Genes shown in red are commonly altered genes with both GSK932121A and GSK2617971A.
Despite the fact that GSK932121A (ETC inhibitor) and GSK2617971A (uncoupler) perturb
mitochondrial function with differing mechanisms, they share 11 transcripts within their respective top
significant gene lists. This opens up the possibility that, independent of mechanism, a common
transcriptional response may exist following treatment with mitochondrially toxic agents. Connectivity
mapping analysis was performed as described in section 2.17.6.
The expression signatures for both compounds were analysed separately with connection scores and p-
values plotted as volcano diagrams (as shown in Fig.7.9). The connection score is calculated from
comparison of query gene signatures with the reference database and therefore any closely related
compounds appear on the far right of the x-axis. Statistically significant data points are located above a
threshold (highlighted by the green line in Fig.7.9A) and therefore closely connected compounds which
have a statistically significant comparison index are located as far right and as high as possible (the top 10
Genes Submitted for Connectivity Mapping
Cellular Function
Gene Symbols
GSK932121A GSK2617971A
Cell metabolism Sds, Ppargc1a, Irs2, Sik1, Lpin1, Nr4a1,
Nr4a3, Coq10b
Sds, Ppargc1a, Irs2, Sik1, Lpin1, Got1,
Ppp1r3b, Mir-122, Pdk4
Cell signalling / signal
transduction
Jun, Gem, Trib1 Jun, Rab30, Rgs16
Cell cycle control /
apoptosis
Mir-505, Insc, Zfp354a, Gdf15, Rhob, Btg2 Mir-505, Btg2, G0s2, Klf6
Cell stress response Atf3, Chac1, Gadd45b, Sult2a1, Sult2a2,
Gadd45g, Il1rn, Alp1, Gstm3
Atf3, Chac1, Hsph1, Hspb1, Upp2, Tnfaip2,
Gadd45b, Cyp1a1 (xenobiotic metabolism)
Transporters Slc16a6 (lactate/ pyruvate, amino acids,
ketones) Slc38a2 (amino acid transporter),
Atp1b1 (Na+ / K+), Slc1a4 (amino acid
transporter)
Slc38a2 (amino acid transporter)
Other cell processes Doc2a (calcium sensing), Egr1 (mitogenesis
and differentiation), Mt2a (binds heavy
metals), Ccrn4l (circadian rhythm)
Igfbp1 (cell growth), Eif4ebp3 (protein
translation), Mt1a (binds heavy metals), S1pr1
(cell migration), Usp18 (protein deubiquination),
P4ha1 (collagen synthesis), Midlip1 (unknown)
192
connected compounds for both GSK932121A and GSK2617971A are shown in Fig.7.9B). Analysis of
volcano plots for both GSK932121A and GSK2617971A identified a single “top-hit” molecule
(azacyclonol) which was highly significant for both drugs in terms of similarity of gene expression
signatures.
193
FIGURE 7.9: Exemplar volcano plot for GSK2617971A / GSK932121A connectivity map and top ten connected
compounds: (A) The sscMap volcano plot generated during comparison of the most statistically significant
genes altered following GSK932121A/GSK2617971A treatment to a reference data set. The x-axis shows
connection score while the y-axis relates to –log10 p-value. The green horizontal line represents a pre-set
threshold of p-value with any data points above the line considered significant. Circled is the most significant
and highly connected compound, Azacylonol (inset).(B) Tables showing top ten connected compounds for both
GSK932121A and GSK2617971A. Connection scores are calculated from comparison of query gene signatures
with the reference database (higher the connection score the more significant the transcriptional similarity).
Azacylondol was the top-hit connection for both GSK932121A and GSK2617971A.
Following identification of azacyclonol as the most significantly connected compound for both
GSK932121A and GSK2617971A, I wanted to explore whether this connection was due to effects on
GSK932121A
Connected
Compounds
Connection
Score
Azacyclonol 7.35
Disulfiram 6.73
Mometasone 6.50
Ciclopirox 6.47
Mefloquine 6.38
Perphenazine 6.35
Astemizole 6.10
Maprotiline 6.04
Tribenoside 6.03
Iocetamic acid 6.02
GSK2617971A
Connected
Compounds
Connection
Score
Azacyclonol 6.04
Ikarugamycin 5.64
Helveticoside 5.42
Lanatoside C 5.31
Strophanthidin 5.29
Haloperidol 5.20
Clozapine 5.12
Econazole 5.06
Dosulepin 5.06
Disulfiram 4.94
Azacyclonol
A
B
194
mitochondrial function or whether it was due to induction of similar genes via a different mechanism. In
order to assess whether azacyclonol provokes a high degree of similarity in gene expression to
GSK932121A and GSK2617971A due to mitochondrial toxicity, I analysed the acute effect of
azacyclonol (purchased from Selleck Chemicals, #S3196) on ETC function and OXPHOS efficiency
using the Seahorse Bioanalyser. The analysis was performed in vitro (in HepG2 liver cells) and ex vivo
(isolated liver mitochondria from a control rat). Data is shown in Fig.7.10 below. Further work is required
to assess whether other significantly connected compounds (listed in Fig.7.9B), cause adverse effects on
mitochondrial function.
FIGURE 7.10: Effect of azacyclonol on mitochondrial OCR in both HepG2 cells and isolated control liver mitochondria.
At the concentrations tested (0.1µM-100µM, n=3) azacyclonol had no significant effect on OCR in either HepG2 cells (A) or isolated liver mitochondria (B), p>0.05 (mean ± SD).
T im e (m in s )
OC
R (
pm
ols
/min
)
0 2 5 5 0 7 5
0
1 0 0
2 0 0
3 0 0
4 0 0
D M S O
0 .1 M
1 M
10 M
50 M
100 M
Oli
go
my
cin
FC
CP
A/R
T im e (m in s )
OC
R (
pm
ols
/min
)
5 1 0 1 5 2 0 2 5 3 0 3 5
-5 0 0
0
5 0 0
1 0 0 0
1 5 0 0
2 0 0 0
2 5 0 0
0 .1 M
1 M
10 M
50 M
100 M
D M S O
A D P O ligom ycin
F C C PA ntim ycin
A
A
B
195
No difference was observed in OCR following treatment with azacyclonol (0.1µM-100µM, n=3)
compared to the DMSO control in either HepG2 cell cultures (Fig.7.10A) or in naive isolated liver
mitochondria (Fig.7.10B). This data suggests that the similarity in transcriptional response between
azacyclonol and both GSK tool mitochondrial toxicants was not due to any effect on the respiratory chain
(either acceleration or inhibition).
To further investigate any mechanistic similarity between azacyclonol and GSK932121A/GSK2617971A
the effect of the compound on both lactate and on intracellular glycogen / lipid stored was investigated
(essentially as described in section 7.2.2 and 7.2.4. above). As shown in Fig.7.11 below no significant
effect on HepG2 cell media lactate concentration was observed following treatment with azacyclonol
(1µM, 50µM and 100µM) compared to a 0.1% DMSO control (n=3, p>0.05). Furthermore, no effect on
the percentage of cells containing intracellular glycogen stores was observed following TEM analysis of
azacyclonol (at 50µM and 100µM only) treated cells at 8 hours. A moderate reduction in the percentage
of cells containing >1 lipid droplet was observed in a dose dependent manner, however further work and
experimental repeats are required to assess whether this change is statistically significant. In addition,
TEM micrographs of HepG2 cells treated with azacyclonol were assessed for the effect of compound
treatment on mitochondrial morphology, however, no effect was observed compared to the DMSO
control (data not shown).
196
FIGURE 7.11: Effect of azacyclonol on both HepG2 cell lactate generation and on the intracellular level of glycogen
clusters and lipid droplets. (A) Effect of azacyclonol (1µM-100µM) on HepG2 cell media lactate
concentration compared to a 0.1% DMSO control (p>0.05, n=3). Data shown is mean ± SD and expressed as a
percentage of DMSO control. (B) The table shows the percentage of cells (per 100 cells counted) containing
glycogen clusters and greater than 1 lipid droplet following an 8 hour treatment with 50µM + 100µM
azacyclonol.
These data indicate that azacyclonol (up to a high concentration of 100µM) has no observable effect on
mitochondrial function and extremely limited effects on cellular metabolism (potential reduction in
intracellular lipid stores). It was therefore decided to perform gene expression analysis, using the same
gene panel as described in section 7.2.3, on cells following treatment with 1, 10 and 100µM azacyclonol
(Fig.7.12). It was hoped this experiment would, (a) help to confirm the connection between azacyclonol
and the two tool GlaxoSmithKline mitochondrial toxic compounds and, (b) help to understand whether
changes in genes on the panel are evoked specifically by mitochondrial toxicants or whether
mitochondrially-inactive compounds (i.e. azacyclonol) induce these genes in the present model.
Compound and
Concentration
Time Point
(Hours)
% of Cells with
Glycogen clusters
% of Cells with
Lipid droplets
DMSO Control
(0.1%)
8 21 19
Azacyclonol (50µM) 8 25 11
Azacyclonol (100µM) 8 18 5
A z a c y c lo n o l
T im e (h o u r s )
0
0
5 0
1 0 0
1 5 0
2 0 0
1 M A zacy c lo n o l
50 M A zacy c lo n o l
100 M A zacy c lo n o l
1 2 4 8
Su
pe
rn
ate
nt
La
cta
te
(%
DM
SO
Co
ntr
ol)
A
B
197
Azacyclonol – Gene Panel Data
FIGURE 7.12: Heat map showing the effect in HepG2 cells of azacyclonol on a selection of pertinent genes involved in the response to DIMT. Data shown represents a heat
map of statistically significant changes in the expression of a number of genes following azacyclonol treatment in vitro. Experiments were repeated on 3
occasions (n=3) and fold change (and statistical significance) was calculated against a 0.1% DMSO control. Any changes in gene expression where p<0.05 are shown (in either direction).
Key:
198
The gene expression data presented in Fig.7.12 lends further credence to the significant connection
(identified using connectivity mapping analysis) between azacyclonol and GSK932121A/GSK2617971A
in terms of the transcriptional response to drug exposure. As observed with both GlaxoSmithKline
compounds, gene expression following azacyclonol treatment appears time dependent rather than dose
dependent with 11 of the 14 genes down-regulated at 1 hour post-treatment compared to a 0.1% DMSO
control and 9 of 14 up regulated by 8 hours post-treatment. In contrast to observations with GSK932121A
and GSK2617971A, azacyclonol treatment does not cause an early (~1-2 hour) induction of the regulator
genes Foxo1 and PGC1α, rather, these genes are induced over time in a similar manner to that of their
downstream effectors. Pck1 is however constitutively up-regulated over the duration of the experimental
time course and this is similar to the response shown with both GSK932121A and GSK2617971A. Unlike
both GSK932121A and GSK2617971A, Nr4a1 and Chac1 do not appear to be effected by azacyclonol
treatment in vitro.
Despite the similarity in transcriptional responses, I have demonstrated that, unlike both GlaxoSmithKline
tool mito-toxicants, azacyclonol has no effect on the mitochondrial ETC or OXPHOS or on lactate
generation in vitro. There was also no change in the levels of glycogen stores in HepG2 cells although a
slight reduction in lipid stores was noted following TEM analysis. This highlights that induction of genes
included in the present gene-panel can be stimulated by compounds with no effect on mitochondrial
function and therefore lacks specificity.
7.3. Discussion
7.3.1. MITOCHONDRIAL TOXICITY, CYTOTOXICITY AND LACTATE GENERATION
A key gap of the in vivo studies performed to date is the ability to differentiate primary from adaptive
changes due to the use of high doses and/or late time points. Essential for the detailed characterisation of
a toxicological event these experimental studies are not designed to determine the toxicological sequence
of events. The ideal scenario would be to perform an in vivo study with multiple time points after dosing
of the animals in order to analyse the order in which the key changes take place. However, due to time
and practical constraints this was not possible. As an alternative, the progression of events was explored
in vitro and importantly at concentrations of drug which were not notably toxic. Studying endpoints
which had proven sensitive in vivo (i.e. lactate, electron microscopy and gene expression analysis) it was
199
possible to identify essential changes which, a) are primary to the mechanism of action for the drugs and
may be key to the downstream events within the AOP and b) could be measured in future studies to assess
potential underlying damage to mitochondria.
The effect of both GSK932121A (ETC inhibitor) and GSK2617971A (uncoupler) on both cell
metabolism and cytotoxicity was assessed in HepG2 cells. For both drugs a concentration range was
determined whereby drug-induced effects were observed on cell metabolism but at an exposure level
where no obvious signs of cytotoxicity was evident. It was hypothesised that this would be a narrow
concentration range due to the classical steep dose-response often exhibited by mitochondrial toxicants
[245]. This hypothesis proved relatively valid in relation to GSK932121A and GSK2617971A with a
concentration range of 1µM-10µM and 0.1µM-2.5µM selected for analysis respectively. LDH leakage
and light microscopy analyses (not shown) were used as the measure of cytotoxicity in the present study
as many other cytotoxicity detection assays are in fact measures of mitochondrial activity (e.g. ATP
assays, MTT tetrazolium assay) and as such may over-predict cytotoxicity to our mitochondrial acting
compounds [246]. Disadvantages of the LDH leak/lyse assay however includes the lack of sensitivity to
mild cytotoxic insult and the limited half-life of LDH in culture medium. Following identification of the
optimal concentration window for studying more subtle underlying mitochondrial effects, the
consequence of both GSK932121A and GSK2617971A treatment on a selection of pertinent endpoints
relating to the effects observed in vivo was assessed.
Increases in blood lactate were observed in vivo following treatment with both GSK932121A and
GSk2617971A although generally at high exposure levels. The present work sought to understand
whether sub-toxic concentrations of mitochondrial toxicants provoke an increase in lactate at the cellular
level. These data show that both compounds do cause an increase in media lactate although the effect was
only observed at 4 and 8 hours with ETC inhibition and 8 hours only following uncoupling. This is in
contrast to immediate increases in ECAR observed following OXPHOS uncoupling in vitro however, as
described by Dranka and colleagues it is important to acknowledge that ECAR measurement is based on
pH alteration and is therefore not a direct measure of glycolysis [247]. Lactate has been suggested as a
potential biomarker of mitochondrial perturbation and this may be justified based on its continued
presence downstream of mitochondrial toxicity [230]. Whilst a useful mechanistic indicator, the data
presented here suggests that increases in lactate in systemic circulation or in cell media is not an early
consequence of mitochondrial dysfunction, but rather its generation is a delayed consequence of the
200
metabolic disruption and a significant switch to glycolysis. This is supported by Limonciel et al [143]
who propose that lactate is a more promising biomarker of cell stress in long term repeat dose in vitro
toxicology testing with many of the compounds used to validate their findings modulators of
mitochondrial function.
7.3.2. GENE PANEL DISCUSSION
A gene panel was assembled based on key genes affected by both GlaxoSmithKline tool compounds in
vivo. Striking similarity was observed in the transcriptomic signatures in rats following treatment with
both compounds opening up the possibility of creating a gene panel for the detection of mechanism-
independent/generalised DIMT. The main issues relating to gene panels are however that gene expression
does not necessitate protein translation and inferring biological function from changes in gene expression
remains extremely challenging. This is especially pertinent in the present study as the gene panel was
comprised largely of stress-response genes and as such the induction of many genes on the panel have
previously been reported following a diverse array of signals and for a wide range of cellular functions.
For example the expression of PGC1α has been attributed to the control of cell metabolism [248],
mitochondrial biogenesis [249], the anti-oxidant system [250], the determination of muscle fibre type
[251] amongst others, and this leaves the precise nature of its induction unknown. Furthermore, the
expression of many of the genes on this panel have been described following administration of various
xenobiotics with very differing MOA’s suggesting they are unsuitable as specific biomarkers of
mitochondrial dysfunction. Despite this, it is important to acknowledge that no inferences have to date
been made between any genes involved in the panel and DIMT. As such they all constitute novel
mitochondrial-toxicity signature genes.
GSK932121A and GSK2617971A induced the expression of PGC1α and Foxo1 in vivo and in vitro. As
well as its role in inducing mitochondrial biogenesis, PGC1α is induced under numerous stress conditions
such as fasting (i.e. periods of low glucose) or energy deprivation. PGC1α in turn coordinates the activity
of several transcription factors on the promoters of genes involved in the control of cell metabolism (β-
oxidation, ketogenesis and heme-biosynthesis) within or external to the mitochondrion [252].
Additionally PGC1α co-activates the transcription factor, Foxo1, which in turn coordinates the expression
of genes involved in insulin-regulated gluconeogenesis [155, 253]. In the present study both PGC1α and
Foxo1 were the earliest genes to be differentially up-regulated following treatment with GSK932121A
201
and GSK2617971A (by 1 hour post-treatment). Induction is therefore likely a primary response but
inferring the biological function of their up regulation is a challenge. However, taking into account the
increase in expression is observed prior to induction of numerous PGC1α-Foxo1 downstream effector
genes (i.e. Pck1, Irs2, Pdk4, Lpin1, Hmox1 and G6pd) it can be speculated its induction is related to
control of energy metabolism and specifically induction of gluconeogenesis. There is however a distinct
paucity of data in the literature which describes the effect of various drug-toxicities on the PGC1α -Foxo1
axis and therefore, further work is required to understand their role within a toxicological response
pathway.
In the present experiment the induction of the majority of PGC1α -Foxo1-dependent effector genes occur
at later time points following PGC1α -Foxo1 co-activation. The exception is however the Pck1 gene
which encodes the phosphoenolpyruvate carboxykinase 1 enzyme, responsible for the first committed
step in gluconeogenesis [254]. This gene is induced following activation of the Pck1 promoter by the
PGC1α -Foxo1 complex however, in the present study, its expression appears to be increased alongside
both PGC1α and Foxo1 at the 1 hour time point. Induction of Pck1 may therefore be an early biochemical
adaptation of impaired mitochondrial function with this conclusion suggestive that cells can sense the
requirement to generate glucose from non-carbohydrate sources very early in the AOP following
mitochondrial perturbation.
Another key effect noted in vivo was the effect of both compounds on the NR4a gene family and in the
present study both mitochondrial toxicants induced expression of Nr4a1 and Nr4a3 in a time dependent
manner up to 8 hours. The early-response Nr4a genes are induced by various extracellular signals and
stressors (e.g. glucose, growth factors, inflammation and apoptotic signals) and with this diversity of
pathways regulating Nr4a expression it is likely that the biological function of these receptors is cell-type
specific [255]. In the liver however there is strong evidence linking NR4a expression with cellular
regulation of hepatic glucose metabolism with activation caused by reduced glucose levels [255]. This
data is the first known link between NR4a induction and DIMT with induction likely due to increased
levels of glycogenolysis. Drug induced agonists which promote expression of the NR4a gene family have
been described (e.g. 6-mercaptopurine [256] and both the benzimidazole [257]/isoxazolopyridinone [258]
chemical classes) but without direct association to perturbation of mitochondrial function.
202
Metabolomics data in chapter 4 identified continued efforts to drive FA β-oxidation despite respiratory
chain compromise. This adaptation was generally under-represented in terms of the transcriptomic
analysis with a significant increase in Lpin1 being the only sign of transcriptional regulation of FAO. In
relation to OXPHOS uncoupling it is widely acknowledged that FA substrate utilization is a key feature
of the resulting AOP and again Lpin1 was significantly up-regulated. Lpin1 is also activated by PGC1α
and together they selectively activate a subset of PGC1α target pathways including FAO. Lpin1 is known
to induce activation of Ppar-α and this was observed in the present study whereby generally Lpin1
activation appears earlier than Ppar-α induction. Importantly Lpin1 also has a role in the cytosol as a
Mg2+-
dependent phosphatidate phosphatase type-1 (PAP1) involved in the synthesis of glycerolipids.
Despite its up-regulation alongside PGC1α and Ppar-α (suggesting its role is related to its function as a
transcriptional co-activator in the nucleus), its expression for the purposes of its cytosolic enzymatic
function cannot be ruled out. Either way, Lpin1 upregulation was observed with both compounds in vitro
and in vivo and as such the data suggests it plays a central role in the progression of mitochondrial
toxicity by promoting FAO.
Large increases in both Atf3 and Chac1 were noted in the liver in vivo following DIMT with both
mitochondrial toxicants (especially GSK932121A). Chac1 specifically, is heavily implicated in the ER
stress pathway and is pro-apoptotic with glutathione degrading activity (GSH reduction being a key event
in the progression of GSK932121A toxicity) [259]. Meanwhile, Atf3 is a well-known stress response
gene which is induced to a wide range of stress signals including drug toxicity [260]. Atf3 is able to both
repress and activate gene expression and is reportedly involved in the inflammatory response [261], the
regulation of ER stress mediated pathways, eukaryotic initiation factor kinase 2 stress response, amino
acid starvation [244], mediation of glucose homeostasis [262, 263], tumorigenesis [264] and cell death
[265]. Like many other genes induced in this study, the wide range of cell processes reportedly associated
with Atf3 makes building mechanistic assessments challenging. Further data is required to better
understand the exact role of both Chac1 and Atf3 in the cell stress response following mitochondrial
perturbation.
7.3.3. THE LINK BETWEEN AZACYCLONOL AND GSK932121A AND GSK2617971A
The striking similarity in the transcriptional response to both GSK932121A and GSK2617971A was
highlighted upon performing connectivity mapping analysis. Despite their very different MOA’s the
203
transcriptional response they elicit was significantly connected with one other compound within a
database of over 1000 small molecules. The connection between the transcriptomic profile following
azacyclonol treatment and exposure to both GSK932121A and GSK2617971A was highly statistically
significant and opened up the possibility that azacyclonol may be toxic to mitochondria. Azacyclonol
could rationally then be used to validate mechanistic observations with both GlaxoSmithKline
compounds and as a new tool compound of DIMT. It is important to acknowledge however that despite
the differing mechanisms of action of GSK932121A and GSK2617971A (i.e. complex III inhibition
versus OXPHOS uncoupling), the resulting hepatocellular transcriptional similarity may be due to shared
key events in the resulting AOP/MOA’s (most notably perhaps being a decline in ATP and increased
glycolytic function).
Mechanistic investigations suggest that, unlike GSK932121A or GSK2617971A azacyclonol (up to
100µM), does not adversely affect mitochondrial function nor provoke an increase in supernatant lactate
levels. Furthermore azacyclonol has no effect on mitochondrial morphology or on the levels of
intracellular glycogen clusters although a moderate reduction in the levels of lipid was observed. This
data suggests very little similarity in the biochemical response following azacyclonol treatment compared
to both GlaxoSmithKline compounds despite a similar transcriptional response being first suggested (by
connectivity mapping) and then confirmed (gene-panel data in the present study).
Azacylonol is best known as the N-dealkylation product of terfendaine metabolism [266]. Terfenadine
was withdrawn from development due to reports of QT-interval prolongation and cardiac arrhythmias and
although rapidly metabolized in the liver, azacyclonol was never attributed to the terfenadine toxicity
[267]. In fact, azacyclonol was briefly investigated as an anti-psychotic agent in schizophrenic individuals
and although not being sufficiently efficacious, it was well tolerated in humans which, unlike both
GlaxoSmithKline mitochondrial toxicants, sums up its minimal safety profile [268, 269]. It remains
unknown why it induces a similar gene expression signature to two potent mitochondrial toxins.
Computational analyses were performed to assess whether transcriptional similarity was caused by any
chemical/structural similarity between azacyclonol and either/both of GSK932121A/GSK2617971A.
Using Tanimoto coefficient, essentially as described in [270], low comparative similarity scores of 0.16
and 0.13 were achieved in terms of comparing azacyclonol to GSK932121A and GSK2617971A
respectively (with a score of 1 indicating high structural similarity). In addition, a ligand based target
204
prediction was performed in ChEMBL, to assess any overlap between azacyclonol and either/both of
GSK932121A/GSK2617971A from a target-based perspective. Taking into account the top ten target
predictions for all three compounds, no overlap was observed. These analyses (raw data not shown)
suggests no theoretical association between azacyclonol and either GlaxoSmithKline tool compound
based on structural similarity or target prediction.
This association does however provide some important learnings for the future. Whilst the present work
has highlighted the involvement of genes such as PGC1α, Foxo1, Irs2, Pdk4, Pck1, Lpin1, Nr4a1 and
Atf3 in the response to mitochondrial perturbation, similar responses are observable following treatment
with mitochondrially-inactive compounds (i.e. azacyclonol). This therefore suggests that these genes are
unsuitable as specific biomarkers of mitochondrial toxicity. Furthermore, the present work emphasises
that transcriptional similarity does not always correspond to mechanistic-likeness and as such, the process
of searching for and validating highly specific single-gene or gene-panel biomarkers always requires
additional context and validation. The implication is also that, whilst the lack of a gene change likely
rules out involvement, existence of such a change on its own does not confirm involvement in an effect.
Furthermore, gene changes cannot be used as strong-supporting evidence in the construction of an
AOP/MOA.
7.3.4. SUMMARY
In summary the following conclusions can be drawn from this study.
Concentrations of 0.75µM-10µM GSK932121A (complex III inhibition) and 0.1µM-2.5µM
GSK2617971A (OXHOS uncoupling) cause significant perturbation to mitochondrial function
but are sub-cytotoxic in HepG2 cells at a gross cell level.
Sub-toxic concentrations of both GSK932121A and GSK2617971A only effect HepG2 cell
lactate generation at 4-8 hours post-treatment and as such this may be a delayed adaptive response
to perturbation of energy production rather than an early mechanistic event.
PGC1α, Foxo1 and Pck1 are early response genes following GSK932121A/GSK2617971A
treatment which is followed by time-dependent up-regulation in the NR4a genes (NR4a1/3), the
PGC1α -Foxo1 effector genes (Hmox1, G6pd and Irs2), the FAO activation gene (Lpin1) and the
stress response genes (Atf3 and Chac1).
205
Minimal effects on mitochondrial or cellular morphology were observed up to 8 hours post
treatment with GSK932121A and GSK2617971A suggesting structural changes occur at later
stages and at higher (potentially toxic) concentrations.
Compound connectivity mapping analysis identified azacyclonol as the most statistically
significant similar compound compared with both GSK932121A and GSK2617971A in terms of
the respective transcriptional response to drug treatment. This striking observation highlights the
similarity in transcriptional response following complex III inhibition and OXPHOS uncoupling
in vivo. Despite transcriptional similarity, azacyclonol did not mimic the biological action of
either compound as no effect on mitochondrial function, lactate generation or glycogen stores was
observed in vitro. Gene expression analysis confirmed transcriptional similarity to both
GlaxoSmithKline compounds suggesting that the gene panel used in this study is not specific to
DIMT.
This study supports the use of a systems approach as a combination of endpoints, in a multivariate
model (e.g. genes and metabolites/ functional changes etc.), may be required for good early
predictions.
Further work should involve a timed-kill study in rats, in order to assess the effect of compound treatment
at the tissue-level, at both early and progressive time points in vivo. Further work should also involve the
effect of GSK932121A and GSK2617971A on PGC1α, Foxo1 and Pck1 protein concentration (i.e. using
Western blot) as these genes constitute the earliest transcriptional markers induced following treatment
with tolerated concentrations of mitochondrial toxicants studied to date. Further work may also focus on
whether any of the top 10 similar compounds for both GSK932121A and GSK2617971A effect
mitochondrial function as only azacyclonol was explored in the present work.
206
8.0. THESIS DISCUSSION
207
Drug induced mitochondrial dysfunction is associated with some severe clinical toxicities resulting in
adverse human suffering. Despite the progress made, defining mechanisms of DIMT even in the common
pre-clinical test species (e.g. rat and mouse) remains difficult and the challenge is even greater when
extrapolating to humans. The overall aim of this thesis was to use a systems approach (i.e. the use of a
wide range of endpoints which are multi-faceted in scope) to improve current understanding of the
mechanism and consequences of DIMT in vivo and relate these findings to in vitro observations using tool
compounds.
On personal reflection and by the very nature of the project, this was an ambitious challenge. In hindsight,
I would have focussed more on a particular area in the field (i.e. mechanisms of DIMT specifically in
liver injury or with a particular sub-set of mitochondrial toxicants) as this added level of focus may have
aided more tailored investigations and as such, further progress. Despite this, the challenge provided the
opportunity for substantial scientific advancement and project diversity.
The overall aim of the thesis was broken down into a series of sub-objectives which are discussed below.
8.1. Manifestation of Mitochondrial Toxicity in vitro versus in vivo
The first sub-objective was to test the hypothesis that in vitro assessment of mitochondrial function (i.e. in
vitro cell lines or in vitro testing of drugs on naïve isolated mitochondria) adequately reflects what occurs
in vivo and is therefore a useful means of assessing the potential for mitochondrial toxicity in preclinical
hazard identification. In vitro analysis of DIMT is used in the pharmaceutical industry both for screening
activities and for making mechanistic assessments. The effect of two tool compounds, GSK932121A
(complex III ETC inhibitor) and GSK2617971A (OXPHOS uncoupler) was assessed, to identify how
mitochondrial toxicity manifested both in vitro and in vivo.
In vitro, both GSK932121A and GSK2617971A acted as expected and in line with other respiratory chain
inhibitors and OXPHOS uncouplers respectively. With regards to the effect of both compounds on OCR
in vitro, the direction of change observed was as anticipated i.e. GSK932121A caused a reduction in OCR
and GSK2617971A caused a biphasic increase in OCR. As expected, both compounds decreased the CRC
of freshly isolated control liver mitochondria in vitro due to impairment of the mitochondrial ΔΨ. This
suggests that in vitro studies have utility in assessing mechanisms of DIMT (i.e. by comparing the
208
response to classical tool-molecules with similar mechanisms) though on a number of occasions, the
direction of change observed in vitro was seen to be opposite to that observed in vivo.
Mitochondria isolated from the kidney of rats treated in vivo with GSK2617971A showed an unexpected
decrease in all OCR parameters This is likely due to high levels of exposure in the kidney since the drug
is predominantly cleared via the renal route, coupled with the fact that OXPHOS uncouplers generally
exhibit a bell-shaped response curve (i.e. reducing OCR at high concentrations). This is a key learning
with regard to selecting the most sensitive endpoints to detect drug-induced OXPHOS uncoupling
following in vivo treatment in future studies. Assays of CRC and ΔΨ in mitochondria isolated from
treated animals provided a more sensitive indication of OXPHOS related toxicity in the present studies
than OCR, with findings more consistent with the OXPHOS mechanism of action (i.e. dissipation of the
ΔΨ and reduction in CRC). It is therefore advisable to use these assays, in preference to the OCR assay,
when analysing the effect of OXPHOS uncouplers in vivo.
Mitochondria isolated from rats treated in vivo with GSK932121A demonstrated unexpected yet clear
differences with data obtained in vitro, namely an increase in basal OCR and CRC in mitochondria from
treated animals compared to control. Whilst seemingly contradictory these observations likely represent
an adapted state in vivo resulting from the initial insult in combination with the compensatory response of
the animal/tissue to energy deprivation. Only the initial, unconfounded response is observable in vitro.
Whilst acidosis and the resulting densitisation of the mPTP to calcium-induced pore triggering is
proposed to be the cause of the increase in CRC in mitochondria from GSK932121A treated rats, the
exact reason for the increase in OCR remains unknown. Hypotheses include washout of GSK932121A
during the isolation procedure, increased levels of ROS-induced proton leak and stabilisation of a
mitochondrial subpopulation in GSK932121A treated animals due to reduced mPTP triggering.
Whatever the mechanisms involved, it is now evident that consideration of both the in vitro and in vivo
data is essential; neither on its own would have been sufficient. The in vitro data informs on the likely
molecular initiating event and initial (non-confounded) respiratory response, whist the in vivo data
provides a view of the integrated state of the mitochondria in response to the initial insult plus the
compensatory adaptations occurring in the tissues and organism.
209
8.2. The Use of a Systems Approach to Generate AOP’s
The second sub-objective was to assess the utility of using a systems approach in order to highlight the
underlying mechanisms downstream of mitochondrial perturbation in vivo. Systems toxicology
encompasses the integration of classical toxicology (e.g. pathology, clinical chemistry) with, a) novel
methods of evaluation, in this case functional mitochondrial changes and b) with the quantitative analysis
of large networks of molecular changes occurring across multiple layers of biological organisation, in this
case transcriptomic and metabolomics assessments. A systems approach is particularly useful when the
mechanisms are either completely unknown or where only little understanding exists. To build upon
already existing knowledge of an adverse drug reaction, targeted evaluations may be more useful. Given
the complexity of the downstream mechanisms of DIMT relating to respiratory chain inhibition (chapters
3-5) or OXPHOS uncoupling (chapter 6) in vivo, a systems approach seemed the most suitable.
For GSK932121A, evaluations included classical toxicology (serum biochemistry and histopathology),
novel methods of evaluating mitochondrial function, glutathione profiling, TEM, body temperature etc;
along with the use of global “omics” approaches (transcriptomics and metabolomics). Whilst this
provided a truly system-level view from which to build an AOP for complex III inhibition (described in
chapter 5) determining the key events between the primary molecular initiation event (compound binding
to the Qi site of cytochrome bc1 and inhibiting ETC) and the adverse outcome was very challenging. This
was made harder in this case here because the progression of toxicity was so rapid (within 5 hours),
making identification of the order of events difficult. For this reason, the study design is of paramount
importance and generation of AOP/MOA’s should be augmented by existing literature data with other
compounds with similar mechanistic activities.
Effects of both time and dose should be investigated. The complex nature of toxicological adaptation
makes identifying primary consequences from adaptive secondary events a major challenge. For example,
despite extensive investigations throughout this thesis looking into lactate generation, it still remains
unknown whether this is a primary event following DIMT or whether this occurs downstream of
prolonged perturbation in energy production. This example highlights a key learning. Regardless of the
number of endpoints selected for analysis, the study design is fundamentally crucial to be able to generate
AOP’s. Time and dose responses are required in order to make informed judgements of the key events in
an AOP and answer difficult questions such as; in the absence of any single key event does the adverse
210
outcome manifest? Are there any modifying factors, which when present, effect the progression or
severity of the adverse outcome?
For both GSK932121A and GSK2617971A further work is required in order to investigate lower doses
and earlier time points, using data presented in this thesis as a starting point to help design the studies and
select endpoints that will provide the best possible opportunity to clarify uncertainties remaining in both
AOP’s. An example of such a study would be to investigate the effect of a 14-day repeat dose exposure to
the well-tolerated 12.5mg/kg dose of GSK932121A to identify effects on liver histopathology,
mitochondrial function and body temperature. This would bring insight from the present work into the
repeat-dose scenario and therefore be more representative of the study designs used commonly in drug
development with small molecules.
In addition, it is important to acknowledge that observations made post-treatment with both
GSK932121A and GSK2617971A cannot purely be attributed to their toxicological effects. For example,
observations made following administration of GSK2617971A in vivo may be caused by the drugs action
as a selective androgen receptor modulator as oppose to simply its effects on mitochondrial uncoupling. A
way of delineating “on target” therapeutic effects (i.e. effects as a SARM) from “off-target” effects (i.e.
effects as an uncoupler) would be to have included a positive control non-SARM OXPHOS uncoupler
(e.g. 2,4-DNP) in all studies, alongside GSK2617971A and compared the differential responses (e.g.
transcriptomic signatures) to both molecules. Although this was not feasible due to time constraints this
work is necessary to validate the AOP/MOAs.
The definitive list of AOP’s which are validated to-date are on the AOP-Wiki web-page
[https://aopkb.org/aopwiki/index.php/Main_Page] along with guidance documentation, written by the
Organisation for Economic Co-operation and Development (OECD), on developing and assessing AOP’s
[271]. This was based around advancement (but importantly not replacement) of the existing, mode of
action (MOA) approach which involved the description of a biologically plausible sequence of key events
and processes. This document proposes a weight-of evidence based approach with a tailored set of
Bradford Hill considerations whereby the level of confidence of all endpoints is scrutinised for biological
plausibility, reproducibility, relationships between key events and apical endpoint, assay reliability and
key event essentiality [272]. Table 8.1 below represents the differences between toxicity pathways,
MOA’s, AOP’s and source to outcome pathways.
211
TABLE 8.1: Representation of the relationships between Toxicity Pathways, Mode of Action Pathways, Adverse Outcome
Pathways, and Source to Outcome Pathways. Orange bars represent the breadth of reach common to these concepts. The grey boxes represent the theoretical extent of the concepts. Adapted from [271].
The weight-of evidence based approach described in the OECD white-paper is similar in many regards to
the AOP/MOA hybrid approach taken in chapter 5 to detail the observed acute toxicity with
GSK932121A (complex III inhibition). The approach was not taken with GSK2617971A (chapter 6) due
to having less data available in order to distinguish key events from PKE’s and associated events.
Consideration of alternative explanations for the key AOP observations is imperative as there is often
more than one plausible pathway and as a result, the hybrid AOP/MOA framework is a useful progressive
step in the development of a fully validated AOP. For any investigation which aims to identify a
mechanism of toxicity, the intelligent use of a systems approach is helpful and in some cases crucial.
Following initial identification of fundamental key events and the preparation of a draft AOP/MOA
hybrid (such as that displayed in chapter 5), studies should then be designed for more targeted
evaluations, with refined doses and time-points to clarify uncertainties in the AOP/MOA and progress
towards a full AOP. The AOP-Wiki provides a validation-procedure which provides the opportunity for
other users to comment and edit AOP proposals prior to formal review by both the OECD and Extended
Advisory Group on Molecular Screening and Toxicogenomics (EAGMST). This level of peer-review is
critical for the generation of reliable and informative AOP’s which have utility in future drug/chemical
risk-assessment.
Environmental
Containment
Exposure MIE Organelle
and
Molecular
Effects
Cellular
Effects
Tissue
Effects
Organ
Effects
Organ
Systems
Effects
Individual
Effects
Population
Effects
Community
Effects
Toxicity Pathways
Mode of Acton
Adverse Outcome Pathway
Source to Outcome Pathway
212
8.3. Markers of DIMT in the Absence of Overt Toxicity
The third sub-objective of the thesis was to set the groundwork for identifying markers of DIMT that
change prior to the onset of overt toxicity. Importantly, this effect can be assessed either at low (sub-
toxic) doses or at earlier time-points with a higher (toxic) dose.
In the past, drugs have been withdrawn from the market due to toxicity which was subsequently identified
to be associated with mitochondrial dysfunction that was not overtly evident throughout pre-clinical and
clinical trials (troglitazone being a key example). This may be due to the fact that damage to mitochondria
was not detected in preclinical trials since mitochondrial functional changes have historically not been
assessed or because the underlying effects are asymptomatic (e.g. erosion of reserve capacity).
Mitochondria are able to respond to a certain level of direct or indirect stress by utilisation of an innate
reserve capacity and this mitochondrial-resilience prevents the immediate onset of toxicity early in drug
development. In vivo markers of mitochondrial damage which change prior to the onset of overt toxicity
would be of immense value in monitoring the potential safety of molecules with some degree of
mitochondrial activity but which are generally well tolerated in animals.
The most striking sub-toxic marker of underlying mitochondrial changes in vivo (identified in the present
work) was measurement of CRC; for example administration of GSK2617971A to rats at a dose which
caused no adverse clinical effects or body temperature alterations (30mg/kg) caused a significant
depletion of CRC in isolated liver and kidney mitochondria. Mitochondrial functional measures,
particularly CRC, may therefore be an informative marker of potential underlying DIMT in preclinical
studies and this potential is now being investigated further in follow up studies within GlaxoSmithKline.
Although extremely valuable in pre-clinical evaluations, CRC analysis in isolated mitochondrial fractions
is not easily translatable to human trials due to the need for tissue. It is for this reason that more accessible
markers of DIMT; for example, in bio-fluids or biopsy samples are being sought. Hence the plasma
metabolite findings, described in chapter 4, are of particular value.
Metabolomics analyses identified a number of potential markers of DIMT prior to the onset of clinical
signs following GSK932121A treatment. These included changes in the fatty acyl carnitines
palmitoylcarnitine, oleylcarnitine and stearoylcarnitine, the ketone body BHBA and amino acid
catabolism marker AHB. Importantly, whilst these metabolomic changes can inform about the metabolic
213
adaptation due to perturbed energy generation the fact is they closely resemble other conditions such as
metabolic syndrome and insulin resistance. Consequently any markers derived from this work need to be
applied with this in mind until further validation work is performed. For example, they may be best used
in scenarios where mitochondrial activity is known or suspected with a candidate molecule and used for
monitoring purposes rather than as routine biomarkers run on every in vivo study, such as standard
clinical pathology makers. It is however my opinion that further work is warranted due to the potential
translatability of these measurements to humans. Without taking these findings forward and generating
further data with other mitochondrial toxicants it is impossible to determine the potential utility of these
endpoints in terms of DIMT.
Chapter 7 focussed on identifying markers of DIMT in vitro at sub-cytotoxic concentrations of both
GSK932121A and GSK2617971A using endpoints shown to be sensitive in vivo. Genes involved in the
induction of gluconeogenesis, specifically the switch genes PGC1α and Foxo1 and the gene encoding the
rate-limiting step in gluconeogenesis (Pck1) were induced early following treatment of HepG2 cells with
sub-cytotoxic concentrations of both drugs. Like the mitochondrial functional endpoints described above,
measurement of these genes may prove valuable in future pre-clinical assessments although, connectivity
mapping analysis raised questions about their specificity as markers of DIMT, as the expression of many
changed in response to a molecule with no obvious effect on mitochondrial function (azacyclonol).
In addition to the potential identification of biomarkers, the work presented here has provided invaluable
mechanistic insight. Sub-toxic markers help identify primary toxicity from adaptive cell events in the
development of an AOP/MOA (as described above). For example, studies presented here have revealed
that potentiation of calcium-induced mPTP does not necessarily provoke a clinical outcome and is
therefore an early event in the AOP. Additionally it has been noted that, induction of genes involved in
the gluconeogenic response is an early consequence and biomarker of dysfunctional mitochondrial
ETC/OXPHOS systems.
The withdrawal of a number of drugs due to toxicity which was later discovered to involve perturbation
of mitochondrial function highlights a gap in current drug development methodologies, namely the
apparent insensitivity of the commonly used animal models to mitochondrial perturbation. This may
reflect the metabolic state of the animals currently used in pre-clinical studies that are generally young,
healthy and possess a large reserve capacity allowing them to readily adapt to stress. This is at odds with
214
many patient groups whose metabolic capacities are eroded by co-morbidities, co-medication, age,
genetics, lifestyle etc. This apparent lack of concordance between the current pre-clinical animal model
and the patient population is illustrated by Fig.8.1 below.
FIGURE 8.1.: Graphical representation of the relative metabolic states of potential target patient populations and the
commonly used preclinical animal species.
A potential option to address this issue is to increase the metabolic burden on the animals alongside drug
treatment, for example increasing the exercise demand, co-administering with other molecules which alter
metabolic demand/function or using older animals. For example, in a recent GlaxoSmithKline study (data
not shown) a candidate drug which had been well-tolerated in 14 day oral toxicity studies (despite
histopathological changes in cardiac tissue) was co-administered with dobutamine (a cardiac β1 receptor
agonist used to stimulate heart contraction). This uncovered physiological changes in cardiovascular
function which were absent in either drug alone or dobutamine alone controls. Other options are to
explore the use of transgenic animal models in which metabolic capacity is affected, which may be more
representative of patients in terms of underlying mitochondrial function. An example would be Sod2+/-
mice which have been shown to be more sensitive to troglitazone-induced liver injury highlighting the
increased sensitivity of this mouse model to DIMT [273].
REPRESENTATIVE?
Metabolic State
High-performing
endurance
athletes
Target Patient
Group?
(Elderly, co-
morbidities?)
Pre-clinical
animal species
(e.g. Laboratory
rats)
%
Population
215
What remains clear is that markers which can inform on mitochondrial perturbation prior to the onset of
overt toxicity or the use of animals models that are more representative of patients with regard to
metabolic status would be of immense value. This would enable improved monitoring of molecules with
some degree of mitochondrial activity in vitro and ultimately improve drug safety for patients.
8.4. Future Work
Validation work with additional tool compounds is required to confirm that the observations made with
GSK932121A and GSK2617971A are mechanism related and not specific to the individual compounds
(i.e. many of the effects observed following administration of GSK2617971A for example may be due to
its activity as a SARM as opposed to just its uncoupling effects). Compounds such as antimycin A, and
2,4-DNP or other terminated GlaxoSmithKline molecules with the right properties, could be considered.
Future studies should include tissue-collection at early time-points to determine exactly when
mitochondrial functional changes occur and to provide a time course for more in depth transcriptomic
work.
Critically, the potential markers highlighted by the in vivo studies presented (ranging from body
temperature, through biochemical analyses to mitochondrial functional endpoints) should be tested in
chronic repeat-dose studies with mitochondrially-active compounds, at tolerated doses, to see if low level
chronic reductions in mitochondrial function can be detected in the absence of overt toxicity. These
studies should accurately represent the study designs used for standard regulatory toxicology work to test
the utility of these markers in a standard study setting. Potential biomarkers of DIMT in plasma (i.e.
acylcarnitines, BHBA and AHB) should also be tested to see if they are robust and reproducible and as
such, potentially translatable to the clinic.
As described in section 8.3 above, the animal models currently used in drug safety assessment appear
relatively insensitive to DIMT. This represents a significant gap that might be improved by the use of
more sensitive animal models (although there is a dynamic move to reduce reliance on animal models in
R&D and replace them with non-animal approaches where possible). Early investigations should follow
up on existing work using the Sod2+/-
mouse model (increased levels of oxidative stress) or with co-
administration study designs. Ethically it will be important not to place the animals under unnecessary
216
stress. Any observed exacerbation of toxicity with known mito-toxicants compared to the effects observed
in controls may indicate a more suitable model for the detection of underlying, asymptomatic DIMT.
The corresponding protein levels of the key genes identified following DIMT (e.g. PGC1α, Foxo1 and
Pck1) should also be explored downstream of DIMT both in vitro and in vivo, via Western blot, as gene
expression changes are not always representative of protein translation/expression. It would also be
interesting to modulate the expression of these genes via RNA interference (RNAi) in vitro, and analyse
the effect of this knockdown following treatment with mitochondrial toxicants, specifically whether gene
knockdown confers resistance or exacerbates the effect of DIMT.
Further work should also focus on the intelligent mining of existing data relating to mitochondrial
function in the pharmaceutical industry. The creation of computational tools to visualise, analyse and
identify compounds and structures with varying degrees of mitochondrial activity (not just necessarily
toxicity) would be invaluable both in selection of tool molecules, re-positioning of assets between
discovery programmes (i.e. a compound which inhibits the mPTP, and thus delays cell death, may not be
beneficial to oncology programmes but may be extremely beneficial to stress and repair groups), and to
build structure activity relationship (SAR) paradigms.
8.5. Summary
This thesis has focused on using a systems approach to understand mechanisms of drug induced
mitochondrial toxicity in vitro and in vivo, specifically using compounds which inhibit the mitochondrial
ETC complex III (GSK932121A, chapters 3-5) or uncouple OXPHOS (GSK2617971A, chapter 6). This
type of evaluation is rarely seen in the literature, particularly with novel pharmaceutical candidates (albeit
terminated ones) and as such will be of particular interest to those who are faced with designing safety
studies for mitochondrially active drugs and potential mito-toxicants. In vitro investigations were
performed to assess the effect of sub-toxic concentrations of the two tool compounds on endpoints which
had been identified as informative from in vivo studies (i.e. TEM, gene expression and lactate – chapter
7).
This project has answered some of the questions posed and in doing so has contributed to our general
knowledge of the mechanisms of DIMT and the downstream biological consequences. It is clear that the
217
use of a systems approach can be of significant value when defining an initial mechanistic overview and
therefore as a starting point for developing a AOP/MOA for a particular toxicity. Systems-based
evaluations lay the groundwork for more tailored and detailed follow-up studies aimed at clarifying the
key events to result in a final AOP (a robust resource for use in the risk assessment of other compounds
with similar mechanistic activity). This in turn will help reduce costly compound attrition, reduce the time
to get new drugs to market and ultimately improve the safety profile of medicines for patients by
preventing future cases of DIMT in humans.
218
REFERENCES
1. Nadanaciva, S. and Y. Will, Investigating mitochondrial dysfunction to increase drug safety in the
pharmaceutical industry. Curr Drug Targets, 2011. 12(6): p. 774-82.
2. Nadanaciva, S. and Y. Will, Current concepts in drug-induced mitochondrial toxicity. Curr Protoc Toxicol,
2009. Chapter 2: p. Unit 2 15.
3. Saha, S., et al., Investigation of the role of the thiazolidinedione ring of troglitazone in inducing
hepatotoxicity. Toxicol Lett, 2010. 192(2): p. 141-9.
4. Dykens, J.A., L.D. Marroquin, and Y. Will, Strategies to reduce late-stage drug attrition due to
mitochondrial toxicity. Expert Rev Mol Diagn, 2007. 7(2): p. 161-75.
5. Hamilton, B.F., et al., In vivo assessment of mitochondrial toxicity. Drug Discov Today, 2008. 13(17-18):
p. 785-90.
6. Scatena, R., et al., The role of mitochondria in pharmacotoxicology: a reevaluation of an old, newly
emerging topic. Am J Physiol Cell Physiol, 2007. 293(1): p. C12-21.
7. Pereira, C.V., et al., Investigating drug-induced mitochondrial toxicity: a biosensor to increase drug
safety? Curr Drug Saf, 2009. 4(1): p. 34-54.
8. Ernster, L. and G. Schatz, Mitochondria: a historical review. J Cell Biol, 1981. 91(3 Pt 2): p. 227s-255s.
9. Palade, G.E., The fine structure of mitochondria. Anat Rec, 1952. 114(3): p. 427-51.
10. Benard, G. and R. Rossignol, Ultrastructure of the mitochondrion and its bearing on function and
bioenergetics. Antioxid Redox Signal, 2008. 10(8): p. 1313-42.
11. Lazarow, A. and S.J. Cooperstein, Studies on the enzymatic basis for the Janus green B staining reaction. J
Histochem Cytochem, 1953. 1(4): p. 234-41.
12. Siekevitz, P. and M.L. Watson, Cytochemical studies of mitochondria. II. Enzymes associated with a
mitochondrial membrane fraction. J Biophys Biochem Cytol, 1956. 2(6): p. 653-69.
13. Azzone, G.F. and L. Ernster, Respiratory control and compartmentation of substrate level phosphorylation
in liver mitochondria. J Biol Chem, 1961. 236: p. 1501-9.
14. Kagawa, Y., [Reconstitution of oxidative phosphorylation system]. Tanpakushitsu Kakusan Koso, 1971.
16(9): p. 775-86.
219
15. Berman, S.B., F.J. Pineda, and J.M. Hardwick, Mitochondrial fission and fusion dynamics: the long and
short of it. Cell Death Differ, 2008. 15(7): p. 1147-52.
16. Detmer, S.A. and D.C. Chan, Functions and dysfunctions of mitochondrial dynamics. Nat Rev Mol Cell
Biol, 2007. 8(11): p. 870-9.
17. Su, B., et al., Abnormal mitochondrial dynamics--a novel therapeutic target for Alzheimer's disease? Mol
Neurobiol, 2010. 41(2-3): p. 87-96.
18. Collins, T.J. and M.D. Bootman, Mitochondria are morphologically heterogeneous within cells. J Exp Biol,
2003. 206(Pt 12): p. 1993-2000.
19. Yi, M., D. Weaver, and G. Hajnoczky, Control of mitochondrial motility and distribution by the calcium
signal: a homeostatic circuit. J Cell Biol, 2004. 167(4): p. 661-72.
20. Wallace, K.B. and A.A. Starkov, Mitochondrial targets of drug toxicity. Annu Rev Pharmacol Toxicol,
2000. 40: p. 353-88.
21. Picard, M., et al., Mitochondria: isolation, structure and function. J Physiol, 2011. 589(Pt 18): p. 4413-21.
22. Mitchell, P., Coupling of phosphorylation to electron and hydrogen transfer by a chemi-osmotic type of
mechanism. Nature, 1961. 191: p. 144-8.
23. Poyton, R.O. and J.E. McEwen, Crosstalk between nuclear and mitochondrial genomes. Annu Rev
Biochem, 1996. 65: p. 563-607.
24. Gray, M.W., G. Burger, and B.F. Lang, The origin and early evolution of mitochondria. Genome Biol,
2001. 2(6): p. REVIEWS1018.
25. O'Brien, T.W., Properties of human mitochondrial ribosomes. IUBMB Life, 2003. 55(9): p. 505-13.
26. Van Houten, B., V. Woshner, and J.H. Santos, Role of mitochondrial DNA in toxic responses to oxidative
stress. DNA Repair (Amst), 2006. 5(2): p. 145-52.
27. Wallace, K.B., Mitochondrial off targets of drug therapy. Trends Pharmacol Sci, 2008. 29(7): p. 361-6.
28. Taylor, R.W. and D.M. Turnbull, Mitochondrial DNA mutations in human disease. Nat Rev Genet, 2005.
6(5): p. 389-402.
29. Sondheimer, N., et al., Neutral mitochondrial heteroplasmy and the influence of aging. Hum Mol Genet,
2011. 20(8): p. 1653-9.
30. Brandon, M., P. Baldi, and D.C. Wallace, Mitochondrial mutations in cancer. Oncogene, 2006. 25(34): p.
4647-62.
31. Rich, P.R., The molecular machinery of Keilin's respiratory chain. Biochem Soc Trans, 2003. 31(Pt 6): p.
1095-105.
32. Mogilevskaya, E., O. Demin, and I. Goryanin, Kinetic model of mitochondrial Krebs cycle: unraveling the
mechanism of salicylate hepatotoxic effects. J Biol Phys, 2006. 32(3-4): p. 245-71.
220
33. Papa, S., et al., The oxidative phosphorylation system in mammalian mitochondria. Adv Exp Med Biol,
2012. 942: p. 3-37.
34. Saada, A., The use of individual patient's fibroblasts in the search for personalized treatment of nuclear
encoded OXPHOS diseases. Mol Genet Metab, 2011. 104(1-2): p. 39-47.
35. Maslov, L.N., et al., [Uncoupling proteins and their role in the regulation of brain and heart tolerance to
impact of ischemia and reperfusion]. Ross Fiziol Zh Im I M Sechenova, 2011. 97(8): p. 761-80.
36. Velours, J., et al., Mitochondrial F1F0-ATP synthase and organellar internal architecture. Int J Biochem
Cell Biol, 2009. 41(10): p. 1783-9.
37. Perron, N.R., C. Beeson, and B. Rohrer, Early alterations in mitochondrial reserve capacity; a means to
predict subsequent photoreceptor cell death. J Bioenerg Biomembr, 2013. 45(1-2): p. 101-9.
38. Desler, C., et al., Is There a Link between Mitochondrial Reserve Respiratory Capacity and Aging? J Aging
Res, 2012. 2012: p. 192503.
39. Hill, B.G., et al., Importance of the bioenergetic reserve capacity in response to cardiomyocyte stress
induced by 4-hydroxynonenal. Biochem J, 2009. 424(1): p. 99-107.
40. Maaswinkel-Mooij, P.D., et al., Depletion of mitochondrial DNA in the liver of a patient with lactic
acidemia and hypoketotic hypoglycemia. J Pediatr, 1996. 128(5 Pt 1): p. 679-83.
41. Thomas, C., et al., Hydroxyl radical is produced via the Fenton reaction in submitochondrial particles
under oxidative stress: implications for diseases associated with iron accumulation. Redox Rep, 2009.
14(3): p. 102-8.
42. Ott, M., et al., Mitochondria, oxidative stress and cell death. Apoptosis, 2007. 12(5): p. 913-22.
43. Han, D., E. Williams, and E. Cadenas, Mitochondrial respiratory chain-dependent generation of
superoxide anion and its release into the intermembrane space. Biochem J, 2001. 353(Pt 2): p. 411-6.
44. Adam-Vizi, V. and C. Chinopoulos, Bioenergetics and the formation of mitochondrial reactive oxygen
species. Trends Pharmacol Sci, 2006. 27(12): p. 639-45.
45. Soubannier, V. and H.M. McBride, Positioning mitochondrial plasticity within cellular signaling cascades.
Biochim Biophys Acta, 2009. 1793(1): p. 154-70.
46. Grivennikova, V.G. and A.D. Vinogradov, Generation of superoxide by the mitochondrial Complex I.
Biochim Biophys Acta, 2006. 1757(5-6): p. 553-61.
47. Grijalba, M.T., A.E. Vercesi, and S. Schreier, Ca2+-induced increased lipid packing and domain formation
in submitochondrial particles. A possible early step in the mechanism of Ca2+-stimulated generation of
reactive oxygen species by the respiratory chain. Biochemistry, 1999. 38(40): p. 13279-87.
48. Armstrong, J.S., The role of the mitochondrial permeability transition in cell death. Mitochondrion, 2006.
6(5): p. 225-34.
221
49. McConkey, D.J., Biochemical determinants of apoptosis and necrosis. Toxicol Lett, 1998. 99(3): p. 157-
68.
50. Ow, Y.P., et al., Cytochrome c: functions beyond respiration. Nat Rev Mol Cell Biol, 2008. 9(7): p. 532-
42.
51. McIlwain, D.R., T. Berger, and T.W. Mak, Caspase functions in cell death and disease. Cold Spring Harb
Perspect Biol, 2015. 7(4).
52. Tait, S.W. and D.R. Green, Caspase-independent cell death: leaving the set without the final cut.
Oncogene, 2008. 27(50): p. 6452-61.
53. Zamzami, N., et al., Inhibitors of permeability transition interfere with the disruption of the mitochondrial
transmembrane potential during apoptosis. FEBS Lett, 1996. 384(1): p. 53-7.
54. Miyoshi, H., Structure-activity relationships of some complex I inhibitors. Biochim Biophys Acta, 1998.
1364(2): p. 236-44.
55. Degli Esposti, M., Inhibitors of NADH-ubiquinone reductase: an overview. Biochim Biophys Acta, 1998.
1364(2): p. 222-35.
56. Wojtovich, A.P., et al., Physiological consequences of complex II inhibition for aging, disease, and the
mKATP channel. Biochim Biophys Acta, 2013. 1827(5): p. 598-611.
57. Lemarie, A., et al., Specific disintegration of complex II succinate:ubiquinone oxidoreductase links pH
changes to oxidative stress for apoptosis induction. Cell Death Differ, 2011. 18(2): p. 338-49.
58. Linnett, P.E. and R.B. Beechey, Inhibitors of the ATP synthethase system. Methods Enzymol, 1979. 55: p.
472-518.
59. Ueno, Y., The toxicology of mycotoxins. Crit Rev Toxicol, 1985. 14(2): p. 99-132.
60. Dabbeni-Sala, F., G. Schiavo, and P. Palatini, Mechanism of local anesthetic effect on mitochondrial ATP
synthase as deduced from photolabelling and inhibition studies with phenothiazine derivatives. Biochim
Biophys Acta, 1990. 1026(1): p. 117-25.
61. Palmeira, C.M., A.J. Moreno, and V.M. Madeira, Mitochondrial bioenergetics is affected by the herbicide
paraquat. Biochim Biophys Acta, 1995. 1229(2): p. 187-92.
62. Wei, Y.H., et al., Inhibition of the mitochondrial Mg2+-ATPase by propranolol. Biochem Pharmacol,
1985. 34(7): p. 911-7.
63. Snoeij, N.J., A.H. Penninks, and W. Seinen, Biological activity of organotin compounds--an overview.
Environ Res, 1987. 44(2): p. 335-53.
64. Petrescu, I. and C. Tarba, Uncoupling effects of diclofenac and aspirin in the perfused liver and isolated
hepatic mitochondria of rat. Biochim Biophys Acta, 1997. 1318(3): p. 385-94.
222
65. Moreno-Sanchez, R., et al., Inhibition and uncoupling of oxidative phosphorylation by nonsteroidal anti-
inflammatory drugs: study in mitochondria, submitochondrial particles, cells, and whole heart. Biochem
Pharmacol, 1999. 57(7): p. 743-52.
66. Miranda, E.J., et al., Two deaths attributed to the use of 2,4-dinitrophenol. J Anal Toxicol, 2006. 30(3): p.
219-22.
67. Ilivicky, J. and J.E. Casida, Uncoupling action of 2,4-dinitrophenols, 2-trifluoromethylbenzimidazoles and
certain other pesticide chemicals upon mitochondria from different sources and its relation to toxicity.
Biochem Pharmacol, 1969. 18(6): p. 1389-401.
68. Terada, H., The interaction of highly active uncouplers with mitochondria. Biochim Biophys Acta, 1981.
639(3-4): p. 225-42.
69. Starkov, A.A., "Mild" uncoupling of mitochondria. Biosci Rep, 1997. 17(3): p. 273-9.
70. Reed, P.W., Ionophores. Methods Enzymol, 1979. 55: p. 435-54.
71. Terada, H., et al., The cyanine dye triS-C4(5) as a cationic uncoupler of oxidative phosphorylation:
interaction with mitochondria detected by derivative spectrophotometry. Cell Struct Funct, 1983. 8(2): p.
161-70.
72. Parry, J.D., et al., Pivotal role for two electron reduction in 2,3-dimethoxy-1,4-naphthoquinone and 2-
methyl-1,4-naphthoquinone metabolism and kinetics in vivo that prevents liver redox stress. Chem Res
Toxicol, 2009. 22(4): p. 717-25.
73. Gant, T.W., et al., Redox cycling and sulphydryl arylation; their relative importance in the mechanism of
quinone cytotoxicity to isolated hepatocytes. Chem Biol Interact, 1988. 65(2): p. 157-73.
74. Walker, U.A. and E. Byrne, The therapy of respiratory chain encephalomyopathy: a critical review of the
past and current perspective. Acta Neurol Scand, 1995. 92(4): p. 273-80.
75. Brand, M.D. and D.G. Nicholls, Assessing mitochondrial dysfunction in cells. Biochem J, 2011. 435(2): p.
297-312.
76. Liebecq, C. and R.A. Peters, The toxicity of fluoroacetate and the tricarboxylic acid cycle. 1949. Biochim
Biophys Acta, 1989. 1000: p. 254-69.
77. Goncharov, N.V., R.O. Jenkins, and A.S. Radilov, Toxicology of fluoroacetate: a review, with possible
directions for therapy research. J Appl Toxicol, 2006. 26(2): p. 148-61.
78. Kerner, J., et al., Characterization of the malonyl-CoA-sensitive carnitine palmitoyltransferase (CPTo) of a
rat heart mitochondrial particle. Evidence that the catalytic unit is CPTi. J Biol Chem, 1994. 269(11): p.
8209-19.
79. Stanley, W.C., G.D. Lopaschuk, and J.G. McCormack, Regulation of energy substrate metabolism in the
diabetic heart. Cardiovasc Res, 1997. 34(1): p. 25-33.
223
80. Wolf, H.P., Possible new therapeutic approach in diabetes mellitus by inhibition of carnitine
palmitoyltransferase 1 (CPT1). Horm Metab Res Suppl, 1992. 26: p. 62-7.
81. Ankarcrona, M., F. Mangialasche, and B. Winblad, Rethinking Alzheimer's disease therapy: are
mitochondria the key? J Alzheimers Dis, 2010. 20 Suppl 2: p. S579-90.
82. Nishimura, J., et al., Possible involvement of oxidative stress in fenofibrate-induced hepatocarcinogenesis
in rats. Arch Toxicol, 2008. 82(9): p. 641-54.
83. Camara, A.K., E.J. Lesnefsky, and D.F. Stowe, Potential therapeutic benefits of strategies directed to
mitochondria. Antioxid Redox Signal, 2010. 13(3): p. 279-347.
84. Juhaszova, M., et al., The identity and regulation of the mitochondrial permeability transition pore: where
the known meets the unknown. Ann N Y Acad Sci, 2008. 1123: p. 197-212.
85. Rao, V.K., E.A. Carlson, and S.S. Yan, Mitochondrial permeability transition pore is a potential drug
target for neurodegeneration. Biochim Biophys Acta, 2014. 1842(8): p. 1267-72.
86. Halestrap, A.P. and A.P. Richardson, The mitochondrial permeability transition: a current perspective on
its identity and role in ischaemia/reperfusion injury. J Mol Cell Cardiol, 2015. 78: p. 129-41.
87. Hausenloy, D.J., et al., Inhibiting mitochondrial permeability transition pore opening: a new paradigm for
myocardial preconditioning? Cardiovasc Res, 2002. 55(3): p. 534-43.
88. St John, J.C., et al., Mitochondrial DNA transmission, replication and inheritance: a journey from the
gamete through the embryo and into offspring and embryonic stem cells. Hum Reprod Update, 2010. 16(5):
p. 488-509.
89. Lewis, W., B.J. Day, and W.C. Copeland, Mitochondrial toxicity of NRTI antiviral drugs: an integrated
cellular perspective. Nat Rev Drug Discov, 2003. 2(10): p. 812-22.
90. Kakuda, T.N., Pharmacology of nucleoside and nucleotide reverse transcriptase inhibitor-induced
mitochondrial toxicity. Clin Ther, 2000. 22(6): p. 685-708.
91. Walker, U.A., et al., Depletion of mitochondrial DNA in liver under antiretroviral therapy with didanosine,
stavudine, or zalcitabine. Hepatology, 2004. 39(2): p. 311-7.
92. Mazat, J.P., et al., What do mitochondrial diseases teach us about normal mitochondrial functions...that we
already knew: threshold expression of mitochondrial defects. Biochim Biophys Acta, 2001. 1504(1): p. 20-
30.
93. FDA, Guidance for industry: Antiviral product development - Conducting and submitting virology studies
to the agency. 2006.
94. Yakes, F.M. and B. Van Houten, Mitochondrial DNA damage is more extensive and persists longer than
nuclear DNA damage in human cells following oxidative stress. Proc Natl Acad Sci U S A, 1997. 94(2): p.
514-9.
224
95. Garrabou, G., et al., Reversible inhibition of mitochondrial protein synthesis during linezolid-related
hyperlactatemia. Antimicrob Agents Chemother, 2007. 51(3): p. 962-7.
96. Oerter, D., et al., Effect of chloramphenicol and thiamphenicol on mitochondrial components and the
possible relationship to drug toxicity. Postgrad Med J, 1974. 50 Suppl 5: p. 65-8.
97. McKee, E.E., et al., Inhibition of mammalian mitochondrial protein synthesis by oxazolidinones.
Antimicrob Agents Chemother, 2006. 50(6): p. 2042-9.
98. Jafarian, I., et al., Toxicity of valproic acid in isolated rat liver mitochondria. Toxicol Mech Methods,
2013. 23(8): p. 617-23.
99. Silva, M.F., et al., Valproic acid metabolism and its effects on mitochondrial fatty acid oxidation: a review.
J Inherit Metab Dis, 2008. 31(2): p. 205-16.
100. Nadanaciva, S., et al., Target identification of drug induced mitochondrial toxicity using immunocapture
based OXPHOS activity assays. Toxicol In Vitro, 2007. 21(5): p. 902-11.
101. Labbe, G., D. Pessayre, and B. Fromenty, Drug-induced liver injury through mitochondrial dysfunction:
mechanisms and detection during preclinical safety studies. Fundam Clin Pharmacol, 2008. 22(4): p. 335-
53.
102. Gross, V.S., et al., Isolation of functional mitochondria from rat kidney and skeletal muscle without manual
homogenization. Anal Biochem, 2011. 418(2): p. 213-23.
103. Zhao, X., et al., Phosphoproteome analysis of functional mitochondria isolated from resting human muscle
reveals extensive phosphorylation of inner membrane protein complexes and enzymes. Mol Cell
Proteomics, 2011. 10(1): p. M110 000299.
104. Horton, A.A. and J.A. Spencer, Decline in respiratory control ratio of rat liver mitochondria in old age.
Mech Ageing Dev, 1981. 17(3): p. 253-9.
105. Robinson, B.H., et al., Nonviability of cells with oxidative defects in galactose medium: a screening test for
affected patient fibroblasts. Biochem Med Metab Biol, 1992. 48(2): p. 122-6.
106. Marroquin, L.D., et al., Circumventing the Crabtree effect: replacing media glucose with galactose
increases susceptibility of HepG2 cells to mitochondrial toxicants. Toxicol Sci, 2007. 97(2): p. 539-47.
107. Nadanaciva, S. and Y. Will, New insights in drug-induced mitochondrial toxicity. Curr Pharm Des, 2011.
17(20): p. 2100-12.
108. Armstrong, J.S., Mitochondrial medicine: pharmacological targeting of mitochondria in disease. Br J
Pharmacol, 2007. 151(8): p. 1154-65.
109. Ash, A.S. and H.T. Toh, Oxidative phosphorylation in heart mitochondria isolated from chlorpromazine-
treated animals. Br J Pharmacol, 1970. 38(2): p. 436P-437P.
225
110. Leont'eva, I.V., et al., [The use of positron emission tomography for noninvasive diagnosis of
mitochondrial dysfunction and assessment of myocardial compensatory reserve in children with
cardiomyopathies]. Kardiologiia, 2002. 42(1): p. 80-5.
111. Penn, A.M., et al., Generalized mitochondrial dysfunction in Parkinson's disease detected by magnetic
resonance spectroscopy of muscle. Neurology, 1995. 45(11): p. 2097-9.
112. Thyfault, J.P., et al., Rats selectively bred for low aerobic capacity have reduced hepatic mitochondrial
oxidative capacity and susceptibility to hepatic steatosis and injury. J Physiol, 2009. 587(Pt 8): p. 1805-16.
113. Ong, M.M., C. Latchoumycandane, and U.A. Boelsterli, Troglitazone-induced hepatic necrosis in an
animal model of silent genetic mitochondrial abnormalities. Toxicol Sci, 2007. 97(1): p. 205-13.
114. Kirby, K., et al., RNA interference-mediated silencing of Sod2 in Drosophila leads to early adult-onset
mortality and elevated endogenous oxidative stress. Proc Natl Acad Sci U S A, 2002. 99(25): p. 16162-7.
115. Shoubridge, E.A., A debut for mito-mouse. Nat Genet, 2000. 26(2): p. 132-4.
116. Graham, B.H., et al., A mouse model for mitochondrial myopathy and cardiomyopathy resulting from a
deficiency in the heart/muscle isoform of the adenine nucleotide translocator. Nat Genet, 1997. 16(3): p.
226-34.
117. Trifunovic, A., et al., Premature ageing in mice expressing defective mitochondrial DNA polymerase.
Nature, 2004. 429(6990): p. 417-23.
118. Ahting, U., et al., Neurological phenotype and reduced lifespan in heterozygous Tim23 knockout mice, the
first mouse model of defective mitochondrial import. Biochim Biophys Acta, 2009. 1787(5): p. 371-6.
119. Horobin, R.W., S. Trapp, and V. Weissig, Mitochondriotropics: a review of their mode of action, and their
applications for drug and DNA delivery to mammalian mitochondria. J Control Release, 2007. 121(3): p.
125-36.
120. Zhang, H., et al., In silico prediction of mitochondrial toxicity by using GA-CG-SVM approach. Toxicol In
Vitro, 2009. 23(1): p. 134-40.
121. Shikuma, C.M., et al., Mitochondrial oxidative phosphorylation protein levels in peripheral blood
mononuclear cells correlate with levels in subcutaneous adipose tissue within samples differing by HIV and
lipoatrophy status. AIDS Res Hum Retroviruses, 2008. 24(10): p. 1255-62.
122. Fannin, R.D., et al., Acetaminophen dosing of humans results in blood transcriptome and metabolome
changes consistent with impaired oxidative phosphorylation. Hepatology, 2010. 51(1): p. 227-36.
123. McGill, M.R., et al., Circulating acylcarnitines as biomarkers of mitochondrial dysfunction after
acetaminophen overdose in mice and humans. Arch Toxicol, 2014. 88(2): p. 391-401.
124. Waters, M., et al., Systems toxicology and the Chemical Effects in Biological Systems (CEBS) knowledge
base. EHP Toxicogenomics, 2003. 111(1T): p. 15-28.
226
125. Sturla, S.J., et al., Systems toxicology: from basic research to risk assessment. Chem Res Toxicol, 2014.
27(3): p. 314-29.
126. Plant, N., Can systems toxicology identify common biomarkers of non-genotoxic carcinogenesis?
Toxicology, 2008. 254(3): p. 164-9.
127. Bueno, J.M., et al., Exploration of 4(1H)-pyridones as a novel family of potent antimalarial inhibitors of
the plasmodial cytochrome bc1. Future Med Chem, 2012. 4(18): p. 2311-23.
128. Lote, C., Principles of Renal Physiology; 4th Edition. Springer, 2000.
129. Frezza, C., S. Cipolat, and L. Scorrano, Organelle isolation: functional mitochondria from mouse liver,
muscle and cultured fibroblasts. Nat Protoc, 2007. 2(2): p. 287-95.
130. Kristian, T., et al., Isolation of mitochondria with high respiratory control from primary cultures of
neurons and astrocytes using nitrogen cavitation. J Neurosci Methods, 2006. 152(1-2): p. 136-43.
131. Gostimskaya, I. and A. Galkin, Preparation of highly coupled rat heart mitochondria. J Vis Exp, 2010(43).
132. Nadanaciva, S., et al., Assessment of drug-induced mitochondrial dysfunction via altered cellular
respiration and acidification measured in a 96-well platform. J Bioenerg Biomembr, 2012. 44(4): p. 421-
37.
133. Rogers, G.W., et al., High throughput microplate respiratory measurements using minimal quantities of
isolated mitochondria. PLoS One, 2011. 6(7): p. e21746.
134. Bernardi, P. and V. Petronilli, The permeability transition pore as a mitochondrial calcium release
channel: a critical appraisal. J Bioenerg Biomembr, 1996. 28(2): p. 131-8.
135. Bernardi, P., The permeability transition pore. Control points of a cyclosporin A-sensitive mitochondrial
channel involved in cell death. Biochim Biophys Acta, 1996. 1275(1-2): p. 5-9.
136. Petronilli, V., et al., Regulation of the permeability transition pore, a voltage-dependent mitochondrial
channel inhibited by cyclosporin A. Biochim Biophys Acta, 1994. 1187(2): p. 255-9.
137. Oliveira, P.J., et al., Inhibitory effect of carvedilol in the high-conductance state of the mitochondrial
permeability transition pore. Eur J Pharmacol, 2001. 412(3): p. 231-7.
138. Billiard, J., et al., Quinoline 3-sulfonamides inhibit lactate dehydrogenase A and reverse aerobic glycolysis
in cancer cells. Cancer Metab, 2013. 1(1): p. 19.
139. Szanto, M., et al., Poly(ADP-ribose) polymerase-2 depletion reduces doxorubicin-induced damage through
SIRT1 induction. Cardiovasc Res, 2011. 92(3): p. 430-8.
140. Seligman, A.M., H.L. Wasserkrug, and J.S. Hanker, A new staining method (OTO) for enhancing contrast
of lipid--containing membranes and droplets in osmium tetroxide--fixed tissue with osmiophilic
thiocarbohydrazide(TCH). J Cell Biol, 1966. 30(2): p. 424-32.
141. Marbach, E.P. and M.H. Weil, Rapid enzymatic measurement of blood lactate and pyruvate. Use and
significance of metaphosphoric acid as a common precipitant. Clin Chem, 1967. 13(4): p. 314-25.
227
142. Babson, A.L. and G.E. Phillips, A rapid colorimetric assay for serum lactic dehydrogenase. Clin Chim
Acta, 1965. 12(2): p. 210-5.
143. Limonciel, A., et al., Lactate is an ideal non-invasive marker for evaluating temporal alterations in cell
stress and toxicity in repeat dose testing regimes. Toxicol In Vitro, 2011. 25(8): p. 1855-62.
144. Van Gelder, R.N., et al., Amplified RNA synthesized from limited quantities of heterogeneous cDNA. Proc
Natl Acad Sci U S A, 1990. 87(5): p. 1663-7.
145. Irizarry, R.A., et al., Exploration, normalization, and summaries of high density oligonucleotide array
probe level data. Biostatistics, 2003. 4(2): p. 249-64.
146. Zhang, S.D. and T.W. Gant, A simple and robust method for connecting small-molecule drugs using gene-
expression signatures. BMC Bioinformatics, 2008. 9: p. 258.
147. Zhang, S.D. and T.W. Gant, sscMap: an extensible Java application for connecting small-molecule drugs
using gene-expression signatures. BMC Bioinformatics, 2009. 10: p. 236.
148. Nelson, L., Acute cyanide toxicity: mechanisms and manifestations. J Emerg Nurs, 2006. 32(4 Suppl): p.
S8-11.
149. Grundlingh, J., et al., 2,4-dinitrophenol (DNP): a weight loss agent with significant acute toxicity and risk
of death. J Med Toxicol, 2011. 7(3): p. 205-12.
150. Nony, P.A., et al., 3-Nitropropionic acid (3-NPA) produces hypothermia and inhibits histochemical
labeling of succinate dehydrogenase (SDH) in rat brain. Metab Brain Dis, 1999. 14(2): p. 83-94.
151. Stoner, H.B., The role of the liver in non-shivering thermogenesis in the rat. J Physiol, 1973. 232(2): p.
285-96.
152. Rotig, A., et al., Pearson's marrow-pancreas syndrome. A multisystem mitochondrial disorder in infancy. J
Clin Invest, 1990. 86(5): p. 1601-8.
153. Claessens, Y.E., et al., Bench-to-bedside review: severe lactic acidosis in HIV patients treated with
nucleoside analogue reverse transcriptase inhibitors. Crit Care, 2003. 7(3): p. 226-32.
154. Murray, B.J., Severe lactic acidosis and hypothermia. West J Med, 1981. 134(2): p. 162-6.
155. Gross, D.N., A.P. van den Heuvel, and M.J. Birnbaum, The role of FoxO in the regulation of metabolism.
Oncogene, 2008. 27(16): p. 2320-36.
156. Postic, C., R. Dentin, and J. Girard, Role of the liver in the control of carbohydrate and lipid homeostasis.
Diabetes Metab, 2004. 30(5): p. 398-408.
157. Quinn, P.G. and D. Yeagley, Insulin regulation of PEPCK gene expression: a model for rapid and
reversible modulation. Curr Drug Targets Immune Endocr Metabol Disord, 2005. 5(4): p. 423-37.
158. Tyynismaa, H., et al., Mitochondrial myopathy induces a starvation-like response. Hum Mol Genet, 2010.
19(20): p. 3948-58.
228
159. Chen, Q., et al., Production of reactive oxygen species by mitochondria: central role of complex III. J Biol
Chem, 2003. 278(38): p. 36027-31.
160. Zoratti, M. and I. Szabo, The mitochondrial permeability transition. Biochim Biophys Acta, 1995. 1241(2):
p. 139-76.
161. Lemasters, J.J., et al., The mitochondrial permeability transition in toxic, hypoxic and reperfusion injury.
Mol Cell Biochem, 1997. 174(1-2): p. 159-65.
162. Dranka, B.P., B.G. Hill, and V.M. Darley-Usmar, Mitochondrial reserve capacity in endothelial cells: The
impact of nitric oxide and reactive oxygen species. Free Radic Biol Med, 2010. 48(7): p. 905-14.
163. Carre, J.E. and M. Singer, Cellular energetic metabolism in sepsis: the need for a systems approach.
Biochim Biophys Acta, 2008. 1777(7-8): p. 763-71.
164. Collino, S., F.P. Martin, and S. Rezzi, Clinical metabolomics paves the way towards future healthcare
strategies. Br J Clin Pharmacol, 2013. 75(3): p. 619-29.
165. Shaham, O., et al., A plasma signature of human mitochondrial disease revealed through metabolic
profiling of spent media from cultured muscle cells. Proc Natl Acad Sci U S A, 2010. 107(4): p. 1571-5.
166. Roberts, L.D., A. Koulman, and J.L. Griffin, Towards metabolic biomarkers of insulin resistance and type
2 diabetes: progress from the metabolome. Lancet Diabetes Endocrinol, 2014. 2(1): p. 65-75.
167. Stryer, L., Biochemistry. Fourth Edition ed. 1995, New York, NY: W.H.Freeman and Co. 1064.
168. Bain, J.R., et al., Metabolomics applied to diabetes research: moving from information to knowledge.
Diabetes, 2009. 58(11): p. 2429-43.
169. Muoio, D.M. and C.B. Newgard, Mechanisms of disease: molecular and metabolic mechanisms of insulin
resistance and beta-cell failure in type 2 diabetes. Nat Rev Mol Cell Biol, 2008. 9(3): p. 193-205.
170. Newgard, C.B., Interplay between lipids and branched-chain amino acids in development of insulin
resistance. Cell Metab, 2012. 15(5): p. 606-14.
171. Suhre, K., et al., Metabolic footprint of diabetes: a multiplatform metabolomics study in an epidemiological
setting. PLoS One, 2010. 5(11): p. e13953.
172. Frye, R.E., S. Melnyk, and D.F. Macfabe, Unique acyl-carnitine profiles are potential biomarkers for
acquired mitochondrial disease in autism spectrum disorder. Transl Psychiatry, 2013. 3: p. e220.
173. Mihalik, S.J., et al., Increased levels of plasma acylcarnitines in obesity and type 2 diabetes and
identification of a marker of glucolipotoxicity. Obesity (Silver Spring), 2010. 18(9): p. 1695-700.
174. Mai, M., et al., Serum levels of acylcarnitines are altered in prediabetic conditions. PLoS One, 2013.
8(12): p. e82459.
175. Sampey, B.P., et al., Metabolomic profiling reveals mitochondrial-derived lipid biomarkers that drive
obesity-associated inflammation. PLoS One, 2012. 7(6): p. e38812.
229
176. Gruber, L., et al., High fat diet accelerates pathogenesis of murine Crohn's disease-like ileitis
independently of obesity. PLoS One, 2013. 8(8): p. e71661.
177. Schooneman, M.G., et al., Acylcarnitines: reflecting or inflicting insulin resistance? Diabetes, 2013. 62(1):
p. 1-8.
178. Newgard, C.B., et al., A branched-chain amino acid-related metabolic signature that differentiates obese
and lean humans and contributes to insulin resistance. Cell Metab, 2009. 9(4): p. 311-26.
179. Shah, S.H., et al., Branched-chain amino acid levels are associated with improvement in insulin resistance
with weight loss. Diabetologia, 2012. 55(2): p. 321-30.
180. Shah, S.H., L.P. Svetkey, and C.B. Newgard, Branching out for detection of type 2 diabetes. Cell Metab,
2011. 13(5): p. 491-2.
181. Jesús Zacarías Villarreal-Pérez, J.Z.V.-M., Fernando Javier Lavalle-González, María del Rosario Torres-
Sepúlveda, Consuelo Ruiz-Herrera, Ricardo Martín Cerda-Flores, Erik Rubén Castillo-García, Irám Pablo
Rodríguez-Sánchez and Laura Elia Martínez de Villarreal, Plasma and urine metabolic profiles are
reflective of altered beta-oxidation in non-diabetic obese subjects and patients with type 2 diabetes
mellitus. Diabetology & Metabolic Syndrome, 2014. 6.
182. Gall, W.E., et al., alpha-hydroxybutyrate is an early biomarker of insulin resistance and glucose
intolerance in a nondiabetic population. PLoS One, 2010. 5(5): p. e10883.
183. Gall, W.E., et al. Alpha-hydroxybutyrate reduces mitochondrial ATP synthesis in human muscle. in
American Diatetic Association, 70th Session. 2011. Orlando, FL.
184. Cobb, J., et al., A novel fasting blood test for insulin resistance and prediabetes. J Diabetes Sci Technol,
2013. 7(1): p. 100-10.
185. Voet, D.V., J.G., and C.W. Pratt, Fundamentals of Biochemistry. 1999: John Wiley & Sons, Inc.
186. Berkeley, L.I., et al., Hepatoprotection by L-cysteine-glutathione mixed disulfide, a sulfhydryl-modified
prodrug of glutathione. J Biochem Mol Toxicol, 2003. 17(2): p. 95-7.
187. Parikh, S., et al., Diagnosis and management of mitochondrial disease: a consensus statement from the
Mitochondrial Medicine Society. Genet Med, 2014.
188. Demine, S., et al., Unraveling biochemical pathways affected by mitochondrial dysfunctions using
metabolomic approaches. Metabolites, 2014. 4(3): p. 831-78.
189. Capper, M.J., et al., Antimalarial 4(1H)-pyridones bind to the Qi site of cytochrome bc1. Proc Natl Acad
Sci U S A, 2015. 112(3): p. 755-60.
190. Lyamzaev, K.G., et al., Inhibition of mitochondrial bioenergetics: the effects on structure of mitochondria
in the cell and on apoptosis. Acta Biochim Pol, 2004. 51(2): p. 553-62.
230
191. Watabe, M. and T. Nakaki, ATP depletion does not account for apoptosis induced by inhibition of
mitochondrial electron transport chain in human dopaminergic cells. Neuropharmacology, 2007. 52(2): p.
536-41.
192. Lee, S.J., et al., Mitochondrial dysfunction induces formation of lipid droplets as a generalized response to
stress. Oxid Med Cell Longev, 2013. 2013: p. 327167.
193. Pao, D., et al., Hyperlactataemia and hepatic steatosis: mitochondrial toxicity of nucleoside reverse
transcriptase inhibitors. Sex Transm Infect, 2001. 77(5): p. 381-4.
194. Timbrell, S., et al., Lactic acidosis secondary to metformin overdose: a case report. J Med Case Rep, 2012.
6: p. 230.
195. Clemmer, T.P., et al., Hypothermia in the sepsis syndrome and clinical outcome. The Methylprednisolone
Severe Sepsis Study Group. Crit Care Med, 1992. 20(10): p. 1395-401.
196. Borron, S.W., Recognition and treatment of acute cyanide poisoning. J Emerg Nurs, 2006. 32(4 Suppl): p.
S12-8.
197. St-Pierre, J., et al., Topology of superoxide production from different sites in the mitochondrial electron
transport chain. J Biol Chem, 2002. 277(47): p. 44784-90.
198. Yang, Y., et al., Reactive oxygen species in the immune system. Int Rev Immunol, 2013. 32(3): p. 249-70.
199. Gribble, E.J., et al., Toxicity as a result of immunostimulation by biologics. Expert Opin Drug Metab
Toxicol, 2007. 3(2): p. 209-34.
200. Ma, X., et al., Mitochondrial electron transport chain complex III is required for antimycin A to inhibit
autophagy. Chem Biol, 2011. 18(11): p. 1474-81.
201. Davoudi, M., et al., A mouse model of mitochondrial complex III dysfunction induced by myxothiazol.
Biochem Biophys Res Commun, 2014. 446(4): p. 1079-84.
202. Berson, A., et al., Inhibition by nilutamide of the mitochondrial respiratory chain and ATP formation.
Possible contribution to the adverse effects of this antiandrogen. J Pharmacol Exp Ther, 1994. 270(1): p.
167-76.
203. Fau, D., et al., Mechanism for the hepatotoxicity of the antiandrogen, nilutamide. Evidence suggesting that
redox cycling of this nitroaromatic drug leads to oxidative stress in isolated hepatocytes. J Pharmacol Exp
Ther, 1992. 263(1): p. 69-77.
204. Nath, A.K., et al., Chemical and metabolomic screens identify novel biomarkers and antidotes for cyanide
exposure. FASEB J, 2013. 27(5): p. 1928-38.
205. Kadenbach, B., Intrinsic and extrinsic uncoupling of oxidative phosphorylation. Biochim Biophys Acta,
2003. 1604(2): p. 77-94.
206. Kessler, R.J., et al., Uncouplers and the molecular mechanism of uncoupling in mitochondria. Proc Natl
Acad Sci U S A, 1977. 74(6): p. 2241-5.
231
207. Finkelstein, A., Weak-acid uncouplers of oxidative phosphorylation. Mechanism of action on thin lipid
membranes. Biochim Biophys Acta, 1970. 205(1): p. 1-6.
208. McDougall, P., et al., The mechanism of inhibition of mitochondrial oxidative phosphorylation by the
nonsteroidal anti-inflammatory agent diflunisal. Biochem Pharmacol, 1983. 32(17): p. 2595-8.
209. Mahmud, T., et al., Nonsteroidal antiinflammatory drugs and uncoupling of mitochondrial oxidative
phosphorylation. Arthritis Rheum, 1996. 39(12): p. 1998-2003.
210. Norman, C., et al., Salicylic acid is an uncoupler and inhibitor of mitochondrial electron transport. Plant
Physiol, 2004. 134(1): p. 492-501.
211. Porceddu, M., et al., Prediction of Liver Injury Induced by Chemicals in Human with a Multiparametric
Assay on Isolated Mouse Liver Mitochondria. Toxicol Sci, 2012.
212. Cunha, F.M., et al., Mild mitochondrial uncoupling as a therapeutic strategy. Curr Drug Targets, 2011.
12(6): p. 783-9.
213. Perry, R.J., et al., Controlled-release mitochondrial protonophore reverses diabetes and steatohepatitis in
rats. Science, 2015. 347(6227): p. 1253-6.
214. Tao, H., et al., Niclosamide ethanolamine-induced mild mitochondrial uncoupling improves diabetic
symptoms in mice. Nat Med, 2014. 20(11): p. 1263-9.
215. Silachev, D.N., et al., Neuroprotective effect of glutamate-substituted analog of gramicidin A is mediated
by the uncoupling of mitochondria. Biochim Biophys Acta, 2014. 1840(12): p. 3434-42.
216. Maragos, W.F., et al., Pre- or post-treatment with the mitochondrial uncoupler 2,4-dinitrophenol
attenuates striatal quinolinate lesions. Brain Res, 2003. 966(2): p. 312-6.
217. Kamour, A., et al., Increasing frequency of severe clinical toxicity after use of 2,4-dinitrophenol in the UK:
a report from the National Poisons Information Service. Emerg Med J, 2014.
218. Wise, J., Increase in reports of toxicity from fat burning supplement seen in UK. BMJ, 2014. 348: p. g4188.
219. Haasio, K., et al., Effects of entacapone and tolcapone on mitochondrial membrane potential. Eur J
Pharmacol, 2002. 453(1): p. 21-6.
220. van Marken Lichtenbelt, W., Brown adipose tissue and the regulation of nonshivering thermogenesis. Curr
Opin Clin Nutr Metab Care, 2012. 15(6): p. 547-52.
221. Samudio, I., M. Fiegl, and M. Andreeff, Mitochondrial uncoupling and the Warburg effect: molecular
basis for the reprogramming of cancer cell metabolism. Cancer Res, 2009. 69(6): p. 2163-6.
222. Matthias, A., et al., Thermogenic responses in brown fat cells are fully UCP1-dependent. UCP2 or UCP3
do not substitute for UCP1 in adrenergically or fatty scid-induced thermogenesis. J Biol Chem, 2000.
275(33): p. 25073-81.
223. Li, Y., et al., Mitochondrial dysfunction induced by sertraline, an antidepressant agent. Toxicol Sci, 2012.
127(2): p. 582-91.
232
224. Weng, Z., et al., Regorafenib impairs mitochondrial functions, activates AMP-activated protein kinase,
induces autophagy, and causes rat hepatocyte necrosis. Toxicology, 2015. 327: p. 10-21.
225. Melmed, C., G. Karpati, and S. Carpenter, Experimental mitochondrial myopathy produced by in vivo
uncoupling of oxidative phosphorylation. J Neurol Sci, 1975. 26(3): p. 305-18.
226. Felser, A., et al., Hepatocellular toxicity of benzbromarone: effects on mitochondrial function and
structure. Toxicology, 2014. 324: p. 136-46.
227. Haasio, K., K. Lounatmaa, and A. Sukura, Entacapone does not induce conformational changes in liver
mitochondria or skeletal muscle in vivo. Exp Toxicol Pathol, 2002. 54(1): p. 9-14.
228. Somasundaram, S., et al., Mitochondrial damage: a possible mechanism of the "topical" phase of NSAID
induced injury to the rat intestine. Gut, 1997. 41(3): p. 344-53.
229. Kuruvilla, S., et al., Effects of minimally toxic levels of carbonyl cyanide P-(trifluoromethoxy)
phenylhydrazone (FCCP), elucidated through differential gene expression with biochemical and
morphological correlations. Toxicol Sci, 2003. 73(2): p. 348-61.
230. Dykens, J.A. and Y. Will, Drug-induced mitochondrial dysfunction. 1st ed. 2008: Wiley.
231. Wang, G., et al., Modeling the mitochondrial cardiomyopathy of Barth syndrome with induced pluripotent
stem cell and heart-on-chip technologies. Nat Med, 2014. 20(6): p. 616-23.
232. Murata, S., et al., Antitumor effect of 1, 8-cineole against colon cancer. Oncol Rep, 2013. 30(6): p. 2647-
52.
233. Garedew, A., S.O. Henderson, and S. Moncada, Activated macrophages utilize glycolytic ATP to maintain
mitochondrial membrane potential and prevent apoptotic cell death. Cell Death Differ, 2012.
234. Zhao, Y. and D. Bruemmer, NR4A orphan nuclear receptors: transcriptional regulators of gene expression
in metabolism and vascular biology. Arterioscler Thromb Vasc Biol, 2010. 30(8): p. 1535-41.
235. Liu, C. and J.D. Lin, PGC-1 coactivators in the control of energy metabolism. Acta Biochim Biophys Sin
(Shanghai), 2011. 43(4): p. 248-57.
236. Handschin, C., The biology of PGC-1alpha and its therapeutic potential. Trends Pharmacol Sci, 2009.
30(6): p. 322-9.
237. Kousteni, S., FoxO1, the transcriptional chief of staff of energy metabolism. Bone, 2012. 50(2): p. 437-43.
238. Guo, S., Insulin signaling, resistance, and the metabolic syndrome: insights from mouse models into
disease mechanisms. J Endocrinol, 2014. 220(2): p. T1-T23.
239. Araki, M., Y. Nozaki, and K. Motojima, [Transcriptional regulation of metabolic switching PDK4 gene
under various physiological conditions]. Yakugaku Zasshi, 2007. 127(1): p. 153-62.
240. Sass, G., R. Barikbin, and G. Tiegs, The multiple functions of heme oxygenase-1 in the liver. Z
Gastroenterol, 2012. 50(1): p. 34-40.
241. Ishimoto, K., [Lipin 1 in lipid metabolism]. Yakugaku Zasshi, 2011. 131(8): p. 1189-94.
233
242. Finck, B.N., et al., Lipin 1 is an inducible amplifier of the hepatic PGC-1alpha/PPARalpha regulatory
pathway. Cell Metab, 2006. 4(3): p. 199-210.
243. Allen-Jennings, A.E., et al., The roles of ATF3 in liver dysfunction and the regulation of
phosphoenolpyruvate carboxykinase gene expression. J Biol Chem, 2002. 277(22): p. 20020-5.
244. Jiang, H.Y., et al., Activating transcription factor 3 is integral to the eukaryotic initiation factor 2 kinase
stress response. Mol Cell Biol, 2004. 24(3): p. 1365-77.
245. Shoichet, B.K., Interpreting steep dose-response curves in early inhibitor discovery. J Med Chem, 2006.
49(25): p. 7274-7.
246. Riss, T.L., et al., Cell Viability Assays, in Assay Guidance Manual, G.S. Sittampalam, et al., Editors. 2004:
Bethesda (MD).
247. Dranka, B.P., et al., Assessing bioenergetic function in response to oxidative stress by metabolic profiling.
Free Radic Biol Med, 2011. 51(9): p. 1621-35.
248. Liang, H. and W.F. Ward, PGC-1alpha: a key regulator of energy metabolism. Adv Physiol Educ, 2006.
30(4): p. 145-51.
249. Scarpulla, R.C., Metabolic control of mitochondrial biogenesis through the PGC-1 family regulatory
network. Biochim Biophys Acta, 2011. 1813(7): p. 1269-78.
250. Valle, I., et al., PGC-1alpha regulates the mitochondrial antioxidant defense system in vascular endothelial
cells. Cardiovasc Res, 2005. 66(3): p. 562-73.
251. Lin, J., et al., Transcriptional co-activator PGC-1 alpha drives the formation of slow-twitch muscle fibres.
Nature, 2002. 418(6899): p. 797-801.
252. Finck, B.N. and D.P. Kelly, PGC-1 coactivators: inducible regulators of energy metabolism in health and
disease. J Clin Invest, 2006. 116(3): p. 615-22.
253. Puigserver, P., et al., Insulin-regulated hepatic gluconeogenesis through FOXO1-PGC-1alpha interaction.
Nature, 2003. 423(6939): p. 550-5.
254. Stark, R., et al., A role for mitochondrial phosphoenolpyruvate carboxykinase (PEPCK-M) in the
regulation of hepatic gluconeogenesis. J Biol Chem, 2014. 289(11): p. 7257-63.
255. Pei, L., et al., NR4A orphan nuclear receptors are transcriptional regulators of hepatic glucose
metabolism. Nat Med, 2006. 12(9): p. 1048-55.
256. Wansa, K.D., et al., The AF-1 domain of the orphan nuclear receptor NOR-1 mediates trans-activation,
coactivator recruitment, and activation by the purine anti-metabolite 6-mercaptopurine. J Biol Chem,
2003. 278(27): p. 24776-90.
257. Dubois, C., B. Hengerer, and H. Mattes, Identification of a potent agonist of the orphan nuclear receptor
Nurr1. ChemMedChem, 2006. 1(9): p. 955-8.
234
258. Hintermann, S., et al., Identification of a series of highly potent activators of the Nurr1 signaling pathway.
Bioorg Med Chem Lett, 2007. 17(1): p. 193-6.
259. Crawford, R.R., et al., Human CHAC1 Protein Degrades Glutathione and mRNA Induction is Regulated by
the Transcription Factors ATF4 and ATF3 and a Bipartite ATF/CRE Element. J Biol Chem, 2015.
260. Hai, T., et al., ATF3 and stress responses. Gene Expr, 1999. 7(4-6): p. 321-35.
261. Gilchrist, M., et al., Activating transcription factor 3 is a negative regulator of allergic pulmonary
inflammation. J Exp Med, 2008. 205(10): p. 2349-57.
262. Kim, J.Y., et al., Chronic ethanol consumption inhibits glucokinase transcriptional activity by Atf3 and
triggers metabolic syndrome in vivo. J Biol Chem, 2014. 289(39): p. 27065-79.
263. Tsai, W.W., et al., ATF3 mediates inhibitory effects of ethanol on hepatic gluconeogenesis. Proc Natl Acad
Sci U S A, 2015. 112(9): p. 2699-704.
264. Wang, A., et al., The transcription factor ATF3 acts as an oncogene in mouse mammary tumorigenesis.
BMC Cancer, 2008. 8: p. 268.
265. Lu, D., C.D. Wolfgang, and T. Hai, Activating transcription factor 3, a stress-inducible gene, suppresses
Ras-stimulated tumorigenesis. J Biol Chem, 2006. 281(15): p. 10473-81.
266. Ling, K.H., et al., Metabolism of terfenadine associated with CYP3A(4) activity in human hepatic
microsomes. Drug Metab Dispos, 1995. 23(6): p. 631-6.
267. Woosley, R.L., et al., Mechanism of the cardiotoxic actions of terfenadine. JAMA, 1993. 269(12): p. 1532-
6.
268. Odland, T.M., Azacyclonol (frenquel) hydrochloride in the treatment of chronic schizophrenia; a double-
blind, controlled study. J Am Med Assoc, 1957. 165(4): p. 333-5.
269. Braun, D.L., B.B. Brown, and R.G. Feldman, The pharmacologic activity of alpha-(4-piperidyl)-benzhydrol
hydrochloride (azacyclonol hydrochloride); an ataractive agent. J Pharmacol Exp Ther, 1956. 118(2): p.
153-61.
270. Vilar, S., et al., Drug-drug interaction through molecular structure similarity analysis. J Am Med Inform
Assoc, 2012. 19(6): p. 1066-74.
271. OECD, OECD, 2013. Guidance Document on Developing and Assessing Adverse Outcome Pathways.
Series on Testing and Assessment No. 184. 2013.
272. Becker, R.A., et al., Increasing Scientific Confidence in Adverse Outcome Pathways: Application of
Tailored Bradford-Hill Considerations for Evaluating Weight of Evidence. Regul Toxicol Pharmacol,
2015. 72(3): p. 514-537.
273. Fujimoto, K., et al., Sensitivity of liver injury in heterozygous Sod2 knockout mice treated with troglitazone
or acetaminophen. Toxicol Pathol, 2009. 37(2): p. 193-200.
235
274. Hornig-Do, H.T., et al., Isolation of functional pure mitochondria by superparamagnetic microbeads. Anal
Biochem, 2009. 389(1): p. 1-5.
275. Garcia-Cazarin, M.L., N.N. Snider, and F.H. Andrade, Mitochondrial isolation from skeletal muscle. J Vis
Exp, 2011(49).
276. Schmidt-Mende, J., et al., Early mitochondrial alterations in ATRA-induced cell death. Cell Death Differ,
2006. 13(1): p. 119-28.
277. Coelho, A.M., et al., Hepatic damage during acute pancreatitis in the rat. Braz J Med Biol Res, 1997.
30(8): p. 947-53.
278. Mantena, S.K., et al., High fat diet induces dysregulation of hepatic oxygen gradients and mitochondrial
function in vivo. Biochem J, 2009. 417(1): p. 183-93.
279. Tirapelli, L.F., et al., Renal ischemia in rats: mitochondria function and laser autofluorescence. Transplant
Proc, 2008. 40(5): p. 1679-84.
280. Ruggiero, C., et al., High-fat diet induces an initial adaptation of mitochondrial bioenergetics in the kidney
despite evident oxidative stress and mitochondrial ROS production. Am J Physiol Endocrinol Metab, 2011.
300(6): p. E1047-58.
281. Tucci, S., Jr., et al., Calcium channel blocker and renal mitochondrial function in warm renal ischemia. Int
Braz J Urol, 2005. 31(4): p. 384-9.
282. Kemp, R., et al., Evaluation of the mitochondrial respiration of cardiac myocytes in rats submitted to
mechanical bile duct obstruction. Acta Cir Bras, 2008. 23 Suppl 1: p. 66-71; discussion 71.
283. Labieniec-Watala, M., K. Siewiera, and Z. Jozwiak, Resorcylidene aminoguanidine (RAG) improves
cardiac mitochondrial bioenergetics impaired by hyperglycaemia in a model of experimental diabetes. Int J
Mol Sci, 2011. 12(11): p. 8013-26.
284. Taylor, D., S. Bhandari, and A.M. Seymour, Mitochondrial dysfunction in uremic cardiomyopathy. Am J
Physiol Renal Physiol, 2015. 308(6): p. F579-87.
285. Shen, X., et al., Protection of cardiac mitochondria by overexpression of MnSOD reduces diabetic
cardiomyopathy. Diabetes, 2006. 55(3): p. 798-805.
286. Yajid, F., et al., Effects of 4 wk of hindlimb suspension on skeletal muscle mitochondrial respiration in rats.
J Appl Physiol (1985), 1998. 84(2): p. 479-85.
287. Crescenzo, R., et al., Skeletal muscle mitochondrial oxidative capacity and uncoupling protein 3 are
differently influenced by semistarvation and refeeding. FEBS Lett, 2003. 544(1-3): p. 138-42.
288. Muller, F.L., et al., Denervation-induced skeletal muscle atrophy is associated with increased
mitochondrial ROS production. Am J Physiol Regul Integr Comp Physiol, 2007. 293(3): p. R1159-68.
289. Lin, L., et al., Regulation of skeletal muscle oxidative capacity and muscle mass by SIRT3. PLoS One,
2014. 9(1): p. e85636.
236
290. Stauch, K.L., P.R. Purnell, and H.S. Fox, Aging synaptic mitochondria exhibit dynamic proteomic changes
while maintaining bioenergetic function. Aging (Albany NY), 2014. 6(4): p. 320-34.
291. Yan, W. and J. Liu, Effects of Chinese herbal monomers on oxidative phosphorylation and membrane
potential in cerebral mitochondria isolated from hypoxia-exposed rats in vitro. Neural Regen Res, 2012.
7(27): p. 2099-106.
292. Cormier, A., et al., Nicotine protects rat brain mitochondria against experimental injuries.
Neuropharmacology, 2003. 44(5): p. 642-52.
293. Pandya, J.D., V.N. Nukala, and P.G. Sullivan, Concentration dependent effect of calcium on brain
mitochondrial bioenergetics and oxidative stress parameters. Front Neuroenergetics, 2013. 5: p. 10.
294. Singh, I.N., et al., Phenelzine mitochondrial functional preservation and neuroprotection after traumatic
brain injury related to scavenging of the lipid peroxidation-derived aldehyde 4-hydroxy-2-nonenal. J Cereb
Blood Flow Metab, 2013. 33(4): p. 593-9.
295. Papkovsky, D.B., et al, Phosphorescent Oxygen Sensitive Probes.SpringerBriefs in Biochem and Mol Bio,
2012. DOI: 10.1007/978-3-0348-0525-4_2
296. Dranka, D.P., et al., Assessing bioenergetic function in response to oxidative stress by metabolic profiling.
Free Radic Biol Med, 2011. 51(9): 1621-1635.
237
APPENDIX I – STRUCTURAL ASSESSMENT OF ISOLATED
MITOCHONDRIAL FRACTIONS
Following optimisation of mitochondrial isolation procedures for the five tissues of highest metabolic
load (i.e. the liver, kidney, heart, skeletal muscle and brain) it was important to assess the structural
integrity of the obtained fractions. Although the use of isolated mitochondria have proved to be a very
powerful tool in the study of the OXPHOS system, biogenesis, substrate oxidation etc., compromises
remain regarding their utility as tools to study DIMT. One of the primary compromises relates to the
effect of mitochondrial isolation on the structural integrity of the obtained fraction and as a result, the
“likeness” of the isolated mitochondria to those in the in vivo milieu. The isolation of mitochondria from
animal tissues is a stressful procedure, typically relying on Dounce, Potter-Elvehjem and rotor/stator
shearing homogenisers [102]. This causes structural damage to the mitochondria, disruption of the
heterogeneous bioenergetic network and disturbance to dynamic mitochondrial processes (e.g. fission and
fusion). It was therefore decided to use electron microscopy and Western blots to assess the structural
integrity of the mitochondria isolated from each tissue in an attempt to determine the suitability of these
isolates for the study of DIMT.
APPENDIX 1.1: Transmission Electron Microscopy
TEM imaging was performed on isolated mitochondrial pellets (from all five tissues) as described in
section 2.10.1. TEM images and a description of the main findings are presented in Appendix Table 1.1
below.
238
Organ Low magnification (12000x) High magnification (30000x) Details
Liver
The mitochondria were
generally of typical appearance
with intact cristae and medium
electron dense matrices. The
cristae showed a degree of
swelling and the occasional pale
swollen mitochondrion was
seen. A large amount of
heterogeneous material (tubular,
vesicular and amorphous
material) was present between
the mitochondria.
Kidney
Little heterogeneous material
and no presence of other
organelles. Large swelling of
cristae was observed with low
electron density matrices
Heart
The mitochondria were
generally of normal appearance
although a small proportion had
swollen cristae. They show a
high density of tightly packed
cristae. There was little
heterogeneous material
observed between the
mitochondria with no other
organelles present.
Skeletal
Muscle
Many of the mitochondria were
swollen or showed quite marked
dilation of the cristae. The
mitochondria obtained from this
tissue were considered to be the
most altered. Other organelles
were not present but fragments
of myofibrils were seen among
the mitochondria.
239
APPENDIX TABLE 1.1: TEM Analysis of crude mitochondrial pellets isolated from five tissues of high metabolic load.
Isolated mitochondria from liver, kidney, heart, skeletal muscle and brain were processed for TEM as described in section 2.10.2. Images are shown at 12,000x and 30,000x magnification.
In addition to observations made in appendix table 1.1 above, brain mitochondria were often observed
within membrane bound vacuoles. It is believed that these vacuoles are synaptosomes which are formed
when pre-synaptic membranes re-seal enclosing the contents of the nerve terminals (not shown).
Furthermore a number of liver mitochondria were observed undergoing fission/fusion events although it
remains unclear whether this is physiological (e.g. repair mechanisms, natural replication) or simply an
idiosyncratic observation with little relevance to the population of mitochondria (not shown).
Brain
The mitochondria were
generally of normal appearance
but a proportion contained
swollen cristae. The
mitochondrial membranes
appeared densely organised.
240
APPENDIX 1.2: Western Blot
The Western blot data presented in Fig.Appendix1 below generally supports observations from the TEM
investigations described above. Mitochondrial protein was analysed by Western blot according to the
method outlined in section 2.11. Mitochondria were also probed for detection of proliferating cell nuclear
antigen (anti-PCNA) and alpha-tubulin (Anti-α-tubulin) as markers of both the nuclear and cytoplasmic
fractions respectively. This was performed to ensure purity of the mitochondrial fractions from other
cellular compartments. Despite observations of cellular debris in the TEM images, no PCNA or α-tubulin
was detectable via Western blot (data not shown), suggesting that mitochondrial preparations from all
tissues are relatively pure and lacking in contamination.
The molecular weights of the structural subunit proteins are generally consistent with those suggested by
the manufacturer (outlined in Appendix-Fig.1.1B) although a slight discrepancy is seen with the
cyclophilin D and cytochrome c proteins. Western blot data supports the TEM observations which show
mitochondria isolated from the heart with prominent banding and protein abundance especially in terms
of the inner membrane respiratory complexes, the mitochondrial matrix and the IMS. The dense banding
also suggests larger quantities of protein at all mitochondrial levels per mg of mitochondria analysed.
Likewise mitochondria from the skeletal muscle were suggested to be the most altered in terms of
structure following TEM analysis and this is confirmed via Western blot where banding appears faint and
only very minor levels of the OMM porin proteins were detected.
241
APPENDIX FIGURE 1.1: Assessment of mitochondria isolated from 5 rodent tissues via Western blot.(A) Mitochondria
isolated from the liver, kidney, heart, skeletal muscle and brain were examined via Western blot using a
multiplexed Antibody cocktail containing proteins essential to the IMM (complex V), OMM (porin), matrix
(cyclophilin D) and IMS (cytochrome C). (B) Image lifted from Mitosciences protocol booklet (Abcam
#ab110414) detailing the expected molecular weights of each protein and the identification of corresponding
bands [http://www.abcam.com/membrane-integrity-wb-antibody-cocktail-ab110414.html] – Accessed 10 July
2015.
Western blot data with liver, kidney and brain suggests that the integrity of the mitochondria isolated
from these tissues is generally fair although all have relatively faint banding of the OMM porin protein.
This was to be expected as it suggests that the isolation procedure affects the outer membrane structure
more severely than the IMM, IMS and matrix. Despite general accordance with the manufacturer’s
expected banding (see Fig.Appendix 1B) no separation of the two OMM porin isoforms was observed in
any mitochondrial preparation. It remains unknown whether this is due to structural damage to the outer
membrane or due to poor resolution/contrast in the Western blot images. Following analysis of both TEM
images and Western blot data, the rank order of structural integrity following mitochondrial isolation is
shown below.
Heart > Liver > Brain > Kidney > Skeletal Muscle
Liver Kidney Heart
Skeletal
Muscle Brain
A B
242
The structural data presented in this appendix does however suggest that all mitochondrial isolates are
relatively fit for purpose. The isolation protocols are all selective for the mitochondrial population (i.e. no
obvious presence of other organelles) and all isolate mitochondria which remain structurally sound
(although to varying degrees of success). Future work should focus on the continued improvement of
isolation protocols and should assess the utility of methods, either not involving the manual
homogenisation of tissue (i.e. tissue shredders [102] or nitrogen cavitation [130]), or which rely less on
stressful homogenisation steps (i.e. the magnetic bead capture methods [274]).
243
APPENDIX II – FUNTIONAL ASSESSMENT OF ISOLATED
MITOCHONDRIAL FRACTIONS
Following optimisation of mitochondrial isolation procedures, it was important to ensure the obtained
fractions were functional in a number of key assays. A sustained period of time was spent optimising the
parameters for mitochondria isolated from all five tissues in the CRC, OCR and mitochondrial ΔΨ assays.
It does however remain inherently challenging to compare mitochondria isolated from each tissue. This is
a result of the vastly different isolation protocols which produce fractions which vary widely with regard
to the following…
Mitochondrial number (i.e. per mg of tissue).
The degree of structural damage caused by the isolation procedure, particularly the tissue
homogenisation step.
The resulting buffer which the mitochondria are stored in.
As a result of the above factors, the optimisation of each assay with each mitochondrial fraction required
individual tailoring. This optimisation created a functional battery of assays with mitochondria from these
five tissues. Key optimisation variables included the mitochondrial substrate (i.e. complex I or complex II
driven substrates) and the concentration of mitochondria. The resulting assay kinetics therefore reflect
artefacts of both the isolation protocol and optimisation parameters in combination with the biology and
metabolic activity of the mitochondria from each tissue. As a result and due to the fact that the assay
conditions of mitochondria from each tissue are so non-standardised, directly comparing the functionality
of mitochondria from each tissue is fundamentally problematic.
A functional assessment which was made however was the respiratory control ratio (RCR) of
mitochondria from all five tissues. The RCR is calculated by dividing the respiration in state 3 (ADP-
driven respiration) by that in state 4. As a result, the RCR represents the degree of coupling between ETC
function and OXPHOS with high RCR values implying that mitochondria have a high capacity for
substrate utilisation and ATP turnover and a low proton leak [75]. Although there is no benchmark RCR
to define functional/dysfunctional mitochondria (as RCR is substrate and tissue dependent), Garcia-
244
Cazarin and colleagues in 2011 suggested that an RCR of above 4 is considered as evidence of a viable
mitochondrial population [275]. This was therefore the arbitrary RCR-number which was deemed
acceptable for mitochondria isolated from each tissue. In order to validate the viability and functionality
of the obtained RCR values, comparisons were drawn to others reported in the literature with
mitochondria isolated from each tissue. RCR values obtained from isolated mitochondrial fractions are
shown in Appendix Fig.2.1 below. These RCR values have been calculated as an average (±SD) of a
number of control animals used in multiple studies at GlaxoSmithKline over the course of the PhD (n-
numbers stated below).
T is su e o r ig in o f
iso la te d m ito c h o n d r ia
RC
R
L iv e r K id n e y H e a rt S M B ra in
0
2
4
6
8
APPENDIX FIGURE 2.1: RCR values obtained for mitochondria isolated from liver, kidney, heart, skeletal muscle and
brain rat tissues. Data represents RCR values (state 3/state 4) for mitochondria isolated from rat liver (n=37), kidney (n=8), heart (n=37), skeletal muscle (n=24) and brain (n=17). Data shown is mean ± SD.
RCR values shown in appendix Fig.2.1 above correlate well with published values obtained in other
laboratories as shown in appendix table 2.1 below. It is however important to acknowledge that
measurement of mitochondrial respiration is performed using multiple different techniques (i.e. Seahorse
Bioanalysers, Luxcel oxygen sensing probes, Clarke-type electrode) and, as a result, RCR values are
likely to differ greatly making the drawing of valid comparisons challenging. The technique used to
generate the reported RCR’s is also detailed in appendix table 2.1.
245
APPENDIX TABLE 2.1: Non-quantitative comparison between obtained RCR values for mitochondria isolated from five
tissues of high metabolic load and published RCR values.
The obtained RCR values are comparable with those reported in the literature although, with all tissues,
higher RCR values can be found in the literature. Any future attempts to improve isolation protocols
should use RCR values as the gold-standard measure of mitochondrial viability and isolation protocols
should only be changed if higher RCR values are consistently obtained.
Tissue Origin Achieved RCR Published RCR (including method used for respiratory analyses)
Liver 4.81 RCR = 4 (Hanastech Instruments, Oxygen electrode) [276].
RCR = 5.86 (Clark-type electrode)[104].
RCR = 4.45 (Gilson oxygraph) [277]
RCR = 4.4 - 4.5 (Clark-type electrode) [278].
Kidney 4.66 RCR = 3.6-4.1 (Oroboros oxygraph system) [102]
RCR = 3 – 3.5 (Clark-type electrode) [279]
RCR = ~3.2 (Seahorse XF24) [280].
RCR = 5.21 (Gilson oxygraph) [281].
Heart 4.06 RCR = 4.3 (Clark-type electrode) [282].
RCR = 2.4 – 3.5 (Clark-type electrode)[283]
RCR = 5 – 12 depending on substrate utilised (Clark-type electrode) [284].
RCR = 6 – 8.5 (Clark-type electrode) [285].
Skeletal Muscle 5.82 RCR = ~2 – 6 depending on substrate utilised (Clark-type electrode) [286]
RCR = 3.4 – 10 depending on substrate utilised (Clark-type electrode)[287]
RCR = 6-10 (Clark-type electrode)[288]
RCR = ~3.9 (Oroboros oxygraph)[289] .
Brain 4.36 RCR = 3 – 3.25 (Seahorse XF24) [290].
RCR = 5.5 (Clark-type electrode) [291].
RCR = 3 – 3.5 (Clark-type electrode) [292]
RCR = 6.6 (Clark-type electrode)[293]
RCR = ~7 (Seahorse XF24) [294].
246
APPENDIX III – CONCENTRATION OF GSK932121A IN
ISOLATED LIVER MITOCHONDRIA OF RATS TREATED
WITH A 50MG/KG DOSE (CHAPTER 3)
Appendix Table 3.1: Levels of GSK932121A in the mitochondrial fraction. GSK932121A levels were assessed in the
mitochondrial fraction to determine if GSK932121A had been washed out during the isolation procedure. An
average concentration of 1.9µM (± 1.4µM sd) GSK932121A was detected in the mitochondrial fraction which
is above the IC50 for mammalian cytochrome bc1 inhibition as described in reference [12], i.e.IC50 = 0.4µM (human Hek293 cells) and 0.6µM (rat H9C2 cells).
Rat ID GSK932121A level in mitochondrial
fraction (µg/mg)
GSK932121A concentration (µM)
i 1.79 4.2
ii 1.71 4.02
iii 0.92 2.16
iv 0.81 1.9
v 0.74 1.74
vi 0.0016 0.0038
vii 0.381 0.89
viii 0.831 1.95
ix 0.706 1.66
x 0.127 0.3
247
APPENDIX IV: METABOLOMICS RAW DATA
Liver Data
Appendix Table 4.1: Liver metabolomics raw data: The table shown details the raw (scaled intensity) liver metabolomics data for the biochemicals reported in chapter 4. Raw
metabolomics data is assigned to the rat ID (numbered 1-20) showing the differential effect of GSK932121A (12.5mg/kg and 50mg/kg) and vehicle control.
Control 12.5mg/kg GSK932121A 50mg/kg GSK932121A
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
Maltohexaose 1.196 1.026 0.675 0.974 1.100 1.306 1.056 1.652 0.889 0.165 0.165 0.165 0.228 2.576 0.165 0.165 0.165 0.535 0.165 0.165
Maltotriose 12.954 13.252 10.160 10.838 13.005 15.368 11.461 10.745 11.877 7.635 1.531 4.209 7.905 16.607 0.459 0.057 0.091 8.940 1.000 0.345
Maltose 3.090 3.325 2.489 2.934 3.200 3.727 2.885 2.280 3.283 2.694 1.169 1.678 2.597 3.831 0.693 0.086 0.154 2.513 0.555 0.548
Glucose 1.393 1.485 1.176 1.543 1.152 1.427 1.259 1.116 1.484 1.411 0.806 1.098 1.328 1.250 0.696 0.247 0.306 1.199 0.499 0.615
Glucose 6 Phosphate 0.797 0.796 0.727 1.522 0.752 0.797 0.790 0.963 0.777 1.526 1.004 1.000 1.183 1.139 1.116 1.349 0.931 1.045 1.239 1.582
2-Phosphoglycerate 0.426 0.603 0.870 1.000 0.465 0.694 0.544 0.644 0.575 0.970 1.277 1.004 0.805 1.159 1.089 0.893 1.055 0.750 1.261 1.145
Phosphoenolpyruvate 0.547 0.684 0.676 1.000 0.424 0.624 0.666 0.636 0.602 0.906 1.113 1.208 0.932 0.986 1.113 1.212 0.972 0.705 1.278 1.267
Pyruvate 1.773 3.074 3.946 2.612 1.733 4.343 0.301 2.246 0.840 1.727 1.000 1.528 2.179 4.701 0.605 0.217 0.012 0.690 1.567 0.332
Lactate 1.207 1.270 1.215 1.451 1.164 1.245 1.005 1.106 1.080 1.492 0.909 1.167 1.177 1.000 0.843 0.379 0.456 0.971 0.675 0.758
3-hydroxybutyrate (BHBA) 0.968 0.689 0.954 0.569 0.933 0.529 1.274 0.456 1.029 0.635 1.000 1.029 1.302 0.552 1.438 1.326 1.985 1.127 1.532 1.543
Serine 0.853 0.975 0.732 0.690 0.879 0.888 1.109 1.049 0.940 1.200 0.967 1.059 1.074 1.170 1.305 1.389 1.328 0.996 1.341 1.075
Threonine 0.899 0.942 0.724 0.620 0.917 0.898 0.874 0.788 0.979 1.203 1.025 1.209 1.071 0.913 1.617 1.602 1.763 0.810 1.514 1.297
Valine 0.893 0.899 0.942 0.786 0.908 1.000 0.970 0.916 1.121 1.173 0.977 0.962 1.001 0.981 1.197 0.972 1.242 0.870 1.154 1.289
Leucine 0.871 0.947 1.020 0.776 0.980 1.097 0.970 0.967 1.170 1.179 0.920 0.874 0.961 1.037 1.147 0.889 1.187 0.871 1.069 1.252
Isoleucine 0.934 0.989 1.006 0.850 0.948 1.086 0.989 0.935 1.186 1.181 0.970 0.887 1.000 1.053 1.205 0.934 1.223 0.889 1.169 1.311
Sedoheptulose-7-phosphate 0.679 0.980 0.758 1.016 0.585 0.831 1.331 0.767 0.726 1.898 1.428 1.191 1.120 0.544 4.001 4.368 1.467 2.804 2.979 3.892
Cysteine-glutathione disulfide 0.606 0.446 1.417 0.652 0.566 0.545 1.704 0.896 0.726 1.208 0.841 0.940 1.000 0.873 0.939 1.080 0.982 0.767 1.328 0.666
Opthalmate 1.504 0.665 0.909 0.359 0.641 0.397 1.000 0.987 0.783 0.938 1.693 1.625 1.802 0.720 0.166 0.319 0.082 0.225 0.708 0.633
Glutathione Reduced (GSH) 1.558 1.502 1.124 1.578 1.505 1.415 1.260 1.376 1.717 1.367 1.187 1.590 1.057 1.258 0.600 0.564 0.789 1.282 0.608 0.980
Glutathione Oxidized (GSSG) 0.676 0.980 1.396 0.753 0.760 0.900 0.938 0.762 0.753 1.152 0.908 0.884 1.065 0.910 1.250 1.000 0.869 1.011 1.497 1.146
248
Plasma Data
Animal Time
Dose
(mg/kg) citrate
α-
ketoglutarate succinate fumarate malate carnitine BHBA
Palmitoyl
Carnitine
(C16)
Oleoyl
carnitine
(C18)
Stearoyl
Carnitine
(C18) valine leucine isoleucine AHB AKB
1 Predose
VC
0.642 0.375 0.863 0.594 0.495 1.045 0.386 0.630 0.595 0.542 0.664 0.700 0.623 0.470 0.206
2 Predose 0.867 0.745 1.111 0.804 0.835 0.939 0.554 0.879 0.678 0.849 1.047 1.126 1.010 0.655 0.048
3 Predose 1.162 0.956 1.100 0.953 1.151 0.961 1.000 0.712 0.745 0.978 1.088 1.095 1.019 0.671 0.268
4 Predose 0.990 1.522 1.378 1.554 1.683 0.917 0.711 0.750 0.609 0.785 1.099 1.084 1.012 0.850 1.048
5 Predose 1.118 0.846 0.945 0.896 0.956 0.812 0.665 0.441 0.338 0.612 1.050 1.035 0.967 0.428 0.786
7 Predose
12.5
1.085 1.184 0.885 0.755 0.912 0.884 0.702 0.630 0.593 0.698 0.792 0.916 0.788 1.000 0.209
8 Predose 1.097 0.714 0.986 0.721 0.718 0.786 0.608 0.643 0.599 0.770 1.023 1.149 0.996 0.430 0.048
9 Predose 1.132 1.189 1.943 1.906 2.016 0.776 0.821 0.707 0.663 0.744 1.009 1.020 0.996 1.012 0.401
10 Predose 0.914 0.821 0.992 1.044 1.233 0.998 0.587 0.873 0.712 0.901 0.922 0.959 0.859 0.822 2.163
11 Predose 1.250 2.023 2.093 2.015 2.078 0.994 1.007 1.146 1.190 1.114 1.043 1.000 1.000 0.911 0.220
12 Predose 1.224 1.031 1.786 1.306 1.195 1.007 0.847 1.002 1.168 1.100 0.900 0.881 0.773 0.972 0.209
13 Predose 1.046 0.679 1.023 0.711 0.651 0.784 0.996 1.095 1.497 1.116 0.923 0.891 0.864 0.538 0.048
14 Predose
50
1.110 0.581 0.855 0.753 0.740 0.831 0.529 0.835 0.760 0.999 0.932 1.023 0.921 0.833 0.332
15 Predose 0.968 0.955 1.213 0.951 0.878 1.037 0.662 0.778 0.569 0.739 1.070 1.063 1.005 0.631 0.478
16 Predose 0.968 0.970 1.000 0.982 1.000 0.861 1.414 1.298 1.518 1.126 1.000 0.962 0.940 1.032 1.410
17 Predose 1.412 1.512 2.353 2.330 3.037 0.928 0.839 0.837 0.724 0.868 1.116 1.132 1.045 0.876 0.048
18 Predose 0.940 0.779 1.046 1.035 0.929 0.977 0.878 0.631 0.514 0.718 1.137 1.174 1.087 0.508 1.066
19 Predose 1.205 2.257 4.726 2.656 3.171 1.044 1.003 1.078 0.929 1.067 1.064 1.074 1.019 0.981 0.151
20 Predose 1.026 1.305 2.208 1.454 1.488 0.945 0.876 0.980 0.993 0.983 0.993 1.072 0.909 0.691 0.240
1 0.5h
VC
1.011 1.454 1.266 1.000 0.902 1.257 0.583 0.971 1.000 0.763 0.958 1.033 0.958 0.599 0.245
2 0.5h 1.176 1.054 0.849 0.577 0.725 0.983 0.668 0.760 0.767 0.785 0.992 1.000 0.974 0.644 0.048
3 0.5h 1.013 0.746 0.891 0.607 0.605 1.099 0.711 0.878 0.918 0.981 0.965 1.062 0.988 0.336 0.048
4 0.5h 1.332 1.981 2.289 2.114 2.407 1.068 0.946 0.879 0.708 0.791 1.061 1.031 1.051 1.051 0.296
5 0.5h 1.321 1.608 1.093 1.009 0.803 1.004 0.931 0.509 0.484 0.692 1.002 1.097 1.014 0.765 0.328
6 0.5h 1.565 1.351 1.215 0.828 0.860 0.948 0.443 0.603 0.524 0.650 0.816 0.872 0.796 0.315 0.402
7 0.5h
12.5
0.879 0.892 0.682 0.600 0.467 0.824 0.589 0.894 0.868 1.001 0.865 0.934 0.825 0.775 0.288
9 0.5h 0.970 1.167 1.093 0.850 0.760 0.774 0.824 0.883 0.970 0.864 0.977 1.008 0.977 0.820 0.048
10 0.5h 0.998 0.932 0.894 1.051 1.117 1.043 0.649 0.998 0.899 1.132 0.902 0.998 0.920 0.875 0.048
11 0.5h 1.637 2.135 2.218 2.297 2.592 1.035 2.407 1.957 2.569 1.374 0.921 0.910 0.946 2.241 2.066
12 0.5h 1.235 1.756 1.884 1.622 1.827 1.140 1.201 1.220 1.296 1.000 0.806 0.809 0.782 3.331 1.052
13 0.5h 1.306 0.883 1.321 1.454 1.451 0.819 0.857 1.024 1.000 1.120 0.986 1.010 1.006 1.319 0.609
14 0.5h
50
1.079 0.877 0.744 0.694 0.599 0.955 0.632 0.896 0.881 0.957 0.872 0.908 0.896 0.739 0.412
15 0.5h 1.104 0.649 1.857 1.112 1.413 1.184 1.019 1.136 1.007 1.072 0.973 0.979 0.989 1.138 0.281
16 0.5h 1.202 0.631 1.529 1.663 1.789 0.914 1.393 1.352 1.507 1.263 0.960 0.985 0.973 2.220 2.188
249
17 0.5h 1.531 0.853 1.224 1.021 1.000 1.006 1.252 1.012 1.053 0.939 1.008 1.034 0.994 0.912 0.048
18 0.5h 1.000 1.080 1.035 1.021 1.008 1.000 1.306 0.685 0.733 0.761 0.905 0.940 0.882 0.365 0.048
19 0.5h 1.201 0.797 2.388 1.877 1.921 1.276 1.497 1.288 1.457 1.046 0.842 0.921 0.903 2.835 1.063
20 0.5h 0.981 1.029 1.657 1.367 1.211 0.958 1.003 1.374 1.413 1.275 0.994 1.008 0.999 2.064 1.305
1 1h
VC
1.212 1.066 0.872 0.638 0.686 1.288 0.738 0.909 0.961 0.730 1.061 1.081 1.051 0.956 0.502
2 1h 0.982 0.507 1.525 1.013 1.059 0.999 0.703 1.089 1.000 1.062 1.060 1.046 1.059 0.832 0.048
3 1h 1.097 1.194 1.000 0.723 0.741 1.064 1.656 0.717 0.902 0.762 1.006 0.964 0.975 0.362 0.563
4 1h 1.282 1.750 3.780 2.201 2.158 1.168 1.011 1.073 0.859 0.941 0.962 1.009 1.016 1.020 0.048
5 1h 1.308 1.140 1.077 1.161 1.245 0.946 0.792 0.455 0.369 0.527 1.022 1.002 0.974 0.702 0.048
6 1h 1.000 0.286 0.746 0.535 0.320 0.928 0.319 0.601 0.501 0.614 0.858 0.931 0.822 0.244 0.207
7 1h
12.5
0.860 0.851 0.823 0.740 0.646 0.855 0.709 0.792 0.753 0.844 0.893 0.987 0.880 0.822 0.308
8 1h 0.867 0.546 1.276 0.827 0.639 0.728 0.406 0.435 0.497 0.497 0.719 0.793 0.705 0.271 0.048
9 1h 1.059 0.979 0.858 0.791 0.744 0.872 0.559 0.856 0.908 0.961 0.991 0.980 0.990 0.672 0.048
10 1h 0.949 0.816 0.995 0.982 0.980 1.059 0.780 1.002 0.921 1.007 0.900 0.964 0.963 0.673 0.465
11 1h 1.348 2.162 1.024 1.381 1.444 1.000 1.756 1.681 2.051 1.270 0.887 0.859 0.883 1.947 1.777
12 1h 1.115 0.980 1.000 0.859 0.782 1.098 1.591 1.500 1.477 1.277 0.944 0.916 0.924 2.593 1.400
13 1h 1.412 1.200 2.624 1.359 1.327 0.776 1.966 0.969 1.284 1.106 1.043 1.001 1.091 1.052 0.685
14 1h
50
0.923 0.735 0.624 0.758 0.544 1.006 0.668 0.883 0.903 1.001 0.898 0.895 0.895 0.690 0.048
15 1h 1.068 0.662 0.799 0.603 0.672 1.053 0.758 0.997 0.932 0.993 0.998 0.965 1.016 0.960 0.048
16 1h 1.487 2.629 1.447 1.710 1.946 0.891 1.922 1.621 1.688 1.281 0.937 0.888 0.908 3.149 2.083
17 1h 1.532 1.112 1.165 0.989 1.104 0.976 1.486 0.867 0.874 0.795 0.984 0.977 1.032 1.314 0.353
18 1h 1.162 1.014 0.909 1.000 0.884 1.000 1.341 0.725 0.746 0.718 0.813 0.813 0.796 0.405 0.048
19 1h 1.350 1.777 1.172 1.406 1.302 1.129 1.900 1.103 1.359 1.021 0.860 0.814 0.851 2.834 1.788
20 1h 1.115 0.717 1.076 0.991 1.280 0.933 1.049 0.934 1.043 0.953 1.004 0.961 1.001 2.153 1.326
1 2h
VC
0.974 0.293 0.657 0.431 0.657 1.234 0.970 0.888 0.876 0.780 1.147 1.125 1.143 1.000 1.470
2 2h 0.868 0.720 0.689 0.529 0.476 1.000 0.552 0.815 0.799 0.994 1.026 1.000 0.983 0.652 0.316
3 2h 0.965 1.046 1.129 0.792 0.778 0.937 0.914 1.032 0.988 1.137 0.861 0.873 0.862 0.481 0.302
4 2h 1.017 0.904 1.109 1.029 0.928 0.994 0.476 0.882 0.720 0.929 0.919 0.980 0.939 0.733 0.335
5 2h 1.081 0.971 1.156 0.870 0.848 1.002 0.800 0.628 0.496 0.694 0.902 0.897 0.863 0.734 0.048
6 2h 0.977 1.000 1.223 0.746 0.522 0.956 0.409 0.788 0.623 0.821 0.825 0.905 0.840 0.322 0.048
7 2h
12.5
0.962 0.803 0.578 0.672 0.606 0.811 1.214 0.947 0.878 0.861 0.817 0.857 0.818 0.900 0.257
8 2h 1.432 0.992 1.518 0.970 1.136 0.813 0.756 0.710 0.808 0.890 0.957 1.019 0.958 0.365 0.188
9 2h 0.879 0.691 1.118 0.828 0.709 0.902 0.718 0.979 1.124 1.001 0.900 0.900 0.919 0.524 0.048
10 2h 1.148 1.492 1.171 1.218 1.446 0.980 1.394 1.078 1.106 0.975 1.019 1.014 1.127 2.372 1.306
11 2h 1.206 0.740 0.782 0.804 0.951 0.952 2.272 2.332 2.224 1.463 0.963 0.946 1.026 2.544 3.611
12 2h 1.295 1.049 1.393 1.000 1.183 0.959 2.868 1.767 1.985 1.244 0.903 0.908 1.000 4.946 1.846
13 2h 1.096 0.960 0.603 0.657 0.565 0.692 2.248 1.665 2.118 1.276 0.908 0.848 0.947 2.194 2.508
250
Appendix Table 4.2: Plasma metabolomics raw data: The table details the raw (scaled intensity) plasma metabolomics data for the biochemicals reported in chapter 4. Raw
metabolomics data is assigned to the rat ID (numbered 1-20) showing the differential effect of GSK932121A (12.5mg/kg and 50mg/kg) and vehicle control. Data
is ordered according to 5 sample collection times (pre-dose, 0.5hr, 1hr, 2hr and 4hr post dose).
14 2h
50
1.010 0.483 0.485 0.584 0.636 0.903 0.662 1.021 1.030 1.054 0.833 0.868 0.902 0.562 0.048
15 2h 0.988 0.690 0.699 0.627 0.623 0.984 0.925 1.347 1.368 1.048 1.021 0.931 1.074 1.365 1.020
16 2h 1.346 1.485 0.723 0.979 0.935 0.707 2.619 1.682 1.883 1.130 0.949 0.863 0.949 3.582 3.332
17 2h 1.253 0.539 0.807 0.708 0.715 0.790 1.039 0.781 0.891 0.776 1.000 0.905 1.067 1.352 0.944
18 2h 1.113 0.515 0.714 0.813 0.608 0.865 2.514 1.249 1.388 1.113 0.925 0.913 1.061 0.623 0.560
19 2h 1.349 1.136 0.813 1.129 1.165 0.979 3.839 2.267 2.798 1.166 0.911 0.847 0.970 7.664 5.104
20 2h 1.002 1.295 0.690 0.665 0.681 0.908 1.579 1.322 1.782 1.151 1.055 1.005 1.104 3.677 6.051
1 4h
VC
1.066 0.800 0.658 1.911 2.498 1.139 0.911 0.989 0.803 0.817 1.309 1.273 1.352 2.288 2.475
2 4h 0.853 0.455 0.423 0.738 0.799 0.992 0.709 0.934 0.800 0.926 1.179 1.196 1.239 1.256 1.188
3 4h 0.965 1.239 0.490 0.880 0.862 1.031 1.196 0.898 0.783 0.929 0.954 0.907 0.938 1.000 1.252
4 4h 0.934 1.688 0.907 1.979 1.963 1.057 0.997 0.755 0.625 0.813 0.956 1.089 1.056 1.258 0.411
5 4h 0.968 1.134 0.597 1.443 1.530 0.981 1.035 0.605 0.598 0.538 0.883 0.862 0.913 0.941 0.710
6 4h 0.857 0.644 0.622 1.020 1.031 0.915 0.624 0.768 0.690 0.768 1.033 1.094 1.089 0.499 0.939
7 4h
12.5
1.364 1.472 0.559 1.398 1.906 0.734 1.591 1.169 1.036 1.053 0.917 0.931 0.995 3.694 2.193
8 4h 1.118 1.115 0.674 1.359 1.450 0.744 0.739 0.721 0.826 0.816 1.008 1.078 1.166 1.156 1.246
9 4h 0.974 0.490 0.379 0.748 0.724 0.763 1.016 0.964 1.045 0.896 1.022 1.001 1.192 0.988 0.408
10 4h 1.031 1.034 0.581 1.211 0.939 0.867 0.997 1.181 1.020 0.893 0.979 0.920 1.095 7.376 6.091
11 4h 1.093 1.690 1.256 3.221 3.098 0.943 1.722 2.498 2.036 1.339 1.018 0.951 1.074 4.020 3.203
12 4h 1.053 1.457 0.605 1.871 1.760 0.942 1.768 2.003 1.738 1.406 1.143 1.074 1.250 6.856 3.618
13 4h 1.044 1.000 0.783 1.440 1.528 0.712 4.050 2.610 2.862 1.442 1.000 0.986 1.140 6.380 8.154
14 4h
50
0.954 0.774 0.509 0.916 1.025 0.840 1.591 1.248 1.287 1.047 1.166 1.191 1.366 1.691 1.933
15 4h 1.430 1.675 1.227 5.937 8.771 0.695 1.928 1.864 1.752 1.262 1.482 1.493 1.756 8.013 2.910
16 4h 1.269 4.528 2.627 10.358 11.156 0.682 1.801 2.134 1.925 1.464 1.356 1.470 1.527 7.429 5.848
17 4h 2.152 4.178 4.709 15.840 22.674 0.662 3.914 2.190 2.351 1.149 1.856 1.969 2.051 10.990 3.112
18 4h 1.030 1.487 0.735 1.948 1.737 0.850 1.737 1.279 1.330 0.884 1.196 1.168 1.358 1.193 0.833
19 4h 1.136 2.763 1.416 4.004 4.335 0.926 1.949 2.181 2.228 1.431 1.170 1.166 1.387 13.343 5.806
20 4h 1.156 1.775 0.602 1.481 1.527 0.746 3.120 1.883 2.312 1.248 1.108 1.008 1.237 11.351 10.924
251
APPENDIX V: METABOLON PLASMA LACTATE ANALYSIS
Appendix Fig.5.1: Plasma lactate measured by Metabolon following treatment of rats with 12.5mg/kg and 50mg/kg
GSK932121A. Data shows the effect of GSK932121A (12.5mg/kg light blue line and 50mg/kg dark blue line)
on plasma lactate levels compared to VC (turquoise line). Plasma samples were assessed pre-dose and then 0.5,
1, 2 and 4 hours post-dose. Data shown represents scaled intensity of the total ion counts for each metabolite
whereby the median ion is equal to 1. A significant increase in plasma lactate was observed at 4 hours post-dose with 50mg/kg GSK932121A (n=7) compared to VC (n=6), p<0.01**.
**