A Registry-based Study of Thyroid Paraganglioma ...erc.endocrinology-journals.org/content/early/2015/01/16/ERC-14... · We performed a multinational population-based study on thyroid

- 1 -

A Registry-based Study of Thyroid Paraganglioma: Histologic and Genetic

Characteristics

Ernst von Dobschuetz, MD,1 Helena Leijon, MD,2 Camilla Schalin-Jäntti MD,3

Francesca Schiavi, PhD,4 Michael Brauckhoff, MD, PhD,5* Mariola Peczkowska, MD,6

Giovanna Spiazzi, MD,7 Serena Demattè MD,8 Maria Enrica Cecchini, MD,8 Paola

Sartorato, MD,9 Jolanta Krajewska, MD,10 Kornelia Hasse-Lazar, MD,10 Katarzyna

Roszkowska-Purska, MD,11 Elisa Taschin, BS, 4 Angelica Malinoc, PhD,12 Lars A.

Akslen, MD PhD,13 Johanna Arola, MD,2 Dariusz Lange, MD,14 Ambrogio Fassina,

MD,15 Gianmaria Pennelli, MD,15 Mattia Barbareschi, MD,16 Jutta Luettges, MD,17

Aleksander Prejbisz, MD,6 Andrzej Januszewicz, MD,6 Tim Strate, MD,1 Birke

Bausch, MD,18 Frederic Castinetti, MD,19 Barbara Jarzab, MD,10** Giuseppe Opocher,

MD,4** Charis Eng, MD, PhD,20** Hartmut PH Neumann, MD12**

1Section of Endocrine Surgery, Clinic of General, Visceral and Thoracic Surgery,

Krankenhaus Reinbek, Academic Teaching Hospital University of Hamburg, Reinbek,

Germany

2Department of Pathology of Helsinki University Central Hospital, Helsinki, Finland

3Division of Endocrinology, Department of Medicine, Helsinki University Central

Hospital, Helsinki, Finland

4Familial Cancer Clinic and Onco Endocrinology, Veneto Institute of Oncology,

IRCCS Padova, Italy

5Department of Endocrine Surgery, University of Bergen, Bergen, Norway

6Department of Hypertension, Institute of Cardiology, Warsaw, Poland

7Endocrinology, Diabetes and Metabolism, University of Verona and Azienda

Ospedaliera Universitaria Integrata Verona, Verona, Italy

Page 1 of 39 Accepted Preprint first posted on 16 January 2015 as Manuscript ERC-14-0558

Copyright © 2015 by the Society for Endocrinology.

- 2 -

8Units of Internal Medicine, Santa Chiara General Hospital, Trento, Italy

9Department of Internal Medicine, General Hospital, Montebelluna, Treviso, Italy

10Department of Nuclear Medicine and Endocrine Oncology, Maria Sklodowska-Curie

Memorial Cancer Center and Institute of Oncology, Gliwice Branch, Gliwice, Poland

11Department of Pathology and Laboratory Diagnostics, Skłodowska-Curie Memorial

Institute of Oncology, Warsaw, Poland

12Section for Preventive Medicine, Department of Nephrology, Albert-Ludwigs-

University, Freiburg, Germany

13Centre for Cancer Biomarkers CCBIO, Department of Clinical Medicine, Section for

Pathology, University of Bergen, Bergen, Norway

14Department of Tumor Pathology, M.Sklodowska-Curie Memorial Cancer Center

and Institute of Oncology, Gliwice Branch, Gliwice, Poland

15Department of Surgical Pathology and Cytopathology Unit, Department of Medicine

DIMED University of Padova

16Department of Pathology, Santa Chiara Regional Hospital, Trento

17Department of Pathology, Marienkrankenhaus, Hamburg, Germany

18Department of Gastroenterology, Albert-Ludwigs-University, Freiburg, Germany

19Department of Endocrinology, La Timone Hospital, Hopitaux de Marseille and

Centre de Recherche en Neurobiologie et Neurophysiologie de Marseille, Aix-

Marseille University, France

20Genomic Medicine Institute, Lerner Research Institute and Taussig Cancer

Institute, Cleveland Clinic, Cleveland, OH, USA

*Michael Brauckhoff died on September 10, 2014. We dedicate this manuscript to his

memory.

**Shared senior authorship

Page 2 of 39

- 3 -

Corresponding author:

Hartmut P.H. Neumann, MD

Department of Nephrology and General Medicine

Albert-Ludwigs-University of Freiburg

Hugstetter Str. 55

79106 Freiburg, Germany

Phone +49 173 3050398

Email: [email protected]

1

Page 3 of 39

- 4 -

Abstract: 2

The precise diagnosis of thyroid neoplasias will guide surgical management. Primary 3

thyroid paraganglioma has been rarely reported. Data on prevalence, 4

immunohistochemistry and molecular genetics in a systematic series of such patients 5

are pending. We performed a multinational population-based study on thyroid 6

paraganglioma and analyzed prevalence, immunohistochemistry and molecular 7

genetics. Patients with thyroid paraganglioma were recruited from the European-8

American-Head-and-Neck-Paraganglioma-Registry. Demographic and clinical data 9

were registered. Histopathology and immunohistochemistry were reinvestigated. All 10

patients with thyroid paraganglioma underwent molecular genetic analyses of the 11

genes SDHA, SDHB, SDHC, SDHD, SDHAF2, VHL, RET, TMEM127, and MAX. 12

Analyses included Sanger sequencing and MLPA for detection of large 13

rearrangements. Of 947 registrants, 8 candidates were initially identified. After 14

immunohistochemical analyses of these 8, 5 (0.5%) were confirmed with thyroid 15

paraganglioma. Immunohistochemistry was positive for chromogranin, synaptophysin 16

and S-100 and negative for calcitonin in all 5 thyroid paragangliomas whereas the 3 17

excluded candidate tumors stained for pan-cytokeratin, a marker excluding endocrine 18

tumors. Germline variants, likely representing mutations, were found in 4 of the 5 19

confirmed-thyroid paraganglioma cases, 2 each in SDHA and SDHB, whereas the 20

excluded cases had no mutation in the tested genes. Thyroid paraganglioma is a 21

finite entity which must be differentiated from medullary thyroid carcinoma, because 22

medical, surgical and genetic management for each is different. Notably, ~80% of 23

thyroid paragangliomas are associated with germline mutations, with implications for 24

additional tumors and a potential risk for the family. As opposed to sporadic tumors, 25

surgical management and extent of resection are different for heritable tumors, each 26

guided by the precise gene involved. 27

Page 4 of 39

- 5 -

Word count: 249 28

Introduction 29

Neuroendocrine tumors of the thyroid gland are rare, and virtually all are medullary 30

thyroid carcinoma (Ferri, et al. 2009). Paragangliomas of the head and neck are 31

neuroendocrine neoplasms developing from parasympathetic paraganglia, which 32

occur at skull base and cervical sites, mostly the carotid body and the tympanic, 33

vagal and jugular paraganglia. The inferior laryngeal paraganglia can be located 34

within the thyroid capsule explaining why this tumor might occur in the thyroid gland. 35

Head and neck paragangliomas can occur as sporadic tumors or as a manifestation 36

of familial paraganglioma syndromes type 1-4 (PGL 1 to PGL 4). PGL 1 to PGL 4 are 37

associated with germline mutations of the genes encoding succinate dehydrogenase 38

subunit D, SDHD (PGL 1), SDHAF2 (PGL 2), SDHC (PGL 3), SDHB (PGL 4) and 39

SDHA (PGL 5), the SDHx genes (Boedeker, et al. 2009; Zantour, et al. 2004). 40

Heritable non-SDHx paraganglioma can also occur in tumor syndromes mainly 41

associated with pheochromocytomas as von Hippel-Lindau disease (associated with 42

mutations of the VHL gene), multiple endocrine neoplasia type 2 (RET gene), and 43

neurofibromatosis type 1 (NF1 gene) (Boedeker et al. 2009; Burnichon, et al. 2010; 44

Castro-Vega, et al. 2014; Neumann, et al. 2009; Yang, et al. 2014). In patients 45

carrying germline mutations of the new susceptibility genes FH, PHD1, and PHD2, 46

head and neck paragangliomas have not been reported (Castro-Vega et al. 2014; 47

Yang et al. 2014). Somatic mutations of the HIF2A gene have been reported in 48

abdominal paraganglial tumors but not in head and neck paragangliomas (Toledo, et 49

al. 2013). We therefore sought to determine the frequency and characteristics of 50

thyroid PGL in our population-based European-American-Head-and-Neck-51

Paraganglioma-Registry based in Freiburg, Germany. 52

53

Page 5 of 39

- 6 -

54

Methods 55

56

Patients and data collection 57

We utilized the population-based European-American-Head-and-Neck-58

Paraganglioma-Registry (European-American-HNPGL-Registry) which is based in 59

Freiburg/Germany and has currently 947 registrants. Registration policy has been 60

described in detail previously (Neumann et al. 2009; Neumann, et al. 2004; Schiavi, 61

et al. 2005). Of these 947 registrants with head and neck paragangliomas, only 8 62

carried the initial (working) diagnosis of thyroid paraganglioma. For these 8, we re-63

reviewed registered data for their putative thyroid paraganglioma including 64

demographic information such as age, gender, symptoms, location and size of the 65

tumor, radiological imaging, results from fine needle aspiration cytology and 66

histopathology of the surgical specimens. Tumors were diagnosed as malignant only, 67

if the patients showed metastases (Lloyd RV 2004). 68

69

70

Histology and immunohistochemistry 71

Tumor material from 8 patients who had a working (initial) diagnosis of thyroid 72

paraganglioma were collected and new slides from the paraffin blocks were centrally 73

sectioned and reanalyzed by our internal reference center in the Department of 74

Pathology of the University of Helsinki Central Hospital using conventional H&E 75

histology and immunohistochemistry. The panel of immunohistochemistry included 76

staining against chromogranin A, synaptophysin, S-100, pan-cytokeratin (CK-PAN), 77

calcitonin, thyroid transcription factor 1 (TTF-1), MIB-1 and p53. Slides were 78

processed through deparaffinization in xylene followed by rehydration with graded 79

Page 6 of 39

- 7 -

alcohol series. Endogenous peroxidase was blocked with 0.3% Dako REAL 80

Peroxidase-Blocking Solution. The used antibodies, dilutions and pretreatment are 81

shown in Supplement-Table 1. Detection was done with Dako REAL EnVision/HRP 82

detection system in Autostainer (Labvision Autostainer 480S). Slides were 83

counterstained with Meyer’s hematoxylin and mounted in mounting medium (Fluka, 84

Eukitt Quick-hardening mounting medium). In each immunohistochemical staining 85

run a positive and a negative control were used. Each of the different 86

immunohistochemistry procedures was performed on the same day for all 8 cases 87

and blindly scored by J.A. and H.L. with 100% concordance. 88

These results were compared with those primarily obtained in the participating 89

centers. The diagnosis paraganglioma was newly established according to the 90

criteria of the WHO (DeLellis RA 2004). All patients provided written informed 91

consent. 92

93

Genetic mutation analyses 94

All patients were offered molecular testing for germ-line mutations of the genes which 95

have been reported to cause head and neck paragangliomas: SDHA, SDHAF2, 96

SDHB, SDHC, SDHD, VHL, RET, MAX and TMEM127 (Burnichon et al. 2010; 97

Neumann et al. 2004; Schiavi et al. 2005). In these genes we looked for mutations in 98

all exons except in RET which was analyzed for exons 8, 10, 11, 13-16 only. 99

Mutation screening was not performed in the new candidate genes FH, PHD1, 100

PHD2, and HIF2A (Castro-Vega et al. 2014; Toledo et al. 2013; Yang et al. 2014), 101

because such patients seem to have only extremely seldom head and neck 102

paragangliomas: in addition, HIF2A mutations are typically associated with 103

polycythemia, which was not seen in any of our registrants. Genomic DNA was 104

obtained from EDTA-anticoagulated whole blood. We performed bidirectional Sanger 105

Page 7 of 39

- 8 -

sequencings of the coding regions and splice sites of all genes. In order to find a 106

deletion or duplication of the listed genes we performed MLPA analyses for the VHL, 107

SDHB, SDHC, SDHD, SDHAF2, MAX, and SDHA and semiquantitative multiplex-108

PCR for TMEM127. We did not scan RET for large rearrangements. Primers used for 109

these analyses and PCR conditions are available upon request. To elucidate the 110

extent of large deletions, breakpoints have been located through quantitative real-111

time PCR gene dosage determination, and then characterized by long-range PCR 112

and nucleotide sequencing. The results were subjected to in silico analyses using the 113

programs SIFT, Mutation Taster and PolyPhen-2 in order to predict pathogenicity of 114

the DNA variants. We call likely pathogenic if at least 2 of the 3 software predicts 115

damaging/pathogenic. 116

117

Page 8 of 39

- 9 -

Results 118

119

Prevalence of thyroid paraganglioma 120

As of May 1, 2014, the European-American-HNPGL-Registry based in Freiburg, 121

Germany, comprises 947 registrants. Among these 947 patients, 939 carried the 122

diagnosis of head and neck paragangliomas: 55% had tympanojugular HNPs, 45% 123

had carotid body tumors, 5% had vagal HNPs, and 2% had HNPs with other 124

locations. From the 947 patients, 8 carried the putative diagnosis of thyroid 125

paraganglioma. After comprehensive reanalaysis (described below), three tumors did 126

not meet the WHO criteria of thyroid paraganglioma (see below); thus in the 127

European-American-HNPGL-Registry the prevalence of documented thyroid 128

paraganglioma was estimated to be 0.5% (5/944). 129

130

Patients 131

The 8 patients with the initial working diagnosis of thyroid paraganglioma comprised 132

5 females and 3 males with ages at diagnosis of 27 – 71 (median 40) years. All 133

patients had focal enlargement of the thyroid gland. One had dysphagia. Thyroid 134

ultrasonography revealed tumors of 22 to 60 (median 44) mm in largest diameter. 135

None of the patients had additional neuroendocrine tumors. None of the patients had 136

metastases. Clinical findings are shown in table 1. Family history for paraganglial 137

tumors was positive only in patient (case 1). 138

139

Fine needle aspiration cytology 140

Fine needle aspiration cytology was performed in 5 of the 8 patients. Cytology 141

revealed findings suggesting a “tumor” in 1, an adenoma in 1 and a follicular 142

neoplasia in 3 patients (table 1). 143

Page 9 of 39

- 10 -

144

Treatment 145

All patients had removal of the thyroid tumor. This was done in two patients by 146

hemithyroidectomy and in six patients by total thyroidectomy. 147

148

Histology and immunohistochemistry 149

Histology was studied by hematoxylin and eosin (H&E) stains and 150

immunohistochemistry (IHC) was systematically performed and re-investigated in 151

one of the participating centers (Helsinki). Histology together with 152

immunohistochemistry showed that five of the eight tumors had the characteristics of 153

paragangliomas (figures 1 - 5). By conventional histology, there were cells with 154

diffuse sheet-like patterns of growth or nests (the classic Zellballen). These cells had 155

mostly a clear or basophilic abundant cytoplasm in H&E stain and some variation in 156

nuclei. These cells represent chief cells. The mitotic rate was low. Around the sheets 157

or nests of chief cells, there were cells which represent sustentacular cells. Between 158

tumor cells, there were highly vascularised fibrous septa. Immunohistochemistry of 159

all these five tumors revealed chief cells positive for the neuroendocrine markers 160

chromogranin A and synaptophysin. Sustentacular cells were positive for S-100. CK-161

PAN, TTF-1 and calcitonin were also investigated and were negative in all primary 162

thyroid paragangliomas. Both the histology and immunohistochemical profile was 163

consistent with the WHO classification of tumors (DeLellis RA 2004). 164

The proliferation marker MIB-1 was low, between 3-5% in all five thyroid 165

paragangliomas and p53 was negative, which did not point to a mutation in this 166

tumor-suppressor gene. 167

Three cases (cases A, B, and C in tables 1, 2 and 3) that were initially included in the 168

study as thyroid paragangliomas were exluded because of their 169

Page 10 of 39

- 11 -

immunohistochemical profile (figures 6 – 8). All these cases stained positive with CK-170

PAN, a marker which would exclude paraganglioma The tumor of patient A is only 171

positive for CK-PAN which makes the immunohistochemical diagnosis of an epithelial 172

neoplasia. The tumor of patient B is a medullary thyroid carcinoma or a metastasis of 173

a neuroendocrine tumor. The tumor of patient C is a metastasis of a neuroendocrine 174

carcinoma or a calcitonin-negative medullary thyroid carcinoma. A summary of the 175

immunohistochemistry results are shown in table 2. 176

177

Molecular genetics and family history 178

All 8 patients were analyzed for 9 known paraganglioma-predisposition genes with as 179

part of this study. The three cases that were excluded as thyroid paragangliomas, 180

were found not to carry any germline mutations in the 9 genes. Four of the 5 patients 181

with confirmed thyroid paragangliomas were found to have germline DNA variants 182

which likely represent mutations (table 3). 183

In the first confirmed thyroid paraganglioma case, the youngest of our series at 27 184

years at the diagnosis, the mutation was known from a relative carrying the germline 185

DNA variant SDHB c.664G>A p.Arg177His. This family consisted of 10 members and 186

one unrelated wife (1st generation). Of the 10 relatives, there were 8 mutation carriers 187

and 2 members in whom the mutation is not present (figure 9). Six mutation carriers, 188

had paragangliomas or pheochromocytomas. Among these 6 are the 27year old 189

patient with thyroid paraganglioma (III.1) and the first symptomatic patient of this 190

family (II.1) who presented with metachronic bilateral pheochromocytoma. One 80-191

year old mutation carrier had computerized tomography of the neck, chest and 192

abdomen with normal results. One 14 year old mutation carrier was so far not 193

investigated. The 2 relatives without mutations were not operated for any tumor. In 194

silico analyses for this variant segregating with disease was called deleterious by the 195

Page 11 of 39

- 12 -

SIFT program, disease causing by the Mutation Taster program, and possibly 196

damaging by the PolyPhen-2 program. Together, the in silico analyses and the 197

segregation of mutation and phenotype in the pedigree make the germline variant 198

very likely pathogenic. The phenotypic data are in accordance to the well known 199

reduced penetrance of tumors in subjects carrying mutations of the SDHB gene. 200

The second case (case 2) was a 43 year old male who was found to have a complex 201

rearrangement, consisting of a partial deletion of intron 2 and exon 3 of the SDHB 202

gene and an Alu insertion (Alu family Yb8) (figure 10). The latter mutation has not 203

been reported so far. There is no additional patient with paraganglial tumors known in 204

the family of this case. 205

Two additional patients, 36 and 37 years old at diagnosis, had germline DNA variants 206

of the SDHA gene. In silico analyses called both variants deleterious by SIFT, 207

disease-causing by Mutation Taster and probably damaging by PolyPhen2. Thus, 208

these two DNA variants are very likely mutations rather than polymorphisms (table 209

3). Family history was negative for paraganglial tumors in these two patients. 210

The blood DNA variants detected in cases 1, 3 and 4 are shown in figure 11. The 4 211

patients who likely are carriers of germline mutations were the 4 youngest of this 212

series. 213

214

Postoperative and longterm follow-up 215

Plasma and 24-hour urine catecholamines or metanephrines were measured in all 5 216

patients with confirmed thyroid paraganglioma, preoperatively in 1 and 217

postoperatively in 4, and all measurements revealed normal results. In addition, 218

whole body nuclear medicine investigation using 131I-metaiodobenzylguanidine 219

scintigraphy (in 3 cases), 111In somatostatin receptor scintigraphy (in 2 cases), 18F-220

flurodihydroxyphenylalanine positron emission tomography (PET) (in 1 case) and 221

68Ga-DOTANOC PET/CT (in 1 case) were postoperatively normal. After a median 5 222

Page 12 of 39

- 13 -

years of follow up of the patients with confirmed thyroid paraganglioma, none has 223

been shown to have developed metastases. Case 4 is noteworthy as a 37 year old 224

female patient with SDHA c.1799G>A p.Arg600Gln who was diagnosed with a 225

recurrent/relapsed tumor in the thyroid bed 12 years after thyroidectomy for thyroid 226

paraganglioma. The recurrent tumor was histologically proven to be a paraganglioma 227

again. 228

229

Discussion 230

In the European-American-HNPGL-Registry, the prevalence of confirmed thyroid 231

paragangliomas was 0.5% prevalence, of which all but one are very likely to carry 232

germline mutations in SDHx genes. Despite the expertise and experience of our 233

registry and associated investigators, only 5 of the 8 initially identified putative thyroid 234

paragangliomas turned out to be confirmed thyroid paragangliomas, based on 235

immunohistochemical re-analyses and re-review. 236

The diagnosis of a paraganglioma in the thyroid gland is a challenge. In our series, 237

preoperative reports of fine needle cytology which was performed in 3 cases were 238

not suspicious in any case for paraganglioma, but showed atypical cells as seen in 239

follicular neoplasias or adenomas (table 1). Other thyroid neoplasias easily mistaken 240

for thyroid paraganglioma include and included follicular and papillary carcinoma as 241

well as non-paraganglial neuroendocrine neoplasias, chief of which is medullary 242

thyroid carcinoma (Zantour et al. 2004), (Skiadas, et al. 2001; Yano, et al. 2007; Yu, 243

et al. 2013). As illustrated by our study, the most important clinical investigation to 244

differentiate thyroid paraganglioma from other histologies is immunohistochemistry. 245

We reviewed the literature finding 48 available case reports (Armstrong, et al. 2012; 246

Basu and Viswanathan 2011; Capel 2012; Castelblanco, et al. 2012; Costinean, et al. 247

2012; Evankovich, et al. 2012; Kieu, et al. 2012; Mohyuddin, et al. 2013; Phitayakorn, 248

et al. 2011; Yu et al. 2013). Similar to our cases, true thyroid paragangliomas are 249

Page 13 of 39

- 14 -

characterized by immunohistochemical positive staining for chromogranin A (30 of 30 250

investigated tumors/cases), synaptophysin (21/21), S-100 (27/28) and neuron 251

specific enolase (18/18). Equally importantly, thyroid paragangliomas stain negative 252

for calcitonin (38/38), carcinoembryonic antigen (CEA, 20/20), thyroglobulin (22/22), 253

for thyroid transcription factor 1 (TTF-1, 15/16) and cytokeratin (17/17). Indeed, these 254

data form the basis for the WHO classification of endocrine tumors for 255

paragangliomas in general: paragangliomas stain positive for antibodies against 256

chromogranin A (the marker for neuroendocrine tumors) in all and S-100 (the marker 257

for sustencular cells of paragangliomas) as well as synaptophysin in nearly all, but 258

negative for calcitonin (the marker for medullary thyroid carcinoma), thyroglobulin 259

and cytokeratin in all cases (DeLellis RA 2004). Interestingly, 2 of our paraganglioma 260

patients are male which is exceptional in the reviewed literature (Armstrong et al. 261

2012; Basu and Viswanathan 2011; Capel 2012; Castelblanco et al. 2012; Costinean 262

et al. 2012; Evankovich et al. 2012; Kieu et al. 2012; Mohyuddin et al. 2013; 263

Phitayakorn et al. 2011; Yu et al. 2013). 264

Of our 5 confirmed thyroid paraganglioma patients, 4 were found to carry very likely 265

germline mutations in SDHx. In contrast, none of the 3 patients who eventually 266

turned out to have non-paraganglioma thyroid tumors (cases A, B and C, table 1, 267

figures 6, 7 and 8) were found to have germline mutations in the 9 known 268

pheochromocytoma-paraganglioma-related genes. In addition to 269

immunohistochemistry, therefore, germline genetic analysis could be helpful in 270

differentiating thyroid paraganglioma from other types of thyroid neoplasms that 271

mimic this histology. 272

Thyroid paraganglioma is a rare entity with about 60 cases that are reported, 273

including our series (Armstrong et al. 2012; Basu and Viswanathan 2011; Capel 274

2012; Castelblanco et al. 2012; Costinean et al. 2012; Evankovich et al. 2012; Ferri 275

Page 14 of 39

- 15 -

et al. 2009; González Poggioli, et al. 2009; Kieu et al. 2012; LaGuette, et al. 1997; 276

Mohyuddin et al. 2013; Phitayakorn et al. 2011; Varsavsky, et al. ; Yano et al. 2007; 277

Yu et al. 2013). A major question is whether the rare entity of thyroid paraganglioma 278

is of practical clinical relevance. Our series shows that this diagnosis dictates specific 279

treatment and so, the consequences regarding correct treatment are obvious: one 280

female patient was primarily diagnosed with a papillary thyroid carcinoma. 281

Consequently the patient was subjected to radio-iodine radiation. Only her tumor 282

relapse 12 years later led to the identification of a paraganglioma, hence making the 283

retrospectic diagnosis of a primary thyroid paraganglioma and not papillary thyroid 284

carcinoma. From an outcomes point of view, it is important to know that thyroid 285

paraganglioma may show local invasive growth but confirmed metastases is 286

extremely rare (Massaioli, et al. 1979; Mohyuddin et al. 2013). 287

Finally it has to be emphazised that we found in most patients with thyroid 288

paraganglioma germline DNA variants which very likely represent germline 289

mutations. This opens avenues for genetic family screening and preventive medicine. 290

Patients with germline mutations of the SDHB gene, as found in two of our patients, 291

may display adrenal, retroperitoneal, pelvic or thoracic paragangliomas or 292

metachronous head and neck paragangliomas such as carotid glomus tumors 293

(Haegert, et al. 1974; Hughes, et al. 1997), which may become malignant, and have 294

therefore to undergo lifelong high risk clinical surveillance (Neumann et al. 2004). 295

Similar risk profiles will be identified once statistically sufficient patients with 296

mutations of the SDHA gene are available. 297

In summary, our systematic, population-based series of thyroid paraganglioma 298

demonstrates that thyroid paraganglioma is an important entity to be differentiated 299

from other thyroid tumors, mainly medullary thyroid carcinoma, despite its prevalence 300

of about 0.5% in HNPs, because clinical management are vastly different. The fact 301

Page 15 of 39

- 16 -

that the genetic load of thyroid paraganglioma is seemingly 80% is also significant 302

with implications for both patient management and family members. 303

304

Word count: 2690 305

306

Declaration of interest: 307

I declare that there is no conflict of interest that could be perceived as prejudicing the 308

impartiality of the research reported. 309

310

Funding: 311

Please detail all of the sources of funding relevant to the research reported in the 312

following format: 313

This work was supported by: 314

A grant from the Deutsche Krebshilfe (Grant 107995 to HPHN), a grant from the 315

Sondra J. and Stephen R Hardis Endowment (to CE) and a grant of the Arthur Blank 316

Foundation, Atlanta, GA, USA (to CE). 317

318

319

References: 320 Armstrong MJ, Chiosea SI, Carty SE, Hodak SP & Yip L 2012 Thyroid 321

paragangliomas are locally aggressive. Thyroid 22 88-93. 322

Basu S & Viswanathan S 2011 Primary paraganglioma of thyroid presenting as 323

solitary thyroid mass. J Cancer Res Ther 7 385-387. 324

Boedeker CC, Erlic Z, Richard S, Kontny U, Gimenez-Roqueplo A-P, Cascon A, 325

Robledo M, de Campos JM, van Nederveen FH, de Krijger RR, et al. 2009 Head and 326

Page 16 of 39

- 17 -

Neck Paragangliomas in Von Hippel-Lindau Disease and Multiple Endocrine 327

Neoplasia Type 2. J Clin Endocrinol Metab 94 1938-1944. 328

Burnichon N, Briere JJ, Libe R, Vescovo L, Riviere J, Tissier F, Jouanno E, 329

Jeunemaitre X, Benit P, Tzagoloff A, et al. 2010 SDHA is a tumor suppressor gene 330

causing paraganglioma. Hum Mol Genet 19 3011-3020. 331

Capel 2012 Paraganglioma cervical simulando nodulo tiroideo con afectation del 332

nervio recurrente. Endocrinol Nutr 59 274-275. 333

Castelblanco E, Gallel P, Ros S, Gatius S, Valls J, De-Cubas AA, Maliszewska A, 334

Yebra-Pimentel MT, Menarguez J, Gamallo C, et al. 2012 Thyroid paraganglioma. 335

Report of 3 cases and description of an immunohistochemical profile useful in the 336

differential diagnosis with medullary thyroid carcinoma, based on complementary 337

DNA array results. Hum Pathol 43 1103-1112. 338

Castro-Vega LJ, Buffet A, De Cubas AA, Cascon A, Menara M, Khalifa E, Amar L, 339

Azriel S, Bourdeau I, Chabre O, et al. 2014 Germline mutations in FH confer 340

predisposition to malignant pheochromocytomas and paragangliomas. Hum Mol 341

Genet 23 2440-2446. 342

Costinean S, Balatti V, Bottoni A, Old M, Croce C & Wakely PE, Jr. 2012 Primary 343

intrathyroidal paraganglioma: histopathology and novel molecular alterations. Hum 344

Pathol 43 2371-2375. 345

DeLellis RA 2004 Paraganglioma. In Pathology an Genetics. Tumours of the 346

endocrine organs. World Health Organization Classification of Tumours Pathology 347

and Genetics of Tumours of Endocrine Organs, p 117. Ed LR DeLellis RA, Heitz PU, 348

Eng C. Lion: IARC Press. 349

Page 17 of 39

- 18 -

Evankovich J, Dedhia RC, Bastaki JM, Tublin M & Johnson JT 2012 Primary 350

sclerosing paraganglioma of the thyroid gland: a case report. Ann Otol Rhinol 351

Laryngol 121 510-515. 352

Ferri E, Manconi R, Armato E & Ianniello F 2009 Primary paraganglioma of thyroid 353

gland: a clinicopathologic and immunohistochemical study with review of the 354

literature. Acta Otorhinolaryngol Ital 29 97-102. 355

González Poggioli N, López Amado M & Yebra Pimentel M 2009 Paraganglioma of 356

the Thyroid Gland: A Rare Entity. Endocrine Pathology 20 62-65. 357

Haegert DG, Wang NS, Farrer PA, Seemayer TA & Thelmo W 1974 Non-chromaffin 358

paragangliomatosis manifesting as a cold thyroid nodule. Am J Clin Pathol 61 561-359

570. 360

Hughes JH, El-Mofty S, Sessions D & Liapis H 1997 Primary intrathyroidal 361

paraganglioma with metachronous carotid body tumor: report of a case and review of 362

the literature. Pathol Res Pract 193 791-796; discussion 797-799. 363

Kieu V, Yuen A, Tassone P & Hobbs CG 2012 Cervical paraganglioma presenting as 364

thyroid neoplasia. Otolaryngol Head Neck Surg 146 516-518. 365

LaGuette J, Matias-Guiu X & Rosai J 1997 Thyroid paraganglioma: a 366

clinicopathologic and immunohistochemical study of three cases. Am J Surg Pathol 367

21 748-753. 368

Lloyd RV TA, Kimura N, McNicol AM, Young WF 2004 Adrenal tumors. In Pathology 369

an Genetics. Tumours of the endocrine organs World Health Organization 370

Classification of Tumours, pp 137-138. Ed LR DeLellis RA, Heitz PU, Eng C Lyon: 371

IARC Press. 372

Page 18 of 39

- 19 -

Massaioli N, Balbo G, Fausone G & Negro D 1979 Paraganglioma branchiomerico 373

endotiroideo (non cromaffine). Descrizione di un caso clinico. Minerva Chir 34 867-374

874. 375

Mohyuddin N, Ferrer K & Patel U 2013 Malignant paraganglioma of the thyroid gland 376

with synchronous bilateral carotid body tumors. Ear Nose Throat J 92 E20-23. 377

Neumann HP, Erlic Z, Boedeker CC, Rybicki LA, Robledo M, Hermsen M, Schiavi F, 378

Falcioni M, Kwok P, Bauters C, et al. 2009 Clinical predictors for germline mutations 379

in head and neck paraganglioma patients: cost reduction strategy in genetic 380

diagnostic process as fall-out. Cancer Res 69 3650-3656. 381

Neumann HP, Pawlu C, Peczkowska M, Bausch B, McWhinney SR, Muresan M, 382

Buchta M, Franke G, Klisch J, Bley TA, et al. 2004 Distinct clinical features of 383

paraganglioma syndromes associated with SDHB and SDHD gene mutations. Jama 384

292 943-951. 385

Phitayakorn R, Faquin W, Wei N, Barbesino G & Stephen AE 2011 Thyroid-386

associated paragangliomas. Thyroid 21 725-733. 387

Schiavi F, Boedeker CC, Bausch B, Peczkowska M, Gomez CF, Strassburg T, Pawlu 388

C, Buchta M, Salzmann M, Hoffmann MM, et al. 2005 Predictors and prevalence of 389

paraganglioma syndrome associated with mutations of the SDHC gene. Jama 294 390

2057-2063. 391

Skiadas PK, Kakavoulis TN & Gikonti IJ 2001 Normalisation of blood pressure and 392

heart rate after excision of a thyroid paraganglioma. Eur J Surg 167 392-394. 393

Toledo RA, Qin Y, Srikantan S, Morales NP, Li Q, Deng Y, Kim SW, Pereira MA, 394

Toledo SP, Su X, et al. 2013 In vivo and in vitro oncogenic effects of HIF2A 395

Page 19 of 39

- 20 -

mutations in pheochromocytomas and paragangliomas. Endocr Relat Cancer 20 396

349-359. 397

Varsavsky M, Cortes Berdonces M, Alonso G, Garcia Martin A & Munoz Torres M 398

2011 Adenopatia metastasica de un microcarcinoma tiroideo, diagnostico final de un 399

supuesto paraganglioma. Endocrinol Nutr 58 143-144. 400

Yang C, Zhuang Z, Fliedner SM, Shankavaram U, Sun MG, Bullova P, Zhu R, 401

Elkahloun AG, Kourlas PJ, Merino M, et al. 2014 Germ-line PHD1 and PHD2 402

mutations detected in patients with pheochromocytoma/paraganglioma-polycythemia. 403

J Mol Med (Berl). 404

Yano Y, Nagahama M, Sugino K, Ito K & Kameyama K 2007 Paraganglioma of the 405

thyroid: report of a male case with ultrasonographic imagings, cytologic, histologic, 406

and immunohistochemical features. Thyroid 17 575-578. 407

Yu BH, Sheng WQ & Wang J 2013 Primary paraganglioma of thyroid gland: a 408

clinicopathologic and immunohistochemical analysis of three cases with a review of 409

the literature. Head Neck Pathol 7 373-380. 410

Zantour B, Guilhaume B, Tissier F, Louvel A, Jeunemaitre X, Gimenez-Roqueplo AP 411

& Bertagna X 2004 A thyroid nodule revealing a paraganglioma in a patient with a 412

new germline mutation in the succinate dehydrogenase B gene. Eur J Endocrinol 151 413

433-438. 414

415

416

417

418

Page 20 of 39

- 21 -

419 420

Page 21 of 39

- 22 -

Tables 421

422

Table 1 423

Clinical findings in 8 patients who entered the registry with the diagnosis of thyroid 424

paraganglioma. 425

The diagnosis paraganglioma was confirmed in 5 patients (1-5) and excluded in 3 426

patients (A-C) by this study. 427

“Initial diagnosis” was revised after some weeks until 12 years (last column), but 428

always years before entering the registry. 429

430

Table 2 431

Results of immunohistochemistry performed in this study 432

433

Table 3 434

Results of Mutation Screening 435

4 patients had blood DNA variants in the genes SDHA or SDHB. 436

n.a.= not applicable 437

Further explanations of abbreviation on request 438

439

440

Page 22 of 39

- 23 -

Figure legends 441

442

Figure 1 443

Immunochemistry of case 1: H&E, Chromogranin, Synaptophysin, S-100, CK-PAN, 444

Calcitonin, TTF-1 and internal control for CK-PAN. Note positive staining of the tumor 445

for Chromogranin and Synaptophysin, of sustenticular cells by S-100. The internal 446

control for CK-PAN shows positive staining of epithelial cells. 447

448

Figure 2 449


Calcitonin and TTF-1. Note positive staining of the tumor for Chromogranin and 451

Synaptophysin, of sustenticular cells by S-100. Negative staining are shown for CK-452

PAN, Calcitonin and TTF-1. 453

454

Figure 3 455





460

Figure 4 461





466

Page 23 of 39

- 24 -

Figure 5 467





472

Figure 6 473

Immunochemistry of case A: H&E, Chromogranin, Synaptophysin, S-100, CK-PAN, 474

Calcitonin and TTF-1. Note positive staining for CK-PAN and negative staining for 475

Chromogranin, Synaptophysin, S-100, Calcitonin and TTF-1. 476

477

Figure 7 478

Immunochemistry of case B: H&E, Chromogranin, Synaptophysin, S-100, CK-PAN, 479

Calcitonin and TTF-1. Note positive staining for CK-PAN, but also for Chromogranin, 480

Synaptophysin and TTF-1. Staining for S-100 is negative, and staining for Calcitonin 481

shows only very few positive cells. 482

483

Figure 8 484

Immunochemistry of case C: H&E, Chromogranin, Synaptophysin, S-100, CK-PAN, 485

Calcitonin and TTF-1. Note positive staining for CK-PAN, but also for Chromogranin 486

and Synaptophysin. Staining for S-100, Calcitonin and TTF-1 are negative. 487

488

Figure 9 489

Pedigree of the family with the mutation SDHBc.530G>A (p.Arg177His) (family of 490

case 1): Family members highlighted in blue are mutation carrier whereas those in 491

white have been excluded to carry the mutation. Patient III.1 is the patient with 492

Page 24 of 39

- 25 -

thyroid paraganglioma. Patient II.1 was diagnosed with bilateral pheochromocytoma 493

at the age of 18 and 35 years. Patients II.2 and II.3 had bilateral carotid body tumors 494

at age of 45 and 42 respectively. Patient II.4 had thoracic paraganglioma at age 40. 495

Patient II.5 had an extraabdominal paraganglioma at age 33. Patient I.1 had CT of 496

the neck, thorax and abdomen at age 80 with normal results. Patient III.3 is 14 year 497

old boy and awaiting clinical investigations. 498

499

Figure 10 500

Genomic sequence and electropherogram of the SDHB genomic rearrangment of 501

case 2: the genomic sequence of intron 2 and exon 3 (in bold) are shown in the 502

figure, in italicus are shown the intronic repeat masker (AluSz and AluJb). In red is 503

highlighted the deleted region and in green the inserted segment (AluYb8sequence) 504

with its polyA tail. 505

Long Range -PCR was used to amplify the deleted region and produced a ~1,1kb 506

mutant product compared to the ~2.5kb wild type genomic sequence, predicting a 507

deletion of ~1,4kb; bidirectional sequencing of the mutant PCR product, confirmed 508

the partial deletion of intron 2 and of exon 3 and showed the insertion of ~150bp 509

corresponding to AluYb8 sequence (shown in the figure). 510

511

Figure 11: 512

Electropherograms of SDHB and SDHA sequence variants identified in cases 1, 3 513

and 4 514

515

516

517

518

Page 25 of 39

Tab 1

Case Age Sex Paraganglioma

confirmed

Benign /

Malignant Symptoms Hypertension

Preoperative

Ultrasonography

Fine Needle

Biopsy before

1st Operation

Initial Diagnosis Treatment based

on first Diagnosis

Diagnosis

Paraganglioma

made

1 27 male yes ben relative tested as

SDHB positive no no not done PGL

hormone

substitution after 1st Operation

2 32 male yes ben node in the neck no yes adenoma PGL hormone


3 36 female yes ben node in the neck no no not done hemangiopericytoma hormone

substitution after 3 years

4 37 female yes ben lump in the neck no yes follicular

neoplasia follicular thyroid cancer radio iodine after 12 years

5 71 female yes ben swallowing difficulties yes yes follicular

neoplasia PGL

hormone


A 42 female no mal no no yes not done PGL hormone


B 67 female no ben incidental finding no yes follicular

neoplasia PGL

hormone


C 69 male no ben swallowing difficulties no yes suspicious for

a tumor

neuroendocrine tumor,

PGL radio iodine after some weeks

Page 26 of 39

Table 2

Case Chromogranin A Synaptophysin S-100 Calcitonin TTF1 CytokeratinPAN Diagnosis

1 positive positive positive negative negative negative Thyroid

paraganglioma


praganglioma


praganglioma


paraganglioma


parganglioma

A negative negative negative negative negative positive No

paraganglioma

B positive positive negative a few positive

cells positive positive

No

paraganglioma

C positive positive

negative

(a few

positive

cells)

negative negative positive No

paraganglioma

Page 27 of 39

Case Gene

RefSeq

nucleotide variation and

predicted effect on protein protein domain

public databases pathogenicity clues (in silico analysis)

dbSNP ESP HGMD Alamut software

Case 1 SDHB

NM_003000.2 c.530G>A p.Arg177His 4Fe-4S ferredoxin-type

rs150437793

(MAF: T=0.000/0)

Eur. Am.: T=0.00%

Afr. Am.: T=0.02%

CM130559

pathogenic phenotype:

Phaeochromocytoma

Highly conserved nucleotide (phyloP: 0.84 [-5.2;1.1])

Highly conserved amino acid, up to Baker's yeast

(considering 14 species)

Small physicochemical difference between Arg and His

(Grantham dist.: 29 [0-215])

Align GVGD: C25 (GV: 0.00 - GD: 28.82)

SIFT: Deleterious (score: 0, median: 4.07)

MutationTaster: disease causing (p-value: 1)

Polyphen-2 HumDiv: possibly damaging - score 0.611

(sensitivity: 0.87; specificity: 0.91

Polyphen-2 HumVar: benign - score 0.380 (sensitivity: 0.85;

specificity: 0.79)

Case 2 SDHB

NM_003000.2 c.201-1339_239delinsAluYb8 p.?

not reported in

literature

Case 3 SDHA

NM_004168.2 c.394T>C p.Trp132Arg FAD binding domain

not reported in

literature




Moderate physicochemical difference between Trp and Arg


Align GVGD: C65 (GV: 0.00 - GD: 101.29)



Polyphen-2 HumDiv: probably damaging - score1.000

(sensitivity: 0.00; specificity: 1.00)

Polyphen-2 HumVar: probably damaging - score 0.998


Case 4 SDHA

NM_004168.2 c.1799G>A p.Arg600Gln

Fumarate

reductase/succinate

dehydrogenase

flavoprotein-like,

C-terminal

rs112656

(MAF: A=0.014/31)

Eur. Am.: T=0.00%

Afr. Am.: T=0.00%

not reported in

literature




Small physicochemical difference between Arg and Gln


Align GVGD: C35 (GV: 0.00 - GD: 42.81)



Polyphen-2 HumDiv: probably damaging - score1.000


Polyphen-2 HumVar: probably damaging - score 0.999


Page 28 of 39

Page 29 of 39

Page 30 of 39

Page 31 of 39

Page 32 of 39

Page 33 of 39

Page 34 of 39

Immunochemistry of case B: H&E, Chromogranin, Synaptophysin, S-100, CK-PAN, Calcitonin and TTF-1. Note positive staining for CK-PAN, but also for Chromogranin, Synaptophysin and TTF-1. Staining for S-100

is negative, and staining for Calcitonin shows only very few positive cells.

254x190mm (72 x 72 DPI)

Page 35 of 39

Page 36 of 39

Page 37 of 39

NM_003000.2: c.201-1339_239delinsAluYb8Chr1(GRCh38):g.17033107_17034484delinsAluYb8

tagcaaaggtttttaaagcttccaattcccagtgttagcagaggtccagcagaaaggacgtctacatagtgctgatacaaatacagataatgggccagacgcagtcgctcacacctgtaatcccagcatttgggaaggctgaggcaggtggatcacttgaggtcaggagtttgagaccagcctggccaacatgggaaaacctatctctactaaaaatacaaaaatttgccgggtgtggtg||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||GGTCAGGAGTTTGAGACCAGCCTGGCCAACATGGGAAAACCTATCTCTACTAAAAATACAAAAATTTGCCGGGTGTGGTG

gcatgcacctgtaatcccagctactcgggaggctgaggcaggagaatcgcttgaacccggaaggtagaggttgcagtgag||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | | ||| ||||||||||GCATGCACCTGTAATCCCAGCTACTCGGGAGGCTGAGGCAGGAGAATGGCGTGAACCCGGGAAGCGGAGCTTGCAGTGAG

ccgagatcgcaccattgcctcacacccataatcccaacactttgagaatccaaggcaggaggatcacttgagtccaggag ||||||| | ||| ||| CCGAGATTGCGCCACTGCAGTCCGCAGTCCGGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAAAAAAAAAAAAAAAAA

ccgagatcgcaccattgcctcacacccataatcccaacactttgagaatccaaggcaggaggatcacttgagtccaggagttagagaccagcctgggcaacatggcgaaatcccacctctacaaaaaaatacaaaaattaagctggatgtggtggcacatacctgtagtcccagctactggggggctgaggcaggaggatctcttgaggctgggatgcggaggttacagatctgagatcgtgccactgcactccagcctgggtaacagagcaagaccccgtctcaagaaaaaaaagaaaaaaaatgaaatacagatagtactaaaggaaatgacgtatttttaagtatatttttaatctcatgcatagaaaattagtgagtggaatgggggcagggtggcaaccagaaaatagatttgtggagcacttactgtatgccaggtactatgaaaaattacatatttttatgtaattttcacagtaaccctgtggtgtaaatattaactctacagataaactgaggttcagagagtaatttccgtagaatcacagtttctgcatgatgattattatagttaaactatgatttatatgtcagatgctgctgtaaagatctcgtgtgtattaactcacctccagcaatcctgtgggatgcaggtgctgctctctgcactcagtggattaaatgcctaggcagaaattaaatcatttgcctgcaagctggtaagtggctcagccatggtgcagaccagtctcttggctgccaggccggcactccaggtcccacgcccagggatgctccgcttagtaccatgtcactgcccttgtatgttctaggaggctcacagtgatttgactgggggactgtgagtgattgggtgtcttttattctctgtactatgtcttctcttatggttatgtattattaattactatttaaaactattgtctacatcctaaaaatcaaactaaaatttgaaataaattatttggaaaaactttgcagggagcttcagaagtaaaaaacaaaaactcggccactgtatggaagttgtgtcatacttgtctactactactttagctttccatttcctagaaatgtgtttgcactgtgatcatcaaaatagaactgtgcagtacttaaaatgtaagaatctgcaaaaacaaaactacagaacaaattccgaaggtgacctgagaagaccaaatggataagctaatacatccaggtgtctccgattatattatgataaagtgtagggaggttgaacgttacataaataccactggatatttttctttgttagATGTGGCCCCATGGTATTGGATGCTTTAATCAAGATTAAGAATGAAGTTGACTC

TACTTTGACCTTCCGAAGATCATGCAGAGAAGgtgagcatttcattcctgttgggctccagatacttgtggtcttccaaa

gaggcttgggctggccaaagctgatagagacatctggaaaacagctgcagctctctgctgggtgaacttgctgtgcaacctaattccttttcttgggtaaatgcatccaaaattctaaccatggtgcaagttctggtttctgagtttactttccttcaggagcattctatcctgtggttactgcatctggcggtccctgtgagctgctccacgcttcaaggcctagctaggacctgctgg

deleted regioninserted region (AluYb8)(bold) sdhb exon 3

Page 38 of 39

Page 39 of 39

Documents

A Registry-based Study of Thyroid Paraganglioma ...erc.endocrinology-journals.org/content/early/2015/01/16/ERC-14... · We performed a multinational population-based study on thyroid