A STUDY OF GENETIC ANALYSIS OF MULTIDRUG

RESISTANT SALMONELLA TYPHI

Dr. Khalid Mahmood

MBBS, M. Phil (Microbiology)

SUPERVISOR

Prof. Dr. Mateen Izhar

Head of Pathology Division & Department of Microbiology FPGMI,

Shaikh Zayed Medical Complex Lahore

Dissertation in partial fulfillment of the requirement for the award of PhD degree in

Microbiology from University of the Punjab, Lahore, Pakistan

PLACE OF WORK

Federal Postgraduate Medical Institute, Shaikh Zayed Medical Complex, Lahore

&

School of Biological Sciences, University of the Punjab, Lahore, Pakistan

2012

i

CERTIFICATE OF APPROVAL

This is to certify that research work described in this thesis, entitled “A STUDY OF

GENETIC ANALYSIS OF MULTI DRUG RESISTANT SALMONELLA TYPHI” is the

original work of Dr. Khalid Mahmood and has been carried out under my supervision. I

have personally gone through all the data/results/materials reported in the manuscript and

certify their correctness/authenticity. I further certify that the material included in this

thesis has not been used in part or full in a manuscript already submitted or in the process

of submission in partial/complete fulfilment of the award of any other degree from any

other institution. I also certify that the thesis has been prepared under my supervision

according to the prescribed format and I endorse its evaluation for the award of PhD

degree through the official procedures of the university.

Research Supervisor

(Prof. Dr. Mateen Izhar)

BSc (pb), MBBS (pb), MSc (London)

Ph.D (Cantab), FRCPath (UK)

Head Division of Pathology &

Department of Microbiology &Virology

Fedral Post Graduate Medical Institute Shaikh Zayed Hospital Lahore

ii

DEDICATION

I dedicate this PhD write up to the solders of Pak army who sacrificed their lives for the

honour of their mother land in Gayari sector at Siachen.

iii

ACKNOWLEDGEMENTS

Praise be to Almighty Allah whom are all attributers of knowledge and peace be

to the prophet Muhammad (PBUH) for His blessing on this mankind.

I am deeply indebted to my worthy supervisor Prof. Dr. Mateen Izhar for his

valuable advices, guidance, tolerance and constant encouragement at every stage of my

work enabling me to pursue my endeavors and broaden my horizon of knowledge. It was

a pleasure working with a scholar of his stature.

My sincere and heartfelt thanks to Prof. Dr Saleem Haider chairman, Agriculture

Research Institute University of the Punjab, Lahore. Prof. Dr. Javaid Iqbal Qazi. Head

Department of Microbiology, Prof. Dr. Naeem Rashid School of Biological Sciences and

Dr. Nakhshab Chaudhary (FPGMI) Lahore, for giving me encouragement to take the

first step in this project and then providing invaluable guidance in all respects.

I would like to extend my thanks and gratitude to Dr. Akbar Ali, Dr. Saadat Ali,

Dr. Muhammad Faisal Basher at School of Biological Sciences, Dr. M. Idrees Khan and

Mr. Muhammad Farooque Rasool (CEMB), University of the Punjab Lahore for their

contributions towards technical aspects of this research project.

I must also thank my children, Dr. Muhammad Ahmed, Dr Usman Ahmed and

Dr. Mariam Khalid who helped me with the photographic aspect of my research project.

I express my gratitude for their love, patience and understanding.

Special thanks are due, to Muhammad Tahir Malik, Bilal Tanveer, Irfan Rafique

Maqsood Arif, Irfan Fayyaz, Muhammad Adnan and Mr. Imran Ismail (CL&RC) who

helped me immensely and extended their support whenever I needed it.

I would like to record my cordial thanks to all my friends and colleagues for their

moral support and cooperation during my research work, also appreciate the laboratory

assistants and other staff members at Shaikh Zayed hospital Lahore.

(Dr. Khalid Mahmood)

iv

CONTENTS

Certificate of approval i

Dedication ii

Acknowledgements iii

Contents iv

List of Tables viii

List of Figures ix

Commonly used abbreviations xi

Summary xiii

INTRODUCTION 1

Antimicrobial Resistance 3

Chloramphenicol Resistance 3

Ampicillin and Trimethoprim/Sulfamethoxazole Resistance 3

Multi-drug resistant (MDR) S. typhi 4

Fluoroquinolone Resistance 4

Extended - Spectrum β - Lactamases (ESBLS) 5

Re-emergence of first line anti-typhoid drugs 5

OBJECTIVE OF THE STUDY 6

LITERATURE REVIEW 7

History of organism 8

Morphology and Cultural Characteristics 8

Classification 8

Identification 9

Antibiotic susceptibility testing 10

Virulence 10

Epidemiology of typhoid fever 11

Infective dose of Salmonella 13

Diseases caused by Salmonella 13

Gastroenteritis 14

Focal abscess 14

Typhoid fever 15

Carrier state 15

v

Sources of infection and Risk factors 16

Patient age group 16

Seasons 17

Mortality rate and Relapse 17

Complications 17

Diagnosis of typhoid fever 18

Treatment of typhoid fever 18

First line anti typhoid drugs 18

Chloramphenicol 18

Ampicillin and Trimethoprim/Sulfamethoxazole 19

Multi-drug resistant S. typhi 19

Fluoroquinolones resistance 20

Cephalosporin Resistance 21

Extended-Spectrum β-Lactamases (ESBLS) In S. typhi 21

Mechanisms of drug resistance in S. typhi 21

Genetics of chloramphenicol resistance in S. typhi 22

Types of plasmid involved in Resistance 23

The Prevalence of Inc H plasmid in the S. typhi 23

Conjugal transfer of inc. H plasmid 25

Molecular size and stability of Inc H plasmid 25

Characteristic encoded by Inc H. plasmid 26

R-factor epidemiology 28

R-factor transfer in vivo 28

R-factor transfer under environmental conditions 28

Environmental aspects of H plasmid transfer 29

PATIENTS, MATERIALS ANDMETHODS 30

Sample collection 31

Sample culture 31

Identification of isolates 31

Serological identification 31

Biochemical identification using AP1- 20E 32

Methodology of API -20E 32

Antimicrobial susceptibility testing 32

Methodology 32

vi

Antimicrobial agents tested 33

Extended spectrum βeta lactamase (ESBL) production 33

Double disc synergy test (DDST) 33

Storage of Bacterial Isolates 34

Revival of Salmonella typhi isolates 34

Molecular methods (DNA isolation of S. typhi) 34

Molecular Confirmation of S. typhi strains 34

PCR detection of fliC gene 35

Agarose gel electrophoresis 35

PCR Amplification of multidrug resistant genes in S. typhi: 35

PCR detection of catP gene 35

PCR Detection of tem (β-lactamase) gene 37

PCR detection of Sul-2 gene 37

PCR detection of gyrA gene 37

Confirmation by Sequence 37

RESULTS 39

Morphology and gram staining of isolates 40

Biochemical identification 42

Confirmation of isolates 44

Isolation of S. typhi 44

Isolation of multi-drug resistant S. typhi 47

First line anti typhoid drugs sensitivity 50

Fluoroquinolones sensitivity 51

Cephalosporin sensitivity 55

Extended spectrum βeta lactamase (ESBL) production 55

Carbapenem and others sensitivity 55

Detection and amplification of fliC gene 56

Detection of drug resistance genes in MDR S. typhi 56

Amplification of catP gene conferring chloramphenicol resistance 57

Amplification of tem gene conferring ampicillin resistance 58

Amplification of sul-2 gene conferring resistance to trimethoprim –

sulfamethoxazole 58

Amplification of gyrA gene conferring resistance to ciprofloxacin 59

Representative sequencing Chromatograph of fliC, catP, tem, sul 2

vii

and gyrA gene products 59

DISCUSSION 61

Prevalence of Salmonella typhi 62

Isolation rate of S. typhi 63

Isolation rate of multi-drug resistant S. typhi 63

Antimicrobial susceptibility 64

Extended spectrum β lactamase production 65

Drug resistance in S. typhi 66

RECOMMENDATIONS FOR PHYSICIAN 68

CONCLUSIONS 69

APPENDICES 70

Gram staining 71

API 20E 72

Salmonella serotyping scheme 75

Representative sequencing Chromatograph of

(fliC, catP, tem, sul 2 and gyrA gene products) 79

EFERENCES 83

viii

LIST OF TABLES

Table 1. Primers used for the confirmation of S. typhi 47

Table 2. Primers used for detection of drug resistance genes 49

Table 3. Distribution of the patients in different age groups 53

Table 4. Biochemical reactions of S. typhi studied by API-20E 56

Table 5. The isolation of S. typhi in different months from 2005-6 to 2009-10 59

Table 6. Isolation rate of MDR S. typhi 60

Table 7. Monthly isolation of MDR S. typhi from 2005-2010 61

Table 8. Resistance pattern of S. typhi isolates against different antimicrobials

during study period 62

Table 9. Observed resistance/susceptibility pattern of S. typhi against first line

anti-typhoid drugs 63

Table 10. Observed resistance/susceptibility pattern of S. typhi against

Fluoroquinolones 64

Table 11. Incidence of Nalidixic acid resistant S. typhi isolates. 65

ix

LIST OF FIGURES

Fig. 1. Gender distribution of patients 53

Fig. 2. Typical colonies of Salmonella typhi on Mac Conkey agar 54

Fig. 3. Microscopic appearance of the Gram negative rods 54

Fig. 4. Appearance of the bacterial growth in TSI 55

Fig. 5. Strip showing oxidase test results 55

Fig: 6, API 20-E test results 56

Fig. 7. API strip showing the summery of the results of the tests performed 57

Fig. 8.Slide picture of salmonella typhi confirmation by anti-sera 57

Fig. 9. Average prevalence of typhoid fever in each month 58

Fig. 10.Isolation rate of S. typhi from 2005 to 2010 58

Fig. 11. Average monthly isolation of MDR S. typhi from2005-2010 60

Fig. 12. Resistance/susceptibility pattern of S. typhi observed in 2005-6 63

Fig. 13.Resistance/susceptibility pattern of S. typhi observed in 2005-6 64

Fig. 14. Resistance/susceptibility pattern of S. typhi observed in 2005-6 65

Fig. 15. Resistance/susceptibility pattern of S. typhi observed in 2007-8 66

Fig. 16. Resistance/susceptibility pattern of S. typhi observed in 2008-9 66

Fig. 17. Resistance/susceptibility pattern of S. typhi observed in 2009-10 67

Fig. 18. Resistance/susceptibility pattern of S. typhi observed in 2009-10 67

Fig. 19. DDST showing increased ZOI with Augmentin 68

Fig. 20.A representative agarose gel electrophoresis picture showing PCR

bands of fliC, gyrA, sul2,temand catP 69

Fig. 21.A representative agarose gel electrophoresis picture showing PCR

bands of fliC gene 70

Fig. 22.A representative agarose gel electrophoresis picture showing PCR

bands of catP gene 70

Fig. 23.A representative agarose gel electrophoresis picture showing PCR

bands of tem gene 71

Fig. 24.A representative agarose gel electrophoresis picture showing

PCR bands of sul 2 gene 71

Fig. 25.A representative agarose gel electrophoresis picture showing PCR

bands of gyrA gene 72

Fig. 26. Sequencing chromatogram of gyrA PCR product showing mutation 72

x

Fig. 27.A representative agarose gel electrophoresis picture showing

multiplex PCR bands of sul 2, fliC and tem genes 73

xi

List of Abbreviations

A. baumanni Acinetobacter baumannii

API Analytical Profile Index

ATCC American Type Culture Collection

BHI Brain Heart Infusion

CI Confidence Interval

CLSI Clinical Laboratory Standards Institute

DNA Deoxyribonucleic acid

E. faecalis Enterococcus faecalis

E. coli Escherichia coli

Fig. Figure

GIT Gastrointestinal Tract

IBU Inhibine Antibacterial Unit (IBU)

MDR Multi Drug Resistance

MGO Methylglyoxal

MH agar Mueller Hinton Agar

MIC Minimum Inhibitory Concentration

NaCl Sodium Chloride

P. aeruginosa Pseudomonas aeruginosa

S. paratyphi A Salmonella paratyphi A

S. typhi Salmonella typhi

SLE Systemic Leupus Erythematosus

TSA Tryptic Soya Agar

Taq Thermus aquaticus

TSB Tryptic Soya Broth

WHO World Health Organization

xii

SUMMARY

Typhoid fever is an old disease transmitted by faecally contaminated food and water.

Typhoid carriers handling food also spread the disease. MDR S. typhi is a serious health

problem in developing countries. Majority of the global typhoid epidemics occur in

tropical, subtropical and Asian countries. Typhoid fever represents a common cause of

death in Pakistan. WHO report revealed 33 million new cases causing more than 200,000

deaths annually. In Asian countries mortality rate is between 12 to 32% which can be

reduced to 0.5% with proper treatment.

Chloramphenicol was considered gold standard drug for typhoid fever till

chloramphenicol resistant outbreak occurred in Mexico. Subsequently treatment scenario

changed from first line anti typhoid to fluoroquinolones or cephalosporin. Withdrawal of

first line anti-typhoid drugs caused loss of R- plasmid from S. typhi which resulted in re-

emerging sensitivity of these drugs. New emergence of extended spectrum beta lactamase

production in MDR S. typhi has not only restricted treatment options but also transpires the

need of genetic analysis of MDR S. typhi and reappraisal of antibiotics sensitivity.

Salmonella typhi isolates included in the study after confirmation by API testing and

serotyping. Antimicrobial susceptibility was determined by Kriby-Bauer disc diffusion

method. Three isolates of MDR Salmonella typhi were found ESBL producer on double

disc synergy test and molecular reconfirmation of the isolates by detection of fliC gene.

PCR amplification of (catP, tem (β-lactamase), sul-2 and gyrA) genes were carried out and

amplified products sequenced for the confirmation of right sequence of respective gene

products. Sequencing results showed that Ser 83 to Phe (TCC to TTC) mutation found in

all cases. The PCR results were in accordance with the multi-drug resistant pattern of S.

typhi as detected by disc diffusion method.

S. typhi equally infected both sexes and disease incidence was higher among children.

Maximum cases were reported during hot and humid weather and minimum during cold

season but typhoid fever remained endemic throughout the year. Significant decrease in

incidence of S. typhi and MDR S. typhi was observed from 2005 to 2010. Increased

susceptibility of the first- line anti typhoid drugs and decreased susceptibility of quinolones

was observed in this study. Significant resistance against ciprofloxacin suggests unreliable

xiii

efficacy of the drug which reflects the wide spread misuse of ciprofloxacin. Carbapenem

group showed maximum susceptibility and were the most potent antimicrobials available.

Treating physician should investigate the patient with pyrexia of unknown origin for

typhoid fever and treatment must be based on susceptibility report because MDR S. typhi is

frequently prevalent. Intensive infection control measures, rational antimicrobial use and

regular surveillance should be carried out to control the emergence of antimicrobial

resistance. In Pakistan best solution for the prevention of typhoid fever is provision of clean

drinking water and adequate sanitation alongwith educating people at large for personal

hygiene which can reduce the incidence of the disease significantly.

1

INTRODUCTION

2

Multi drug resistant Salmonella typhi (MDR S. typhi), the causative agent of

typhoid fever, continues to be a major public health problem in developing countries of

Asia, Africa and Latin America, affecting both local populations and travelers to the

endemic areas (Le et al., 2005; Hasan et al., 2008; Crump and Mintz et al., 2010; Essa et

al., 2012). Up to 78 % of the world population lives in developing countries and 93% of

global epidemics of typhoid fever occur in Asia (Murray and Lopez, 1997; Siddiqui et

al., 2006). Frequent out breaks have been reported from South Asian countries and the

disease is a serious potential threat to the developed nations (Uneke, 2008).

According to the World Health Organization (WHO) 27-33 million new cases of

typhoid fever are reported each year causing 216,000 deaths (Chrisopher et al., 2007).

Typhoid fever remains endemic throughout the year and represents the 4th most common

cause of death in Pakistan (Hanan1995; Tran et al., 2005; Arif et al., 2005). In Indian

subcontinent too, typhoid fever is endemic (El-Akkad1970; Farid et al., 1975; Asna et

al., 2003). Infection caused by MDR S. typhi results in higher rate of morbidity, mortality

and complications (Rowe and Threllfal, 1990; Ahasan et al., 1993; Pang et al., 1995;

Khan et al., 1996). Mortality rates ranging from 12 to 32% have been reported from

Pakistan, India, Bangladesh, Nepal and Indonesia. However, the incidence can be

reduced from 30 % to 0.5% with proper treatment (Parry et al., 2002; Cook and Wain,

2004; Lakshmi et al., 2006).

S. typhi exclusively a human pathogen is transmitted by faeco-oral route.

Incidence of typhoid fever has been significantly reduced in overcrowded urban areas of

the USA and Europe after provision of clean drinking water, better sanitary conditions

and hygiene (Bottieau et al., 2006). Sporadic cases of typhoid fever still occur in

developed countries because of foreign traveling and consumption of imported

contaminated food (Cooke et al., 2007). In England and Wales more than 70 % typhoid

fever patients represent immigrants returning from India and Pakistan (Crump et al.,

2004).

Disease burden is under - estimated due to limited availability of culture facilities

and poor disease reporting systems in developing countries including Pakistan (Siddiqui

et al., 2006; Steele and Weetch, 2007; Deroeck, 2007). Chloramphenicol was first

introduced by Wood ward for the treatment of S. typhi infection in 1948. It proved an

3

ideal drug, because application of chloramphenicol reduced duration of fever from weeks

to days and mortality to less than 1%. (Woodward et al., 1948; Colquhoun and Weetch,

1950; Gupta, 1994; Chande et al., 2002; Wain et al., 2003; Mateen A. et al., 2004;

Tsonyo et al., 2007). The drug yielded fairly uniform clinical response all over the world

(Woodward et al., 1948; Bottieau et al., 2006). It remained gold standard drug of choice

even having a risk of developing a-plastic anemia till the emergence of drug resistant

Salmonella serotypes (Snego and Bhutta, 1987; Islam et al., 1993).

Antimicrobial Resistance

Development of drug resistance in bacteria for frequently employed and/or low

dose administered antibiotics is a well-known phenomenon since more than 50 years.

The S. typhi has been documented for resistance against the forth mentioning drugs

(Levy, 2000).

Chloramphenicol Resistance

Chloramphenicol resistant strain of S. typhi was first reported in 1950 from

England (Colquhoun and Weetch, 1950), in 1959 from India (Murti et al., 1962;

Agrawal, 1962; Njoku, 1965), in 1965 from South Africa and in 1967 from Greece

(Konitomichalou, 1967; Agarwal et al., 1981; Mirza et al., 1996; Ackers et al., 2000).

From Pakistan first case of chloramphenicol resistant S. typhi was identified in 1987 and

then its incidence increased to peak level within few years (Mirza and Hart, 1993).

First outbreak of chloramphenicol resistant S. typhi occurred in 1972 reported

from Mexico (Paniker and Vimala, 1972; Butler et al., 1973). Outbreaks have also been

reported from India, Pakistan, Vietnam, Thailand, Korea and Peru (Sippel et al., 1981;

Hannan, 1991; Mushtaq, 2006). Wide spread plasmid mediated chloramphenicol

resistant strains pose a serious threat to treatment failure and urge to search for alternate

drugs (Paniker and Vimala, 1972; Wain et al.,2003; Cooke and Wain, 2004).

Ampicillin and Co-trimoxazole Resistance

Ampicillin proved to be an excellent antimicrobial for treatment of S. typhi since

1961-1967 (Brown and Acred, 1961; Rolinson and Stevens, 1961; Kaye et al., 1967).

Ampicillin became the drug of choice in cases of chloramphenicol resistant S. typhi

strains (Mills-Robertson et al., 2002; Wain et al., 2004; Kariuki et al., 2004). Ampicillin

4

sensitive but chloramphenicol resistant S. typhi isolates have been reported from India in

1972, Vietnam and other countries in1973 (Pillay et al., 1975; Scragg and Rubidge,

1975). Trimethoprim/sulfamethoxazole (SXT) combination was found to be as good as

ampicillin and thus used as drug of choice in cases of typhoid fever caused by ampicillin

resistant S. typhi strains (Butler et al., 1982).

Multi-drug resistant (MDR) S. typhi

S. typhi isolates simultaneously resistant to three or more different groups of

drugs are considered multi-drug resistant (MDR). First report of MDR S. typhi appeared

in 1972 from Mexico (Center for disease control (1976), from Nepal (Watson and

Pettibone, 1991) from Vietnam in1993 (Suganthi et al., 1993; Parry, 2002). From

Pakistan first MDR S. typhi was documented in 1987 (Hannan et al., 1988; Karamat et

al., 1996). MDR S. typhi incidence increased to over 80 % in India and Pakistan (Takkar

and Khurana, 1995; Karamat et al., 1996).

Incidence of 100% MDR S. typhi were reported from Calcutta and Karachi

during 2000 (Saha et al., 2001; Mubeena et al., 2006). Emergence of plasmid mediated

MDR S. typhi has increased the fatality rate in Pakistan, India, Sri Lanka and Bangladesh

(Tong et al., 2000; Ugwu et al., 2005; Siddiqui et al., 2006).

Fluoroquinolone Resistance

Ciprofloxacin has been successfully used against S. typhi, resistant to first line

anti typhoid drugs till 1990 (Gupta, 1994). Decreased susceptibility to ciprofloxacin was

reported in 1992 which spread globally. From Pakistan first case of reduced

susceptibility to ciprofloxacin was reported in 1993 (Hannan et al., 1993; Butt et al.,

2003; Threlfall et al., 2006). Higher level fluoroquinolone resistant S. typhi strains are a

major problem in tropical and South Asian countries (Renuka et al., 2005; Chu et al.,

2007). Nalidixic acid resistance and decreased susceptibility to ciprofloxacinis

considered due to single mutation in gyrA gene while higher fluoroquinolone resistance

is associated with double mutations. Its incidence has increased in subcontinent and

neighboring countries (Mushtaq, 2006).

5

Extended Spectrum β Lactamases (ESBLS)

Plasmid and chromosomal mediated resistance against first line anti typhoid and

fluoroquinolones has limited the treatment options to third generation cephalosporin

(Shanahan al., 1998). Among third generation cephalosporin, ceftriaxone is considered

the drug of choice for fluoroquinolone resistant or MDR S. typhi infections (Bottieau et

al., 2006; Al Naiemi et al., 2008). Extended spectrum β lactamase producing S. typhi

was also reported from Netherland (Al Naiemi et al., 2008). Nosocomial infection

caused by ESBL producing Salmonella has been reported from Latin America, France,

Senegal, Africa, Asia and Europe (Winokur et al., 2001; Gniadkowski, 2001; Weill,

2004; Su et al., 2005). Sporadic cases of third generation cephalosporin resistant S. typhi

were reported from Bangladesh, India and Pakistan (Saha et al., 1999; Madhulika et al.,

2004). Emergence of an ESBL in MDR S. typhi constitutes a new challenge and has

become a matter of serious concern, especially in the developing countries. Newly

emerged resistant trait has further restricted the treatment options.

Re-emergence of first line anti-typhoid drugs sensitivity

Ciprofloxacin and third generation cephalosporin have been used since last two

decades. Withdrawal of first line anti-typhoid drugs resulted in decreased incidence of

MDR S. typhi reported from Pakistan (Mahmood, 2000; Tariq, 2005), India (Chande et

al., 2002), Bangladesh (Rahman et al., 2003) and from Egypt (Momtaz et al., 2002).

Increased sensitivity of chloramphenicol was also reported from India (Chande et al.,

2002; Ananad, 2004), Egypt (Wasfy et al., 2002) and England (Cooke et al., 2007). Re-

emergence of sensitivity of ampicillin, trimethoprim/sulfamethoxazole and

chloramphenicol was reported from South East Asia and 100% sensitivity reported

fromIndia (Lathi, 2005). Excellent susceptibility of ampicillin, trimethoprim/

sulfamethoxazole and chloramphenicol against S. typhi has also been noted by other

workers (Mandal et al., 2004; Dhanashree, 2007; Gupta et al., 2009). Thus it can now be

hoped that chloramphenicol and ampicillin may once again be considered as effective

first line anti typhoid drugs.

Re-emerging sensitivity of 1st line anti typhoid on one hand, and new emergence

of ESBLS on the other hand transpired the need for genetic analysis of MDR S. typhi and

reappraisal of antibiotics sensitivity.

6

Aims and objectives

The present study aims at the following objectives.

1. To assess the prevalence of S. typhi and MDR S. typhi infections in our local set up.

2. To find out percentile sensitivity of different groups of antimicrobials.

3. To detect drug resistant genes by PCR.

4. To study emergence of ESBLS production.

5. To prepare the guideline for treating physicians.

7

LITERATURE REVIEW

8

History of typhoid fever

Typhoid fever was first described in 1643 by Wills. Bud (1856) reported that

enteric fever is infectious in nature and could be spread through patient or carrier’s

faeces and urine. Contaminated food, milk and water play important role in transmission

of typhoid fever. These observations were considered the milestones in developing

community hygiene (cited in Collier Encyclopedia 1989). The causative organism was

named after the pathologist’s name Daniel E. Salman who isolated the bacterium from

the intestine of pig and the strain was called Salmonella choleraseuis (Eberth, 1880;

Miller Pegues, 2000). Eberth (1880) first observed the typhoid bacilli in the mesenteric

lymph node and spleen in fatal cases of enteric fever and named it Salmonella typhosum.

Salmonella was cultured for the first time on artificial media by Salmon and Smith (cited

in Collier Encyclopedia 1989).

Morphology and Cultural Characteristics

S. typhi is gram negative bacilli, 2-4 µm long and 0.1-0.6 µm in width, non-

lactose fermenting and most species are motile. It can grow on blood agar and Mac.

conkey agar media. Colonies are usually gray with average diameter of 2 – 3 mm. They

may be circular and low convex with smooth surface. Several selective media have been

recommended for culturing this bacterium including salmonella shegella agar, Wilson

and Blain’s Bismuth sulphate medium and deoxycholate citrate medium (Parker, 1964).

Classification

S. typhi belongs to genus Salmonella, member of family enterobacteriaceae

(Rahn, 1937). Antigenic variations among strains of the genus Salmonella were noted

and serological classification was introduced by Schutze (1921) using specific anti- sera.

Kauffmann suggested simple diagnostic scheme using limited number of sera which

made the presumptive sero-typing of most Salmonellae possible (Kauffmann et al.,

1952).

Biochemical classification of S. typhi was reported by Shaw (1956). S. typhi

differs from most other Salmonellae species biochemically by being citrate negative and

not producing gas when it breaks down sugar. The name S. Kauffmanni was suggested.

The S. cholerasuis is biochemically atypical and does not ferment arabinose. The S.

Arizona often ferments lactose and is ONPG positive, liquefies gelatin slowly and

9

manifests usually malonate positive reaction (Ewing, 1963). The genus Salmonella has

been divided into various subgenera considered as species by Kauffman and White

(1966) such as S. Kauffmannii (subgenus I), S. salamae (subgenus II), S. arizona

(subgenus III) and S. houtenae (subgenus IV). S. pullorun and S. gallinarum are often

combined but the S. pullorun produces the gas while the S. gallinarum does not (Le

Minor et al., 1970). The genus was further split into groups A, B, C & D etc. Each group

shared a common somatic antigen. In case of more than one somatic antigens present on

one strain, they were considered as antigenic determinant. They were further sub divided

into sub groups e.g. Group “C” is divided into sub groups C-1 & C-2. The first was

characterized by the “O” antigen 6 & 7, while the second by “O” antigen 6 & 8. There

are 40 groups, the first 26 were designated by alphabets (ABCDEF), while the remaining

by number of their groups determining antigens etc. (Center for disease control 1976;

Chun et al., 1977; Clark et al., 1984). Serological classification has been simplified to

only 12 “O” sera 18 “H” sera and V1 sera can be used to classify the genus Salmonella

(Kauffman et al., 1952).

Bacterio-phage, a unique method of strain / group discrimination has been

established (Craigie and Yen, 1938). Six sub groups in genus Salmonella have been

reported. Sub group I includes obligate parasites and pathogens of human beings and

warm blooded domestic animals. Sub group II, III-a, III-b, IV and V are isolated from

environment and cold blooded animals. The II, III-a, and III-b can cause disease in

human beings. It is concluded that all these strains are related to S. enterica single

species (Edwards and Ewing, 1986).

Identification

Genus Salmonella was first identified by using biochemical tests (Abrams et al.,

1966). Carbohydrates are fermented with production of acid and gas. S. typhi produces

only acid. Glucose and mannitol are fermented, but lactose, sucrose, salicin or adonital

are not fermented. ONPG test is negative. Buissiere and Nardon (1968) described strip

based biochemical identification of Salmonella. Commercial form of this strip is called

analytical Profile Index (API) system. Martin et al. (1971) reported 88 % and Smith et

al. (1972) reported 96 % positive results of S. typhi by using API system. More than 50

characters could be determined by API method. Twenty tests of API strip are more than

sufficient for identification of salmonella (Bondi et al., 1947; Martin et al., 1971; Smith

10

et al., 1978). Another test method was developed which was improved for performing

biochemical identification using paper disks impregnated with substrate test reagents

(Snyder et al., 1951; Pickett et al., 1955).

Antibiotic susceptibility testing

Antimicrobial susceptibility is determined by zone of inhibition around the

antibiotic disc (Cooper, 1955). Rate of diffusion depends largely on molecular weight of

the antimicrobial agents (Garrod and Grady, 1971). Muller Hinton medium with4 mm

agar thickness is recommended for antibiotic susceptibility testing. Zone of inhibition

increases in size as the thickness of the agar is reduced and vice versa (Bauer et al.,

1964; Ericsson and Sherris, 1971; Davis and Stout, 1971; Barry and Fay, 1973).

Paper discs used for antimicrobials susceptibility were introduced by Vincent and

Morley (1944). This method is more commonly used as compared to cup or tablet

method (Morley, 1945; Lund and Funder, 1951; Bauer et al., 1964). Disc diffusion

susceptibility testing method was recommended by National Committee of antimicrobial

susceptibility testing and has been widely used in USA (Thornsberry, 1974).This method

was modified by Ericsson and Sherris (1971) then by Thorns berry (1974). The method

is commonly used in British laboratories (Stockes and worthy, 1972). Three control

strains, Staphylococcus aureus, E. coli and Pseudomonas aeruginosa must be tested

parallel to each test strain as recommended by Brown and Blowers (1978).

Virulence

Salmonella species are protected from phagocytosis due to its smooth cell wall

(Cunningham et al., 1975). Smooth surface of Salmonella prevents activation of

complement (Makela, et al., 1973; Liang-Takasaki et al., 1983). Flagella and

chemotactically directed motility are essential for adhesion to intestinal epithelial cells

and also contribute to the survival of salmonella in phagocytic cells (Savage, 1972;

Uhlman and Jones, 1982).

Salmonella entero-toxin is produced in low concentration and is related to its cell

wall (Houston, 1981). Koupal (1975) reported that Salmonella toxin is strongly

associated with lipopolysaccharide in the outer membrane of bacterial cell. Prostaglandin

and Salmonella entero-toxin activate adenylate-cyclase which acts synergistically to

11

produce diarrhea. Plasmids play a key role in virulence. Loss of plasmid leads to loss of

virulence (Jiwa, 1981; Baird et al., 1985; Helmuth et al., 1985; Nakamura et al., 1985).

Plasmid expressed a more virulent phenotype manifested by a more adhesive and

invasive organism in a HeLa cell system. Some strains of Salmonella can readily accept

and maintain plasmid which carries drug resistance or to an increase in transposon each

carrying a drug resistance gene as happens in E. Coli. Plasmid can confer properties

which contribute to the bacterial strain communicability and virulence in addition to the

properties of drug resistance, entero-toxigenicity, or surface antigen synthesis (Deboy et

al., 1980; Rowe et al., 1980; Robert et al., 1982).

Epidemiology of typhoid fever

According to the world health origination 33 million new cases and 216000

deaths occur each year globally due to the disease of typhoid fever (Crump et al., 2004;

Wellcome trust Sanger Institute, 2010). In Asia alone, 21 million new cases are reported

annually (Ivanoff, 1995; Bethell, et al., 1996; Aarestrup et al., 2003). Highest incidence

of 1000 cases / 100,000 people occurred in South Asia (Pang et al., 1995). Annual

incidence rate of 980 / 100,000 from India and 198 / 100,000from Southern Vietnam has

been reported (Parry, 2002). South East Asia has an incidence of 110 cases / 100,000

which is the third highest incidence rate for any region, Pakistan falls into this region

(Siddiqui et al., 2006).

Annual incidence reported from Papu, New Guinea and Indonesia is about

1200/100000 population. In South East Asia and South Central Asia highest epidemic

rates of greater than 100 / 100000 cases per year have been recorded. Rest of the Asia,

Africa, Latin America, the Caribbean and Oceania (except Australia and New Zealand)

has incidence rates of 10 - 100/100000 (McConkey, 2002). It has highest incidence rate

of 274 cases per 10000 people over five times higher than the second highest from Latin

America (Crumpet al., 2004).

12

Typhoid fever has significantly decreased in western countries and its incidence

has been brought to lowest level, especially in USA, England and Wales. In UK, there is

approximately one case per 100,000/ population per year (Crump et al., 2004). In the

developed countries most cases of enteric fever occur in immigrants and their incidence

is increasing (Bhutta et al., 1996; WHO 2006). Majority of patients have a history of

travel to endemic area. In England 150 - 300 cases of typhoid fever occur each year,

where maximum patients come from India and Pakistan (Cooke et al., 2007). Typhoid

fever caused by egg product was reported during the out breaks of salmonellosis in 1963.

Salmonella species have been isolated from faeces of birds and animals. S. typhi

epidemics caused by eggs, chicken, ducks, turkeys and poultry products account for

50%, beef and pork 13%, raw and powdered milk 4% of total incidence of epidemics.

Reservoir among domestic animals is a key factor in epidemiology (Bennett and Hook,

1959).

Since man is the only reservoir of S. typhi, contact with typhoid patients or

typhoid carrier is essential for spread of infection. Contaminated food by asymptomatic

typhoid carriers is another source of infection (Parker, 1964). Pancreatic extract, liver

13

extract, carmine dye, bile salt, pepsin, gelatin, vitamins, thyroid extract, adrenal cortical

extract and pituitary extract, diagnostic or pharmacological animal origin preparations

have been considered as source of infection and outbreaks (Baine et al., 1973). Marked

decline of infection in developed nations is merely due to improved sanitary measures

and proper chemotherapy (Edelman and Levine, 1986; Johanson and Aderele, 1981;

Edelman and Levine, 1986; Chatterjee et al., 2001).

Typhoid fever is still commonest febrile illness reported from major cities of

Pakistan including Rawalpindi, Islamabad, Lahore, Quetta, Karachi, Bahawalpur and

Dera Ghazi Khan. S. typhi is the main serotype responsible causing typhoid fever in

Indian subcontinent (Farooqui et al., 1990; Yousaf and Sadick, 1990; Sabherwal et al.,

1992).

Infective dose of Salmonella

Infective dose of S. typhi bacterium sufficient to cause disease depends upon the

targeted person and portal of entry. In human large number of organisms are required to

cause infection (Jacobsen, 1964). In case of aerosols small number of organisms required

to cause infection in animals and birds. In case of per-orally large number of organisms

are required to produce the disease (Crozier and Woodward, 1962).

It is noted that less than 50 ml liquid bolus can pass easily through stomach.

Organism along with such a small bolus will have minimum contact with the gastric

juice and directly enter into small intestine where small number of organisms multiply

and cause the disease (Silverio, 1964; Mossel and Oei, 1975). A positive co-relation

between the infective dose and development of disease was observed in a study

conducted on volunteers groups. When 109, 10

7, 10

5 and 10

3organisms per ml were given

orally to the volunteers they develop disease in descending order 100 %, 50 %, 25 % and

0% (Hornick, et al., 1970).

Diseases caused by Salmonella

Any serotypes of Salmonella (S. typhi, S. para typhi A, B, or C) can cause

gastroenteritis, focal abscess, enteric fever or asymptomatic carrier state. These clinical

conditions are not mutually exclusive. Infected patient may rarely exhibit all the four.

14

Gastroenteritis is the most common encountered clinical condition (Saphra and Winter,

1957).

Gastroenteritis

Major signs and symptoms are diarrhea, abdominal pain and vomiting, incubation

period of gastroenteritis lasts for 6 - 48 hours (Mandal and Mani, 1976; Appelbaum,

1976). In USA 20,000 cases of gastroenteritis were reported in 1975, the incidence of

disease increased with the passage of time and number of cases reached to 42,028 during

1986. The incidence of disease has been assumed 100 times more than reported officially

(Hargrett-Beem, et al., 1988). More than 24000 species causing gastroenteritis in human

have been identified. The most common encountered serotype was S. typhimurium.

Other common serotypes causing food poisoning were S. agona, S. enteriditis, S. hadar,

S. heidelberg, S. Indiana and S. Newport (Aserkoff and Bennett, 1969: Joseph and

Palmer, 1989).

Gastroenteritis caused by Salmonella species resolve without developing any

complication. Only fluids and electrolyte replacement is required. In gastroenteritis

patients, antibiotics always prolonged the excretion of Salmonella in stool. Treatment

with antibiotics like ampicillin has facilitated the establishment of gastro-intestinal

infection rather than to cure (Aserkoff and Bennett, 1969; Rose and Miller, 1969;

Hornick, et al., 1970; Washington, 1975; Water worth, 1978, and Istrup and Washington,

1983).

Focal abscess

Focal typhoid abscess caused by S. enteritidis was identified in 1982 while

typhoid abscess caused by Salmonella typhi reported secondary to typhoid fever (Robert,

et al., 1982; Rehman et al., 1991). Meningitis caused by Salmonella species including S.

enteridis, S. para typhi A and S. heidelberg in different age groups was reported (Qadri,

et al., 1976; Bhutta et al., 1991). Salmonella can cause osteomyelitis in a healthy person

or in patients suffering from sickle-cell hemoglobinopathies, systemic lupus

erythematosus (SLE), bone surgery, trauma and cirrhosis of liver (Saphra and Winter,

1957; Rowland1961; Ortiz-Neu et al., 1978; Rubin, 1982).

15

Pericarditis caused by Salmonellawas first reported in 1936, subsequently by S.

typhimurium in patients suffering from SLE in 1986 and by S. Hada in 1993 and

endocarditis caused by S. enteritidis in prosthetic heart valve patient (Cohen, et al., 1936;

Shanson et al., 1977; Dale, et al., 1986 and Aziz. et al.,1993). Splenic abscess causing S.

agona and S. chastr, hepatic abscess by Salmonella and respiratory tract infection was

caused by Salmonella species (Saphra and Winter, 1957; Lasch, 1966; Hornick, et al.,

1970; Sharr, 1972; Poon and Sanders, 1972; Mandel and Mani, 1976; Appelbaum, et al.,

1976; Scott, et al., 1977; Barney, et al., 1977).

Typhoid fever

Typhoid fever was previously confused with typhus fever, later on distinguished

from the typhus and globally coined as typhoid fever (Ochiai et al., 1959; Falcow, 1975;

Lacey, 1975). Typhoid fever caused by S. typhi is an acute systemic disease presented

with anorexia, nausea, lethargy, malaise, head ache and fever. Step ladder pattern fever is

the characteristic feature of typhoid fever found in majority of patients. Diarrhoea is

watery in nature and contains leucocytes. Duration of illness lasts for 4-5 weeks (Foster,

1983; Akthar, et al., 1987). During incubation period bacteria invade macrophages and

spread throughout the reticulo-endothelial system. Incubation period is prolonged in case

of contaminated water and shorter in case of contaminated food (Datta et al., 1979).

Symptomatic period usually represents in three phases. Progressive elevation of the

temperature followed by bacteremia is the characteristic features during first week of

illness. Rose spots, abdominal pain and splenomegaly are key signs in second week. The

third week is marked by intense intestinal inflammatory response which may results in

perforation and hemorrhage. During first week of the illness Salmonella can be isolated

from 80 % patient’s blood culture sample. Causative organism can also be isolated from

20-30 % patients even in third week if sample has been collected before starting

antimicrobial therapy (Stuart and Pullen, 1946).

Carrier state

Typhoid carrier is a patient who excretes S. typhi organisms in urine or faeces for

more than three months after treatment (WHO 2003). Infected individual can carry the

typhoid bacilli for days to years without showing any symptom of disease. Typhoid

bacilli multiply in the gall bladder and reach the intestine though bile duct. In adults,

carrier state of typhoid fever was reported from 15 – 45 years of age (Goodall and

16

Washbourn, 1996). Higher incidence of carrier state observed in women than men, ratio

is 3:1 (Senthilkumar and Prabakaran, 2005). Maximum incidence of carrier state (10%)

in age group from (20-59) years and minimum (0.3%) in less than 20 years of age was

observed (Ames and Robins, 1943). Carrier state can occur in 1.7 % typhoid fever

patients even after 60 weeks of active disease (Rubenstein, et al., 1944). Females

frequently become chronic carriers represent 65 to 70% of total carrier population. About

8.5 % female excrete Salmonella for more than three months and 4.2 % for more than

one year. Incidence is very low among the men and only 1.7 % excretes Salmonella for

three month and 0.8 % for more than year (Arbuzova, 1960; Musher and Rubenstein,

1973).

Sources of infection and risk factors

The most important primary source of infection is stool or urine of typhoid

patient or carrier (Ahmad et al., 1994; Mubeena et al., 2006). Secondary sources are

contaminated water, food, fingers, flies, and fomites (Topley and Wilson, 1990). S. typhi

rapidly grows in milk without changing its taste and appearance. S. typhi can survive in

water from 2 - 7 days, over a month in ice and ice cream, up to 70 days in soil irrigated

with sewage water during winter months / moist environment and from 30 to 35 days

during summer / dry season (WHO.1969). Risk factors contributing to typhoid fever

endemicity include limited availability of safe clean drinking water, poor sewage

disposal facilities and lack of disease awareness (Tehmina et al., 2001).

Patient age groups

Typhoid fever is more common in young children and infants but incidence is

under reported from Pakistan because of natural reluctance to draw 5 ml blood from

infants. Passive detection of S. typhi also contributes to under estimation of disease in

children and infants (Rathish, et al., 1995; Bhutta, 1996; Saqib and Ahmed, 2000; Lin et

al., 2000). Majority of typhoid patients (75 - 80 %) were reported from pediatric age

group (William and Mahle, 1993; Bhutta, 1996; Dutta and Kanwal, 1998; Usha Das and

Bhattacharya, 2006). In South Asia, incidence is 57 % in less than 5 years of age and 27

% in less than 2 years of age (Bhutta and Husein, 2006). Goodall and Washbourn, (1996)

on the other hand, noted that typhoid fever is more common in adult age from 21 -40

years.

17

Seasons

During hot and rainy season number of typhoid fever patients increase because

higher temperature (from 30 - 35 oC) with humidity favors growth of Salmonella typhi.

In Pakistan, maximum cases are reported during and after monsoon rains (Lin et al.,

2000). Flies increase to enormous number during summer and serve as vector in

transmission of typhoid infection (Gupta, 1994; Laurie et al., 1995; Wain et al., 1998).

More over heavy rainfall causes flooding and mixing of sewage water with drinking

water resulting in contamination hence increase in typhoid patients (Velema et al., 1997;

Siddiqui et al., 2006).

Mortality rate and Relapse

Typhoid fever causes higher rates of morbidity, mortality and complications

(Pang et al., 1995; Khan et al., 1996 and Rowe et al., 1997). In younger age group 1.6 %

mortality rate has been reported (Lakshmi et al., 2006; Doughari et al., 2007). Mortality

rate of 12- 32 % was reported from Indonesia, India and Nigeria (John et al., 2003) and

14 % - 34 % from Africa (Kouame et al., 2004; Ugwu et al., 2005; Aziz et al., 2005).

Mortality can be reduced with effective drugs in proper dose and duration of treatment

(Cook, 2004; Lakshmi et al., 2006).

WHO reported relapse rate 5 - 15 % in typhoid patients treated with

chloramphenicol and 4 - 8 % with ampicillin (WHO 2003). Typhoid patients treated with

ampicillin are frequently prone to relapse than patients treated with chloramphenicol

(Yew et al., 1991) and relapse rate (5-10%) can be prevented with 2-3 weeks

chloramphenicol treatment (Momtaz et al., 2002).

Complications

Most common complications of typhoid fever are gastrointestinal hemorrhage

and perforation. Complications may be observed in 10-15 % cases after two weeks of S.

typhi infection, out of which 5-30 % patients may die due to lack of adequate treatment.

Higher rate of complications and mortality encountered among children have been

reported (Sinha et al., 1999; Siddiqui et al., 2006).

Single perforation may occur in the terminal ileum in more than 70% patients.

Multiple perforations and encephalopathy may also occur in some patient (Agbakwuru,

18

2003). Hepatic or spleenic abscess, pancreatitis, encephalomyelitis, osteomyelitis and

glomerulonephritis may also be observed in few patients. Renal failure and myocarditis

can cause circularity collapse. Severe diarrhea, toxicity and disseminated intravascular

coagulation are more common in infants (Richens, 2004; Laloum et al., 2005).

Diagnosis of typhoid fever

Clinical diagnosis of typhoid fever is difficult in endemic areas because typhoid

presentation mimic a number of other febrile illnesses and isolation rate of S. typhi is

only 40 - 60 % mainly due to self-medication (Ochiai et al., 2005; Berkley et al., 2005).

Bone marrow culture is more sensitive but difficult to obtain, relatively invasive and of

little use in public health setting. Urine and stool culture are positive after first week of

illness with very low sensitivity in developing countries. Blood culture positive typhoid

incidence is about half of the actual figure of typhoid fever. Typhidot and tubex detect

1gM against a host specific S. typhi antigen. Blood leucocytes count is usually low

(20000 – 25000/mm3) with wide range in younger children. Thrombocytopenia is a

marker of illness and may accompany disseminated intravascular coagulation (Gilman et

al., 1975; Wain et al., 1998). .

Treatment of typhoid fever

For the treatment of typhoid fever, prevention of carrier state and complications,

selection of right drug, proper dose, and adequate duration is essential (Shirakawa et al.,

2006).

First line anti typhoid drugs

Chloramphenicol

S. typhi a lethal pathogen, was successfully treated with chloramphenicol for a

long time which reduced mortality to less than 1% and duration of fever from weeks to

days (Mateen A, 2004; Tsonyo, 2007). Chloramphenicol was gold standard drug till

emergence of drug resistant Salmonella serotypes (Snego and Bhutta, 1987; Islam,

1993).

First chloramphenicol resistant S. typhi case was identified just after two years of

its induction in medical therapy from England (Colquhoun and Weetch, 1950) and

19

subsequently from Africa, Greece and India (Agrawal, 1959; Murti, et al., 1962; Njoku-

Obi, 1965 and Kontomichalou, 1967). Outbreaks of chloramphenicol resistant S. typhi

were reported from India, Pakistan, Vietnam, Thailand, Korea and Peru (Sipple, et al.,

1981; Rowe et al., 1997 and Mirza et al., 2000). Monitoring of asymptomatic carriers

resulted in decreased frequency of chloramphenicol resistant S. typhi out breaks from

1.83 to 0.83 per year from (1960 – 1979) to (1980 - 1999) (P = 0.0001) reported from

USA (Parry, 2004).

Ampicillin and Trimethoprim / Sulfamethoxazole

Ampicillin and trimethoprim/sulfamethoxazole were considered suitable next

choice for chloramphenicol resistant S. typhi infection. Plasmid encoded resistance of S.

typhi to ampicillin was first observed in 1979 then trimethoprim / sulfamethoxazole was

introduced in 1980 and plasmid encoded trimethoprim / sulfamethoxazole resistant

developed shortly after wards (Rodrigues et al., 1998; Sanghavi et al., 1999 and Kariuki

et al., 2004). Ampicillin and trimethoprim/ sulfamethoxazolewere considered standard

antimicrobials till mid 1980’s for the treatment of enteric fever (Nair et al., 2004 and

Wain and Kidgell, 2004).

Multidrug resistant S. typhi

Wide spread use of chloramphenicol, ampicillin and trimethoprim/

sulfamethoxazole has resulted in multidrug resistance in Salmonellae. Strains

simultaneously resistant to three or more different groups of drugs are designated as

(MDR S. typhi) which is a real challenge in the developing countries (Holmberg et al.,

1984). From sub-continent prevalence of MDR S. typhi was reported in mid 80s (Rao et

al., 1993). MDR S. typhi incidence sharply increased from 60% to 90% from 1991 to

1993 (Rowe, et al., 1997; Rasaily et al., 1994 and Hazir et al., 2002). Over 86% MDR S.

typhi strains from Vietnam (Nguyen, 1993) and 93% from India (Bhat, 1998). MDR S.

typhi strain encompasses China, South East Asia and Indian sub-continent (Mirza, 1996;

Graham et al., 2002), also reported from Kuwait (Suganthi et al.,1993), Qatar (Uwydah

et al.,1991), Kenya 65% (Kariuki et al.,2004; Wain and Kidgell, 2004) and Egypt 60%

(Momtaz, et al., 2002).

20

Fluoroquinolones resistance

MDR S. typhi was treated effectively with ciprofloxacin, was a drug of choice in

Bangladesh and regional countries of South East Asia where disease is endemic. The

quinolones were found effective with100% cure rate (Wang et al., 1989; Anand et al.,

1990; Ahmed et al., 1992) and became the first line empirical drugs for MDR S. typhi

infection (Parry et al., 2002; Vollaard et al., 2005 and Okeke et al., 2005).

Nalidixic acid resistant strain with decreased susceptibility to ciprofloxacin was

first detected in 1991 resulting in treatment failure and spread globally. Incidence of

14% resistance was reported from United Kingdom in 2001 (Dunne et al., 2000; Graham

et al., 2000; Threlfall and Ward, 2001). Incidence of decreased susceptibility to

ciprofloxacin and nalidixic acid resistant S. typhi was reported from Europe and Japan

during 1999 – 201 (Threlfall et al., 1999; Hirose et al., 2001). Similar incidences were

reported from India, Vietnam, Tajikistan and United Kingdom (Karmaker, 1991;

Jesudason et al., 1996; Murdoch et al., 1998; 2002; Haque et al., 2003).

The strains with decreased susceptibility to ciprofloxacin were interpreted

ciprofloxacin susceptible according to disk testing criteria although associated with

treatment failures. Gradual increase in MICs of ciprofloxacin was noticed but still lower

than the breakpoint of resistance, therefore revision in break point for ciprofloxacin

sensitivity was suggested (Bottieau et al., 2006; Parry et al., 2007; Crump et al., 2008).

Finally ciprofloxacin sensitivity break point revised (CLSI 2010).

Nalidixic acid resistance and decreased susceptibility to ciprofloxacin is acquired

due to mutation (s) in gyrA gene characteristically occurring at position 83 of the DNA

gyrase enzyme (changing serine to phenylalanine/Tyrosine) and position 87 (changing

aspartate to tyrosine/glycine). Increased fluoroquinolone resistance is associated with

both the mutations in the gyrA gene; its incidence has increased frequently in Asian

countries (Hasan et al., 2005; Mushtaq, 2006; Chau et al., 2007).

From Pakistan, first fluoroquinolone resistant S. typhi was reported in 1993

(Hannan et al., 1993). S. typhi strains both ciprofloxacin resistant and ciprofloxacin

susceptible but resistant to Nalidixic acid are prevalent in the sub-continent and their

21

incidence has increased (Rowe et al., 1997). In Pakistan over 90% MDR S. typhi strains

and more than 82 % with decreased susceptibility to ciprofloxacin have complicated the

treatment (Haque and Rahman, 2003).

Cephalosporin Resistance

Plasmid mediated emergence of quinolone resistance left the treatment choices to

beta lactams and third generation cephalosporin. Cephalosporin cure rate of 82-97 %

against MDR S. typhi infection has been reported from India and Pakistan (Frenck, 2003;

Bhutta, 2006). In developing countries usefulness of third generation cephalosporin

including ceftriaxone, cefotaxime and ceftazidime is very limited due to cost effective

and parenteral route for administration. Ceftriaxone resistant sporadic cases of S. typhi

were reported from different parts of the world (Crump et al., 2008; Yoon et al., 2009

and Malini et al., 2009).

Extended-Spectrum β-Lactamases (ESBLS) in S. typhi

Ceftriaxone a third generation cephalosporin is considered the drug of choice for

fluoroquinolone resistant and MDR S. typhi infection (Parry, 2002; Malini et al., 2009).

Extended spectrum beta lactamase producing Salmonella causing nosocomial infection

has been reported from Latin America, Africa, Asia and Europe. Salmonella have been

found to express a wide variety of ESBL types including TEM, SHV, PER and CTXM

enzyme. Emerging extended spectrum beta lactamase producing S. typhi constituted a

new challenge for treating physicians in endemic countries (Tzouvelekis et al., 2003;

Batchelor et al., 2005; Paterson, 2006; Bottieau et al., 2006; Al Naiemiet al., 2008).

Mechanisms of drug resistance in S. typhi

Plasmid (R- factor) was first defined as autonomously replicating DNA in

enterobacteriaceae and the Plasmid DNA carries the genetic determinants for resistance

to one or more antibiotics. Plasmid conferring antimicrobial resistance should be called

as R-plasmid (Watanab, 1963). R-plasmid is of two types conjugative and non-

conjugative. Conjugative plasmids transfer their copies from one bacterium to another

through tube called sex pili. R-plasmid can be transferred from one bacterium to another.

When introduced in a new bacterial host they replicate independently and are inherited

by both daughter cells at cell division (Novick, 1969; Datta, 1975).

22

Plasmids (R-plasmids) transfer resistance from one bacterium to another and

colonization of patient with resistant strains. It is reported that environmental selection

by antibiotics in gastrointestinal tract has epidemiological significance. The incidence of

transfer of R-plasmids from natural isolates to suitable recipient bacteria is generally

very low. The R-plasmid can be transferred among enterobacteriaceae either by

conjugation or by transformation. Drug resistance hardly occurred in normal gut and the

transfer of drug resistance may be detected in special environment for example during

antibiotic therapy (Lacey, 1975; Akthar et al., 1987).

Genetics of chloramphenicol resistance in S. typhi

Chloramphenicol resistance is mediated by plasmid which belongs to

incompatibility group named Inc. H. group. H plasmids can be subdivided in to H1 and

H2. It is thermo sensitive and can be transferred into E. Coli K-12 in overnight

incubation at 30oC. Plasmid determinants comprising with chloramphenicol (C),

sulfonamide (Su), tetracycline (T) and streptomycin (St) (C, Su, T, St) were considered

to be the causal agents for individual typhoid epidemics occur in Thailand, South

Vietnam and India. Chloramphenicol resistance associated with inc. H plasmid has been

observed in different serotypes of Salmonellae including S. typhimurium. In an outbreak

of animals and humans infection occurred in Singapore and Malaysia, resistance to

ampicillin, tetracycline and kanamycin coded by H1 R-factor have been isolated from S.

typhimurium Phage type 193 (Anderson et al.,1975; Anderson, 1977; Anand, 1990).

A study conducted on calves infected by S. typhimurium explains that the specific

Salmonella strains carrying H – plasmids are distributed in clonal and epidemic fashion.

Numerous milk born outbreaks caused by sulfonamide and tetracycline resistant S.

typhimurium phage type 204 have been reported (Threlfall et al., 1982). In

Leicestershire epizootic infection of calves were reported caused by a strain of type 204.

Considerable clinical significance has been observed due to the wide spread

dissemination of multi resistant H. plasmid carrying S. typhimurium in bovine sources

apart from the economic implication to cattle industry. Threlfall conducted study in UK,

reported 289 strains with inc. H. containing S. typhimurium and 216 non-inc. H. strain

out of 505 human infections. Inc. H. group plasmid has medical and veterinary

significance but the plasmid transfer system and the other genomic determinants are

however, largely unknown. The origin of plasmid, temperature sensitivity for transfer,

23

prevalence in other gram negative bacteria and in animals or humans from different

regions of the world are also not known and transpires the need for considerable research

during the past more than a decade (Threlfall et al.,1980; Threlfall et al.,1982).

Types of plasmid involved in Resistance

Twenty six different incompatibility (inc.) groups among plasmid of enteric

bacteria have been reported. Inc. H. plasmids were reclassified in to two separate H.

incompatibility groups and designated as inc. H1 and inc. H11. The inc. H1 plasmid was

further sub divided into inc. H (11,12 and 13) and all the H1 were thermo-sensitive for

conjugal transfer and are large molecules with molecular weight of 100 M Daltons or

more (Grindely, et al.,1973; Taylor and Grant, 1977;Roussel and Chabbert, 1978;

Bradley et al.,1982).

Inc. H13 plasmids were referred to as inc. H3and these sub groups contained

MIP 233 on known plasmid which was incompatible with sub groups H11 and H12

plasmid. The pili specified by inc. H11 and H12 plasmid were serologically related to H.

pili and those specified by inc. H13 have been serologically different from all known

pilus types including H pili (Minor et al., 1976; Bradley et al., 1982).

The Prevalence of inc. H plasmid in the S. typhi

Global distribution of plasmid in S. typhi and S. typhimurium was known and

Group H12 plasmid frequently found in S. typhimurium isolates from human source from

Canada, mainly H12 plasmids were isolated from animal and human sources. Plasmid in

S. typhimurium from human source in Mexico was predominantly inc. 1i and inc. H.

plasmid could not identified in isolates from Australia and New Zealand (Anderson

(1977). Inc. H11 was the dominant plasmid type in isolates of human and animal origin

in Southeast Asia. Inc. H12 contributing 21 % of transferable plasmid in Africa. In

Middle East F1me plasmid was widely distributed in S. typhimurium clone causing

severe infections in pediatric units. Anderson concluded from observation that in a

particular region, ecological conditions had favored the emergence of particular strains of

S. typhimurium armed with particular plasmid and the strains had established themselves

(Anderson et al., 1973; Anderson, 1977).

24

Out breaks of human Salmonellosis caused by resistant strains of S. typhimurium

affected pediatric units, and in systemic invasion, 30% mortality rate has been observed

due to multi resistant nature of the dominant plasmid type extremely limited the therapy.

These findings were supported by Avril (1977) who studied 410 strains in France and

Belgium belongings to six serotypes of epidemic salmonella collected from France and

Belgium. Resistant pattern encoded by inc. H. was predominantly (C, St, SU, T)

chloramphenicol, streptomycin, sulfonamide and tetracycline (Avril et al., 1977).

European, Canadian and Japanese studies suggest that incidence of particular R-

factor type can change with time and environmental conditions of salmonella species in a

particular geographical region. Change in plasmid type distribution simply related with

change in antibiotic usage. In S. typhi, chloramphenicol resistance is associated with the

inc. H. plasmid which encodes many other antibiotic resistant determinants. H. plasmid

is not confined to any single phage type of S. typhi, indicated by the isolation of nine

distinct Vi phage types carrying H11 plasmid encoding (C, S, SU, T) resistance from

South Vietnam and Thailand during typhoid epidemics (Anderson et al., 1973; Anderson

et al., 1974; Bezanson et al., 1981).

S. typhimurium serovar was the most predominant among the multidrug resistant

salmonella. Presence of H. plasmid in wild as well as caged birds in the absence of any

known selective pressure was also reported in a study conducted in Japan (Niida et al.,

1983). Chloramphenicol resistant salmonella serotypes isolated from animal has been

reported at peak level in the past and associated with inc. H. plasmid encoding resistance

to other clinically important drugs. Inc. H. Salmonella serovar causing epidemics in

intensive livestock units are usually of a clonal nature may be distributed rapidly in

different regions due to animal transportation. Salmonella infection is most commonly

caused by poultry and Pork. Salmonella infection in human is largely associated with

pediatric units causing systemic invasions. Meningitis is the main complication observed

with 30 % mortality rate. Inc. H. plasmid encodes resistant determinants to five or more

clinically useful antibiotics. Numerous out breaks of inc. H. plasmid have seriously

compromised the antimicrobial therapy. Taylor reported that animals are the original

source for these inc. H. plasmid mediated Salmonella strains (Lintonet al., 1981;

Tayloret al., 1982; Niida et al., 1983).

25

Conjugal transfer of inc. H plasmid

The plasmids identified in typhoid bacteria have optimum conjugal transfer

efficiency at 37⁰C. If temperature is below 37⁰C, transfer efficiency will be markedly

decreased. Thermo-sensitivity is the main distinguishing feature of H1 group i.e.

conjugate most efficiently at temperature below 37⁰C. Environment also affects in which

conjugation take place and the transfer of plasmid. Thermo-sensitivity has been

described as ability of H. plasmid to transfer more efficiently at temperature between

22⁰C to 30⁰C than 37⁰C. Transferability of H1 plasmid from resistant (R +

enterobacteria) to E. Colik12, divide the plasmid into two groups. Both groups optimally

work at different temperatures for conjugation. Group I have optimal transferability at

22⁰C while group II plasmid at temperature 22⁰C-33⁰C transfer efficiently. H12

subgroup was found in both groups whereas H11 plasmid was found in group II. Poor

transmissibility at 37⁰C has been observed (Bradley et al., 1980; Taylor et al., 1982).

Molecular size and stability of inc. H plasmid

Inc. H. plasmids are maintained in E. Coli K12 at 37⁰C indicating replication of

plasmid is not thermo-sensitive and maintenance of H. plasmid is less efficient in

Salmonella. Maintenance of H1 plasmid in S. typhi in different environmental conditions

is as follow.

a. In the presence of bile salts, at pH values from 6.3-7.3

b. In anaerobic environment.

Plasmids H11 and H12 were lost from S. typhi at variable rates up to 20 % cases. It has

been observed that H+ Salmonella strains, if stored at room temperature, lost their

resistance phenotype within 2-3 months (Taylor et al., 1978; Rangnekar et al., 1982).

Plasmid H1 457 has been found very unstable disappeared completely from host

E. Coli K-12 and Klebsiella in nutrient broth at a rate of 0-75% per generation. It was

further reported that most of the original drug resistances were non-conjugative and

determined no pili. Plasmid also gave rise to variants which lacked 25 M Dalton DNA.

Bradley reported another H11 plasmid Ph H1 508 stably maintained in both hosts. Inc. S

(H-12) plasmid was stable in E.Coli-K12 during growth at 30⁰C and at 42⁰C and

originally detected in Serratiamarcescens. Stability of thermo sensitive plasmids isolated

from different enterobacterial species and transferred them to E. Coli K-12. Out of 73

plasmids 34 were stably maintained after three daily passages at 44⁰C in broth culture. It

26

was proved that plasmid loss was determined solely by the loss of drug resistance

determinants. The rate of loss varied from 1 to 100 % in remaining 39 plasmids. H11

plasmid appeared to be more stable than plasmid of the H12 sub group during growth at

44⁰C. An Inc. plasmid which was isolated from different hosts (E. Coli K-12, E. Coli and

S. typhimurium) has shown a marked level of instability (Smith et al., 1978; Taylor and

Levine, 1980; Bradley et al., 1982);

Characteristic encoded by Inc H. plasmid

Characteristics encoded by Inc. H. plasmid had been concerned with drug

resistance determinants because of clinical and veterinary significance. Number of

phenotype character may be encoded by H. plasmid DNA suggested by the large size of

Inc. H. plasmid. Plasmid encoded genes for individual sugar utilization from a range of

different incompatibility groups. Inc. H plasmids carrying the gene for lactose or sucrose

utilization have been isolated from a number of different Salmonella serovar. It has been

observed by Smith that thermo sensitive plasmid of H11 sub group can transfer citrate

phenotype from original Salmonella typhi host to E. Coli K12. H11 plasmid encoding the

citrate determinant was isolated from E. Coli of animal and bird origin. Hybridization

studies between the H11 plasmid and a cloned citrate determinant from an Inc. H.

plasmid indicated no DNA homology between the citrate genes carried by plasmid from

these two Inc. groups (Ishiguro et al., 1980; Shinagawa et al., 1982).

Resistance to As, Hg and Te had been associated with plasmid of inc. H. group. It

has been observed that metal resistance is a specific characteristic of H12 plasmid with

Te resistance. Single plasmid belong to sub group- H13 and the smaller number of

plasmid assigned to H11 group also encode tellurium resistance. It has been observed

from the studies that inc. H plasmid confers simultaneous resistance to number of drugs.

It is difficult to assess the relative incidence of different combinations of antimicrobials

resistance determinants within the H. Incompatibility group. Commonly

chloramphenicol, sulfonamide, streptomycin and tetracycline (C, Su, S, T) profile was

associated with H11 sub group in Salmonella. The (C, Su, S, T) resistance was also

mediated by other H. plasmid and by plasmid from other inc. group. Dominant resistance

profile of (C, S, K, T) chloramphenicol, streptomycin, kanamycin and tetracycline It is

also concluded that chloramphenicol resistance was derived from spontaneous mutation

of current pattern and Inc. H12 plasmid do not mediate chloramphenicol resistance. It is

27

concluded from studies conducted on S. typhiurium phenotype193 possess H11 plasmid

which mediate Ampicillin and kanamycin (A, K) or ampicillin, kanamycin and

trimethoprim (A, K, T) resistance. Although chloramphenicol resistance determinant is

one the most widely encountered resistance specified by plasmid of the H group. It is

generally considered that chloramphenicol resistance determinant is not an integral

coding region on inc. H. plasmid (Anderson, 1975; Taylor et. al., 1978).

Chloramphenicol acetyl-transferase (CAT) is an intracellular tetrameric enzyme

which acetylates and inactivates the antibiotics using acetyl-coA as acyl donor. High

level resistance is mediate to chloramphenicol. Naturally occurring 15 variants of (CAT)

have been known and could be differentiated from one another by molecular weight,

plasmid linkage, mode of synthesis, native electrophoretic mobility, their reagent

sensitivity and affinity to chromatography. R-plasmids determined three different CAT

enzymes which could be distinguished with the help of MIC values, Km values for

chloramphenicol, electrophoretic mobility and inhibition by DTNB reported by Foster.

Type I CAT was commonly encoded by fi plasmid from a variety of incompatibility

groups including the H12 sub group observed by (Gaffney et al.,1978) Large number of

transposons have been identified which carry the genes for resistance to one or more

antimicrobials. Transposons which transpose at high frequency are widely distributed

among plasmid of many groups and transposons which transpose at low frequency were

found in narrow range of plasmids (Gaffney et al., 1978; Foster, 1983; Smith and Burns,

1984).

Transposibility of resistance determinants for trimethoprim and streptomycin /

spectinomycin carried by H11 plasmid isolated from a Klabsella aerogenosa strain

obtained from a patient suffering from enteric fever. Digestion of the plasmid DNA with

Hind III followed by gel separation and screening for the characteristic internal

fragments of Tn7, indicated that the H11 plasmid carried a Tn7-like transposon which

determined a type 1 dihydrofolate reductase. Persistence of E. Coli strain carrying the

H12 plasmid, pJT4, in the calf intestine. Simultaneous experiments with plasmid

negative, isogenic strains clearly indicated that pJT4 carried genes enhanced the ability

of the host strain to maintain itself in the intestine. It is assumed that pJT4 may code for

changes in the outer membrane that lessen immunogenicity or that enhanced resistance

to gut immune mechanism (Richard and Datta, 1982; Timoney and Linton, 1982).

28

R-factor epidemiology

Higher incidence of antibiotic resistance has been found in meat animal. Jackson

proved that highly resistant E. Coli were found in pigs, poultry and calves and a few

numbers occurring in adult cattle and sheep. Linton stated that majority of E. Coli in pig,

poultry and calves were resistant to one or more of the therapeutically useful antibiotics

whether or not the animal is receiving these antibiotics. The sero-type distribution of E.

Coli in human and animal. Based on o-serotype alone it is impossible to distinguished

normal gut E. Coli of animals from those present in humans (Jackson, 1981; Linton et

al., 1981; Linton, 1982).

R-factor transfer in vivo

Resistant strain of E. Coli from animal origin if acquired by man or its

persistence for longer period in the gut of humans do not produced any detectable

pathological effects. Therefore the potential transfer of R factor from transient R+ animal

E. Coli or from more persistent animal serotype which temporarily colonized the gut, to

the endogenous E. Coli strains or to pathogenic species such as Salmonella or Shigella.

Colonization of intestine by a specific strain mainly depends upon the surface structure

of that particular strain (Cohen, 1973; Broda, 1979).

R-factor transfer occurred within the gut has a considerable controversy.

Enterobacteria accounted less than 1 % of the total flora in the gut and the conditions in

the normal gut are not conductive towards conjugation. Petrocheilou concluded that

transfer of R-factor commonly not occur in the gut and demonstrated transfer of plasmid

between E. Coli strains in the gut of a healthy volunteer in the absence of antibiotic

selection (Petrocheilou et al., 1976).

R-factor transfer under environmental conditions

Coliform with R factor in faecally contaminated water, sewage water, plants, and

sediments have presented insignificant difference of survival of R+ and R- bacteria.

Identical results have been also reported from a project (Fontain and Hoadley, 1976;

Bell, 1978).

R factor transfer can occur in dialysis bags immersed in a river and dam under

specific environmental conditions. And in a study on conventional sewage treatment

29

plants inactivation (quiescent) process such as sedimentation have been observed to

favor conjugation and transfer of resistance among enterobacterial strains of E. Coli,

Proteus mirabilis and S. enteridis could transfer their R-factors to E. Coli and Shigella

sonnei in membrane diffusion chamber which were placed in the primary and secondary

setting tanks of waste water treatment plant. R+ E. Coli strains randomly at temperature

ranging between 15⁰C - 35⁰C from river water, sea water and nutrient broth for

transferability of these isolates and observed transfer of R-factor in about 50 % of the

isolates under temperature, nutrient and environmental conditions (Grabow et al., 1975;

Grabow et al., 1976; Cook, 1980).

Environmental aspects of H plasmid transfer

Calves infected with a H12 plasmid harboring chloramphenicol resistant strains

of S. typhimurium in a calf unit, invariably harbored E. Coli resistant to the same range

of antibiotics. The excretion of resistant coliform pattern and the combination of R-

determinants carried by 89 % of the chloramphenicol resistant E. Coli, indicated that the

H12 plasmid had been transferred from Salmonella to indigenous E. Coli strain. H12

plasmid has been detected from six different serotype of E. Coli it means multiple

transfers had been occurred between Salmonella and E. Coli or between H+ E. Coli

trans-conjugants and other sensitive E. Coli strains. It is further reported that

colonization of the animal occurred by the faeco-oral route and transfer of H plasmid had

occurred outside the animal in the faecally contaminated environment. With respect to

the ecology of H. plasmid rapid dissemination of H. plasmid in Salmonella isolates has

been reported (Anderson, 1977; Linton et al., 1981).

30

PATIENTS, MATERIALS AND METHODS

31

In this study four thousands seven hundred and forty eight (n = 4748) S. typhi

isolates were collected from blood culture samples of patients who were admitted or

visited outpatient department of Sheikh Zayed Medical Complex Hospital, Lahore, with

the complaints of pyrexia of unknown origin or septicemia during five years from July

2005 to June 2010. One sample from each patient was included in the study.

Sample collection

From adult patients 5-10 ml and from children/infants 1-5 ml blood was collected

and inoculated to blood culture bottles containing 45 ml brain-heart infusion broth.

Bottles were labeled with patient name, age, sex, date and location and were incubated

aerobically at 37⁰C for one week.

Sample culture

Blood culture samples collected from patients were first sub cultured on

Mac.Conkey Salmonella and Shigella (SS) agar plates after 48 hours of incubation.

Inoculated plates were incubated aerobically at 37⁰C for 24 hours in inverted position. In

case of no growth observed after 24 hours the plates were re-incubated for another 24

hours. The growths sub cultures were repeated on 5th and 7th days of incubation.

Identification of isolates

Laboratory standard operating procedure for identification of the organism

included colonial morphology, gram staining, serological and biochemical tests

employing AP1 – 20E identification system of Biomeriux, inc. France (Cowan& steal,

1997; fine gold, 1999). For Gram staining, cells from a single isolated 2-4 mm flat non

lactose fermenting colony were smeared on glass slide and stained with gram stain and

examined.

Serological identification

Serological identification of S. typhi was performed by Salmonella O, H & V1

antigen (BD Difco, USA) according to the instructions of manufactures. Accordingly a

drop of distilled water was placed on a clean glass slide, and a single colony of the test

organism from Mac. Conkey agar plate was employed for making a homogenous

suspension by thorough mixing. This was followed by addition of one drop of

agglutination sera of S. typhi and the suspension was again mixed with a sterile stick.

32

The slide was rotated for 10-15 seconds and observed for agglutination with necked eye.

Positive and negative controls were used for comparison.

Biochemical identification using AP1- 20E

AP1 – 20E system was used for identification of organisms which provided an

easy and quick identification.

Methodology of API -20E

Twenty one test results in the API – 20E system were converted to seven digits

profile using octal coding system and identification was made though the analytical

profile index, following to the instructions of manufactures.

Antimicrobial susceptibility testing

The antimicrobial susceptibility pattern of S. typhi was determined by Kirby-Baur

disc diffusion method in accordance with the Clinical and Laboratory Standard Institute

(CLSI) guideline using commercially available antimicrobial discs (Oxoid, Basingstoke,

USA). E-Coli (ATCC – 25922) was used as control strain for all the antimicrobial

susceptibility tests.

Methodology

Antimicrobial susceptibility was performed on diagnostic sensitivity test (DST)

agar media with 4mm thickness. Bacterial test inocula were standardized to match with a

0.5 Mac Farland turbidity standard (1x108cfu/ml). Sterile swab was first immersed into a

given inoculum ampoule. The agar plate was inoculated by streaking evenly with the

swab. Before applying the antimicrobial discs, plates were held at room temperature for a

few minutes so that the surface moisture should be absorbed. Then the antimicrobial

discs were placed on the agar at appropriate distance from center to center. The discs

were tapped gently with the help of blunt end of a sterile metal probe to ensure complete

and uniform contact with the agar surface. Plates were then inverted and incubated

aerobically at 37⁰C for 24 hours.

33

Antimicrobial agents tested

In vitro susceptibility of antimicrobials was determined by using 5 mm

commercially available discs on Muller- Hinton agar following the modification of

Kirby-Bauer disc diffusion method according to CLSI recommendations. The

antimicrobial agents tested were ampicillin (10mg/l), chloramphenicol (30mg/l),

trimethoprim (1.25mg/l), sulfamethoxazole (25mg/l), ceftriaxone (30mg/l), cefotaxime

(30mg/l) ceftazidem (30mg/l), ciprofloxacin (5mg/l), nalidixic acid(5mg/l) and others as

mentioned in the Table 8, 9 and 10.

Zone edges examined with naked eye were considered point of complete

inhibition of growth. Zone of inhibition around each antibiotic disc was measured with

the help of vernier caliper. If the distance between radius of zone in controlled area and

the radius of zone in the testing area was equal to or less than 3 mm, the test organism

was considered sensitive while it was considered resistant if the zone radius measured

was equal or more than 3 mm. Production of extended spectrum beta lactamase (ESBL)

was evaluated using cephalosporin indicator discs in combination with co– amoxiclav.

Staphylococcus aureus (ATCC – 25923), Pseudomonas aeruginosa (ATCC – 27853), E.

coli (ATCC – 25922), Acinetobacter baumanni (ATCC – 29212) and Enterococcus

faccalis (ATCC – 29212) were used as reference strains and treated similarly for quality

control.

Extended spectrum βeta lactamase (ESBL) production

S. typhi µisolates were tested for extended spectrum beta lactamase (ESBL)

production using ceftazidime (CAZ), cefotaxime (CTX) or ceftriaxone (CRO) indicator

discs (oxide) following the CLSI criteria (12). The isolates that showed zones of

inhibition (ZOI) less than 22mm for CAZ and less than 27mm for CTX were also tested

by double disc synergy test in combination with the co-amoxiclav (amoxicillin +

clavulanic acid).

Double disc synergy test (DDST)

Muller-Hinton (MH) agar was inoculated with test isolate to give a semi

confluent growth using CAZ (30ug) and AMC (20ug). The discs were then placed

strategically 25-30 mm apart from center to center following overnight incubation at

34

37⁰C for 24 hours aerobically. The isolates showing an increase in ZOI equal or more

than 5mm were phenotypically confirmed as ESBL producer.

Storage of Bacterial Isolates

The isolates were preserved in 16% v/v glycerol in tryptic soya broth (Oxoid Ltd

UK) and then stored at – 70⁰C. The bacterial strains were sub cultured and retested for

characteristic features before use. Working cultures were maintained on tryptone soya

agar (TSA) slant at 2 – 8⁰C for up to two weeks.

Revival of S. typhi isolates

The isolates were revived in TSB by inoculation of 3ml medium with 50µl of

thawed stock culture followed by incubation at 370⁰C for 24 hours. The growth in TSB

was sub cultured on Mac. Conkey agar plates and incubated overnight to obtain pure

culture for further use.

DNA isolation of S. typhi

Single isolated colony of average size measuring 2 to 4 µm was picked up and

mixed in 30ul T.E in 0.2ml PCR tube with the help of 200ul tip. PCR tubes were then

placed in the thermo cycler, heated at 95⁰C for 5min, cooled down to room temperature

and centrifuged at 500g for 30 second. Supernatant was saved as a source of DNA for

further use in PCR.

Molecular Confirmation of S. typhi strains

Primers used for the confirmation of S. typhi (Accession number = AF 332601)

isolates are shown in Table 1.

Table: 1. Primers used for the confirmation of S. typhi.

Primer Oligonuleotide sequence(5-3) Target gene

Amplicon size b/p

Reference

STN (F) F-5’ act gctaaaacc act act 3’

fliC 363 Song et at

1993 STN (R) R-5’ tggagacttcggtcgcgtag 3’

35

PCR detection of fliC gene

Detection of fliC gene confirms the isolate as S. typhi reported by Song et al.

(1993) and Frankel (1994). For detection of fliC gene in the test isolate a PCR was done

using 1x PCR buffer (Famentas), 1.5mM MgCl2, 0.2mM dNTPs, 0.5mM primers (STN-

F and STN-R, accession number AF332601, Table 1) and 0.5U Taq polymerase and 2µl

of DNA. The total reaction volume was 20ul. Optimized conditions for amplification of

fliC gene were 30 cycles of 1 minute each at 94⁰C, 53⁰C and 72⁰C followed by final

extension at 72⁰C for 5 mints. All procedures including culture, DNA extraction and

PCR were carried out in specific separate cabin with designated set of pipettes and tips.

Reagents used in the PCR were divided in aliquots which were discarded after single use

to ensure further safety.

Agarose gel electrophoresis

PCR products were loaded on 1.5% agarose gel and electrophoresis was

performed in 1xTAE at 100 volts. Ten µl of each PCR product was mixed with 2µl DNA

loading dye and loaded on gel.

Agarose gel was prepared by dissolving 1.5% agarose in 1X TAE by boiling. It

was cooled down to approximately 60⁰C and ethidium bromide was added to a final

concentration of 0.5µg/ml. Then it was poured into the casting tray containing a sample

comb and allowed to solidify. After gel solidification the comb was removed and gel was

transferred in the electrophoresis chamber and the buffer was added till the gel just

dipped in the buffer. The PCR products mixed with 6x loading dye were loaded on gel.

A 100bp DNA ladder was used as molecular size maker (Fermentas). The bands in the

gel were observed and a photographed was taken using gel doc instrument.

PCR Amplification of genes in MDR S. typhi isolates

PCR detection of catP gene

PCR was done for the detection of chloramphenicol drug resistance gene (catP)

using 1X PCR buffer (Fermentas), 1.5mM MgCl2, 0.2mMdNTPs, 0.5mM both primers

(catP F& catP R, table 2), 0.5U Taq polymerase and 2µl of the template DNA. The total

reaction volume was 20µl. The cycling condition for PCR were initial denaturing at 95⁰C

for 2 minutes followed by 35 cycler of 95⁰C for 30sec, 50⁰C for 30sec and 72⁰C for

45seconds.

36

Table 2.Primers used for detection of drug resistance genes.

Primer Oligonucleotide sequence (‘5-‘3) Accession Number

Targeted gene

Drug Amplicon size (bp)

Reference

ASRC (F)

ASRC (R)

F 5’- cctgcc act cat cgcagt -3’

R 5’- ccaccgttgata tat eec -3’ U 46780 catP Chloramphenicol 623

Beatriz et al., 2001

A (F)

A (R)

F 5’- geacgagtgggttacatc ga-3’

R 5’- ggtcctccgatggttgtc ag-3’ Ay 436361-1 Tem Ampicillin 311

Carlson et al., 1999

SUL (F)

SUL(R)

F 5’- tcaacataacctcggacg gt-3’

R 5’- gat gaagtcaggtcc ace t -3’ x-57730 sul2

Trimethoprim/

sulfamethoxazole 707

Chu et al.,, 2001

CiP (F)

CiP (R)

F 5’- taccgt cat agt tat cca cga-3’

R 5’-gta ctttacgccatgaac gt-3’ Ay 302580 GyrA Ciprofloxacin 313

Molbak K et al., 1999

37

PCR detection of tem (β-lactamase) gene

Ampicillin drug resistant gene(tem) was detected by PCR using 1x PCR buffer

(Fermentas) , 2.0mM MgCl2, 0.2mM dNTPs, 0.5mM each of forward and reverse

primers (tem F& tem R, Table 2), 0.5U Taq polymerase and 2µl of the template DNA.

The total reaction volume was 20µl. The thermocycler conditions for PCR reaction were

initial denaturing at 95⁰C for 2 minutes followed by 35cycler of 95⁰C for 30sec, 50⁰C

for 30sec and 72⁰C for 45seconds.

PCR detection of sul-2 gene

For the detection sulfonamide resistant gene (sul-2), a PCR was done using 1x

PCR buffer (Fermentas), 1.5m MMgCl2, 0.2mMdNTPs, 0.5m Meach primer (sul-2,

Fand sul-2 R Table -2), 0.5U Taq polymerase and 2µl of the template DNA. The total

reaction volume was 20ul. Thermocycler conditions for PCR reactions were initial

denaturing at 95⁰C for 2 minutes followed by 35 cycles of 95⁰C for 30 seconds 50⁰C for

30 seconds and 72⁰C for 1 minute.

All the PCR amplification products were electrophoresed on 1.5% (w/v) agarose gel in

TAE at 100 volts as earlier in this section.

PCR detection of gyrA gene

For the detection of gyrA gene mutations responsible for fluoroquinolones

resistance, a PCR was done using 1x PCR buffer (Fermentas), 1.5mM MgCl2 0.2mM

dNTPs, 0.5mM of both primers (gyrA F & gyrA R, Table 2), 0.5U Taq polymerase and

2µl of the template DNA . The total reaction volume was 20µl. Thermocycler conditions

for PCR reaction were initial denaturing at 95 ⁰C for 2minutes followed by 35 cycles of

95⁰C for 30 seconds, 50⁰C for 30 seconds and 72⁰C for 1minute. PCR products were

observed by gel electrophoresis and a picture was taken.

Confirmation by Sequence

All the PCR products were sequenced for the confirmation of right sequence of

fliC, Sul-2, Tem, CatP and gyrA gene products. In case of gyrA gene, mutations were

also studied by sequencing. Before sequencing, PCR products were cleaned up using

Silica Bead DNA Gel Extraction Kit by Fermentas using following procedure.

38

The gel slice containing the DNA fragment was excised using a clean scalpel and

placed into a pre-weighed 1.5 ml tube and weighed again. The weight of the gel

slice was recorded.

Added a 3:1 volume of Binding Buffer (6M NaI) to the gel slice (volume:

weight) and incubated at 55°C for 5 min or until the gel slice was completely

dissolved. The tube was inverted every few minutes to facilitate the melting

process.

A 7μlSilica Powder Suspension was added to the DNA/Binding Buffer mixture

and incubated the mixture for 5 min at 55°C to allow for binding of the DNA to

the silica matrix. The tube was inverted every few minutes to keep the silica

powder in suspension.

The tube was centrifuged shortly to get the pellet of silica powder/DNA mixture.

The supernatant was removed carefully.

The pellet was washed with 500 μl of ice cold 75% ethanol, spun shortly and the

supernatant was discarded. The washing procedure was repeated. The silica pellet

was air dried for 15min.

The DNA was eluted in 30 μl low TE.

39

RESULTS

40

The present study was conducted on four thousands seven hundred and forty

eight S. typhi isolates collected from typhoid patients. Among all the patients, 2429

(52%) were males and 2250 (48%) were females. Male to female ratio of 1:1.02

appeared insignificant (Fig. 1).

Fig. 1.Gender distribution of patients

Patients were classified into three age groups, children (5-15 years), adults (16-60

years) and elders (61-85 years). Maximum number of patients was from children age

group followed by adult age group. The number of patient decreased to minimum in

elder age group. In all the age groups, the percentage of male patients was higher than

that of females (Table 3).

Table 3. Distribution of the patients in different age groups

Age group (years) Total (%) Male (%) Female (%)

Children (5-15) 2245 (47.3) 1253 (48) 992 (46)

Adult (16-60) 1666 (35) 870 (34) 796 (37)

Elder age (61-85) 837 (17.7) 470 (18) 367 (17)

Morphology and gram staining of the bacterial isolates

Colonies grown on Mac Conkey agar after 24 hours of incubation were colorless,

typically non lactose fermenting, translucent and circular having size from pin point to 2

mm in diameter. Microscopic examination of stained smear made from selected colonies

41

revealed gram negative rods of 3 to 5µm in length and 0.5 to 1.0 µm in width. Results

were reproducible (Fig. 2and 3).

Fig. 2. Typical colonies of Salmonella typhi on Mac Conkey agar

Fig. 3.Microscopic appearance of the Gram negative rods

42

Biochemical identification of the bacterial isolates

Test isolates inoculated on triple sugar iron (TSI) medium after 24 hours of

incubation showed typical S. typhi characteristics, including red slant and yellow butt.

Slight blackening in the medium indicated H2S production. Spreading growth along

inoculation showed motility of pathogens (Fig. 4). Oxidase test was negative (Fig. 5).

The results of API-20E strip (Bio-meraux, Hazelwood, Durhan NC, USA) are shown in

Table 4 and Fig. 6, 7. All the results were reproducible.

Fig. 4.Appearance of the bacterial growth in TSI, Reddish Slant indicated alkaline

reaction; Blackening showed H2S production and Yellow butt expressed Acidic reaction.

Fig. 5.Strip showing oxidase test results. Left side-Negative confirming Non-lactose

fermenting (S. typhi) and right side-Positive control pseudomonas aeruginosa (right)

43

Table 4. Biochemical reactions of S. typhi studied by API-20E

Test Active ingredient Reaction/Enzyme Results

% Negative Positive

ONPG 2-nitrophenyl-ßd-ala ß-galactosidase Colorless Yellow 100

ADH L-arginine Arginine Dihydrolase Yellow Red/orange 98

LDC L-Lysine Lysine Decarboxylase Yellow Red/orange 98

ODC L-ornithine Ornithine Decarboxylase Yellow Red/orange 100

CIT Trisodium citrate Citrate utilization Pale/green/yellow Blue-green/blue 100

H2S Sodium thiosulfate H2S production Colorless/greyish Black deposit 92

URE Urea Urease Yellow Red/orange 100

TDA L-tryptophane TryptophaneDeaminase Yellow Reddish brown 100

IND L-tryptophane Indole production Colorless/ Pale Pink 100

VP Sodium pyruvate Acetone production Colorless Pink/red 100

GEL Gelatin Gelatinase No diffusion black pigment 100

GLU D-glucose Fermentation/Oxidation Blue/blue-green Yellow/grayish 100

MAN D-mannitol Fermentation/Oxidation Blue/blue-green Yellow 99

INO Inositol Fermentation/Oxidation Blue/blue-green Yellow 100

SOR D-sorbitol Fermentation/Oxidation Blue/blue-green Yellow 100

RHA L-rhamnose Fermentation/Oxidation Blue/blue-green Yellow 100

SAC D-sucrose Fermentation/Oxidation Blue/blue-green Yellow 100

MEL D-melibiose Fermentation/Oxidation Blue/blue-green Yellow 95

AMY Amygdalin Blue/blue-green Blue/blue-green Yellow 100

ARA L-arabinose Fermentation/Oxidation Blue/blue-green Yellow 100

Fig: 6, API 20-E test results

44

Fig.7. API strip showing the summery of the results of the tests performed

Confirmation of the bacterial isolates by anti-sera

Isolates were confirmed using anti-sera (Bio-Rad Laboratories CA, USA). Strong

positive agglutination was observed within 30 seconds with anti-sera. Negative and

positive controls including E. Coli NCTC 10418 and S. typhi ATCC 6539 respectively

were used (Fig 8). Anti-sera results were reproducible.

Fig. 8. Slide picture of salmonella typhi confirmation by anti-sera showing negative (left)

and positive (right) agglutination results

Isolation of S. typhi

Isolation of S. typhi was noted in each month of the year, throughout the study

period from 2005 – 2010. A decreasing trend was seen in the overall isolation of S. typhi

from 2005-6 to 2009-10 (P< 0.001, Fig. 10). Maximum incidence (10.7% to 11.2 %)

occurred during hot and humid months of June, July and August. Incidence decreased to

minimal in winter season during November, December, January and February

45

accounting 6.6% to 7.3%. During rest of the months (March to May and in September

and October), the incidence remained between 7.6% and 7.7% throughout the study

period (Fig. 9,Table 5).

Fig. 9.Average prevalence of typhoid fever in each month observed from 2005 to 2010

Fig. 10.Isolation rate of S. typhi from 2005 to 2010

46

Table 5. Isolation of S. typhi in different months from 2005-6 to 2009-10

Year Total

cases Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec

2005-6 1372

124

(9%)

96

(6.9%)

118

(8.6%)

99

(7.2%)

120

(8.7%)

134

(9.7%)

138

(10.0%)

142

(10.3%)

93

(6.7%)

116

(8.4%)

102

(7.4%)

90

(6.5%)

2006-7 1050

72

(6.8%)

76

(7.2%)

81

(7.7%)

46

(4.3%)

98

(9.3%)

120

(11.4%)

125

(11.9%)

118

(11.2%)

96

(9.1%)

78

(7.4%)

72

(6.8%)

68

(6.4%)

2007-8 1018

68

(6.6%)

71

(6.9%)

79

(7.7%)

49

(4.8%)

92

(9.0%)

116

(11.3%)

118

(11.5%)

110

(10.8%)

84

(8.2%)

76

(7.4%)

82

(8.0%)

73

(7.1%)

2008-9 760

51

(6.7%)

49

(6.4%)

58

(7.6%)

62

(8.1%)

65

(8.5%)

85

(11.1%)

91

(11.9%)

86

(11.3%)

53

(6.9%)

49

(6.4%)

57

(7.5%)

54

(7.1%)

2009-10 548

43

(7.8%)

39

(7.1%)

41

(7.4%)

43

(7.8%)

48

(8.7%)

61

(11.1%)

59

(10.7%)

57

(10.4%)

46

(8.3%)

42

(7.6%)

35

(6.3%)

34

(6.2%)

47

Isolation of multi-drug resistant S. typhi

Out of 4748 S. typhi isolates, 431 were MDR S. typhi. Among these MDR S. typhi,

180 were collected during 2005. Isolation number decreased gradually to only 23 isolates in

2010, the decreasing trend was statistically significant (P < 0.001, Table 6). Maximum

average incidence was seen during the months of July and August (Table 7, Fig. 11).

Table 6.Isolation rate of MDR S. typhi

year No. of MDR isolates %age

2005-6 180 13.0%

2006-7 110 10.4%

2007-8 80 7.8%

2008-9 38 5.0%

2009-10 23 4.2%

Fig. 11. Average monthly isolation of MDR S. typhi from 2005-2010

48

Table 7. Monthly isolation of MDR S. typhi from 2005-2010

year Total cases

Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec

2005-6 180/1372

14/124

(11.2%)

12/96

(12.5%)

11/118

(9.3%)

7/99

(7.0%)

15/120

(12.5%)

21/134

(15.6%)

29/138

(21%)

33/142

(23.2%)

9/93

(9.6%)

12/116

(10.3%)

6/102

(5.8%)

11/90

(12.2%)

2006-7 110/1050

7/72

(9.7%)

7/76

(9.2%)

9/81

(11.1%)

5/46

(10.8%)

9/98

(9.1%)

13/120

(10.8%)

17/125

(13.6%)

14/118

(11.8%)

8/96

(8.3%)

7/78

(8.9%)

7/72

(9.7%)

7/68

(10.2%)

2007-8 80/1018

5/68

(7.3%)

6/71

(8.4%)

7/79

(8.8%)

4/49

(8.1%)

8/92

(8.6%)

10/116

(8.6%)

11/118

(9.3%)

8/110

(7.2%)

6/84

(7.1%)

4/76

(5.2%)

6/82

(7.3%)

5/73

(6.8%)

2008-9 38/760

2/51

(3.9%)

1/49

(2%)

2/58

(3.4%)

3/62

(4.8%)

3/65

(4.6%)

6/85

(7%)

6/91

(6.5%)

6/86

(6.9%)

3/53

(5.6%)

2/49

(4%)

2/57

(3.5%)

2/54

(3.7%)

2009-10 23/548

1/43

(2.3%)

1/39

(2.5%)

1/41

(2.4%)

2/43

(4.6%)

2/48

(4.1%)

3/61

(4.9%)

4/59

(6.7%)

3/57

(5.2%)

2/46

(4.7%)

2/42

(4.7%)

1/35

(2.8%)

1/34

(2.9%)

49

Table 8.Resistance pattern of S. typhi isolates against different antimicrobials during study period

2005-6 2006-7 2007-8 2008-9 2009-10

Drugs N=1372 %age N=1050 %age N=1018 %age N=760 %age N=548 %age

Ceftriaxone 196 14.2 160 15.2 162 15.9 118 13.5 23 4.2

Cefotaxime 248 18 171 16.2 132 12.9 108 14.2 26 4.7

Ceftazidime 226 16.4 158 15 145 14.2 90 11.8 28 5.1

Sparfloxacin 208 14.8 127 12 108 10.6 96 12.6 58 10.5

Gentacin 248 18 168 16 140 13.7 120 15.7 87 15.8

Imipenem 36 2.0 26 2.4 31 3.0 18 2.3 10 1.8

Meropenem 42 3.1 31 2.9 31 3.0 17 2.2 11 2.0

50

First line anti typhoid drugs sensitivity

Significantly increasing susceptibility of first- line anti typhoid drugs was

observed against the S. typhi isolates. Sensitivity of chloramphenicol, ampicillin and

trimethoprim / Sulfamethoxazole increased from 53.9 %, 29.9 % and 36.1 %, respectively

during 2005 to 87.3 %, 81.1 % and 78.2 % in 2010 against the S. typhi of this study

(Table 9, Fig. 12, 13).

Table 9.Observed resistance / susceptibility pattern of S. typhi against first line anti-

typhoid drugs

2005-6 2006-7 2007-8 2008-9 2009-10 P

Chloramphenicol Resistance 632 278 195 101 70

<0.001 Susceptibility 740 772 823 659 478

Ampicillin Resistance 962 685 236 161 104

<0.001 Susceptibility 410 365 782 599 444

Trimethoprim / Sulfamethoxazole

Resistance 878 602 248 183 120 <0.001

Susceptibility 494 448 770 577 428

Fig. 12. Resistance / susceptibility pattern of S. typhi observed in 2005-6. The organism

shows susceptibility to ciprofloxacin (in the center) and resistance to first line anti-typhoid

drugs along with tetracycline and erythrocin (peripheral rim).

51

Fig. 13. Resistance / susceptibility pattern of S. typhi observed in 2005-6. The organism

shows reduced susceptibility to ciprofloxacin (in the center) and resistance to first line anti-

typhoid drugs along with tetracycline and erythrocin (peripheral rim).

Fluoroquinolones sensitivity

Ciprofloxacin showed gradual reduction in sensitivity pattern from 2005 to 2010.

Susceptibility of ciprofloxacin was 83.9 % in 2005 which reduced to 45.1 % during the year

2010. Incidence of nalidixic acid resistant S. typhi decreased significantly from 2005-6 to

2006-7. The incidence significantly increased from 2006-7 to 2009-10 (Table 10, P<0.001).

Table 10.Observed resistance / susceptibility pattern of S. typhi against fluoroquinolones

2005-6 2006-7 2007-8 2008-9 2009-10 P

Ciprofloxacin Resistance 220 380 498 410 301

<0.001 Susceptibility 1152 670 520 350 247

Nalidixic Acid Resistance 1236 742 895 726 526

<0.001 Susceptibility 136 308 123 34 28

Isolation of S. typhi resistant to nalidixic acid showing reduced susceptibility to

ciprofloxacin increased gradually while that of resistant to nalidixic acid showing

susceptibility to ciprofloxacin decreased gradually during the study period (Table 11, Fig.

14, 15, 16, 17 and 18).

52

Table 11. Incidence of Nalidixic acid resistant S. typhi isolates

Year Ciprofloxacin Reduced

susceptibility S. typhi (%age)

Ciprofloxacin sensitive

S. typhi (%age)

2005-6 79/1372(5.7 %) 1293/1372(94.3%)

2006-7 109/1050(10.3%) 941/1050(89.7%)

2007-8 256/1018(25.1%) 762/1018(74.9%)

2008-9 228/760(30.0%) 532/760(70.0%)

2009-10 206/548(37.6%) 342/548(62.4%)

Fig. 14. Resistance / susceptibility pattern of S. typhi observed in 2005-6. The organism

shows susceptibility to fluoroquinolones and resistance to first line anti-typhoid drugs.

53

Fig. 15. Resistance / susceptibility pattern of S. typhi observed in 2007-8. The organism

shows susceptibility to ciprofloxacin while resistance to nalidixic acid and first line anti-

typhoid drugs.

Fig. 16. Resistance / susceptibility pattern of S. typhi observed in 2008-9. The organism

shows susceptibility to first line anti-typhoid drugs, reduced susceptibility to ciprofloxacin

while resistance to nalidixic acid.

54

Fig. 17. Resistance / susceptibility pattern of S. typhi observed in 2009-10. The organism

shows susceptibility to ciprofloxacin, nalidixic and first line anti-typhoid drugs.

Fig. 18. Resistance / susceptibility pattern of S. typhi observed in 2009-10. The organism

shows reduced susceptibility to ciprofloxacin and susceptibility to first line anti-typhoid

drugs while resistance to nalidixic acid.

55

Cephalosporin sensitivity

Susceptibility of cephalosporin (ceftriaxone, cefotaxime and ceftazidime) was found

95.7 %, 94.8 % and 94.6 % respectively throughout the study period on MH agar among

4748 S. typhi isolates (Table 8).

Extended spectrum βeta lactamase (ESBL) production

Out of 431- MDR S. typhi specimens, 238 isolates showed reduced susceptibility to

cephalosporin on Muller – Hinton agar using modified Kirby - Bauer disc diffusion method.

These isolates were further tested for ESBL production using double disc synergy test. Only

three isolates appeared ESBL producers (0.69 %) in present study (Fig. 19).

Fig. 19. DDST showing increased ZOI with Augmentin

Carbapenem and gentamycin sensitivity

S. typhi (n =4748) isolates were tested for susceptibility of carbapenem, and

gentamycin. Imipenem and meropenem were the most potent antimicrobials with 97.7% and

97.8% susceptibility. Second most effective drug against S. typhi and MDR S. typhi

respectively was gentamycin with 84.2 % effective against the isolates tested (Table 8).

56

PCR detection of resistance genes in MDR S. typhi

Detection of catP, tem, sul-2 and gyr A genes by PCR amplification methods were

done in all the 100 MDR S. typhi isolates (Fig. 20). The PCR products were sequenced for

the confirmation of results. The results were in accordance with the MDR pattern of S. typhi

detected by disc diffusion method.

Fig. 20.A representative agarose gel electrophoresis picture showing PCR bands of fliC

(363bp), gyrA (313bp), sul2 (707bp), tem (311bp) and catP (623bp) genes M is 50bp DNA

marker

PCR detection of fliC gene

The fliC gene is considered to be very specific for S. typhi. Amplification of a 363-

bp region of fliC gene using specific primers (Table 2) confirmed that all the test isolates

were S. typhi (Fig. 21).

57

Fig. 21.A representative agarose gel electrophoresis picture showing PCR bands of fliC gene

Lane 1 and 2 show negative and positive controls respectively Lanes 3-16 show PCR bands

from different test samples. M is 50bp DNA marker.

Amplification of catP gene

Chloramphenicol resistant susceptibility pattern of S. typhi isolates were determined

in all the selected samples by Kirby-Baur disc diffusion method. Chloramphenicol resistance

is conferred by an enzyme encoded by catP gene. The presence of catP gene in S. typhi was

confirmed by PCR amplification of 623- bp product using specific primers given in Table 2

(Fig. 22).

Fig. 22.A representative agarose gel electrophoresis picture showing PCR bands of catP

gene Lane 1 and 2 show negative and positive controls respectively. Lanes 3-16 show PCR

bands from different test samples. M is 100bp DNA marker

58

Amplification of tem gene conferring ampicillin resistance

Ampicillin resistance in S. typhi isolates is considered to be related to tem gene. In all

the S. typhi isolates, ampicillin resistance was also determined by Kirby-Baur disc diffusion

method. Amplification of 311- bp product using specific primers (Table 2) confirmed the

presence of tem gene in S. typhi isolates resistant to ampicillin (Fig. 23).

Fig. 23.A representative agarose gel electrophoresis picture showing PCR bands of tem gene

Lane 1 and 2 show negative and positive controls respectively Lanes 3-15 show PCR bands

from different test samples. M is 50bp DNA marker

Amplification of sul-2 gene

Sul-2 gene is associated with trimethoprim / sulfamethoxazole resistance. PCR

amplification of a 707 bp fragment of Sul-2 gene (Fig. 24) was carried out by using

previously reported primers (Table 2), which confirmed the presence of Sul-2 in isolates of

S. typhi. Trimethoprim / sulfamethoxazole resistance was also determined by Kirby-Baur

disc diffusion method in these isolates.

Fig. 24.A representative agarose gel electrophoresis picture showing PCR bands of sul 2

gene Lane 1 and 2 show negative and positive controls respectively. Lanes 3-15 show PCR

bands from different test samples. M is 100bp DNA marker

59

Amplification of gyrA gene

Mutations in gyrA gene (Ser 83 to Phe / Tyr and Asp 87 to Gly / Tyr) are related to

fluoroquinolones resistance. Presence of gyrA gene was confirmed by PCR amplification of

313 bp product (Fig. 25) using specific primers (Table 2) in selected samples of S. typhi. The

mutations were detected by sequencing. These isolates showed reduced susceptibility to

ciprofloxacin by Kirby-Baur disc diffusion method.

Fig. 25.A representative agarose gel electrophoresis picture showing PCR bands of gyr A

gene. Lane 1 and 2 show negative and positive controls respectively. Lanes 3-16 show PCR

bands from different test samples. M is 50bp DNA marker

Sequencing results showed that Ser 83 to Phe (TCC to TTC) mutation was found in

all the cases. No mutation at codon 87 was seen in any case. The results confirmed that the

resistance in the organism against fluoroquinolones was due to a mutation present at codon

83 (Fig. 26).

Fig. 26. A representative sequencing chromatogram of gyrA PCR product showing G to A

mutation (C to T in reverse sequence)

60

Sequence of the PCR

productCCGGGGCTTCTTTTTTCAAGATCGGCCTCAGTCCGTGGGCGATTTTCGCAGACGGATCTCCGTATAACGCATTGCCGCCGCGGAGTCGCCGTCATAGAACCGAAGTTACCCTGACCA

TCCACCAGCATGTAACGCAGCGAGAATGGCTGCGCCATACGAACGATGGTGTCATACACTG

CGAAATCGCCGTGGGGATGGCCTTACCGATT

Reverse Sequence of above AATCGGTAAGGCCATCCCCACGGCGATTTCGCAGTGTATGACACCATCGTTCGTATGGCGC

AGCCATTCTCGCTGCGTTACATGCTGGTGGATGGTCAGGGTAACTTCGGTTCTATGACGGC

GACTCCGCGGCGGCAATGCGTTATACGGAGATCCGTCTGCGAAAATCGCCCACGGACTGAG

GCCGATCTTGAAAAAAGAAGCCCCGG

Fig. 27. A representative agarose gel electrophoresis picture showing multiplex PCR bands

of sul2 (707 bp), fliC (363 bp) and tem (311 bp) genes Lane 1-5 show PCR bands from

different test samples. M is 50 bp DNA marker

61

DISCUSSION

62

In present study male typhoid patients were 52% of the total cohort which is in accordance

with the studies conducted by Bhatta et al. (2005). Likewise Mubeena et al. (2006)

conducted a survey in Karachi and reported that males were infected more than females.

Kustner, (1979) from South Africa mentioned that both sexes were almost equally infected,

although slight female dominance among hospital admitted patients has been reported too

(Watson,1954; Chalmers, 1971 and Gaffar, 1992). From these diverse studies it appears that

the incidence of typhoid fever has no gender influence.

Maximum pediatric patients (47%) were followed by adult (35%) and elder age

group (18%). These findings are comparable with the results reported from Karachi,

Pakistan (Bhutta1996). Dutta and Kanwal (1998) from Sri Lanka and Das Usha and

Bhattacharya, (2006) from India reported pediatric age group frequently infected by S. typhi.

Highest incidence in children below 5 years of age reported by various workers

(Sinha et al., 1999 and Siddiqui et al., 2006) is probably due to exposure of relatively large

infecting doses of organisms / body weight. Saha et al. (2001) from Bangladesh reported

57% patients of below 5 years of age. Bhatta et al. (2005) on the other hand reported adult

age group from 21 to 40 years was more prone to enteric fever. Such variable results reflect

hygienic stranded variations practiced for different age groups in different localities and in

parts also are indicative of a particular age group shown in the total population

Prevalence of Salmonella typhi

Typhoid cases identified in each month and incidence pattern showed maximum

cases during hot and humid weather and minimum during cold season. Impact of climate

has been described by many workers with the conclusion that hot rainy season and humid

environmental conditions enhance the prevalence of typhoid fever (Velema et al., 1997;

Luby et al., 1998; Lin et al., 2000).

These seasonal variations are due to less likely hood of the S. typhi rapid growth

rates and less consumption of water and other contaminated fluids in colder months. While

63

there is no evidence to suggest that the incidence of enteric fever has gone down because

factors responsible for endemicity of enteric fever in our country like overcrowding, lacks of

clean drinking water, inadequate sewage disposal system and poor hygienic conditions have

not changed.

Enteric fever is a serious public health problem in South East Asian countries

including Pakistan (Edelman and Levine, 1986). Bhutta (1991) and Sabherwal et al. (1992)

stated that municipal tap water is a possible vehicle for spreading the of S. typhi infection.

From the above studies it can be concluded that public health measures, general hygiene

practices, food preparation and improvement in water quality should be simultaneously

focused for prevention of typhoid fever.

Isolation of S. typhi

A significant decrease in isolation rate of S. typhi from 2005 to 2010 is indicative of

progress in the general public hygienic conditions as well as health education to some

extent. Finding of the present study are comparable with the observations of Saha et al. ,

(1999) and Sood et al., (1999) who also reported decreased isolation of S. typhi in their

studies. Tariq et al., (2005) from Rawalpindi, Pakistan also reported similar findings. The

decrease in the isolation rate of the organism in the lab does not necessarily reflect a

decrease in the prevalence of the disease in community. Antibiotics are easily available to

people in Pakistan without any prescription from a physician. A patient with any type of

fever may buy antibiotic from pharmacy for self-medication. In such cases, the incidence is

not reported. Treatment should be based on culture and sensitivity report, which is not being

practiced in Pakistan by majority of the physicians. In most of the cases, the patients are on

prior antibiotics before culture and sensitivity testing. In such cases also, the isolation rate

will be decreased.

Isolation rate of multi-drug resistant S. typhi

MDR S. typhi declined from 180 to 23 isolates from 2005 to 2010. These results are

in good agreement with the findings of Wafsy et al. (2002), Mills-Robertson et al. (2002)

who reported decreasing trend in isolation of MDR S. typhi. Takkar et al. (1995), Agarawal

64

et al. (1998), Rahman et al. (2002) and Lathi (2005) reported decreased isolation rate of

MDR S. typhi.

Decreased isolation of MDR S. typhi in our study might have occurred due to the

with-drawl of first line anti typhoid drugs as empirical therapy because of their

compromised response after the year 2000. Several studies have documented higher rates of

isolation of MDR S. typhi before the year 2000 (Rowe et al., 1990; Karamat et al.,

1991;Butta et al., 1991and Agarwal et al., 1992). Higher incidence in these studies is

attributable to widespread use of first line anti typhoid drugs as empirical therapy for the

enteric fever during 1990s. Results of the present study indicated gradual decrease in

incidence of disease caused by MDR S. typhi from 180 to 23 isolates from 2005 to 2010.

This might be a reflection of improvement in general health concern, personal and domestic

hygiene, relatively better sanitary condition, concern over quality of drinking water and food

etc. Metro, Makro, Hyper star, K&Ns and Zenith are providing hygienically approved

quality food and mineral water. Frequent use of third generation cephalosporin has also

contributed towards the decrease in isolations of MDR S. typhi.

Antimicrobial susceptibility

The susceptibility of first line anti-typhoid drugs increased while that of quinolone

group (ciprofloxacin) decreased for the S. typhi isolates in present study. Third generation

cephalosporin, carbapenem and gentamycin were found to be highly effective against S.

typhi infection. On the contrary, Doughari et al. (2007) reported increase in the resistance

against first line anti typhoid drugs from 2001 to 2003. Similar results have also been

reported by Bhat et al. (1998) and Mateen A et al. (2004). They also reported that only 2.5%

to 15% of the isolates did not respond to ciprofloxacin while 3% to7% of the isolates did not

respond to cephalosporin.

In the present study, fifty five percent MDR S. typhi isolates resistant to ciprofloxacin

during 2009-10 (Table 10) suggests that efficacy of the drug is unreliable. This reflects the

wide spread use or misuse of ciprofloxacin. Self-medication, low dose intake, shorter

duration of treatment and more frequently prescribed nature might have been contributing

for the present results.

65

Frequently prescribed drug is a well-known phenomenon contributing toward the

development of resistance. Due to poverty, many patients cannot consultant treating

physician. They start self-therapy after sharing disease problem with colleagues. Having a

little bit relief is sufficient in such instances for stopping medicine. Short duration therapy is

also practiced due to common belief prevalent in the society about harmful side effects of

the allopathic drugs.

Increased resistance against first line anti typhoid drugs and higher sensitivity of

quinolones has been reported extensively till 2002 (Sanghavi et al., 1999; Mahmood, 2000;

Hakanen et al., 2001; Parry et al., 2002; Tariq et al., 2003 and Tsonyo et al.,2007). Studies

conducted afterward contrarily reported increased sensitivity of first line anti typhoid drugs

and decreased susceptibility of quinolones. Dromgny et al. (2003) reported excellent

sensitivity of first line anti typhoid drugs with less than 1% resistance among 232 isolates of

S. typhi in Dakar, Sengial. Madhulika et al. (2004) from India also reported similar findings.

Third generation cephalosporin has been reported very effective against MDR S.

typhi without risk of relapse. Ceftriaxone was reported to be 100 % effective against MDR

S. typhi in many studies (Tehmina et al., 2001; Talti, 2003 and Mateen A et al., 2004).

Anand et al. (1990) from India reported 82-97% cure rate with third generation

cephalosporin. Saha et al. (1999) and Haque et al. (2003) detected resistance against third

generation cephalosporin in few strains of MDR S. typhi. Bhat et al. (1998) reported 3%

third generation cephalosporin resistance among MDR S. typhi isolates.

Extended spectrum β lactamase production

Only three isolates out of 431 MDR S. typhi were identified as ESBL producer using

double disc synergy test accounting (0.69 %) in the present study which is comparable to the

studies conducted in Canada, Poland, England, and France, where up to 3% ESBL

production has been reported in MDR S. typhi (weill et al., 2004; Batchelor et al., 2005:

Patterson et al., 2006;). Mohanty et al. (2006) reported 3-8% ESBL production in

Salmonella species in India. Dunne, (2000) from Latin America reported 2.8% ESBL

producing MDR S. typhi. Emergence of ESBL production in MDR S. typhi has constituted a

66

new challenge for physicians treating enteric fever, especially in developing countries where

typhoid is highly endemic.

Drug resistance in S. typhi

S. typhi acquire drug resistance most commonly through plasmid. Resistance to

chloramphenicol, ampicillin and trimethoprim / sulfamethoxazole and tetracycline is often

encoded by plasmids belonging to the incompatibility complex group Inc. H1 (Rowe et al.,

1990; Hampton et al., 1998). Results of antimicrobial susceptibility showed 431 MDR S.

typhi isolates resistant to chloramphenicol, ampicillin and trimethoprim / sulfamethoxazole.

Resistance to all the drugs is due to presence of a single plasmid, because no any other

plasmid could be isolated in S. typhi strains which were sensitive to chloramphenicol,

ampicillin and trimethoprim - sulfamethoxazole. Rowe et al. (1990) reported similar

observations from his study. Karmakar et al. (1991) reported that S. typhi isolate were found

to be resistant to chloramphenicol, ampicillin, tetracycline and streptomycin.

Clinical suspicion of typhoid fever can be confirmed by blood, urine and stool

culture of patient. Blood culture isolation is time consuming and bacterial isolation rate is

only 30 % due to prior medication by patients. This compelled for development of some

effective method which can diagnose enteric fever at an early stage, provide information for

focused therapy and must be cost effective. For diagnosis of S. typhi, fliC gene was

considered best (Song et al., 1993). We targeted catP gene using primers mentioned in the

section (Patients, Materials and Methods) which gave results that were in total agreement

with those obtained by disc diffusion method in all our isolates of the study. Ampicillin

resistance in Salmonella may be due to tem-beta-lactamase (Shanahan et al., 1988). We

detected tem gene in 100 MDR S. typhi isolates of study using primers described in the

section (Patients, Materials and Methods) which was exactly in accordance to the sensitivity

pattern determined by disc diffusion method in these isolates. Trimethoprim-

sulfamethoxazole resistance in gram-negative bacilli is usually due to acquisition of sul 1 or

sul 2 gene (Skold, 2000; Enne et al., 2001). Sul 2 gene was selected because it is universally

present in clinical isolates of S. typhi resistant to this drug (Aerstrup et al., 2003). The results

of sul2 gene amplification were in accordance with the finding of disc diffusion method in

67

all isolates of MDR S. typhi. Ciprofloxacin resistance is usually attributed to gyr A gene

mutations (Jones et al., 2000). Plasmid mediated qyr gene has been shown to be involved

with quinolone resistance in E. Coli as well (Wang et al., 2003). For the amplification of

gyr A gene we use primers described in the section (Patients, Materials and Methods). The

results were similar to the findings obtained by disc diffusion method. The sequencing

results confirmed that the resistance was due to a C to T mutation at codon 83 (TCC to

TTC). The other reported mutations were not seen in any resistant isolate.

PCR conditions were optimized for simultaneous amplification of specific S. typhi

fliC gene and relevant drug resistant genes. This multiplex PCR could differentiate between

different genes easily (Fig. 27). Multiplex PCR, in addition to its excellent sensitivity, can

provide results very quickly within 2 hours and enable the clinicians to have a rapid,

definitive diagnosis for the selection of a suitable therapy as compared to blood culture

sensitivity testing which needs at least 4-5 days. The early and focused therapy will ensure

early recovery of patient and also save financial resources that would have been spent on hit

and trial treatment. The rapid and successful elimination of typhoid bacilli will certainly

reduce the carrier rate which is the main source of spread of infection. The rapid diagnosis

and elimination of pathogen will help in controlling disease and will be a better check on

emergence of new drug resistance strains.

68

RECOMMENDATION FOR PHYSICIAN

1) Patient with pyrexia of unknown origin should be investigated for typhoid fever.

2) Drug therapy must be based on susceptibility report and physician should follow,

up to date guidelines.

3) If facilities exist molecular methods should be preferred.

4) Infection control measures and regular surveillance for antimicrobial resistance in

hospitals

5) Prescription from physician should mandatory and over the counter availability of

drugs must be restricted.

69

CONCLUSIONS

1. Typhoid fever can be prevented by provision of clean drinking water and adequate

sanitation.

2. Education of the peoples for personal hygiene, preventing contamination of food or

water and importance of hand washing before eating or food handling.

3. Self-medication and misuse of drugs has resulted in higher prevalence of MDR S.

typhi in our society.

4. S. typhi isolates should be continuously monitored for the presence of plasmid

carrying resistant markers against antimicrobials.

5. Avoid close contact with suspected patients during acute phase of disease.

70

APPENDICES

71

APPENDIX (A)

Gram Stain

Preparation of the Smear

A thin film of the material on a clean glass slide, using a sterile loop was made. The

slide was air dried and then heat fixed by passing it through a flame, making sure that it

should not become too hot to touch. To be visible on a slide, organisms that stain by the

Gram method must be present in concentrations of a minimum of 104 to 10

5 organisms / ml

of un-concentrated staining fluid. At lower concentrations, the Gram stain of a clinical

specimen seldom reveals organisms even if the culture is positive. Smears that are not

properly fixed tend to be washed away during staining and washing resulting in the absence

of stained bacteria.

Staining Procedure

1. The smear was covered with crystal violet stain for 60 seconds.

2. The crystal violet was poured off and washed thoroughly with iodine solution. The

slide was then covered with iodine solution and allowed to act for 30 seconds.

3. The iodine solution was poured off and then decolorized with acetone-ethanol until

the color ceased to come out of the smear (This took about 3-4 seconds).

4. The slide was thoroughly washed with water.

5. The slide was counterstained with diluted carbolfuchsin for 30 seconds. Washed with

water, blotted with absorbent paper and air dried.

Quality Control

Staphylococcus aureus (ATCC 25923)

Escherichia coli (ATCC 25922)

Results

Organisms that retained the violet-iodine complexes after washing in acetone-ethanol stain

purple and were termed as Gram-positive, those that lost this complex stain and became red

from the counter stain carbolfuchsin were termed Gram-negative.

72

APPENDIX (B)

API 20E

API 20E is a standardized identification system for Enterobacteriaceae and other

non-fastidious, Gram negative rods which uses 21 miniaturized biochemical tests and a

database.

Principle

The API 20E strip consists of 20 micro tubes containing dehydrated substrates.

These tests are inoculated with a bacterial suspension that reconstitutes the media. During

incubation, metabolism produces color changes that are either spontaneous or revealed by

the addition of reagents. The reactions are read according to the Reading Table and the

identification is obtained by referring to the Analytical Profile Index or using the

identification software.

Procedure

Oxidase Test

The oxidase test was performed according to the manufacturer's instructions for use.

The result of this test was recorded result sheet as it is an integral part of the final profile

(21st identification test).

Preparation of the Strip

1) Five ml of distilled water was distributed into the honeycombed well of the tray to

create a humid atmosphere.

2) On the elongated flap of the tray, the strain reference was recorded.

3) Strip was removed from its packaging and placed in the incubation box.

73

Preparation of the Inoculum

A single well isolated colony from overnight culture was picked up with inoculating

loop and emulsified into a tube containing 5 ml of sterile distilled water. This suspension

was used immediately after preparation.

Inoculation of the Strip

1) Both tube and cupule of the tests CIT , VP and GEL were filled with the bacterial

suspension.

2) Only the tube (and not the cupule) of the other tests were filled

3) The tests ADH, LDC,ODC, H2S and URE, mineral oil was overlaid to create ana-

erobiosis

4) Incubation box was closed with flap and incubated at 37°C for 18 hours.

Reading the Strip

1) Reading Table was consulted for reading the results of API strip after incubation.

2) All the positive were recorded on the result sheet and then reagents were added for

following tests:

3) TDA Test: 1 drop of TDA reagent was added. Appearance of reddish brown color

was considered a positive reaction and recorded on the result sheet.

4) IND Test: 1 drop of JAMES reagent was added and a pink color in the whole cupule

was taken as a positive reaction.

5) VP Test: 1 drop each of VP 1 and VP 2 reagents were added and result was recorded

after 10 minutes. A pink or red color indicated a positive reaction. Slightly pink color

after 10 minutes was not considered positive.

6) The indole production test was performed last since this reaction releases gaseous

products which interfere with the interpretation of other tests on the strip.

7) In case, the number of positive tests (including the GLU test) before adding the

reagents were less than 3:

8) Re-incubated the strip for a further 24 hours without adding any reagents.

74

9) Supplementary tests were performed in case the recorded results were not

conclusive.

Interpretation

Identification was obtained with the numerical profile.

Determination of the numerical profile

On the result sheet, the tests were separated into groups of 3 and a value 1, 2 or 4 is

indicated for each. By adding together the values corresponding to positive reactions within

each group, a 7-digit profile number was obtained for the 20 tests of the API 20 E strip. The

oxidase reaction constitutes the 21st test and has a value of 4 if it is positive.

Identification

This was performed using the database (V4.0) with the Analytical Profile Index by

looking up the numerical profile.

Quality Control

Escherichia coli ATCC 25922 was used for quality control

75

APPENDIX (C)

Salmonella Serotyping Scheme

1. Difco Salmonella O Anti-sera are used in slide agglutination tests for the

identification of Salmonella by somatic (O) antigens.

2. Difco Salmonella H Anti-sera are used in tube agglutination tests for the

identification of Salmonella by flagellar (H) antigens.

3. Difco Salmonella Vi Antiserum was used in slide agglutination tests for the

identification of Salmonella Vi.

Principles of the Procedure

1. Salmonella O antigens are somatic (O) heat-stable antigens and were identified first.

2. The Vi antigen is a heat-labile envelope antigen that may surround a cell wall and

mask somatic antigen activity.

3. Microorganisms having the Vi Antigen will not agglutinate in O anti-sera.

4. In order to determine the O antigen of these cultures, a suspension of the organism

was boiled to destroy the heat-labile envelope antigen and then tested with O anti-

sera.

5. The flagellar (H) antigens are heat labile and are usually associated with motility.

Slide Test Procedure

Salmonella O and Vi Anti-sera

1. 1 drop (35 µL) of each antiserum to be tested was dispensed on an agglutination

slide.

2. From an overnight solid agar medium, a loop-full of an isolated colony was

transferred to the reaction area above and mixed thoroughly.

76

3. Negative control: 1 drop of 0.85% sterile NaCl solution was transferred on an

agglutination slide and 1 drop of each Difco Salmonella O Antiserum was added to

be tested on an agglutination slide and mixed thoroughly.

4. Positive control: 1 drop of each Difco Salmonella O Antiserum was dispensed on an

agglutination slide.

5. The slides were rotated for 1 min and read for agglutination. Results were read

within 1 min.

Tube Test Preparation

1. 0.6% Formalized Saline was prepared by adding 6 ml formaldehyde per 1000 mL of

sterile 0.85% NaCl solution.

2. Test organism: The organism was grown in Motility GI Medium in order to increase

the motility of the organism. The tube was inoculated slightly below the surface of

the medium using the stab method and incubated at 35-37°C for 18-20 h.

3. Only those organisms were transferred that have successfully migrated to 50-60 mm

through the medium in 18-20 h.

4. Brain Heart Infusion Broth was used for cultivating motile Salmonella prior to

testing and incubated at 35°C for 4-6 h.

5. Test organism suspension was prepared by using equal volumes of broth culture and

0.6% formalized saline. The final density of this test suspension was adjusted that of

a McFarland Turbidity Standard No. 3.

6. Salmonella H Anti-sera: A 1:250 dilution was prepared by adding 0.1 ml

reconstituted antiserum to 25 mL of 0.85% NaCl solution. After mixing equal

amounts (0.5 ml) of diluted antiserum and test isolate, the final dilution was 1:1,000.

Tube Test Procedure

Salmonella H Anti-sera

1. A 12 x 75 mm culture tube was prepared for each organism to be tested.

2. Diluted antiserum: 0.5 ml of diluted antiserum was dispensed in each tube.

77

3. Test isolate: 0.5 ml of test isolate was added in appropriate tube.

4. Positive control: 0.5 ml of antigen positive control was added in a tube containing

0.5 mL of antiserum.

5. Negative control: 0.5 ml of 0.85% NaCl solution was added to a tube containing 0.5

mL of test isolate.

6. Incubated all tubes in a water bath at 50°C for 1 h.

7. Flocculation (agglutination) was observed.

8. Tube Test was repeated using a phase-reversed test organism.

Phase Reversal

1. Motility GI Medium phase reversal medium was prepared according to directions.

2. Antiserum was prepared opposite to the phase desired.

3. 1ml of a 1:10 dilution of antiserum was added to 25ml of sterile GI Motility Medium

and thoroughly mixed. Poured into a sterile Petri dish and allowed to solidify.

4. Inoculated by punching the edge of the solidified medium and incubated at 37°C for

24 h.

5. Growth was transferred from the spreading edge opposite the inoculation site to a

liquid medium for testing according to steps already mentioned.

Results

Slide Test

1. 4+100% agglutination, background is clear to slightly hazy. 1+ 25% agglutination,

background is cloudy.

2. 3+75% agglutination, background is slightly cloudy.

3. 2+ 50% agglutination, background is moderately cloudy.

4. The positive control should show 3+ or greater agglutination.

5. The negative control should show no agglutination.

6. For test isolates, a 3+ or greater agglutination is a positive result.

7. A partial (less than 3+) or delayed agglutination reaction was considered

negative.

78

Tube Test

1. 4+100% agglutination; background is clear to slightly hazy. 1+ 25% agglutination;

background is cloudy.

2. 3+75% agglutination; background is slightly cloudy.

3. 2+50% agglutination; background is moderately cloudy.

4. The positive control should show 3+ or greater agglutination at the routine test

dilution (RTD).

5. The negative control should show no agglutination.

79

Representative Sequencing Chromatograms

(fliC, CatP, tem, sul-2 and gyrA PCR products)

Fig. xxx. F1F Sequencing Chromatogram of fliC gene PCR product

Deduced sequence of fliC gene PCR product

TTCTTAATAAAAGTAAATGTTTCTTTTGTGACGTTGCTCAACTGGAGCTGTGATTTTGGTGGCGCAATGGTAAA

TCTGAAGTTGTTACTGCTACCGATGGTAAGACTTACTTAGCAAGCGACCTTGACAAACATAACTTCAGAACAGG

CGGTGAGCTTAAAGAGGTTAATACAGATAAGACTGAAAACCCACTGCAGAAAATTGATGCTGCCTTGGCACAGG

TTGATACACTTCGTTCTGACCTGGGTGCGGTTCAGAACCGTTTCAACTCCGCTATCACCAACCTGGGCAATACC

GTAAATAACCTGTCTTCTGCCCGTAGCCGTATCGAAGATTCCGACTACGCGACCCGAAGTCTCCAA

80

Fig.xxx Sequencing Chromatogram of catP gene PCR product

Sequence of catP gene PCR product

TGGGTTTGGTTCATTAAGCATTCTGCCGACATGGAGCCATCACAACGGCATGATGAACCTGAATCGCCACGCGG

CATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGG

CCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCT

TTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATC

GTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACAC

TATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGGAATTCCGGATAGCATTCATCATGGGGGGAGATG

TGGTAAAGGCCGGGGAAACTTTTGCTATTGTCTTTTTTTGGAAGGGAGAC

Figxxx Sequencing Chromatogram of tem gene PCR product

81

Sequence of tem gene PCR product

CGAAAGGTTCACAGCGGTAGATCCTTGAGAGTTTTCGCCCCGAGACGTTTTCCAATGATGAGCACTTTTAAGTT

CTGCTATGTGGTGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCA

GAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCA

GTGCTGCCATAACCATGAGTGATAACACTGCTGCCAACTTACTTCTGACAACGATCGGAGGACCA

Figxxx G1F Sequencing Chromatogram of gyr A gene PCR product

Sequence of gyr A gene PCR product

tgtctgtcattgttggccgttgtccgagatggcctgaagccggtacaccgtcgcgtactttacgcca

tgaacgtattgggcaatgactggaacaaagcctataaaaaatctgcccgtgtcgttggtgacgtaat

cggtaaataccatccccacggcgattccgcagtgtatgacaccatcgttcgtatggcgcagccattc

tcgctgcgttacatgctggtggatggtcagggtaacttcggttctattgacggcgactccgcggcgg

caatgcgttatacggagatccgtctggcgaaaatcgcccacggactgatggccgatctcgaaaaaga

gacggtggatttcgtggataactatgacggtacggaaaaaattccggacgtcatgccgaccaaaatt

ccgaatctgctggtgaacggttcttccggtatcgcagtaggtatggcgacgaatttcctcggcccac

aacggcaatatcccgccgcacaa

82

Fig xxx .Sequencing Chromatogram of sul 2 gene PCR product

Sequence of sul 2 gene PCR product

taggcatgatctaaccctcggtctctggcgtcgcgactgcgaaatttcgcgagggtttccg

agaaggtgattgcgcttcgcagatctccaggcgcgtgggtgcggacgtagtcagcgccatt

gccgatcgcgtgaagttccgccgcaaggctcgctggacccagatcctttacaggaaggcca

acggtggcgcccaagaaggatttccgcgacaccgagaccaatagcggaagccccaacgccg

acttcagcttttgaaggttcgacagcacgtgcagcgatgtttccggtgcggggctcaagaa

aaatcccatccccggatcgaggatgagccggtcggcagcgaccccgctccgtcgcaaggcg

gaaacccgcgcctcgaagaaccgcacaatctcgtcgagcgcgtcttcgggtcgaaggtgac

cggtgcgggtggcgatgccatcccgctgcgctgagtgcataaccaccagcctgcagtccgc

ctcagcaatatcgggatagagcgcagggtcaggaaatccttggatatcgttcaggtagccc

acgccgcgcttgagcgcatagcgctgggtttccggttggaagctgtcgattgaaacacggt

gcatctgatcggacagggcgtctaagagcggcgcaatacgtctgatctcatcggccggcga

tacaggcctcgcgtccggatggctggcggccggtccgacatccacgacgtctgatccgact

cgcagcatttcgatcgccgcggtgacagcgccggcggggtctagccgccggctctcatcga

agaaggagtcctcggtgagattcagaatgccgaacaccgtcaccat

83

REFERENCES

84

Aarestrup FM, Wiuff C, Molbak K, Threlfall EJ. Is it time to change fluoroquinolone

breakpoints for Salmonella spp. Antimicrob agents chemother 2003;47(2):827–9.

Abdul Mateen Khan Muhammad Noman Yousaf, Tariq Mehmood current trends in the

management of typhoid fever, Gomal Journal of medical Sciences July-Dec.,2004

Vol. 2.No.2; 59-61.

Abrams, I.F., Cochran, W.D., Holmes, L.B., Marsh, E.B. and Moore, J.A. A Salmonella

newport outbreak in a premature nursery with a one-year follow-up. Effect of

ampicillin following bacteriologic failure of response to kanamycin. Pediatrics1966; 37

: 616.

Ackers ML, Puhr ND, Tauxe RV, Mintz ED. Laboratory-based surveillance of

Salmonella serotype Typhi infections in the United States: antimicrobial

resistance on the rise. JAMA 2000; 283 : 2668-73

Agarwal KC. Panhotra BR, Arya VK, et al. Typhoid fever due to chloramphcnicol

resistance Salmonella typhi associated with R-plasmid. Indian .j Med Res.

1981;73:484-88.

Agbakwuru EA, Adesunkanmi AR, Fadiora SO, Olayinka OS, Aderonmu AO, Ogundoyin

OO et al. A review of typhoid perforation in a rural African hospital. West African

Journal of Medicine 2003; 22(1):22-25.

Agrawal, S. C.: Chloramphenicol resistance of Salmonella species in India, 1959-61. Bid.

R.H.O., 27: 331-335, 1962

Agarwal,V.,Brahmne,R.B.,Dhanvijay,A.G.,Jalgaonkar, 'P.D., Pathak, A.A. and Saoji,

A.M.Antibiogram, phage types and biotypes of Salmonella typhi isolated in Nagpur.

Indian J. Med. Res. 1992; 95[A] : 14.

Agarwal KS. Singh SK, Kumar n, Srivastav, R Rajkumar A.A study of Current trends in

enteric fever J Commun Dis 1998-17174.

Ahasan HN, Rafiqueuddin AKM, Chowdhury mAJ, Azhar MA, Ara M, Farazi MA.

Complications of enteric fever encountered in medical wards. J Dhaka Med Coll

1993; 2: 32-33

Ahmad ZU, Siddiqui AM and Hasan O. Emergence of drug resistant enteric fever in

Bangladesh Pak Armed Forces Med J 1994: 44(2):14-16.

85

Ahmed, Alam, M.N. Haq S.A. Majid M.N. Hasan Z Ahsan, S.A., Ahmed, N. and Rehman,

K.M. (1992) Multidrug resistant enteric fever in Bangladesh. Bangladesh J. Med, 3,

38-41

Akhtar, A.M., Malik, Z.A. and Hashmi, A. Treatment of typhoid fever with ofloxacin. Pak.

Air Force J. 1987; 40(i) : 6.

Al Naiemi N, Zwart B, Rijnsburger MC, Roosendaal R, Debets-Ossenkopp YJ, Mulder JA

et al.Extended-Spectrum-Beta-Lactamase Production in a Salmonella enterica

Serotype Typhi Strain from the Philippines. J Clin Microbiol2008; 46(8):2794–5.

Ames, W.R. and Robins, M. Age and Sex as factors in the development of the typhoid carrier

state, and a method for estimating carrier prevalence. Am. J. Public Health 1943; 33 :

221.

Anand AC, Kataria VK, Singh W, et al. An epidemic of multiresistant entenc fever in eastern

India. Lancet, 1990: 1. 352

Anand, A.C. The anatomy of an epidemic (the final report on an epidemic) of multidrug

resistant enteric fever in eastern India. Trop. Gastroenterol 1993; 14(1): 21.

Anderson ES and smith HP. Brit. Med. J 1972; 3:

Anderson ES, Joseph SW, Nasution Q. Febrile illness resulting in hospital admission, A

bacteriological & serological study in Jakarta Indonesia.Am.J.Trop.Med.Hyg. 1976;

25:116

Anderson, E.S, and Threlfall, E.J. The characterization of plasmid in the Enterobacteria. J.

Hyg. Camb. 1974; 7 2 : 471

Anderson, E.S. The problem and implications of chloramphenicol resistance in the typhoid

bacillus J. Hyg. Carob. 1975; 7 4 : 2 8 9

Anderson, E.S., Threlfall, E.J., Carr, J.M. and McConnell, M.M. Clonal distribution of

resistance plasmid-carrying Salmonella typhimurium, mainly in the Middle East.

J. Hyg. 1 9 7 7 ; 7 9 : 4 2 5 .

Appelbaum, P.C., Scragg, J. and Sehouland, M.M. Colonic involvement in Salmonellosis.

Lancet 1976; 2 . 102.

Arbuzova, V.A. Features of reservoirs of Salmonella among human Subjects. J. of Microbiol.

Epidemiol. and Immunology (USSR) 1960; 31 : 1353.

86

Arif Maqsood Ali, Ayaz Hussain Qureshi, Shahid Rafi, Sajjad Hussain Mirza.

Changing frequencies and current status of Multiple-Drug Resistant Typhoidal

Salmonellae in year 2001-2003 at Rawalpindi. Infect Dis J Jan ;14(1):3-6 2005.

Aserkoff, B. and Bennett, J.V. Effect of antibiotic therapy in acute Salmonellosis on the faecal

excretion of Salmonella. N. Engl. J. Med. 1969; 281 : 636.

Asna S.M.Z. and Haq, J.A. (2003): Decrease of antibiotic resistance in Salmonella typhi

isolated from patients attending hospitals of Dhaka City over a 3 year period. Int. J.

Antimicrob, Agents 16, 249-251.

Avril, J. L., Dabernat ,H.J., Gerbaud ,G.R., Horodniceanu, T., Lambert- Zechovsky, N.,

Leminor S., Mendez B. and Chabbert, Y.A.Groups d’ incomeptible des plasmiddes R

chez les Sauches de Salmonella epidemiques. Ann Microbial. (inst. Pasteur) 1977;128

(B) : 12

Aziz, A., Jaffri, W., Jawed, A.T., Shaikh.A., Farooqui. B., Ashfaq, M. K. and Hag, N.U.

Salmonella hadar pericarditis. Annals of Saudi Medicine 1993; 13(1) : 85.

Aziz M, Qadir A, Aziz M, Faizullah., Aziz M, Qadir A et al. Prognostic factors in typhoid

perforation. Jcpsp, Journal of the College of Physicians & Surgeons - Pakistan 2005;

15(11):704-707.

Baine, E.B., Gangarosa, E.J., Bennett, J.V. and Barker, W.H. Jr. Institutional Salmonellosis. J.

Infect. Dis. 1973; 128 : 357.

Baird, G.D., Manning, E.J. and Jones, P.W. Evidence for related virulence sequences in

plasmid of Salmonella dublin and Salmonella typhimurium. J. Gen. Microbiol. 1985;

131 : 1815.

Barney, D.P, Fisher, R. and Schaffner, W . S a l m o n e l l a empyema: A review. South

Med. J. 1977; 70 : 375.

Barry, A.L. and Fay, G.D. The amount of agar in antimicrobial disk susceptibility test plates.

Am. J. of Pathology 1973; 59 : 196.

Bauer, A.W., Kirby, W.M.M., Sherris, J.C. and Turck, M. Antibiotic susceptibility testing by a

standardized single disk method. Am. J. Clin. Pathol. 1964; 45 : 493.

Bell, R.B. Antibiotic resistance patterns of faecal coliform isolated from domestic

sewage beforeand after treatment in an aerobic lagoon Can. J. Microbiol. 1978;

24 : 886

87

Bennett, 1.L. and Hook, E.W: Infections diseases (Some aspects of Salmonellosis). Annu. Rev.

Med. 1959; 10 : 1.

Berkley JA, Lowe BS, Mwangi I, Williams T, Bauni E, Mwarumba S, et al. Bacteremia

among children admitted to a rural hospital in Kenya. N Engl J Med 2005;352: 39-

47.

Bethell. D.B., N.p.J Day M.D nguyen, C.memullin, T.L. Ha. T.h.T Dong, T.N.m.Le, T.M.L

nguyen, Q.D nguyen, V.Ha A.P MacGowan L.O white and N.J White. 1996

pharmacokinetics of oral and intravenous ofloxcin in children with multidrug-

resistant typhoid fever. Antimicrob. Agents Chemother. 40:2167-2172.

Bezanson, G.S., Pauze, M. and Lior, H. Antibiotic resistance and R-plasmid in food-chain

Salmonella: evidence of plasmid relatedness. Appl. Environ. Microbiol. 1981; 41 :

585.

Bhatta CP Bhuyan KCa and Maharjan Antibiotic Sensitivity Pattern of Salmonella

Species Isolated from Blood Culture. Journal of Nepal Health research Council Vol.3

No.2 October 2005.

Bhat KG, Andrade AT, Karadesai SG, Hemashettar BM, Patil CS. Antimicrobial

susceptibility of Salmonella typhi to quinolones & cephalosporins. Indian J Med Res.

1998 Jun;107:247-51.Department of Microbiology, J.N. Medical College, Belgaum.

Bhattacharya SK (2006). The malaria and typhoidfever burden in the slums of Kolkata,

India: data from a prospective community-based study. Trans. R. Soc. Trop. Med.

Hyg., 100: 725-733

Bhutta ZA, Naqvi SH, Razzaq RA, et al. Multidrug-resistant typhoid in children:

presentation and clinical features, RIl)., 1991,13: 832-3

Bhutta ZA. Impact of age and drug resistance on mortality in typhoid fever. Arch Dis Child

1996;75: 21.

Bhutta ZA, Ochiai RL, Wang X, von Seidlein L, Yang J, Bhattacharya SK, et al.

Salmonella paratyphi A rates, Asia. Emerg Infect Dis 2005;11: 1764-6.

Bhutta Zulfiqar A , Husein Lalji Dewraj Current concepts in the diagnosis and treatment

of typhoid fever BMJ. 2006 July 8; 333 (7558):78–82.

Bondi, A., Sapulding, E.H., Smith, D.E. and Dietz. A routine method for the rapid

determination of susceptibility to penicillin and other antibiotics. American J. of

Med. Sci . 1947;213

88

Bottieau E, Clerinx J, Schrooten W, Enden EV, Wouters R, Esbroeck MV et al. Etiology

and Outcome of Fever after a Stay in the Tropics. Arch Intern Med 2006; 166:1642-8

Bradley, D.E., Hughes, V.M., Richards, H. and Datta, N.R-plasmid of a new incompatibility

group determine constitutive production of H pili. Plasmid 1982; 7230.

Bradley, D.E., Taylor, D.E. and Cohen, D.R. Specification of surface mating systems among

conjugative drug resistance plasmid in Escherichia coli K12. J. Bacteriol. 1980; 143 :

1466..

Broda, ?. Conjugation in bacteria, In: Plasmids of Medical, Environmental and Commercial

importance ED Timmis K.N. and Puhler A. (Ed) 1979; Elsevier North-Holland New

York; PP 47..

Brown, D.M. and Acred, P."Penbritin"- new broad-spectrum antibiotic; preliminary

pharmacology and chemotherapy. B.M.J. 1961; 2 : 197

Brown, D.M. and Blowers, R. Disc methods of sensitivity testing and other semi quantitative

methods In: Laboratory Methods in Antimicrobial Chemotherapy. Published for

British Society for Antimicrobial Chemotherapy by Churchill Livingstone Edinburgh

London, 1978; PP 8.

Buissiere, J. and Nardon , P. Micro method ed' identification des bacteries I. Interet de la

quantification descaracteresbiochimiques.Annuls.Inst.Pasteur.Paris.1968; 115 :

218.

Butler, T., Linh, N N., Arnold, K. and Pollack, M. Chloramphenicol-resistant typhoid fever

in Vietnam associated with R factor. Lancet 1973; i i : 983

Butler, T., Rumans, L. and Arnold, K. Response of typhoid fever caused by

chloramphenicol susceptible and chloramphenicol resistant strains of Salmonella

typhi to treatment with trimethoprim-Sulfamethoxazole. Rev. Infect. Dis. 1982; 4 :

551

Butler, T., W. R Bell, J. Levin, N. N. Linh, and K. Arnold. 1978. Typhoid fever; studies of

blood coagulation, bacteremia, and endotoxemia. Arch. Intern. Med. 138:407-410

Butt T, Ahmad RN, Mahmood A, Zaidi S. Ciprofloxacin treatment failure in typhoid

fever case, Pakistan. Emerg Infect Dis 2003; 9 : 1621-2.

Center for Disease Control. Salmonella Surveillance Annual Summary 1975, Atlanta

Georgia. USA. September 1976

Chande C, Shrikhande S, Kapale S, Agrawal S, Fule RP. Change in antimicrobial resistance

89

pattern of Salmonella Typhi in central India. Indian J Med Res. 2002 Jun;115:248-

50. Department of Microbiology, Government Medical College, Nagpur, India.

Chatterjee H, Jagdish S, Pai D, Satish N, Jayadev D, Reddy PS et al. Changing trends in

outcome of typhoid ileal perforations over three decades in Pondicherry. Tropical

Gastroenterology 2001; 22(3):155-158.

Chalmer IM. Typhoid fever in an endemic area: a great” imitator” S Afr Med J 1971;45:

470-472

Chau TT, Campbell JI, Galindo CM, Van Minh Hoang N, Diep TS, Nga TTet al.

Antimicrobial drug resistance of Salmonella enterica serovar typhi in Asia and

molecular mechanism of reduced susceptibility to the fluoroquinolones. Antimicrob

Agents Chemother 2007;51(12):4315-23.

Christopher M. Parry, Vo Anh HO Le ,Thi Phuong Phan Van Be Bay Mai Ngoc Lanh Le

Thanh Tung , Nguyen Thi Hong Tham, joh wain ,Randomized controlled

comparison of Oflooxacin, Azithromycin and Ofloxacin-Azthromycin combination

for the treatment of MDR and Nalidixic acid resistant typhoid fever Antimicrobial

agents and chemotherapy March 2007,P 819-825.

Chun D. Scol SY, Cho DT et al, Drug resislance and R-plasmids in salmonella typhi isolated

in Korea. Antimicrobe Agents, Chemother, 1977.11:209-13.

Clark, W.A., Hollis, D.G. and Weaver, R.E., Identification of unusual pathogenic Gram

negative aerobic and facultatively anaerobic bacteria. Atlanta; Centers for Disease

Control, 1984.

Clinical and Laboratory Standards Institute. 2010. Performance standards for antimicrobial

susceptibility testing: Twentieth Informational Supplement January 2010 Vol 30.

Number 1 M100-S20 ISBN 1-56238-716-2, ISSN 0273-3899 (Replaced M100-S19

Vol 29 No3.

Clinical and Laboratory Standards Institute. 2005. Performance standards for antimicrobial

disk susceptibility tests, approved standard, 8th ed. (M2–A8). Clinical and

Laboratory Standards Institute, Wayne, Pa.

Cohen, L., Fink, H. and Gray,I. Salmonella su-pestifer bacteraemia with pericarditis,

pneumonia and pleural effusion. J.A.M.A. 1936; 107 : 331.

Cohen, S.N. Chloramphenicol-ampicillin resistant Salmonella typhi in California. Morbidity

and Mortality Weekly Report 1973; 22 : 183.

90

Collier's Encyclopedia Vol: 22 Macmillian Educational Company. Collier. Inc London

Colquhoun, J. and Weetch, R. S.: Resistance to chloramphenicol developing during

treatment of typhoid fever. Lancet ii, 621-623, 1950.

Complement activation by polysaccharide of lipopolysaccharide: an important virulence

determinant of Salmonella. Infect. Immune. 1983; 41 : 563..

Cooke FJ, Day M, Wain J, Ward LR, Threfall EJ. Cases of typhoid fever imported into

England, Scotland and Wales (2000-2003). Trans R Soc Trop Med Hyg.

2007;101:398-404.

Cooke FJ, Wain J. The Emergence of AntibioticResistance in Typhoid Fever. Travel Med

Infect Dis.2004;2:67-74

Cooke, M.D. R-factor transfer under environmental conditions; in proc. 4th Int. Symposium

on Antibiotic Resistance: Transposition and Other Mechanisms. Mitsuhashi S. Rosival

L and Kremery V. Eds;springer-Verlag 1980 : 20

Cooper, K.E. Theory of antibiotic inhibition zones in agaz media. Nature 1955; 176 : 510.

Craigie, J. and Yen, C.H. Vi-phage typing method of Salmonella typhi. CTanad. Publ. Hlth.

1938; 29 . 448.

Crozier, D. and Woodward, T.E. Armed Forces Epidemiological Board: Activities of the

commission on Epidemiological Survey 1961. Milit. Med. 1962; 127 : 701

Crump J., Luby, S. Mintz, E 2004. The global burden of typhoid fever. Bull World Health

Organ 82, 346-353

Crump JA, Kretsinger K, Gay K, Hoekstra RM, Vugia DJ et al. Clinical response and

outcome of infection with Salmonella Typhi with decreased susceptibility to

fluoroquinolones: a United States Food Net multi-center retrospective cohort study.

Antimicrob Agents Chemother 2008;52:1278-84

Crump JA, Lubsy SP, Mintz ED. The global burden of enteric fever. Bull World Health

Organ. 2004; 82:346-53.

Crump JA, Mintz ED. Global trends in typhoid and paratyphoid fever. Clin Inf Dis 2010;

50:241 -6

Cunningham, R.K., Soderstrom, T.O. and Gillman, C.F. Phagocytosis as a surface

phenomenon V. Contact angles and phagocytosis of rough and smooth strains of

Salmonella typhimurium and the influence of specific- antiserum. Immunol. Commun.

1975; 4 : 429.

91

Cowan ST, Steel KJ. Manual of the Identification of Medical Bacteria. Cambridge:

Cambridge University Press, 1974.

Dale, L., Haggman, D.O. and Susan, J. Non-typhoidal Salmonella pericarditis. Pedriatic Inf.

Dis. 1986; 5(2) : 259.

Datta, N. Epidemiology and classification of plasmids In: Microbiology Schlessinger D.E.

2nd Ed. American Society for Microbiology, Washington D.C.1975: PP 9-15.

Datta, N., Hugh, V.M., Nugent, M.E. and Richards, H. Plasmids and transposons and their

stability and mutability in bacteria isolated during an outbreak of hospital infection.

Plasmid1979; 2 :182.

Datta, N. Plasmids of enteric bacteria In: Antimicrobial Drug resistance ED Bryan, L.E.

Academic Press, London 1984; PP 487

Davies, W.W. and Stout, T.R. Disc plate method of microbiological antibiotic assay. factors

influencing variability and error applied microbiology 1971; 22: 659.

DeBoy II, J.M., Wachsmuth, I.K. and Davis, B. Antibiotic resistance in entero toxi genic

and nonntero toxi genic Escheria c o l l . J. Clin. Microbiol. 1980; 12 : 264.

Deroeck D, Jodar L, Clemens J.Putting typhoid vaccination on the global health agenda. N

Engl J Med 2007;357:1069-71.

dhanashree b. Antibiotic susceptibility profile of Salmonella enterica serovars: Trend over

three years showing re-emergence of chloramphenicol sensitivity and rare serovars.

Indian J Med Sci 2007;61:576-9

Doughar i , J . H . , Elmahmood, A . M 1. and Nggada , H . P . Retrospective study

on the antibiotic resistant pattern of S a l m o n e l a t y p h i , Department of Medical

Microbiology and Parasitology, University or Port Harcourt Teaching Hospital, PMB

6173 – Port Harcourt, Rivers State, Nigeria. PMB 2007 Yola. Adamawa State,

Nigeria.

DS, Chaudhury R. Enteric fever treatment failures: a global concern. Emerg infect Dis 2001;

7: 762-763

Dunne EF, Fey PD, Kludt P et al. Emergence of domestically acquired caftriaxone-resistant

Salmonella infections associated with AmpC?-lactamase. JAMA 2000; 284 : 3151-

3156.

Dutta AK, Kanwal SK. Typhoid fever: An Asian perspective. In: Proceedings on the

APPSGAN workshop on Pediatric Gastroenterology and Nutrition, Galle, Sri-

92

Lanka, October 1998, pp 71-78.

Edelman R, Levine MM, Summery of an International workshop on Typhoid fever.

Rev.infect.Dis 1986; 8: 329 – 49

Edwards and Ewing's: The genus Salmonella.In Identification of Enterobacteriaceae Ed by

William and Ewing, 4th edition Elsevier Science Publishing Company New York

1986; PP 181-246.

El-AkkadAM . Statistics and epidemiology of typhoid fever in UAR. J Egypt Public Health

Assoc 1970;45:8-16

Ericsson, H. and Sherris, J.C. Antibiotic sensitivity testing. Report of an International

Collaborative study. Acta. Pathol. Microbiol. Scandi. 1971; Section B (Suppl) : 217.

Essa F.abdullah ,H.Faryal,Fatima K, Irfan S.Iqbal S Mir enteric fever in Karachi : current

anti microbial susceptibility of Salmonalla typhi isolate journal of physician and

surgeon Pakistan 2012 ,vol 22 (3): 147-150

Ewing, W.H. An outline of nomenclature for the family Enterobacteriaceae. Int. Bull. Bact.

Nomencl. Taxan. 1963; 13 : 95.

Falcow, S. Infections Multiple Drug Resistance, Chapter 5 Pion Ltd London 1975.

FaridZ, MinerWF, HassanA, TrabolsiB . Misuse of antibiotics. N Engl J Med 1975;

292:216.

Farooqui, B., Ashfaq, M.K., Khurshid, M. and Ahmed, M.S. Epidemiology of typhoid fever.

National Health 1990; 8(6,7) : 20.

Finegold SM, baron EJ. In: Bailey & Scott's Diagnostic Microbiology. 7th Ed. Missouri: CV

Mosby Co., 1986;

Finegold SM, Sutter VL, Atterberry HR, Rosenblast SE. In: Manual of Clinical

Microbiology. Lennette EH, Spaulding EH, Tralant JP (eds). 4th Ed. Washington:

American Soceity of Microbiology, 1985.

Fontaine, T.D III. and Hoadley, A.W. Transferable drug resistance associated with coliform

isolated from hospital and domestic sewage. Health Lab. Sci. 1976; 13 : 238.

Foster, T.J. Plasmid-determined resistance to antimicrobial drugs and toxic metal ions in

bacteria. Microbiol. Rev. 1983; 47 : 361.

Frenck RW, Jr., Clemens J, Frenck RWJ, Clemens J. Helicobacter in the developing world.

Microbes & Infection 2003; 5(8):705-713.

Gaffar MSA, Seedat YK, Coovadia YM, Khan Q. The white cell count in typhoid fever

93

Trop Geogr Med 1992; 44: 32-37

Gaffney, D.F., Foster, T.J. and Shaw, W.V. Chloramphenicol acetyltransferases determined

by R plasmids from Gram-negative bacteria. J. Gen. Microbiol. 1978; 109 : 351

Garrod, L.P. and O'Grady, F. In: Antibiotic and Chemotherapy ED Garrod LP and O'Grady

F, 3rd Ed. Williams and Wilkins Company Baltimore, 1971; PP 350-358.

Gilman, R.H., Terminal, M. and Levine, M.M. Relative efficacy of blood, urine, rectal swab,

bone marrow and rose-spot cultures for recovery of Salmonella typhi in typhoid

fever. Lancet 1975; 1: 1211.

Gniadkowski M (2001). Evolution and epidemiology of extended spectrum ß-

lactamases (ESBL) and ESBL producing microorganisms. Clin. Microbiol.

Infect. 7: 597-608.

Goodall EW and Washbourn JW, editors. London: aris; 1996. p. 290-329.

Gotuzzo, E.G. Characteristics epidemiologicas de la fiebre hfoidea en Lima. Diagnostico.

1981; 8 : 76.

Grabow, W.O.K., Vanzyl, M. and Prozesky, O.W. Behavior in conventional sewage

purification processes of coliform bacteria with transferable and nontransferable drug

resistance. Water. Res. 1976; 10 : 7

Graham SM, Graham SM. Salmonellosis in children in developing and developed countries

and populations. Current Opinion in Infectious Diseases 2002; 15(5):507-512.

Gupta A (1994). Multidrug-resistant typhoid fever in children: epidemiology and

therapeutic approach. Pediatr. Infect. Dis. J., 13: 134-140

Gupta V, Kaur J, Kaistha N. re-emerging chloramphenicol sensitivity and emerging low level

ciprofloxacin resistance among Salmonella enterica serotype typhi isolates in North

India. Trop Doct 2009;39:28-30.

Hannan A et al. Ofloxacin- a possible breakthrough in the treatment of typhoid fever caused

by chloramphenicol resistant Salmonella typhi. In: Nicoletti G, Cocuzza G, eds.

Proceedings of 6th

Mediterranean Congress of Chemotherapy, 22-27 May 1988,

Hannan A, Butt T, Islam SN First quinolone resistant typhoid salmonella. Pakistan Armed

Forces medical Journal, 1993, 44:27-30

Hannan A. Changing pattern of Salmonella typhi isolates in Pakistan and their unchanged

response to ofloxacin. Intemational J Experiment Clin Chemotherapy 1991; 4: 225

94

Hannan A. Typhoid in Pakistan a decade of experience in abstract from proceeding

ofnationa symposium on tropical and infectious diseases at armed forces institute of

pathology, Rawalpindi, September1995.

Hakanen A, Kotilainen P, Huovinen P, Helenius H, Siitonen A. Reduced fluoroquinolone

susceptibility in Salmonella enterica serotypes in travelers returning from Southeast

Asia.EmergInfectDis.2001;7:996-1003.

Haque SMZ, Haq JA, Rahman MM. nalidixic Acid-resistant Salmonella enteric serovar

Typhi with decreased susceptibility to ciprofloxacin caused treatment failures: a

report from Bangladesh. Jpn J Infect Dis 2003; 56: 32-33

Hargret-Bean, H.J., Pavia, A.T. and Tauxe, R.V. Salmonella isolates for humans in the

United States; 1984-1986 MMWR. Annual Summary 1988; 37 . 25

Hasan R, Cooke FJ, Nair S, Harish BN, Wain J. Typhoid and paratyphoid fever. Lancet.

2005; 366:1603-4.

Hasan R, Zafar A, Abbas Z, Mahraj V, Malik F, Zaidi A. Antibiotic resistance among

Salmonella enterica serovar typhi and Paratyphi A in Pakistan (2001-2006). J

Infect Developing Countries 2008; 2:289-94.

Hazir T, SA Qazi, KA Abbas and MA Khan (2002). Therapeutic re-appraisal of multi drug

resistant Salmonella typhi (MDRST) in Pakistani children. J. Pak Med Assoc 52:

123-127

Helmuth, R., Stephan, R. and Bunge, C. Epidemiology of virulence-associated plasmid and

outer membrane protein patterns within seven common Salmonella serotypes. Infect.

Immune. 1985; 48 : 175.

Hirose K, Tamura K, Sagara H, Watanabe H. Antibiotic susceptibilities of Salmonella

enterica serovar Typhi and S. enterica serovar Paratyphi A isolated from patients in

Japan. Antimicrob Agents Chemother. 2001; 45: 956-8

Holmberg SD, Osterholm MT, Senger KA, Cohen ML. Drug-resistant salmonella

from animals fed antimicrobials. N Engl J Med 1984; 311: 61722.

Hornick, R.B., Greisman, S.E. and Woodward, T.E. Typhoid fever: Pathogenesis and

immunogenic control. N. Engl. J. Med. 1970; 283 : 686

Houston, C.W., Koo, F.C.W. and Peterson, J.W. Characterization of Salmonella toxin

released by mitomycin C-treated cells. Infect. Immune. 1981; 32 : 916.

95

Istrup, D.M. and Washington, J.A. The importance of volume of blood cultured in the

detection of bacteraemia and fungaemia. Diagnosis of Microbiology and Infectious

Diseases 1983; 1107.

Ishiguro, N., Goto, J. and Sato, G. Genetical relationship between R-plasmids derived from

Salmonella and E. coil obtained from a pig farm and its epidemiological

significance. J. Hyg. Camb. 1980; 84 : 365.

Islam, A., T. Butler, i.Kabir, and N.h. Alam, 1993. Treatment of typhoid fever with

ceftriaxone for 5 days or chloramphenicol for 14 days: a randomized clinical trial.

Antimicrob. Agents Chemother. 37:1572-1575.

Ivanoff B. Typhoid fever :global situation and WHO recommendations Southeast Asian

Trop Med public health 1995:26(suppl 2):1-6

Jackson, G. A survey of antibiotic resistance of E. coil isolated from animals in Great

Britain from 1971 to 1977. Vet. Record 1981; 108 : 325.

Jacobsen, 1910: Principles of Bacteriology, Virology and Imunology (Vol 2) ED

Topley W.W.E. and Wilson CS 7th Ed. Butler and Tanner Ltd, London1964; PP

332-- 355.

Jesudason, M. v., Malathy, B. and John, T. J. (1996): Trends of increasing level of minimum

inhibitory concentration (MIC)of ciprofloxacin to Salmonella typhi Indian J. Med

Res. 103,247-249.

Jiwa, S.F. 11. Probing for enterotoxigenicity among Salmonella: and evaluation of

biological assays. J. Clin. Microbiol. 1981; 14 :463 .

Johnes A. Crump, Timothy J. Barrett, Jennifer T. Nelson, and Frederick J. Angulo

Reevaluating Fluoroquinolone Breakpoints for Salmonela enterica Serotype

Typhi and for Non-Typhi Salmonellae Foodborne and Diarrheal Diseases Branch,

National Center for Infectious Diseases, and Epidemic Intelligence Service, Division

of Applied Public Health Training, Epidemiology Program Office, Centers for

Disease Control and Prevention, Atlanta, Georgia CID 2003:37 (1 July).2000

Johnson, A.Q.K. and Aderele, W.I. Enteric fever in childhood. J. of Trop. Med. and Hyg.

1981; 84 , 29 .

Joseph, C.A. and Palmer, S.R. Outbreaks of Salmonella infection in England and

Wales1978-1987. Br. Med. J. 1989; 298 : 1161 .

Karamat K A, Akhtar M A, Malik I A, Rehat R etal. Multidrug resistant Salmonella typhi of

96

Northern Pakistan. Pakistan Journal of Pathology, 1991: 2:37-3

Karamat KA, Butt. T, hannan A,Islam SN, Hussain T. Quershi AH, Qamar RH. Problem of

multidrug resistant typhoid fever in Rawalpindi/Islamaad area Pk Armed Forces med

j 1996; 46(2) 48-54

Kariuki S, Revathi G, Muyodi J, et al. Characterization of multidrug resistant typhoid

outbreaks in Kenya J Clin Microbiol 2004; 42: 1477-1482

Karmaker S, Biswas D, Shaikh NM, Chatterjee K, Kataria VK, Kumar R. Role of a large

plasmid of S.typhi encoding multiple drug resistance. J Med Microbiol1991;34 :149-

51.

Kauffmann-White F. and Edwards, P.R. Classification and nomenclature of

Enterobacteriaceae. Int. Bull. Bact. Nomencl. Taxon. 1952; 2 : 2.

Kauffmann-White F. The bacteriology of Enterobacteriaceae. Copenhagen Munksgaard.

1966; P 1-400.

Kaye et, D., Rocha, H. and Eyekmans, L. Comparison of parenteral ampicillin and

parenteral chloramphenicol in the treatment of typhoid fever. Ann. N.Y. Acad. Sci.

1967; 145 : 423

Khan MH, Ain Q and Jamil H. Multidrug resistant typhoid in adults. JCPSP 1996; 6;33-35

Koneman EW, SD Allen, WM Janda, PC Schrechenberger and WC Winn (1997).

Antimicrobial susceptibility testing. In: Color Atlas and Text book of diagnostic

microbiology, London: Lippincott Williams and Wilkins 5: 785-856.

Konitomichalou, P. First Chloramphenicol resistant S. typhi strain isolated in Greece.

Pathologica et Microbiologia 1967; 30 : 71.

Kouame J, Kouadio L, Turquin HT, Kouame J, Kouadio L, Turquin HT. Typhoid ileal

perforation: surgical experience of 64 cases. Acta Chirurgica Belgica 2004;

104(4):445-447.

Koupal, L.R. and Deibel, R.H. Assay, characterization and localization and an enterotoxin

produced by Salmonella. Infect. Immune. 1975; 11 : 14.

Kustner HGV. Trends in four major communicable diseases S Arf Med J 1979: 55 : 460 - 473.

Lacey, R.W. A critical appraisal of the importance of R-factors in the Enterobacteriaceae in

Vivo. J. antimicrob. Chemother. 1975; 1 : 25.

Lakshmi V, Ashok R, Susmita J, Shailaja VV, Lakshmi V, Ashok R et al. Changing trends

97

in the antibiograms of Salmonella isolates at a tertiary care hospital in Hyderabad.

Indian Journal of Medical Microbiology 2006; 24(1):45-48.

Laloum E, Zeller V, Graff W, Aerts J, Chazerain P, Mamoudy P et al. Salmonella typhi

osteitis can mimic tuberculosis. A report of three cases. Joint, Bone, Spine: Revue du

Rhumatisme 2005; 72(2):171-174.

Lathi Nair, Sudarsana J Changing Sensitivity Pattern of Salmonella typhi in Calicut

Microbiology Department Medical College, Calicut, India 2005 E-

Mail:drlathi@rediathimail.com

Le Minor, L., Rohde, R. and Taylor, J. Nomenclaturedes Salmonella. Annals. Inst. Pasteur.

Paris 1970; 119; 206.

Le TA, Lejay-Collin M, Grimont PA, Hoang TL, Nguyen TV, Grimont F, Scavizzi MR

(2005). Endemic, epidemic clone of Salmonela enterica serovar typhi harboring a

single multidrug-resistant plasmid in Vietnam between 1995 and 2002. J. Clin.

Microbiol. 43: 3594-3599.

Levy SB (2001) Antibacterial household products: cause for concern. Emerg Infect Dis 7:

512-515

Liang-Takasaki Saxen H.and Makela P.H. Lund, E., Funder, S.B., Chritensonm H. and

Dupot, A. Sensitivity test with the tablet method. Acta pathologica et Microbiologica

Scandinavia 1951; 29 : 221.

Liang-Takasaki,C-J,Saxen, H.and Makela,P.H.Complement activation by

polysaccharide of lipopolysaccharide: an important virulence determinant of

Salmonella. Infect. Immune. 1983; 41 : 563.

Lin FYC, Ho VA, Bay PV, Thuy NIT, Bryla D, Thanh CT, et al. The . epidemiology of

typhoid fever in the Dong Thap province, Mekong Delta region of Vietnam. Am J

Trop Med Hyg 2000; 62;644-8

Linton, A.H. and Timoney, J.F. and Hinton M. The ecology of chloramphenicol-resistance

in S. typhimurium and E. coli in calves with endemic Salmonella infection. J. Appl.

Bact. 1981; 50 . 115

Linton, A.H. The Swann Report and its impact in the control of antibiotic Resistant Bacteria.

Stuart-Harris C. and Harris D.M. Eds. Academic Press, London. 1982; PP 183

Luby SP, Faizan MK, Fisher-Hoch SP, Syed A, Mintz ED, Bhutta ZA, et al. Risk fac!-ors

for typhoid fever in an endemic setting Karachi Pakistan epidemiologic

98

Lund, E., Funder, S.B., Chritensonm H. and Dupot, A. Sensitivity test with the tablet method.

Acta pathologica et Microbiologica Scandinavia 1951; 29 : 221.

M John, H. T., George, A. j., Yingyuan, Z., Wang, F . and David C. H. (2003)

Plasmid- Mediated Quinolone Resistance in Clinical Isolates of Escherichia coli

from Shanghai, China. Antimicrobial Agents and Chemotherapy.47(7): 2242-48

M. D. Smith, N. P. J. Day, L. T. Phi, C. M. Parry, and N. J. White. 1997. Short courses of

ofloxacin for the treatment of enteric fever. Trans. R. Soc. Trop. Med. Hyg. 91:347-

349.

Madhulika U,Harish BN Parija SC.Current patteren in antimicrobial susceptibility of

Salmonella Typhi isolates in Pondicherry.Indian J Med Res 2004;120:111-4

Mahmood A. Present status of antibiotic susceptibility pattern of Salmonella typhi isolates

at a tertiary care hospital in Karachi. Journal of the Pakistan Medical Association.

2000. 50(12) 428

Makela, P.J., Valtonen, V.V. and Valtonen, M. Role of 0-antigen (lipopolysaccharide) factors

in the virulence of Salmonella. J. Infect. Dis. 1973; 128 : S81.

Malini R. Capoor, Deepthi Nair, Jitendra Posti, Smita Singhal, Monorama Deb, Pushpa

Aggarwal, and Parukutty Pillai Minimum inhibitory concentration of carbapenems

and tigecycline against Salmonella spp. J Med Microbiol 2009 58: 337-41.

Mandal S, Mandal Md, Pal NK. reduced minimum inhibitory concentration of

chloramphenicol for salmonella enterica serovar typhi. Indian J Med Sci 2004 ; 58 :

16-23

Mandel, B. K. and Mani, V. Colonic involvement in Salmonellosis Lancet 1976; 1 : 887

Martin, W,J., Brates, S.F. and Ball, M.M. Evaluation of reagent-impregnated strips for

identification of Enterobacteriaceae. Am. J. Med. Technol. 1971; 37 , 99.

McConkey SJ, McConkey SJ. Case series of acute abdominal surgery in rural Sierra Leone.

World Journal of Surgery 2002; 26(4):509-513.

Medhat Shehab and Aref Al-Nakkas Clinical and microbiological investigations of typhoid

fever in an infectious disease hospital in Kuwait (2007), 56, 538-544

Miller Sl and Pegues DA, Salmonella species, including Salmonella typhi in: principal and

practice of infectious Diseases edited by Mandell GL, Bennett JE and Dolin R,

London, Churchill Livingstone,2000;pp.2344-2359

Mills-Robertson F, Addy ME, Mensah P, Crupper SS, Mills-Robertson F, Addy ME et al.

99

Molecular characterization of antibiotic resistance in clinical Salmonella typhi

isolated in Ghana. FEMS Microbiology Letters 2002; 215(2):249-253.

Minor, L.Le., Coynault, C., Chabberi, Y., Gerbaud, G. and Minor,, S.Le. Groupes de

compatibdite de plasmides metaboliques. Ann. Microbiol. (Inst pasteur) 1976; 127B :

Mirza S, Kariuki S, Mamun KZ, Beeching NJ, Hart CA. Analysis of plasmid and

chromosomal DNA of multidrug resistant Salmonella enterica serovar typhi from

Asia. J Clin Microbiol 2000; 38:1449-52.

Mirza SH, Beeching NJ, Hart CA. Multi-drug resistant typhoid: a global problem. J Med

Microbiol 1996; 11 : 317-9.

Mirza SH, Hart CA. Plasmid encoded multi-drug resistance in Salmonella typhifrom

Pakistan. Annals of Trop Med Parasitol 1993;87:373-7.

Molecular analysis of incHI1 antimicrobial resistance plasmids from Salmonella serovar

Typhi strains associated with typhoid fever. Antimicrob Agents Chemother

2003;47:2732-9.

Molbak K, Baggesen DL, Aarestrup FM, et al. An outbreak of multidrug resistant Salmonela

enterica serotype Typhimurium DT104. N Engl J Med 1999; 34 1:1420–5.

Mohanty S, Renuka K, Sood S, Das BK and Kapil A (2006) Antibiogram pattern and

seasonality of Salmonella serotypes in a North Indian tertiary care hospital.

Epidemiology and Infection 134: 961-966

Momtaz O. Wasfy1, Robert Frenck1,Tharwat F. Ismail1, Hoda Mansour, Joseph L.

Malone1, and Frank J. Mahoney Trends of Multiple-Drug Resistance among

Salmonella Serotype Typhi Isolates during a 14-Year Period in Egypt CID 2002 ; 35

(15 NOVEMBER) . 1265

Morley, D.C. A simple method of testing the sensitivity of wound bacteria to penicillin and

Sulfamethoxazole by the use of impregnated blotting paper discs. J. of Path. and Bact.

1945;57 ; 379.

Mossel, D.A.A. and Oei, H.Y. Person-to-person transmission of enteric bacterial infection

Lancet 1975; i : 751.

Mubeena RS, Saleem AK, Ameena RS. Prevalence of enteric fever in Karachi. Infect Dis J

Pak 2006; 15:103-

Murdoch DA, Banatval NA, Bone A, Shoismatulloev BI. Epidemic' ciprofloxacin- resistant

Salmonella typhi in Tajikistan. Lancet 1998; 351: 339

100

Murray CJL, Lopez AD. Mortality by cause for eight regions of the world: global burden of

disease study. Lancet 1997; 349: 1269-1276

Murti, B. R., Rajyalakshmi, K. and Bhaskaran, C. S.: Resistance of Salmonella typhi to

chloramphenicol. Part I. A preliminary report. J. Clin. Pathol., 15: 544-551, 1962.

Musher, L.M. and Rubenstein, A.D. Permanent carriers of non-typhosa Salmonella. Arch.

Intern. Med. 1973; 132 : 869.

Mushtaq MA. What after ciprofloxacin and ceftriaxone in treatment of Salmonella typhi.

Pak J Med Sci 2006;22 (1):1 51-4.

Nair L, Sudarsana J, Pushpa KK. Epidemic of Salmonella enterica Serotype paratyphi A

in Calicut-Kerala. Calicut Med J 2004; 2:e2.

Nakamura, M., Sato, S. and Ohya, T. Possible relationship of a 36 mega dalton Salmonella

enteritidis plasmid to virulence in mice. Infect. Immune. 1985; 47 : 831.

Nakamura, M.,Sato,S. and Ohya,T.PossibleNepal, in 2003. Diagn Microbiol Infect Dis

2006;54: 299-303

Nguyen TA, ha-Ba-K, nguyen TD la fievre typhoid au sud du viet- nam, 1990-1993 Bull

Soc Pathol Exot 1993-; 86: 476-8

Niida, M., Makino, S., Ishiguro, N., Sato, G. and Nishio, T. Genetic properties of

conjugative R-plasmids in E. coli and Salmonella isolates from feral and domestic

pigeons, crows and kites. Zbt. Bakt. Hyg. I. Abt. Orig. 1983; A255 : 271.

Njoku-Obi, A. N. and Njoku-Obi, J. C.: Resistance of Salmonella typhosa to

chloramphenicol. J. Bacteriol., 90: 552-553, 1965.

Novick, R.P. Plasmid. Bacteriol. Rev. 1969; 33 : 210.

Ochiai RL, Wang X, von Seidlein L, Yang J, Bhutta ZA, Bhattacharya SK et al. Salmonella

paratyphi A rates, Asia. Emerging Infectious Diseases 2005; 11(11):1764-1766.

Ochiai, K., Yamanaka, T., Kimura, K. and Sawada, O. Studies on inheritance of drug

resistance between Shigella strains and E.coli strains. Nippon. Iji. Shimpo.1959; 1861

: 34.

of typhoid fever BMJ. 2006 July 8; 333(7558): 78–82.

Okeke IN, Klugman KP, Bhutta ZA, Duse AG, Jenkins P, O'Brien TF, et al. Antimicrobial

resistance in developing countries. Part II: strategies for containment. Lancet Infect

Dis 2005;5: 568-80.

101

Ortiz-Neu, C., Marr, J.C. and Cherubin, C.E. Bone and joint infections due to Salmonella J.

Infect. Dis. 1978; 138 : 820.

Pang, T., Z.A Bhutta, B.B Finlay, and M.Altwegg. 1995. Typhoid fever and other

salmonellosis: a continuing challenge. Trends Microbiol. 3:253-255

Paniker, C.K.J. and Vimala, K.N. Transferable chloramphenicol resistance in Salmonella

typhi. Nature 1972; 239 : 109

Parker, M.T. Salmonella In Principles of Bacteriology, Virology and Imunology (Vol 2) ED

Topley WWE and Wilson C.S. 7th ed. Butler and Tanner Ltd, London 1964; PP 332-

355.

Parry C (2003). Antimicrobial drug resistance in Salmonela enterica. Curr. Op. Infect.

Dis. 16: 467-472.

Parry CM (2004). Typhoid Fever. Curr. Infect. Dis. Rep., 6: 27-33.

Parry CM, Hien TT, Dougan G, White NJ, Farrar JJ, Parry CM et al. Typhoid fever. New

England Journal of Medicine 2002; 347(22):1770-1782.

Parry CM, HO VA, Phoung LT, Bay VB, Lanh MN, Tung Ie T et al. Randomized controlled

comparison of Ofloxacin, Azithromycin, and an Ofloxacin- Azithromycin

combination for treatment of Multidrug-Resistant and Nalidixic Acid-Resistant

Typhoid Fever. Antimicrob Agents Chemother 2007;51:819-25

Paterson DL (2006). Resistance in gram-negative bacteria: enterobacteriaceae Am. J.

Infect. Control. 34: S20-28.

Petrocheilou, V., Grinsted, J. and Richmond, M.H. R-plasrnid transfer in vivo in the absence

of antibiotic selection pressure. Antimicrob. Agents Chemother. 1976; 10 : 753

Pickett, M.J., Scott, M.L. and Hoyt, R.E. Tableted mediums for biochemical tests in diagnostic

bacteriology. Am. J. Med. Technol. 1955; 21 : 170.

Pillay, N., Adams, E.B. and Coombes, N.D. Comparative trial of amoxycillin and

chloramphenicol in treatment of typhoid fever in adults. Lancet 1975; i i : 333.

Poon, M. and Sanders, M.G. Hepatic abscess caused by Salmonella paratyphi B. Can. Med.

Assoc. J. 1972; 107 : 529.

Qadri, S.M.H., Berotte, J.H. and Wende, R.D. Salmonella heidelberg as a causative agent of

meningitis. Tex. Med. 1976; 72 : 56.

Quantification des caracteres biochimiques. Annuls. Inst. Pasteur. Paris. 1968; 115 : 218.

102

Quantitation of bacteria in blood of typhoid fever patients and relationship between counts

and clinical features transmissibility, and antibiotic resistance. J Clin Microbiol

1998;36: 1683-7

Rahman M, Siddique AK, Shoma S, Rashid H, Salam MA, Ahmed QS, Nair GB, Breiman

RF. Epidemiol Infect. 2006 Apr;134 (2) : 433-8.

Rahman2 Nalidixic Acid-Resistant Salmonella enterica Serovar Typhi with Decreased

Susceptibility to Ciprofloxacin Caused Treatment Failure: A Report from

Bangladesh. Jpn. J. Infect., Dis. 56, 2003.

Rahn, O. New principles for the classification of bacteria. Zent bl. Bakt. Parasit. Kde. Abt. II.

1937; 96 : 273.

Rangnekar, V.M., Banker, D.D. and Jhala, H.I. Drug resistance and incompatibility groups of

R-plasmid in intestinal Escherichia coll. Ind. J. Med. Res. 1982; 75 : 492

Rapid diagnosis of typhoid fever through identification of Salmonella typhi within 18 hours

of specimen acquisition by culture of the mononuclear cell-platelet fraction of blood.

Clin. Microbiol. 28:825827 Trop Med Int Health .1997;2: 1 088.-94

Rasaily R, Dutta P, Saha MR, Mitra U, Lahiri M, Pal SC. Multidrug resistant typhoid fever

in hospitalized children. Eur J Epidemiol 1994;10:41 46.

Rao PS, Rajashekar V, Varghese GK, Shivananda G. Emergence of multidrug resistant

salmonella typhi ir ral Southern India. Am J Trop Med Hyg 1993; 48: 108-111.

Rio M, Garcia1M, Cubedo M, Prez D. Time series in the epidemiology of typhoid fever in

Spain. Med Clin Bare 1996; 1 06:68-69.

Rathish KC, Chandrashekar MR and Negesha CN. An outbreak of Multidrug resistant

typhoid fever in 1.Bangalore. Indian J Pediatr 1995; 62:445-448

Rehman, M.T.A., Basir, N., Zia, N. and Farooqi, B. Thyroid abscess an unusual

complication of typhoid fever. J. Tropical Med. and Hyg. 1991; 94 : 55.

Renuka K, Seema S, Das BS, Kapil A. High level ciprofloxacin resistance in Salmonella

enterica serotype Typhi in India. J Med Microbiol 2005 ; 54: 999-1000

Richards, H. and Datta, N. Plasmids and transposons acquired bySalmonella typhi in man.

Plasmid 1982; 8 : 9.

Richens J. Typhoid Fever. In: Cohen J&PWG, editor. Cohen & Powderly: Infectious

Diseases. Edinburgh: Mosby Inc., 2004: 1561-1565.

103

Robert, M., Walter, J.R. and James, R. Salmonella thyroiditis apathetic thyrotoxicosis and

follicular carcinoma in a laotian women. Cancer 1982; 50 : 2493.

Rodrigues C, metha A, Joshi Vr. Quinolone resistant enteric fever – problems and remedies.

JAPI 1998; 46(8): 751-52.

Rolinson GN and Stevens S. Microbiological studies of new broad-spectrum penicillin

"penbritin". Brit. M. J. 1961; 2 : 191.

Rose, S.B. and Miller, R.E. Studies with the agar cup-plate method I A standardize agar cup-

plate technique. J. of Bact. 1969; 38 : 525.

Rosenthal, S.L. Exacerbation of salmonella Enteritis due to ampicillin. N. Engl. J. Med.

1969; 280 : 147.

Roussel, A.F. and Chabbert, Y.A. Taxonomy and epidemiology of Gram-negative bacterial

plasmids studies by DNA-DNA filter by hybridization in formamide. J. Gen.

Microbiol. 1978; 104 : 269.

Rowe B, EJ. Multidrug resistant Salmonella Typhi, a worldwide epidemic. Clin Infect Dis

1997; 24 (Suppl 1) : S 106-9.

Rowe, B., Frost, J.A., Threlfall, E.J. and Ward, L.R.Spread of multiresistant clone of

Salmonella byphimurium phage type in South-East Asia and the Middle East.

Lancet 1980; i : 1070.

Rowe, B., Ward, L. R. and Threlfall . E. J. (1990) Spread of multiresistant Salmonella typhi.

Lanct . 337 : 1065.

Rowland, H.A.K. The complications of typhoid fever. J. Trop. Med. Hyg. 1961; 64 : 143.

Rubenstein, A.D., Feenster, R.F. and Smith, H.M. Salmonellosis as a public health problem

in wartime. Am. J. Public health 1944; 34 : 841.

Rubin, R.H. Human Salmonellosis: Epidemiology, pathogenesis and clinical syndromes

Infect. Dis. Pract. 1982; 6 : 1.

Sabherwal, U., Chaudhary, U. and Saint, S. Multi-resistant Salmonella typhi in Haryana

in 1989-1990. Indian J. Med. Res. 1992; 95(A) : 12.

Saha SK, Baqui AH, Hanif M, Darmstadt GL, Ruhulamin M, Nagatake T et al. Typhoid

fever in Bangladesh: implications for vaccination policy. Pediatric Infectious

Disease Journal 2001; 20(5):521-524.

Saha SK, Talukder SY, Islam M, Saha S. A highly ceftriaxoneresistant Salmonella Typhi

in Bangladesh. Pediatr Infect Dis J 1999; 18 : 387

104

Salmonella typhi to treatment with trimethoprim-Sulfamethoxazole. Rev. Infect. Dis.

1982; 4 : 551.

Sanghavi SK, Mane MP, Niphadkar KB. Multidrug resistance in Salmonella serotypes.

Indian journal of Medical Microbiology 1999:17(2): 88-90

Saphra, I. and Winter, J.W. Clinical manifestations of Salmonellosis in man. An evaluation of

7779 human infections identified at the New York Salmonella Centre. New Engl. J. of

Med. 1957; 256 : 1128.

Saqib A, Ahmed A. Culture and sensitivity of Salmonella species; analysis of a two year

data. J Pak Med Assoc 2000;50:282-4

Savage, D.C. Survival on mucosal epithelia, epithelial penetration and growth in tissues of

pathogenic bacteria. In: Microbial pathogenicity in man and animals (22nd Symp Soc

Gen Micrbobiol) ED Smith H. and Pearce J.H. Cambridge. 1972; P 25.

Schutze, H. Identification of Salmonella by using specific antisera J. Hyg. 1921; 20 : 230.

Scott, I.H.K., Thomas, H.W. and Walters, R.O. Acute splenic abscess due to Salmonella

chestor. Br. Med. J. 1977; 1 : 688.

Scragg, J.N. and Rubidge, C.J. Amoxycillin in the treatment of typhoid fever in children. Am.

Trop. Med. Hyg. 1975; 24: 860.

Shanahan PM, Jesudason MV, Thomson CJ, Amyes SG. J Clin Microbiol. Molecular

analysis of and identification of antibiotic resistance genes in clinical isolates of

Salmonella typhi from India. J Clin Microbiol. 1998 Jun;36(6):1595-600.

Shanson, D.C., Brigden, W. and Weaver, E.M.J. Salmonella en t e r i t i d i s endocarditis. Br.

Med. J.1977; 1 : 612.

Sharr, M.M. Splenic abscess due to Salmonella agona. Br. Med. J. 1972; 1 : 546.

Shaw, C. Distinction between Salmonella and Arizona by Leifson's sodium malonate medium.

Int. Bull. Bact. Nomencl. Taxon. 1956; 6:1

Shinagawa, M., Makino, S., Hirato, T., Ishiguro, N. andSato, G. Comparison of DNA sequences

required form the function of citrate-utilization among Different

citrateutilization plasmid.J.Bacteriol. 1982; 151 : 1046.

Shirakawa T, Acharya B, Kinoshita S, Kumagai S, Gotoh A, Kawabata M. Decreased

susceptibility to fluoroquinolones and gyrA gene mutation in the Salmonella enterica

serovar Typhi and Paratyphi A isolated in Kathmandu, Nepal, in 2003. Diagn

Microbiol Infect Dis 2006 ; 54: 299-303.

105

Shirakawa T, Acharya B, Kinoshita S, Kumagai S, Gotoh A, Kawabata M. Decreased

susceptibility to fluoroquinolones and gyrA gene mutation in the Salmonella enterica

serovar Typhi and Paratyphi A isolated in Kathmandu,

Siddiqui FJ, Rabbani F, Hasan R, Nizami SQ, Bhutta ZA. Typhoid fever in children: some

epidemiological considerations from Karachi, Pakistan. Int J Infect Dis 2006;

10:21 5-22.

Silverio, J. Gastric emptying time in the newborn and then nursling. Am. J. Med. Sci. 1964;

247: 732.

Sinha A, Sazawal S, Kumar R, Sood S, Reddaiah VP, Singh B, et al. Typhoid fever in

children aged less than 5 years. Lancet 1999; 357.

Sippel JE, DiabAS, MikhailAI,. Chloramphenicol resistant Salmonella typhi in Egypt Trans

R Soc Trop Med Hyg 1981;75:613.

Smith, W.H., Parsell, Z. and Green P. Thermosensitive antibiotic resistance plasmid in

Enterobacteria J. Gen. Microbiol. 1978; 109 : 37.

Smith, A.L. and Burns, J.L. Resistance to Chloramphenicol and fusidic acid, In:

Antimicrobial Drug Resistance Ed by Bryan LE. PP 293. Academic. Press. New.

York. 1984

Snego R H Bhutta Z A. Multiple drug resistant Salmonella. GMPA (editorial) 1987: 212-5

Snyder, M.L., Donnely, D. and Nix, M.J. On some practical applications of impregnated,

dried paperdiscs containing various reagents for the cultural differentiation of bacteria.

Am. J. Med. Technol. 1951; 17 : 105.Stanley, P.J.

Song, J. H., Cho, H., Park, M. Y., Na, D.S., Moon, H . B. and Pai, C. H. 1993. Detection o

Salmonella typhi in the blood of patients wth typhoid fever by polymerase chain

reaction. J Clin Microbiol. 31:1439-1443.

Steele AD and Ivanoff B. 6th International Conference on Typhoid Feverand other

Salmonelloses, Guilin, China,12-14 November 2005. J health popul nutr

2007;25:122-4.

Stokes, E.J. and Waterworth, P.M. Antibiotic Sensitivity tests by diffusion methods

Association of Clinical Pathologists Broad sheet 1972 : 55.

Stuart, M. D. and R. L. Pullen. 1946. Typhoid: clinical analysis of three hundred and sixty

cases. Arch. Intern. Med. 78:629-661.

106

Su LH, Wu TL, Chia JH, Chu C, Kuo AJ, Chiu CH (2005). Increasing ceftriaxone

resistance in Salmonella isolates from a university hospital in Taiwan. J.

Antimicrob. Chemother. 55: 846-852.

Suganthi R, Rajasekar V, Vargese GK, Shivanada PG. Emergence of multi drug resistant

S.typhi in rural Southern India. Am J Trop Med Hyg 1993 ; 48 : 1 08-11

Takkar VP, Kumar R. Takkar R, Khurana S. Resurgence of Chloramphenicol sensitive

Salmonella typhi. Indian Pediatr 1995: 32: 58687

Taormina Giardini Naxos, Italy. Florence, Italy, Edizioni Revise Scientifiche, 1988; 383-5.

Tariq, Ahmad RN, Salman M, Kazmi SY. Changing trends in drug resistance among

typhoid salmonellae in Rawalpindi, Pakistan. East Mediterr Health J. 2005 Sep-

Nov;11(5-6):1038-44

Taylor, D.E. and Grant, R.B. Incompatibility and surface exclusion properties ofH1 andH2

plasmid. J. Bacteriol. 1977; 131 : 174

Taylor, D.E. and Levine, J.C. Studies of temperature- sensitive transfer and maintenance of

H incompatibility group plasmid J. Gen. Microbiol. 1980; 116 : 475

Taylor, D.E., Levine, J.G. and Kouvelos, K.L. Incidenceof plasmidDNA inSalmonella strains

isolated from clinical sources in Ontario, Canada, during 1979 and 1980. Can. J.

Microbiol. 1982; 28 : 1150

Taylor, D.E., Shermer, M. and Grant, R.B. Incidence of the H12 group of plasmid in

chloramphenicolsensitive Salmonella isolated in 1974 from clinical sources in

Ontario. Can. J. Microbiol. 1978; 24 : 600

Tehmina Munir, Munir Lodhi, Tariq Butt, Karamat Ahmed Karamat. Incidence and

Multidrug Resistance in Typhoid Salmonellae in Bahawalpur Area. Pak Armed

Forces Med J Jan ;2001.51(1):10-13

Thornsberry, C. The agar diffusion antimicrobial susceptibility test. In: Current Techniques for

antibiotic susceptibility testing. ED Barlow A, Charles C and Thomas. Springfield,

Illinois 1974; PP 6-16.

Threlfall EJ, Fisher IST, Berghold C, Gerner-Smidt P, Tschape H, Cormican M, Luzzi I,

Schnieder F, Wannet W, Machado J and Edwards G (2003) Trends in antimicrobial

drug resistance in Salmonella enterica serotypes Typhi and Paratyphi A isolated in

Europe, 1999-2001 International Journal of Antimicrob Agents 22: 487-491

Threlfall EJ, Day M, de Pinna E, Lawrence J. Drug-resistant enteric fever in the UK. Lancet

107

2006 ; 367 : 1576.

Threlfall EJ, Ward LR, Skinner JA, Smith HR, Lacey S. Ciprofloxacin resistant Salmonela

Typhi and treatment failure. Lancet 1999; 353: 1590–1.

Threlfall EJ, Ward LR. Decreased susceptibility to ciprofloxacin in Salmonella enterica

serotype Typhi, United Kingdom. Emerg Infect Dis 2001; 7 : 448-50.

Threlfall, E.J., Ward, L.R., Ashley, A.S. and Rowe, B. Plasmid-encoded trimethoprim

resistance in multiresistant epidemic Salmonella typhimurium phage type 204 and

193 in Britain. Br. Med. J. 1980; 280 : 1210.

Threlfall, E.J.Carr, J.M. and Anderson, E.S. Compatibility reactions of resistance plasmid in

Salmonella typhimurium of Middle Eastern origin. Proc. Soc. Gen. Microbial. 1982;

3 : 88.

Timoney, J.F. and Linton, A.H. Experimental ecological studies on H2 plasmid in the intestine

and faeces of the calf. J. Appl. Bact. 1982; 52 : 41

Topley and Wilson's principles of bacteriology, virology and immunity 7th ed. Edward

Arnold, London, England. Sudarmono, S. P. Pulungsih, M. Lesmana, P. Tjaniadi, N.

Sukri, and S. L. Hoffman. 1990. Rapid diagnosis of typhoid fever through

identification of Salmonella typhi within 18 hours of specimen acquisition by culture

of the mononuclear cell-platelet fraction of blood. Clin. Microbiol. 28:825827 Trop

Med Int Health .1997;2: 1 088.-94

Tran HH, Bjune G, Nguyen BM, Rottingen JA, Grais RF, Guerin PJ et al. Risk factors

associated with typhoid fever in Son La province, northern Vietnam. Transactions of

the Royal Society of Tropical Medicine & Hygiene 2005; 99( 11):819-826.

Tsonyo Dimitrov, Eded E. Udo ,Ossama Albaksami, Shehab Al-Shehab, Abdal Kilani

Medhat Shehab and Aref Al-Nakkas Clinical and microbiological investigations of

typhoid fever in an infectious disease hospital in Kuwait Journal of Medical

Microbiology (2007), 56, 538-544.

Tzouvelekis LS, Lukova V, Tassios PT, Fluit AC, Jones RN, Legakis NJ (2003).

Resistance to ß-lactams among blood isolates of Salmonella spp. in European

hospitals: results from the sentry Antimicrobial Surveillance Program 1997-98.

Clin. Microbiol. Infect. 9: 149-152.

108

Ugwu BT, Yiltok SJ, Kidmas AT, Opaluwa AS, Ugwu BT, Yiltok SJ et al. Typhoid

intestinal perforation in north central Nigeria. West African Journal of Medicine

2005; 24(1):1-6.

Uhlman, D.L. and Jones, G.W. Chemotaxis as a factor in interactions between HeLa cells and

Salmonella typhimurium. J Gen Microbiol 1982; 128 : 415.

Uneke C (2008). Concurrent malaria and typhoid fever in the tropics: the diagnost ic

challenges and public health implications. J. Vector Borne Dis., 45: 133-1 42

Usha Das & Bhattacharya S.S,Antibiogram phage, typing & biotyping of Salmonella

Typhi & Salmonella Paratyphi A from Rourkela ,Orissa. Indian J Med Res

124,july 2006,pp 109-111

Uwaydah AK, Matar I, Chacko KC and Davidson JC (1991) The emergence of

antimicrobial resistant Salmonella typhi in Qatar: epidemiology and therapeutic

implications. Trans R Soc Trop Med Hyg 85: 790-792.

Velema JP, van Wijnen G, van Naerssen T, Jota S. Typhoid fever in Ujung Pandang,

Indonesia-high risk groupsai1cfhigh-risk behavior Trop Med Int Health .1997;2: 1

088.-94

Vollaard AM, Ali S, Widjaja S, Asten HA, Visser LG, Surjadi C et al. Identification of

typhoid fever and paratyphoid fever cases at presentation in outpatient clinics in

Jakarta, Indonesia. Transactions of the Royal Society of Tropical Medicine &

Hygiene 2005; 99(6):440-450.

Wain J, Diem Nga LT, Kidgell C, James K, Fortune S, Song Diep T et al.

Molecular analysis of incHI1 antimicrobial resistance plasmids from Salmonella

serovar Typhi strains associated with typhoid fever Antimicrob Agents Chemother

2003;47:2732-9.

Wain J, Diep TS, Ho VA, Walsh AM, Nguyen TT, Parry CM, et al. Quantitation of bacteria

in blood of typhoid fever patients and relationship between counts and clinical

features, transmissibility, and antibiotic resistance. J Clin Microbiol 1998;36: 1683-

7

Wain J, Kidgell c . The emergence of multidrug resistance to antimicrobial agents for the

treatment of typhoid fever. Trans R Soc Trop Med Hyg 2004; 98:423-30.

Wang, F., Gu, X-J., Zhang, M-F. and Tai, T-Y. Treatmentof typhoid fever with ofloxacin. J. of

Antimicrob. Chemother. 1989; 23 : 785.

109

Wasfy MO et al. Trends of multiple-drug resistance among Salmonella serotype Typhi

isolates during a 14-year period in Egypt. Clinical infectious diseases, 2002 35(10):

1265-8

Washington, J.C. Blood cultures: Principles and techniques. Mayo Clinical Proceedings 1975;

50 . 91.

Watson, J.P., Pettibone, E. C. 1991, Chloramphenicol and ampicillin resistant Salmonella

typhi in Nepal. J. Nep. Med. Asso. 29. 259-261

Watanabe, T. Infective heredity of multiple-drug resistance in bacteria, Bacteriol, Rev.

1963; 27: 87.

Waterworth, P.M. Quantitative methods for bacterial sensitivity testing. In: Laboratory

Methods in Antimicrobial Chemotherapy. Published for the British Society for

Antimicrobial Chemotherapy Churchill Livingstone Edinburgh London 1978; PP 31-

40.

Watson, J .P. Pettibone, E. C. 1991, Chloramphenicol and ampicillin resistant Salmonella

typhi in Nepal. J. Nep. Med. Asso. 29. 259-261

Wellcome trust Sanger Institute. Antibiotic Resistance Advance in Asia. Available from;

http://www.sanger.ac.uk/about/press/2006/060224.html 21May 2010, date last

accessed.

Weill F X, Demartin M, Tande D, Espie E, Rakotoarivony I, Grimont PA (2004). SHV-

12-like extended-spectrum-beta-lactamase-producing strains of Salmonella

enterica serotypes Babelsberg and Enteritidis isolated in France among infants

adopted from Mali. J. Clin. Microbiol. 42: 2432-2437.

WHO. Public Health Papers 1969; No. 38 P.78.

World Health Organization Geneva; 2002.

World Health Organization Department of Vaccines and Biologicals. Background

document: the diagnosis, prevention and treatment of typhoid fever. Geneva: WHO,

2003:19-23.

WHO Traditional Medicine Strategy 2002–2005 WHO. Public Health Papers 1969; No. 38

P.78.

World Health Organization. 6th International Conference on Typhoid Feve and other

Salmonelloses.2006.Geneva,WHO.

William T, Mahle MD. Salmonella typhi infection in children younger than five years of

110

age. Pediatr Infect Dis J 1993; 12: 627-631.

Winokur PL, Canton R, Casellas JM, Legakis NJ (2001). Variations in the prevalence

of strains expressing an extended spectrum - lactamase phenotype and

characterization of isolates from Europe, the Americas and the Western Pacific

region. Clin. Infect. Dis. 32: S94–103.

Woodward, T. E., Smadel, J. E., Ley, H. L., Green, R. and Mankikar, D. S.: Preliminary

report on the beneficial effect of chloromyecetin in the treatment of typhoid fever.

Ann. Int. Med., 29: 131-134 1948.

World Health Organization. 6th International Conference on Typhoid Feve and other

Salmonelloses. 2006. Geneva, WHO World Journal of Surgery 2002; 26(4):509-513.

Yew FS, Chew SK, Goh KT, Monterio EH, Lim YS. Typhoid fever in Singapore: a review

of 370 cases. J Trop Med Hyg 1991;94:352-7

Yoon HJ, Cho SH, Kim SH. A Case of Multidrug-Resistant Salmonella enterica Serovar

Typhi Treated with a Bench to Bedside Approach. Yonsei Med J 2009; 50(1):147-

51

Yousaf, M. and Sadick, A. Ofloxacin in the treatment of typhoid fever unresponsive to

chloramphenicol. C (1990)

Bhutta A Zulfiqar A , Husein Lalji Dewraj Current concepts in the diagnosis and

treatment of typhoid fever BMJ. 2006 July 8; 333(7558): 78–82.

111

PUBLICATION

112

African Journal of Microbiology Research Vol. 6(4), pp. 793-797, 30 January, 2012 Available online at http://www.academicjournals.org/AJMR DOI: 10.5897/AJMR1 1.1055 ISSN 1996-0808 ©201 2 Academic Journals

Full Length Research Paper

Emergence of extended-spectrum β-lactamase producing Salmonella typhi in Pakistan

Khalid Mahmood1, Mateen Izhar

1, Nakhshab Choudhry

2, Ghulam Mujtaba

3 and

Naeem Rashid4*

¹Department of Microbiology, Sheikh Zayed Hospital,

Lahore, Pakistan. ²Department of Biochemistry,

Sheikh Zayed Hospital, Lahore, Pakistan. 3Institute of

Nuclear Medicine and Oncology (INMOL), Lahore, Pakistan.

4School of Biological Sciences, University of

the Punjab, Lahore, Pakistan.

A c c e p t e d 2 9 D e c e m b e r , 2 0 1 1

Enteric fever caused by Salmonella typhi, is an increasing health problem affecting the major population in tropical and subtropical regions of the world. Development of multi drug resistance in S. typhi strains has further increased the severity of the problem. In Pakistan and neighboring countries, more than 80% S. typhi strains have been reported as multi drug resistant. A total of 4200 isolates collected during four years study period starting from Jan. 2006 to Dec. 2009, were initially screened using the first-line anti typhoid drugs. Out of them 408 were resistant to all the first-line antityphoid drugs. It was confirmed by polymerase chain reaction that all these isolates contained fliC, sul, catP, tem and gyrA genes. Only three of them (0.7%) had shown extended-s p e c t r u m β -lactamases production by double disk synergy test. Infection control surveillance, better hygiene along with controlled use of anti microbials would minimize the impact of extended-s p e c t r u m β -lactamases and their spread in hospital and intensive care unit patients.

Key words: Extended-s p e c t r um β -lactamase, multi drug resistance, salmonella typhi, polymerase chain reaction, Pakistan.

INTRODUCTION

113

Multi drug resistant (MDR) Salmonella typhi, causing enteric fever continues to be a major public health problem in tropics and subtropics of the world, affecting both local population and travelers to the endemic area. Frequent out breaks have been reported in South Asian countries (Le et al., 2005; Mulvey et al., 2003). In Pakistan, Iran, Nepal, Bangladesh and India more than 80% MDR S. typhi have been reported during the past two decades (Mohanty et al., 2006; Menezes et al., 2011). Treatment scenario has changed from first line anti typhoid such as chloremphenicol (C), ampicillin (AMP), and trimethoprim-sulphamethoxazol (SXT) to

*Corresponding author. E-mail: naeemrashid37@hotmail.com or naeem.ff.sbs@pu.edu.pk. Tel: +92 42 99231534. Fax: +92 42 99230980.

fluoroquinolones and cephalosporins (Parry, 2003; Zaki and Karande, 2011). Extended s p e c t r u m β -lactamases (ESBL) are enzymes that can hydrolyze oxyimino-beta lactams causing resistance to third generation cephalosporins, resulting in treatment failure and association with higher morbidity and mortality among immuno-compromised patients (Rasheed et al., 2000; Bush, 2001). Nosocomial infection caused by ESBL producing S. typhi has been reported from Latin America, France, Senegal, Africa, Asia, and Europe (Winokur et al., 2001; Weill, 2004a, b; Gniadkowski, 2001; Su et al., 2005). The emergence of ESBL in MDR S. typhi, constitutes a new challenge and has become a matter of concern especially in under developed countries.

S. typhi has been found to produce a wide variety of ESBL types including TEM, SHV, PER and CTXM enzyme (Batchelor et al., 2005; Paterson, 2006; Tzouvelekis et al., 2003). Phenotypic detection methods

794 Afr. J. Microbiol. Res.

Table 1. Primer sequences used in this study for PCR amplification.

S e q u e n c e ( 5 ’ -3 ’ ) Gene Size (bp)

ACTGCTAAAACC ACTACT TGGAGACTTCGGTCGCGTAG

fliC 363

TCAACATAACCTCGGACAGT GATGAAGTCAGCTCCACCT

sul2 707

CCTGCCACTCATCGCAGT CCACCGTTGATATATCCC

catP 623

GCACGAGTGGGTTACATCGA GGTCCTCCGATCGTTGTCAG

tem 311

TACCGTCATAGTTATCCACGA GTACTTTACGCCATGAACGT

gyrA 313

perform poorly in bacterial isolates harbouring AmpC gene (Robberts et al., 2009). AmpC β-lactamases are included in class C and are not inhibited by clavulanic acid or other β-lactamase inhibitors. Thus if an ESBL confirmatory test using clavulanic acid is not performed, many AmpC producing strains may be presumed to be ESBL producing strains (Fred et al., 1999; Hague, 2011). Detection of microorganisms with multiple β -lactamases that may interfere with the phenotypic confirmatory tests can only be accomplished by iso-electric focusing or DNA sequencing methods that are usually not available in clinical labs (Goussard and Courvalin, 1999; Pfaller et al., 2001).

The primary objective of this study was to assess the incidence of ESBL producing MDR S. typhi and their antimicrobial sensitivity pattern in Pakistani population using double disc synergy test (DDST) from blood samples of the patients suffering from enteric fever who visited out patients departments or were admitted in Sheikh Zayed Hospital Lahore, Pakistan.

METHODS

This prospective and cross sectional study was conducted from January 2006 to December 2009 at tertiary care, university teaching Federal Post Graduate Sheikh Zayed Medical Complex (referral hospital with 450 beds) in Lahore, Pakistan. S. typhi were isolated from the blood of the patients admitted in the Hospital. Blood sample from the patients were collected in blood culture bottles and incubated at 37°C for 24 h. Sample from blood culture bottle were inoculated on MacConkey and S.S agar. Plates were then incubated at 37°C for 24 h. Identification of the micro-organisms was carried out by using API 20 E (Bio Meraux, Hazelwood, Durham NC, USA), polyvalent “O”Anti sera (Bio-Rad Laboratories CA, USA) and subsequently specific (fliC) gene was isolated by polymerase chain reaction (PCR). Antimicrobial susceptibility tests were performed by using standard disc diffusion method following Clinical Laboratory Standards Institute (CLSI) recommendations. The panel of antibiotics tested includes AMP, C,

SXT, ciprofloxacin (CIP), ofloxacin (OFX), cefotaxime (CTX), ceftriaxone (CRO), ceftazidime (CAZ), imipenem (IPM), and meropenem (MEM). Escherichia coli (ATCC 25922) was used as a control. S. typhi isolates were labeled MDR when showing resistance to all the first line antityphoid drugs.

Genomic DNA from MDR samples was extracted by standard phenol/chloroform method (Sambrook et al., 1989) and subsequently parts of the genes responsible for resistance to these drugs were amplified by PCR using the primers given in Table 1.

All the MDR S. typhi isolates were screened for ESBL production using CAZ and CTX indicator discs (Oxoid, Cambridge, UK). The isolates showing the zones of inhibition (ZOI) ~ 22 mm and 27 mm for CAZ and CTX respectively were further tested in combination with amoxicillin/clavulanic (AMC). The isolates showing an increase in ZOI by greater than or equal to 5 mm when evaluated in combination with AMC were phenotypically considered as ESBL producers.

DDST was performed by inoculating Mueller-Hinton (MH) agar with test isolates to give a semi confluent growth. CAZ 30 µg and AMC 20 µg discs were then placed strategically 25-30 mm apart (centre to centre) following over night incubation aerobically at 37°C. ESBL production was inferred when the zone of inhibition around the indicator disc was expanded by AMC.

RESULTS

During the four years study period from January 2006 to December 2009, a total of 4200 S. typhi isolates were collected from blood culture samples of typhoid patients.

The ratio of S. typhi ranged between 1372 (32.6%) isolates during 2006, 1050 (25%) in 2007, 1018 (24.2%)

in 2008 and 760 (18.09%) during 2009. The results

indicated that the isolation of S. typhi was significantly

decreased to 18.09% in 2009 from 32.6% in 2006 (Table 2).

Out of total 4200 S. typhi specimen 408 (9.7%) were resistant to all the first-line anti-typhoid drugs (C, AMP and SXT), therefore were labeled as MDR S. typhi. Isolation rate of MDR S. typhi reduced to 5% (38 isolates) during 2009 from 13% (180 isolates) during 2006

Primer

fliC F

fliC R

sul2 F sul2 R

catP F catP R

tem F tem R

gyrA F gyrA R

795

Mahmood et al. 795

Table 2. Isolation of S. typhi during the study period (n=4200).

Year No. of isolates %age MDR positive %age ESBL Producer

2006 1372 32.6 180 13.1 1

2007 1050 25 110 10.4 1

2008 1018 24.2 80 7.8 1

2009 760 18.09 38 5 0

Total 4200 100 408 36.3 3 (0.73 %)

Table 3. Antimicrobial resistant pattern of S. typhi isolates during 2006-2009.

Year 2006 (n = 1372) Year 2007 (n = 1050) Year 2008 (n = 1018) Year 2009 (n = 760) Drug

n %age n %age n %age n %age

Chlorompjenicol 632 46.06 278 27.3 195 19.1 101 13.2

Ampicillin 962 70.1 685 49.9 236 23.1 161 21.1

Co-trimoxazole 878 63.9 602 43.8 248 24.3 183 24.0

Ciprofloxacin 220 16.1 380 36.1 498 48.9 410 53.9

Nalidixic acid 1236 90.08 742 70.6 1206 87.9 312 95.6

Ceftriaxone 196 14.2 160 15.2 162 15.9 118 13.5

Cefotaxime 248 18.0 171 16.2 132 12.9 108 14.2

Ceftazidime 226 16.4 158 15.0 145 14.2 90 11.8

Sparfloxacin 208 14.8 127 12.0 108 10.6 96 12.6

Gentacin 248 18.0 168 16.0 140 13.7 120 15.7

Imipenem 36 2.0 26 2.4 31 3.0 18 2.3

Meropenem 42 3.1 31 2.9 31 3.0 17 2.2 n = n u m b e r o f i s o l a t e s .

(P< 0.001) as given in Table 2. Among the first line anti typhoid drugs C showed decreasing resistance patterns from 46.06% in 2006, 27.3% in 2007, 19.1% in 2008 and 13.2% in 2009. AMP also showed decreasing resistance patterns from 70.1% in 2006, 49.9% in 2007, 23.1% in 2008, and 21.1% in 2009. Resistant patterns for SXT were also decreased from 63.9% in 2006, 43.8% in 2007, 24.3% in 2008, and 24% in 2009. On the other hand CIP showed year wise increased resistant patterns from 16.1% in 2006, 36.1% in 2007, 48.9% in 2008, and 53.9% in 2009 (Table 3).

ESBL production was suspected in isolates showing reduced susceptibility to CRO, CAZ or CTX and was tested for ESBL production using DDST. Only three isolates, one in each year from 2006-2008 out of 408 (0.7%) were found to be ESBL producer. No incidence of ESBL production was observed in 2009.

All the 408 MDR isolates were further examined for the presence of fliC gene by PCR by using fliC F and fliC R primers as priming strands and genomic DNA of MDR isolates resulted in the amplification of 363 bp DNA fragments indicating that all the isolates were S. typhi. Three of the representative isolates are shown in (Figure 1A). We also performed PCR by using gyrA F and gyrA R

primers which resulted in the amplification of a DNA fragment of 313 bp in all the isolates (Figure 1B).

796

Mahmood et al. 796

When we performed PCR by using sul2 F and sul2 R primers, a 707 bp DNA fragment was amplified in all the cases reflecting the presence sul2 gene which was responsible for resistance against SXT (Figure 1 C). The presence of tem gene, responsible for resistance against AMP, was demonstrated by the amplification of 311 bp DNA fragments (Figure 1 D) by using tem F and tem R primers. Presence of catP gene is one of the factors responsible for resistance against C in S. typhi isolates. When we performed PCR by using catP F and catP R primers, a DNA fragment of 623 bp was amplified (Figure 1 E) reflecting the presence of catP gene in all the 408 isolates.

DISCUSSION

MDR in S. typhi is a major therapeutic concern and now ESBL emergence in these isolates has constituted a new challenge for physicians treating typhoid fever in developing countries where typhoid fever is endemic. In the present study, decreasing isolation rate, both in S. typhi and MDR S. typhi has been observed. Decreased isolation of S. typhi is assumed to be due to over all improvements in environmental, water and sanitary conditions, public awareness and personal hygiene. It

797

Mahmood et al. 797

Figure 1. Ethidium bromide stained 1% agarose gel demonstrating the PCR amplification of fliC gene, for identification of S. typhi, and various genes responsible for antimicrobial drug resistance.

can also be attributed to withdrawal of first-line anti-typhoid drugs (C, AMP and SXT) for empirical therapy, preventing risk factors for acquiring MDR which includes isolation of patients, short hospital stay, continuous surveillance, controlled and judicial antibiotic use in hospital and ICU (Cassettari et al., 2009). Similar decreasing pattern has been observed in studies conducted in India, Nepal, Kuwait, and USA (Bradford, 2001; Pokharel et al., 2006; Rotimi et al., 2008). Prevalence of MDR S. typhi varies from 0 to 61 % in different parts of the world (Kariuki et al., 2010; Threlfall et al., 2003). Our study demonstrated the presence of 0.7% ESBL producers among MDR S. typhi isolates which is comparable to the studies conducted in Canada, Poland, England, and France where 0-3% ESBL production has been reported in MDR S. typhi (Batchelor et al., 2005; Weill et al., 2004; Mohanty et al., 2006). Since ESBL genes are usually located on mobile genetic elements, the emergence of an ESBL S. typhi may be attributed to exchange of mobile genetic elements.

Increased CIP resistance from 16.1 to 53.9% in MDR S. typhi isolates (Table 3), observed in this study, suggests that efficacy of CIP is unreliable against MDR S. typhi isolates. This reflects the wide spread use or misuse of CIP. Self prescription by patients and incomplete courses of treatment are features contributing to development of resistance to CIP in MDR S. typhi.

REFERENCES

Batchelor M, Hopkins K, Threlfall EJ, Clifton-Hadley FA, Stallwood AD, Davies RH, Liebana E (2005). Bla (CTXM) genes in clinical Salmonella isolates recovered from humans in England and Wales from 1992 to 2003. Antimicrob. Agents Chemother. 49: 1319-1322.

798

Mahmood et al. 798

Bradford PA (2001). Extended-spectrum b β -lactamases in the 21st

century: characterization, epidemiology, and detection of this important resistance threat. Clin. Microbiol. Rev., 14: 933–951.

B u s h K ( 2 0 0 1 ) . N e w β -lactamases in gram-negative bacteria: diversity and impact on the selection of antimicrobial therapy. Clin. Infect. Dis., 32: 1085-1089.

Cassettari VC, Da Selveria IR, Dropa M, Lincopan N, Mamizuka EM, Matté MH, Matté GR, Menezes PR (2009). Risk factors for colonization of newborn infants during an outbreak of extended-s p e c t r u m β -lactamase producing Klebsiella pneumonia in an intermediate-risk neonatal unit. J. Hosp. Infect., 71: 340-347.

Fred CT, Mohammad MJ, Gorton TS, Dembek ZF (1999). Detection and Reporting of Organisms Producing Extended-Spectrum β lactamases: Survey of Laboratories in Connecticut. J. Clin. Micriobiol., 37: 4065-4070.

Gniadkowski M (2001). Evolution and epidemiology of extended spectrum ß-lactamases (ESBL) and ESBL producing microorganisms. Clin. Microbiol. Infect., 7: 597-608.

Goussard S, Courvalin P (1999). Updated sequence information for tem beta-lactamases genes. Antimicrob. Agents Chemother., 43: 367-370.

Hague R (2011). What is the threat from extended spectru m β lactamase-producing organisms in children? Arch. Dis. Child., 96: 325-327.

Kariuki S, Revathi G, Kiiru J, Mengo DM, Mwituria J, Muyodi J, Munyalo A, Teo YY, Holt KE, Robert A, Dougan KG (2010). Typhoid in Kenya Is Associated with a Dominant Multidrug-Resistant Salmonella enterica Serovar Typhi Haplotype That Is Also Widespread in Southeast Asia. J. Clin. Microbiol., 48: 2171 -2176. Le TA, Lejay-Collin M, Grimont PA, Hoang TL, Nguyen TV, Grimont F, Scavizzi MR (2005). Endemic, epidemic clone of Salmonella enterica serovar typhi harboring a single multidrug-resistant plasmid in Vietnam

between 1995 and 2002. J. Clin. Microbiol. 43: 3594-3599. Menezes GA, Harish BN, Khan MA, Goessens WHF, Hays JP (2011). Antimicrobial resistance trends in blood culture positive Salmonella typhi isolates from Pondicherry, India, 2005–2009. Clin. Microbiol.

Infect. Available from: http://onlinelibrary.wiley.com/doi/1 0.111 1/j.1469-0691 .2011 .03546.x.

Mohanty S, Renuka K, Sood S, Das BK, Kapil A (2006). Antibiogram pattern and seasonality of Salmonella serotypes in a North Indian tertiary care hospital. Epidemiol. Infect., 134: 961-966.

Mulvey MR, Soule G, Boyd D, Demczuk W, Ahmed R (2003).

799

Mahmood et al. 799

Characterization of the first extended-spectrum β-lactamase-producing Salmonella isolate identified in Canada. J. Clin. Microbiol. 41: 460– 462.

Parry C (2003). Antimicrobial drug resistance in Salmonella enterica. Curr. Op. Infect. Dis., 16: 467-472. Paterson DL (2006). Resistance in Gram-negative bacteria: enterobacteriaceae. Am. J. Infect. Control, 34: S20-28. Pfaller MA, Acar J, Jones RN, Verhoef J, Turnidge J, Sader HS (2001). Integration of molecular characterization of

microorganisms in a global antimicrobial resistance surveillance program. Clin. Infect. Dis., 32: S156-167. Pokharel BM, Koirala J, Dahal RK, Mishra SK, Khadga PK, Tuladhar NR (2006). Multidrug-resistant and extended-spectrum

β-lactamase (ESBL)–producing Salmonella enterica (serotypes Typhi and Paratyphi A) from blood isolates in Nepal: surveillance of resistance and a search for newer alternatives. Int. J. Infect. Dis., 10: 434–438.

Rasheed JK, AndersonJGJ, Yigit H, Queenan AM, Doménech-Sánchez A, Swenson JM, Biddle JW, Ferraro MJ, Jacoby GA, Tenover FC (2000). Characterization of the extended spectrum β-lactamase reference strain, klebsiella pneumonia K6 (ATCC 700603), which produces the novel enzyme SHV-18. Antimicrob. Agents Chemother., 44: 2382-2388.

Robberts FJL, PC Kohner PC, Patel R (2009). Unreliable Extended-spectrum B-lactamase Detection in the Presence of Plasmid-Mediated Ampc in Escherichia coli Clinical Isolates. J. Clin. Microbiol., 47: 358-361.

Rotimi VO, Jamal W, Pal T, Sovenned A, Albert MJ (2008). Emergence of CTX-M-1 5 type extended-spectrum beta-lactamaseproducing Salmonella spp. in Kuwait and the United Arab Emirates. J. Med. Microbiol., 57: 881–886.

Sambrook J, Fritsch E F, Maniatis T (1989). In: Molecular Cloning: A laboratory manual. Cold Spring Harbor Laboratory Press, NY, USA.

800

Mahmood et al. 800

Su LH, Wu TL, Chia JH, Chu C, Kuo AJ, Chiu CH (2005). Increasing ceftriaxone resistance in Salmonella isolates from a university hospital in Taiwan. J. Antimicrob. Chemother., 55: 846-852.

Threlfall EJ, Fisher IST, Berghold C, Gerner-Smidt P, Tschape H, Cormican M, Luzzi I, Schnieder F, Wannet W, Machado J, Edwards G (2003). Trends in antimicrobial drug resistance in Salmonella enterica serotypes Typhi and Paratyphi A isolated in Europe, 1999-2001. Int. J. Antimicrob. Agents., 22: 487-491.

Tzouvelekis LS, Lukova V, Tassios PT, Fluit AC, Jones RN, Legakis NJ (2003). Resistance to ß-lactams among blood isolates of Salmonella spp. in European hospitals: results from the SENTRY Antimicrobial Surveillance Program 1997-98. Clin. Microbiol. Infect., 9: 149-152.

Weill F X, Demartin M, Tande D, Espie E, Rakotoarivony I, Grimont PA (2004a). SHV-12-like extended-spectrum-beta-lactamase-producing strains of Salmonella enterica serotypes Babelsberg and Enteritidis isolated in France among infants adopted from Mali. J. Clin. Microbiol., 42: 2432-2437.

Weill FX, Perrier-Gros-Claude JD, Demartin M, Coignard S, Grimont PA (2004b). Characterization of extended-spectrum β-lactamase (CTXM-15)-producing strains of Salmonella enterica isolated in France and Senegal. FEMS. Microbiol. Lett., 238: 353–358.

Winokur PL, Canton R, Casellas JM, Legakis NJ (2001). Variations in the prevalence of strains expressing an extended

spectrum β lactamase phenotype and characterization of isolates from Europe, the Americas and the Western Pacific region. Clin. Infect. Dis., 32: S94–103.

Zaki SA, Karande S (2011). Multidrug-resistant typhoid fever: a review. J. Infect. Dev. Ctries, 5: 324-337.