Upload
others
View
3
Download
0
Embed Size (px)
Citation preview
The Pennsylvania State University
The Graduate School
Intercollege Graduate Degree Program in Plant Biology
A RAPID AUXIN-INDUCED INCREASE IN CYTOSOLIC Ca2+ IS UNIQUE TO THE
GROWING ARABIDOPSIS ROOT TIP AND AFFECTS TRANSCRIPTIONAL RESPONSE
TO AUXIN
A Thesis in
Plant Biology
by
Cody L. DePew
© 2013 Cody L. DePew
Submitted in Partial Fulfillment
of the Requirements
for the Degree of
Master of Science
December 2013
The thesis of Cody L. DePew was reviewed and approved* by the following:
Gabriele B. Monshausen Assistant Professor of Biology Thesis Advisor
Kathleen Brown Professor of Plant Stress Biology
Dawn Luthe Professor of Plant Stress Biology
Teh-Hui Kao Professor of Biochemistry and Molecular Biology Chair, Intercollege Graduate Degree Program in Plant Biology
*Signatures are on file in the Graduate School
iii
ABSTRACT
Various tissues respond to auxin in a wide variety of ways. This physiological response
specificity is partially due to tissue-specific differences in gene expression. In the growing root
tip, application of auxin rapidly inhibits cell expansion. A rapid transient increase in cytosolic
Ca2+ concentration ([Ca2+]cyt) as a response to global auxin exposure was monitored via laser
scanning confocal microscopy of a genetically-encoded FRET based biosensor. This response is
present in cells located in the growing root tip, particularly in epidermal cells of the elongation
zone. The response is specific to this region and not detectable in other tissues, such as the mature
root, hypocotyl, lateral root cap, and columella. In the growing root tip, transcriptional regulation
of a subset of auxin-induced genes displays Ca2+ dependence based on treatment with the
pharmacological Ca2+ channel blocker La3+. To learn more about the extent of this regulation
using an unbiased approach, RNA sequencing was performed on these samples revealing
approximately 1400 auxin-induced genes, half of which were Ca2+-dependent. Quantitative PCR
revealed that the La3+ effect on auxin-induced gene expression was absent in tissues that lack a
Ca2+ response. This potential Ca2+-dependent gene expression, in combination with the tissue-
specific cytosolic Ca2+ response, may play a role in the specificity of the auxin-induced growth-
inhibition of the growing root tip.
iv
TABLE OF CONTENTS
LIST OF FIGURES .................................................................................................................. vi
LIST OF ABBEREVIATIONS ................................................................................................ viii
ACKNOWLEDGEMENTS ..................................................................................................... ix
Chapter 1 Introduction ............................................................................................................ 1
Auxin and the Growing Root ........................................................................................... 1 Perception and Specificity of the Auxin Response .......................................................... 5
Chapter 2 Materials and Methods ........................................................................................... 9
Plant Material and Growth Conditions ............................................................................. 9 Fluorescence Microscopy ................................................................................................. 9 Arabidopsis Tissue Collection and RNA Extraction ........................................................ 10 qRT-PCR .......................................................................................................................... 12 RNA Sequencing of Arabidopsis Transcriptome ............................................................. 13 RNA Sequencing Data Analysis ...................................................................................... 13 Promoter Analysis ............................................................................................................ 14 Functional Enrichment Analysis ...................................................................................... 15 Analysis of Growth Profile of Roots Exposed to Auxin .................................................. 15
Chapter 3 Spatial Distribution of Rapid Cytosolic Ca2+ Increases in Response to Auxin Treatment ......................................................................................................................... 17
Introduction ...................................................................................................................... 17 Auxin-Induced [Ca2+]cyt Changes in the Epidermis of the Root Central Elongation
Zone .......................................................................................................................... 19 Auxin Does Not Elicit Detectable [Ca2+]cyt Changes in Cells of the Root Cap and
Mature Root .............................................................................................................. 24 [Ca2+]cyt is Constant in the Growing Hypocotyl ............................................................... 28 Discussion ........................................................................................................................ 30
Chapter 4 Analysis of Ca2+-Dependent Auxin-Regulated Gene Expression in the Growing Root Tip ............................................................................................................ 32
Introduction ...................................................................................................................... 32 Initial Investigations in Ca2+-Dependent Auxin-Regulated Gene Expression ................. 33 Analysis of RNA Sequencing Data .................................................................................. 37 RNA Sequencing Reveals Ca2+-Dependent Auxin-Regulated Gene Expression ............. 41 Analysis of cis-Elements Involved in Ca2+-Dependent Auxin-Regulated
Transcription ............................................................................................................. 47 Discussion ........................................................................................................................ 48
Chapter 5 Tissue Specificity of Ca2+-Dependent Auxin-Regulated Gene Expression ........... 50
v
Introduction ...................................................................................................................... 50 Ca2+-Dependent Auxin-Regulated Gene Expression in the Mature Root ........................ 50 Ca2+-Dependent Auxin-Regulated Gene Expression in Aerial Tissues ........................... 53 WRKY46 and Auxin-Induced Root Growth Inhibition ................................................... 56 Discussion ........................................................................................................................ 58
Bibliography ............................................................................................................................. 60
Appendix A Quantitative RT-PCR Primers ............................................................................ 66
Appendix B Selected RNA Sequencing Results ..................................................................... 67
Genes most highly upregulated by IAA ........................................................................... 67 Genes most highly downregulated by IAA ...................................................................... 69 Genes most highly upregulated by IAA in a Ca2+-dependent manner ............................. 71 Genes most highly downregulated by IAA in a Ca2+-dependent manner ....................... 73
Appendix C Gene Ontology Enrichment Analysis ................................................................. 76
By biological process ....................................................................................................... 76 By cellular component ..................................................................................................... 77 By molecular function ...................................................................................................... 77
vi
LIST OF FIGURES
Figure 1-1: Model for auxin signaling by the TIR1-Aux/IAA co-receptor. ....................... 7
Figure 3-1: Spatiotemporal characteristics of rapid auxin-induced root growth inhibition. ........................................................................................................................ 18
Figure 3-2: Auxin-induced cytosolic [Ca2+] changes in the epidermis of the Arabidopsis root central elongation zone. ..................................................................... 22
Figure 3-3: Cytosolic [Ca2+] of entire Arabidopsis root elongation zone following exposure to 1 µM IAA. ................................................................................................... 23
Figure 3-4: Cytosolic [Ca2+] of Arabidopsis columella and lateral root cap cells following exposure to 1 µM IAA. .................................................................................. 25
Figure 3-5: Weak changes in cytosolic [Ca2+] appear approximately 80 µm from the Arabidopsis root apex following exposure to 1 µM IAA. ............................................ 26
Figure 3-6: Cytosolic [Ca2+] of mature epidermal cells of Arabidopsis roots following exposure to 1 µM IAA. ................................................................................................... 27
Figure 3-7: Cytosolic [Ca2+] of Arabidopsis hypocotyl epidermal cells following exposure to auxin. ........................................................................................................... 30
Figure 4-1: Auxin-induced change in cytosolic [Ca2+] of Arabidopsis epidermal cells in the root central elongation zone is unaffected by 5 days of phosphate starvation. ........................................................................................................................ 34
Figure 4-2: Preliminary qRT-PCR gene expression data indicates Ca2+-dependent auxin regulation of gene expression in the growing root tip. ..................................... 36
Figure 4-3: Bowtie2 paired read alignment lengths used to determine mean and standard deviation mate pair distance for Tophat alignment. ................................... 40
Figure 4-4: RNA sequencing and quantitative real-time PCR display similar gene expression patterns. ........................................................................................................ 43
Figure 4-5: Gene ontology enrichment analysis visualization of Ca2+-dependent auxin-regulated genes. ................................................................................................... 44
Figure 5-1: Effect of La3+ on auxin-regulated gene expression in the root tip and mature root. .................................................................................................................... 51
Figure 5-2: Effect of La3+ on auxin-regulated gene in seedling aerial tissue. .................... 54
vii
Figure 5-3: Short-term effect of La3+ on auxin-regulated gene expression of WRKY46 and coexpressed genes in the root tip. ........................................................ 57
viii
LIST OF ABBEREVIATIONS
[Ca2+]cyt – cytosolic calcium ion concentration
1-NAA – 1-naphthaleneacetic acid
ABP1– AUXIN BINDING PROTEIN 1
AFB – AUXIN F-BOX PROTEIN
ARF – AUXIN RESPONSE FACTOR
Aux/IAA – auxin/indole-3 acetic acid inducible genes
bp – base pairs (of nucleic acids)
CaM – calmodulin
CAMTA1 – CALMODULIN-BINDING TRANSCRIPTION ACTIVATOR 1
cDNA – complementary DNA produced from mature mRNA
CFP – CYAN FLUORESCENT PROTEIN
CPK – Ca2+-dependent protein kinase
DNA – deoxyribonucleic acid
ERF – ETHYLENE RESPONSE FACTOR
FRET – fluorescence resonance energy transfer
GFP – GREEN FLUORESCENT PROTEIN
HM – Hoagland plant growth medium
IAA – indole-3-acetic acid
PAMP – pathogen associated molecular pattern
PP2AA3 – PROTEIN PHOSPHATASE 2A SUBUNIT A3
qRT-PCR – quantitative real-time polymerase chain reaction
RNA – ribonucleic acid
ROS – reactive oxygen species
rRNA – ribosomal ribonucleic acid
TIR1 – TRANSPORT INHIBITOR RESPONSE 1
YC3.6 – YELLOW CHAMELEON 3.6
YFP – YELLOW FLUORESCENT PROTEIN
ix
ACKNOWLEDGEMENTS
Any expression of gratitude regarding this thesis would be woefully incomplete were it
not to begin with my advisor Dr. Gabriele Monshausen whose passion and dedication to research
are nothing short of amazing. Through this entire experience, her commitment to me as a mentor
has been unwavering.
I wish to thank my committee members Drs. Kathleen Brown and Dawn Luthe. This
thesis would mean nothing without their support. In addition, Dr. Teh-Hui Kao, Director of the
Plant Biology Graduate Program, has been a prominent figure in my experience at Penn State
since the beginning.
I would like to thank my colleagues and mentors with whom I have shared this room that
feels so much like home: Dr. Desirée denOs, the future Dr. Han-Wei Shih, and Dr. Cheng Dai.
Additionally, several undergraduate students have been remarkably helpful: Chris Mann, Jaspreet
Singh, and Melin Kanasseril.
I would like to acknowledge Dr. Desirée denOs for providing the evidence of rapid
auxin-induced growth inhibition used in this thesis and Dr. Nathan Miller for developing the
software to visualize it so beautifully.
This experience would have been impossible were it not for the funding that has
supported me through tuition, stipend, and research expenses from the Plant Biology Graduate
Program, Penn State University, and the National Science Foundation.
Outside of the lab and university, I have the remarkable good fortune of being surrounded
by people whose love and support is, to me, a constant source of amazement. First and foremost I
would like to thank Matt Kremke, whose presence has been instrumental in this and so many
aspects of our collaborative life. I am grateful for my parents Dan and Loretta DePew, as well as
the rest of my family, for providing me with the foundations of everything in my life. Their
x
support has been unconditional. Finally, I wish to express my deepest gratitude for Meidō
Barbara Anderson for helping me make sense out of this whole situation.
This thesis truly belongs to all of these people. I have been lucky beyond words for all of
the support I have received during these few short years.
1
Chapter 1
Introduction
Auxin and the Growing Root
As sessile organisms, plants regulate their orientation in space through directional
growth. As early as 1880, Charles Darwin predicted the presence of a mobile “influence” that
allows communication between sites of stimulus perception and tissues that undergo differential
growth in order to change a plant’s growth direction (Darwin and Darwin, 1880). This
“influence” has since been identified as the auxin indole-3-acetic acid, or IAA (Abel and
Theologis, 2010). Beyond the tropic effects originally attributed to auxin, it plays an important
role in many biological processes such as cell expansion in roots, stems, coleoptiles (Perrot-
Rechenmann, 2010), leaves (Keller, 2007), and stamen filaments (Cecchetti et al., 2008);
maintenance of the root meristem (Blilou et al., 2005); lateral root initiation (DeSmet et al.,
2007); vascular development (Scarpella et al., 2010); shoot apical meristem patterning (Bowman
and Floyd, 2008); apical dominance and shoot branching (Stirnberg et al., 2010); and embryo
organization (Benjamins and Scheres, 2008).
Auxin inhibits cell expansion in the root (Perrot-Rechenmann, 2010), which allows for
the control of directional growth upon the spatial redistribution of auxin flow. Influx and efflux
transporters with tissue-specific expression patterns and asymmetric subcellular localization
maintain the tightly regulated movement of auxin (Feraru and Friml, 2008). Members of three
protein families are involved in these auxin movements: the AUXIN/LIKE-AUXIN1
(AUX1/LAX) auxin influx permeases, several B-type ATP-binding cassette (ABCB) transporters,
and the PIN-FORMED (PIN) efflux carriers (Yang et al., 2006; Noh et al., 2001; Palme and
2
Galweiler, 1999). In particular, there is evidence that the polar localization of PIN transporters
plays a crucial role in the directional control of auxin fluxes (Feraru and Friml, 2008). Normally,
auxin flows rootward through the stele to the root cap/columella where it is laterally redistributed
to the lateral root cap before moving shootwards through the root epidermis, eventually flowing
back inward to the stele (Muday and Rahman, 2008). Changes in the local auxin concentration of
elongating cells as a result of auxin flux regulation allow for changes in growth patterns.
These growth effects consist of a variety of physiological and transcriptional responses
that can be observed at different times following auxin treatment (Badescu and Napier, 2006). In
grass coleoptiles, ion fluxes and membrane voltage changes that occur almost immediately are
followed by activation of MAPK pathways and growth promotion. Additionally, early auxin-
response genes are induced within minutes, only to be replaced minutes or hours later by genes
with delayed induction (Badescu and Napier, 2006). Though specific responses to auxin vary by
tissue, the temporally dynamic aspect of these responses is likely similar in other tissues.
Root growth is inhibited by auxin exposure before resuming normal growth after
approximately one to three hours (Ishikawa and Evans, 1993). While it is still unclear precisely
how auxin regulates growth in roots, auxin responses can occur very rapidly. This growth
inhibition is extremely rapid, as cell elongation begins to diminish within seconds of exposure to
IAA (denOs and Monshausen, unpublished.). A transient change in cytosolic calcium ion
concentration ([Ca2+]cyt), extracellular pH, and an oxidative burst of reactive oxygen species
(ROS) are also observed within seconds of this response (Monshausen et al., 2011; Monshausen
et al., 2009). This Ca2+ response is also present in gravistimulated roots. A wave of increased Ca2+
is observed in the cells of the lower side of a horizontally oriented root and travels at the speed of
auxin transport (Monshausen et al., 2011).
In contrast to the root, the hypocotyl experiences rapid growth promotion following auxin
treatment (Perrot-Rechenmann, 2010). This response appears to be independent of known auxin-
3
signaling mechanisms, since it occurs normally in mutants of known transcriptional auxin
receptors (Schenck et al., 2010). This has been largely explained by the acid growth theory (Rayle
and Cleland, 1970). Exposure to auxin enhances proton extrusion via the plasma membrane H+-
ATPase, resulting in a decrease in apoplastic pH (Moloney et al., 1981). In the acidic cell wall
environment, pH sensitive wall-loosening proteins are activated and lead to cellular expansion
(Cosgrove, 2000). H+-ATPase phosphorylation has been implicated in the rapid auxin-induced
growth promotion of the hypocotyl (Takahashi et al., 2012).
Auxin-dependent ROS production is also believed to play a role in auxin-induced growth
responses. Rapid increases in ROS may rigidify and strengthen the cell wall through oxidative
crosslinking of cell wall components during inhibition of cell elongation (Kerr and Fry, 2004). In
fact, tip growth is immediately inhibited in root hairs treated with exogenous ROS (Monshausen
et al., 2007). ROS treatment has also been shown to play a role in gene expression (Torres et al.,
2002). This may be due to the activity of transcription factors known to localize to the nucleus
following changes in cellular redox state (Wrzaczek et al., 2013).
Both cell wall alkalinization and the oxidative burst are Ca2+-dependent, as they do not
occur when cytosolic Ca2+ increases are blocked with the pharmacological Ca2+ channel blocker
La3+ (Monshausen et al., 2011 and unpublished data). Furthermore, roots grown in the absence of
Ca2+ show decreased auxin-induced growth inhibition that is restored upon the addition of Ca2+
(Hasenstein and Evans, 1986). These data point to an important role for Ca2+ in the rapid growth
inhibition induced by auxin.
Ca2+ is one of the most ubiquitous second messengers in cell signaling and is involved in
a variety of plant signaling pathways including response to biotic and abiotic stresses, mechanical
perturbation, and hormones (Dodd et al., 2010). High concentrations of Ca2+ are known to
precipitate phosphates and organic acids, which may adversely affect cellular function. Therefore,
it is theorized that cells have evolved mechanisms to maintain a very low concentration of free
4
Ca2+ within the cytosol (~10-7 M in most cell types) to avoid this danger. Control of Ca2+
concentration is mediated by active sequestration to cellular compartments or extrusion by plasma
membrane transporters, establishing electrochemical gradients that can be used to drive the
movement of Ca2+ into the cytosol. Ca2+-permeable ion channels facilitate this influx, resulting in
a rapid increase of [Ca2+]cyt. In cell signaling, it is essential that Ca2+ channel activity be strictly
regulated to maintain precise control over the timing and duration of [Ca2+] elevation. It is
speculated that these Ca2+ “signatures” encode information that can be translated into a diverse
range of stimulus-specific responses (McAinsh and Pittman, 2009).
When receptor-mediated signaling activates Ca2+ channels, Ca2+ sensor proteins bind Ca2+
to link Ca2+ signals to changes in cellular activity. Several families of Ca2+ sensors are known to
participate in plant signaling by binding target proteins [calmodulin (CaM) and calmodulin-like
proteins] or phosphorylating them [Ca2+-dependent protein kinases (CPKs), Ca2+/calmodulin-
dependent protin kinases (CCaMK) and calcineurin-B link proteins (CBLs) that function in
concert with CBL-interacting protein kinases (CIPKs)]. The target proteins of these Ca2+ sensors
translate Ca2+ signaling information into changes in cellular activity (Dodd et al., 2010).
Observation of cell signaling following the perception of pathogen-associated molecular
patterns (PAMPs) or mechanical perturbation has demonstrated the ability of [Ca2+]cyt elevation to
trigger protein phosphorylation, reactive oxygen species (ROS) generation, pH fluctuations, and
altered gene expression (Segonzac and Zipfel, 2011; Monshausen et al., 2009). In Arabidopsis,
mutation of multiple CPK proteins (cpk5 cpk6 cpk11) resulted in decreased PAMP-induced gene
expression and ROS production, indicating a direct mechanistic link between these Ca2+-
dependent responses and the initial rapid PAMP-induced Ca2+ response (Boudsocq et al., 2010).
Experiments with Arabidopsis ROS signaling mutants suggest that Ca2+-dependent ROS
generation may play its own important role in the regulation of defense signaling (Torres et al.,
2002).
5
In addition to these indirect links between Ca2+ responses and gene expression, Ca2+ or
CaM are known to modulate the activity of some transcriptional proteins directly or through
CDPK activity. Repression of one of these proteins [CALMODULIN-BINDING
TRANSCRIPTION ACTIVATOR 1 (CAMTA1)] results in an increased auxin sensitivity during
hypocotyl elongation (Galon et al., 2010b). These mechanisms provide potential links between
the initial rapid auxin-induced Ca2+ signal and the growth inhibition observed in the root tip. The
results of this Ca2+ signaling can be seen in both the direct physiological response (of growth rate)
and potential downstream gene regulation. Because transcriptional changes appear later than the
rapid responses described above, transcriptionally mediated inhibition of cell elongation may be
responsible for the sustained growth inhibition observed for several hours following rapid auxin-
dependent growth inhibition
Perception and Specificity of the Auxin Response
Local changes in auxin levels must be perceived by the cell to allow the appropriate
response for each tissue to occur. Corresponding to the diversity of physiological auxin responses
that have been observed in various cell types, microarray experiments have revealed tissue-
specific differences in auxin-induced gene expression (Paponov et al., 2008). It is believed that
these transcriptional differences can be explained by tissue-specific expression of auxin signaling
proteins referred to as the “auxin code” (Pierre-Jerome et al., 2013). This auxin-dependent
transcriptional pathway does not, however, explain the rapid growth effects and ion fluxes
observed virtually immediately following exposure to auxin. The location of these rapid effects
within the plant can also be highly specific and may add another layer to the “auxin code” by
mediating tissue-specific auxin responses.
6
Much progress has been made in understanding auxin-regulated transcription via the
TIR1/AFB-Aux/IAA co-receptor pathway of protein degradation (Figure 1-1; Calderon-
Villalobos et al., 2010). The F-box proteins TRANSPORT INHIBITOR RESPONSE 1 (TIR1)
and AUXIN SIGNALING F-BOX (AFB) form the subunit responsible for the substrate binding
activity of an SCF ubiquitin protein ligase (E3) complex (SCFTIR1) (Kepinski and Leyser, 2005).
As its concentration increases (Figure 1-1B), auxin is bound by the TIR1 receptor of SCFTIR1,
facilitating the interaction between SCFTIR1 and the Aux/IAA (Auxin/Indole-3-acetic acid
inducible genes) transcriptional repressors (Tan et al., 2007). When this interaction occurs, the
Aux/IAA proteins are ubiquitylated by SCFTIR1, resulting in degradation by the 26S proteasome
(Gray et al., 2001). The absence of Aux/IAA repressors allows AUXIN RESPONSE FACTORs
(ARF transcription factors), normally bound to Aux/IAA (Figure 1-1A), to modulate transcription
(Guilfoyle and Hagen, 2007). Depending on the function of specific ARFs, transcription of target
auxin response genes is promoted or inhibited.
Though the mechanism of auxin perception by the TIR1-Aux/IAA co-receptor has been
widely studied, the mechanisms involved in auxin-mediated fast growth responses and ion fluxes
are much less understood. In the more than 30 years following its identification in auxin binding
assays, AUXIN-BINDING PROTEIN 1 (ABP1) has been a candidate in the search for an auxin
receptor involved in rapid auxin-induced signaling events (Hertel et al., 1972). Modulation of
ABP1 expression and activity alters auxin-dependent electrical and growth responses (Tromas et
al., 2010). Furthermore, ABP1 has been detected at the plasma membrane, the likely site of IAA
perception during rapid signaling (Napier et al., 2002). However, there is no direct evidence at
this time connecting ABP1 to the rapid root growth inhibition or Ca2+ signaling observed in
response to auxin.
7
In addition to growth changes and ion fluxes, these rapid responses may also contribute
transcriptionally to the delayed auxin responses generally attributed to the TIR1-Aux/IAA co-
receptor. Investigations of the rapid Ca2+ and Ca2+-dependent responses common to a variety of
signaling events have revealed mechanisms of Ca2+-dependent gene regulation that may also
affect the auxin response. Electrically induced cytosolic Ca2+ changes similar to those seen upon
exposure to auxin were shown to have an effect on gene transcription (Whalley et al., 2011).
Therefore, it is reasonable to speculate that auxin-induced [Ca2+]cyt transient increases may affect
the transcriptional responses of the root. Interactions between the “auxin code” of TIR1 signaling
components and various rapid responses capable of altering gene expression likely vary by cell-
type and may work in concert to define tissue-specific transcriptional responses to auxin.
Figure 1-1: Model for auxin signaling by the TIR1-Aux/IAA co-receptor. (A) At low auxin levels, ARF-dependent transcription of auxin response genes is repressed by the Aux/IAA repressors. (B) At higher auxin levels, the TIR1-Aux/IAA complex is formed and leads to Aux/IAA degradation. Figure borrowed from Calderon-Villalobos et al., 2010.
8
It is well established that the TIR1/AFB-AUX/IAA co-receptor signaling pathway is a
key player in mediating auxin-regulated transcription. The research presented in this thesis aims
to provide evidence that the rapid Ca2+ signaling events observed following auxin treatment in the
root tip also contribute to auxin-regulated gene expression and represent a mechanism to confer
tissue-specificity to transcriptional plant auxin responses. To support this model, three hypotheses
will be tested: First, that the Ca2+ response observed in the root tip is specific to this tissue.
Second, that the Ca2+ response is capable of affecting auxin-regulated transcription. And third,
that this co-regulation is absent in tissues that lack auxin-induced Ca2+ responses.
9
Chapter 2
Materials and Methods
Plant Material and Growth Conditions
Seeds of transgenic Arabidopsis thaliana ecotype Columbia expressing 35s-driven
YELLOW CAMELEON 3.6 [YC3.6] were surface sterilized with 50% (v/v) bleach for 10 min
and planted on petri dishes containing quarter-strength Murashige and Skoog basal salts, pH 5.8,
1% agar, supplemented with 1% (w/v) sucrose. After two days of stratification at 4°C, plates
were germinated under 24-h continuous light conditions at 22°C for 4 d. Seedlings were
subsequently used for Ca2+ imaging experiments
For transcriptomic analysis, seeds of wild-type Arabidopsis thaliana Columbia were
surface sterilized as above and grown in plates underneath a layer of 1.5% agar containing
phosphate-free Hoagland nutrient solution (Hoagland and Arnon, 1950; ammonium chloride was
substituted for ammonium phosphate) supplemented with 1% sucrose. 40-50 seedlings per petri
dish were grown for 5 d under continuous light at 22°C before undergoing experimental treatment
and RNA extraction.
Fluorescence Microscopy
Arabidopsis seedlings expressing the FRET-based Ca2+ sensor cameleon YC3.6 (Nagai et
al., 2004) were transferred to custom-built cuvettes (Wymer et al., 1997) and embedded in 1%
(w/v) agarose containing quarter-strength Murashige and Skoog basal salts, pH 5.8, supplemented
with 1% (w/v) sucrose. After at least 6 h, the agarose covering the tissue of interest was removed
10
and the tissue was covered with quarter-strength Murashige and Skoog liquid medium, pH 5.8,
supplemented with 1% (w/v) sucrose. The cuvette was mounted on the stage of a Zeiss LSM 510
laser scanning confocal microscope (Carl Zeiss, Inc.). The seedling was imaged using a 40X, 1.2
numerical aperture, C-Apochromat objective. The Ca2+ sensor was excited with the 458-nm line
of the argon laser. The CFP (484-505nm) and FRET-dependent (526-537 nm) emissions were
collected by using a 458-nm primary dichroic mirror and the Meta detector of the microscope.
Bright-field images were acquired simultaneously using the transmission detector of the confocal
microscope. Images were collected every 3 s, with each individual image scan lasting 1.97 s.
After 60 s of pre-treatment measurement, an equal volume of liquid nutrient medium with 2X
concentration of the hormone (2 µM IAA and 0.02% EtOH from IAA stock solution) was added.
Acquired images were analyzed using ImageJ (http://rsbweb.nih.gov/ij/) software. The YC3.6
Ca2+ sensor is targeted to the cytosol and also localizes to the nucleus of each cell, but is excluded
from all other organelles (see Figure 3-2B). Ratios of Ca2+-dependent FRET and CFP
fluorescence intensities were quantified in defined regions of interest comprising, where possible,
the entire cytosol and nucleoplasm of a cell. To exclude the large, non-fluorescent vacuole from
analysis, images were masked based on pixel intensity threshold prior to fluorescence
quantification.
Arabidopsis Tissue Collection and RNA Extraction
To investigate the role of Ca2+ in auxin-dependent transcriptional regulation, young
Arabidopsis root tips (apical 1-2 mm), mature regions of roots (3-8 mm) and aerial tissues of
seedlings (hypocotyl with cotyledons and shoot apical meristem) were exposed to one of the
following treatments: (i) 20 min exposure to phosphate-free Hoagland medium (HM; control), (ii)
11
20 min of 0.3 mM LaCl3 in HM, (iii) 20 min of 1 µM IAA in HM, (iv) 3 min of 0.3 mM LaCl3 in
HM followed by 20 min of 0.3 mm LaCl3 with 1 µM IAA in HM.
Root tips: After 5 d of growth underneath agar containing phosphate-free HM, agar was
gently removed from the apical 2mm of the seedling roots and the exposed root tips were
incubated in one of the four experimental solutions described above. Immediately after
incubation, root tips were sectioned and flash-frozen within 1-2 min of sectioning. For each
treatment, frozen root tips from three Petri dishes were pooled for RNA extraction (representing 1
biological replicate). Three biological replicates were obtained for each treatment.
Mature root sections: After 7 d of growth underneath agar containing phosphate-free HM,
agar was gently removed from the apical 10 mm of the seedling roots exposed to the same
treatments as root tips. Immediately after incubation, root tips (1-2 mm from tip) and mature roots
(3-8 mm from tip) from the same plants were sectioned and flash frozen. For each treatment,
frozen root tips from three Petri dishes were pooled for RNA extraction (representing 1 of 3
biological replicates).
Aerial seedling tissues: After 5 d of growth with roots underneath agar containing
phosphate-free HM, entire seedlings were exposed to the same treatments as root tips (with IAA
concentration increased from 1 to 5 µM). Immediately after incubation, aerial tissue (including
hypocotyl, cotyledons, and shoot apical meristem) were sectioned and flash frozen. For each
treatment, frozen tissue from three Petri dishes was pooled for RNA extraction (representing 1 of
3 biological replicates).
RNA was purified using the RNeasy Plant Mini Kit (Qiagen Cat. No.: 74904) and tested
for protein/extraction buffer contamination and concentration on a Nanodrop ND-1000 to ensure
260nm/280nm (protein contamination) and 260nm/230nm (extraction buffer contamination)
ratios greater than or equal to 1.8 or 2.0, respectively. Intactness of RNA was verified through
12
visualization of clearly defined rRNA subunits on a 1% agarose + ethidium bromide gel (not
shown).
RNA used for RNA sequencing was analyzed for integrity on an Agilent 2100
Bioanalyzer. All RNA used in next generation sequencing obtained RNA integrity values above
9.0, indicating the appropriately high quality and minimal degradation necessary for next
generation sequencing.
RNA used for qRT-PCR experiments was treated with DNAse (Fermentas, Cat. No.:
EN0521). First strand cDNA synthesis was performed using SuperScript III First-Strand
Synthesis System for RT-PCR (Invitrogen, Cat. No.: 18080-051). Success of cDNA synthesis
was assessed by PCR amplification of Actin 2/8.
qRT-PCR
Quantitative PCR was performed using a StepOnePlus Real-Time PCR system (Applied
Biosystems) and PerfeCTa SYBR Green FastMix ROX (Quanta Biosciences, Cat. No.: 95073-
250). Relative quantification (ΔΔCt method) was performed using Tubulin and PP2AA3 as
endogenous controls. PP2AA3 was chosen as a control based on its stability during hormone
treatment (Czechowski et al., 2005). Reactions were performed in three technical replicates on
each of the three biological replicates. In quantification calculations, multiple references were
geometrically averaged according to Vandesompele et al. (2001) to minimize the effect of
varying PCR reaction kinetics between multiple reference genes. Relative quantification was
calculated according to Pfaffl (2004) using PCR efficiency values obtained from LinRegPCR to
accommodate differences in PCR reaction conditions capable of affecting expression data
accuracy (Ramakers et al., 2003).
13
RNA Sequencing of Arabidopsis Transcriptome
Library construction of root tip transcriptome and paired end RNA sequencing were
performed by Penn State Genomics Core Facility in University Park, PA on three biological
replicates of each experimental treatment described above. Libraries were prepared using TruSeq
RNA Sample Prep Kit v2 - set A (Illumina, Cat. No.: RS-122-2001), pooled, and sequenced on
two lanes of a HiSeq 2000 (Illumina) (see chapter 4 for further detail).
RNA Sequencing Data Analysis
RNA sequencing reads were mapped and analyzed using Bowtie, TopHat, Cufflinks, and
CummeRbund (Tuxedo suite) as described by Trapnell et al. (2012). Due to differences between
Tuxedo suite defaults and the conditions of this experiment, the following modifications were
included: minimum intron length = 40, maximum intron length = 6000, mate inner distance = -44,
mate standard deviation = 48. Range of Arabidopsis intron lengths varied from defaults based on
animal gene structure. In addition, mate inner distance and standard deviation (see chapter 4),
which depend on mRNA fractionation specific to cDNA preparation kits, were modified to reflect
actual fragment length based on the mapping results of a population of sequencing reads specific
to this experiment, excluding significant outliers. Arabidopsis TAIR10 chromosome sequences
and TAIR10 annotations were obtained from TAIR (ftp://ftp.arabidopsis.org/home/tair/
Sequences/). Genes displaying statistically significant differences in regulation between two
treatments were selected based on an alpha = 0.05 in the CummeRbund analysis software using a
statistical model that assumes the number of reads produced by each transcript is proportional to
its abundance but fluctuates due to technical and biological variation (Trapnell et al., 2012).
14
Of all genes expressed in the root tip, those with significantly different expression levels
between the control and IAA treatments were considered auxin-regulated. The expression levels
of these auxin-regulated genes after IAA treatment were then compared to expression following
exposure to IAA in the presence of the Ca2+ channel blocker La3+ following a 3 min La3+
pretreatment (La3+/IAA treatment) to ensure that Ca2+ channels were inactive at the time of
La3+/IAA treatment. Ca2+-dependent auxin-regulated genes were identified when significant
differences in expression were observed between both control vs. IAA and IAA vs. La3+/IAA
treatments. When the expression level of a Ca2+-dependent auxin-regulated gene was
significantly different between the control and La3+ only treatments, they were disregarded due to
inability to distinguish between the effects of Ca2+ signaling and La3+ alone on expression level.
Promoter Analysis
To identify potential cis-elements, analysis of overrepresented hexamer sequences was
performed on promoter sequences of varying length obtained from Athena (Arabidopsis thaliana
expression network analysis) (O’Connor et al., 2005). Promoters of Ca2+-dependent and non-
Ca2+-dependent auxin-regulated genes were compared using the oligo-diff analysis tool available
at the Regulatory sequence Analysis Tools (RSAT) site (http://rsat.ulb.ac.be/rsat).
The first analysis was performed using all statistically different Ca2+-dependent and -
independent genes to discover the overall differences between the genes belonging to each of
these categories. To locate cis-elements involved specifically in the most drastic differences in
expression, further analysis located conserved promoter sequences that varied between the
calcium-dependent and -independent auxin-regulated genes most highly upregulated from control
treatment following exposure to IAA.
15
Functional Enrichment Analysis
For visual representations of gene ontology (GO), enrichment analysis was performed on
Ca2+ dependent genes using the GOslim_Plant categories of the Cytoscape 2.8
(http://www.cytoscape.org) plugin BiNGO (Maere et al., 2005). Although the simplified
GOslim_Plant categories provide a useful overview of trends in GO enrichment, a more in-depth
enrichment analysis was performed on these same genes using the tool AmiGO, which
distinguishes between the specialized sub-categories represented by the more general
GOslim_Plant categories (http://amigo.geneontology.org/cgi-bin/amigo/term_enrichment) (Boyle
et al., 2004).
Analysis of Growth Profile of Roots Exposed to Auxin
Four to five day old Arabidopsis seedlings were grown on 1% agar plates containing
quarter-strength Murashige and Skoog basal salts, pH 5.8, supplemented with 1% (w/v) sucrose.
At least 12 hours before imaging, plants were transferred to the custom-made cuvettes used for
confocal imaging. To image roots growing in vertical orientation, the cuvettes were transferred to
the stage of a Zeiss Axioplan compound light microscope resting on its back. Images of the
vertically growing root were captured every thirty seconds using a 10X 0.25 NA Achroplan
objective and a Stingray camera (Allied Vision Technologies) controlled by the AVT SmartView
1.8.1 software. Image analysis was performed using the computational infrastructure provided by
the iPlant Collaborative (http://www.iplantcollaborative.org/) and custom-written software
(image processing toolkit version 5; Nathan Miller and Edgar Spalding). The software calculates
root growth velocity profiles by tracking endogenous root surface marks using a local image
registration technique (Lucas and Kanade, 1981). By measuring distances between surface marks
16
and a reference point (the root quiescent center) over time, the velocity at which each marker
point along the root ‘moves away’ from the QC during growth can be calculated. A flexible
logistics function was fitted to data sets to obtain a continuous velocity profile along the root axis
over time (Morris and Silk, 1992). The REGR (relative elemental growth rate; Erickson and
Goddard, 1951) profile was obtained by differentiating the velocity profile.
17
Chapter 3
Spatial Distribution of Rapid Cytosolic Ca2+ Increases in Response to Auxin Treatment
Introduction
As outlined above, plant cells display a wide variety of responses to the hormone auxin.
These responses are highly specific, varying by tissue type and developmental stage. Within the
growing region of the root, it is well known that exposure to auxin leads to inhibition of cell
expansion (Perrot-Rechenmann, 2010). The cumulative expansion of cells within the elongation
zone is responsible for almost all root growth. Interestingly, inhibition of cellular expansion by
auxin occurs very rapidly within the elongation zone. When monitored at a sufficiently high
temporal resolution, roots exhibit a decrease in growth rate almost immediately. Figure 3-1 shows
the REGR pattern (in %/h) for each point along the midline of the root. Higher REGR rates are
displayed as red/orange on the heat plot and represent locations on the root with greater rates of
cell expansion. At t = 0 (vertical white line), the liquid quarter-strength M&S medium (+ 1%
sucrose) surrounding the root was replaced with nutrient medium containing 1 µM IAA. Within
30 seconds, a decrease in strain rate is already evident and continues for the remainder of the
experiment (~12 minutes).
18
As seen in the root growth profile (Figure 3-1), exposure to auxin results in an even
decrease in cellular expansion along the entire elongation zone. Most importantly, this response
begins within seconds. On a similar temporal scale, the elongation zone has been shown to
exhibit an auxin-induced transient increase in [Ca2+]cyt accompanied by a Ca2+-dependent
alkalinization of the cell wall (Monshausen et al., 2001). If this Ca2+ response is involved in auxin
response specificity in the growing root, cells that exhibit other responses to auxin treatment
should not display a Ca2+ increase when exposed to auxin. To test this hypothesis, it is necessary
to measure the [Ca2+]cyt of single live cells at a high temporal resolution.
Non-intrusive live cell imaging of Ca2+ signaling under physiological conditions has
undergone great advancement in recent years. While early approaches relied on the injection of
Figure 3-1: Spatiotemporal characteristics of rapid auxin-induced root growth inhibition. Representative relative elemental growth rate (REGR) profile of growth inhibition by 1 µM IAA; experiment performed by Dr. Desiree denOs. REGR (heat plot, see color scale to right) indicates relative growth rate (in percent per hour) of points along the midline of the root. X-axis indicates time (in minutes) before and after addition of 1 µM IAA. Note that the elongation zone appears steady in the heat plot (high REGR) before exposure to auxin (white vertical line at t=0), after which a virtually immediate decrease in REGR can be observed. Temporal resolution is 0.5 minutes.
19
Ca2+ indicator dyes that damaged cells, a breakthrough was achieved with the discovery of the
genetically encoded Ca2+-dependent luminescent photoprotein aequorin. By creating transgenic
plants stably expressing aequorin, cytosolic Ca2+ concentrations could be measured noninvasively
over time (Knight et al., 1993). Unfortunately, the low intensity of photon emissions from
aequeorin make it impossible to measure the [Ca2+] dynamics of single cells at a high temporal
resolution (Dodd et al., 2006). More recently, the development of Foerster resonance energy
transfer (FRET)-based sensors such as YELLOW CHAMELEON 3.6 (YC3.6) have allowed the
non-invasive measurement of [Ca2+]cyt dynamics within a single cell with a temporal resolution of
seconds (Nagai et al., 2004). YC3.6 is a chimeric fusion protein composed of a short-wavelength
variant of GFP (CFP), calmodulin (CaM), the CaM- binding peptide of Xenopus myosin light-
chain kinase (M13), and a long-wavelength variant of GFP (circularly permutated Venus, or
cpVenus). Upon [Ca2+] increase, Ca2+ binds to CaM, increasing its affinity for M13. This causes a
change in protein conformation that increases the efficiency of FRET from CFP to cpVenus
(Nagai et al., 2004). At elevated [Ca2+]cyt, CFP donor fluorescence decreases and cpVenus FRET
fluorescence increases. During confocal microscopy, the fluorescence emissions from these two
proteins are monitored and used to calculate a [Ca2+]-dependent FRET/CFP ratio that represents
[Ca2+]cyt within the cell.
Auxin-Induced [Ca2+]cyt Changes in the Epidermis of the Root Central Elongation Zone
There is much evidence that Ca2+ signaling plays a role in the auxin-induced root growth
inhibition of the root tip. Auxin-induced [Ca2+]cyt changes can be triggered experimentally by
globally applying exogenous auxin to roots to mimic increases in local auxin concentration along
the growing root (e.g. during gravitropic curvature). Auxin was applied globally to roots in this
manner while monitoring relative [Ca2+]cyt in real time using the biosensor YC3.6 and a confocal
20
microscope. Upon exposure to this treatment, the epidermal cells of the central elongation zone
(~300 µm from tip) (Figure 3-2D) experience a virtually immediate transient increase in [Ca2+]cyt
that returns to near baseline levels in approximately 2 min (Figure 3-2A).
Ethanol solvent controls did not elicit any Ca2+ increase in root epidermal cells under
these conditions (Figure 3-2A). The noticeably lower resting (baseline) FRET/CFP ratio seen in
control measurements was likely due to these experiments being performed at a much later date
than the IAA measurements (Figure 3-2A). In this interval, the confocal microscope had
undergone many adjustments in both hardware and software in addition to possible differences in
plant growth conditions and seed stock over time. In the future, these two treatments should be
performed at the same time to ensure the consistency of the baseline.
Auxin is a weak acid that has the potential to cause cytosolic acidification of root cells.
Such acidification could represent a stress triggering Ca2+ signaling. However, it was previously
shown that 1 uM benzoic acid, a weak acid with a pKa similar to that of IAA, does not trigger any
change in cytosolic Ca2+ levels. The Ca2+ response observed upon treatment with IAA is thus not
an unspecific weak acid effect (Monshausen et al., 2011).
21
22
In addition to the epidermis, all other tissues present in the central elongation zone
showed a similar response when viewed under the same conditions (Figure 3-3A). Over a period
of approximately 1 min, a [Ca2+]cyt response was observed in each successive layer of cells from
the epidermis to the stele at the center of the root. It is currently unknown whether Ca2+ elevation
is triggered by auxin diffusing through the apoplast, intercellularly transported auxin, or direct
propagation of the Ca2+ signal from the epidermis to internal tissues.
Figure 3-2: Auxin-induced cytosolic [Ca2+] changes in the epidermis of the Arabidopsis root central elongation zone. (A) Lines represent the average cytosolic [Ca2+]cyt as YC3.6 FRET/CFP ratios based on laser scanning confocal microscopy. Epidermal cells of the central elongation zone of growing Arabidopsis roots were observed. Images were captured every three seconds. Roots suspended in liquid growth medium were exposed to 1 µM IAA dissolved in 0.1% EtOH (red line) or 0.1% EtOH solvent only (black line) at t=0. Error bars represent standard deviation among 5 replicates. Only cells exposed to IAA (red) responded with a transient increase in [Ca2+]cyt. (B) Representative composite image of merged CFP (excitation) and Venus (FRET) channels showing region of interest (yellow polygon) represented in the above graph. (C) Brightfield image of region of interest. (D) Brightfield image showing location of region of interest along the root axis; ROI was located approximately 300 µm from the root tip. (E) Visual representation of representative auxin-induced Ca2+ response.
23
Figure 3-3: Cytosolic [Ca2+] of entire Arabidopsis root elongation zone following exposure to 1 µM IAA. (A) Lines represent the average cytosolic [Ca2+]cyt as YC3.6 FRET/CFP ratios based on laser scanning confocal microscopy. All distinguishable cell-types of the central elongation zone of growing Arabidopsis roots were observed. Images were captured every three seconds. Roots suspended in liquid growth medium were exposed to 1 µM IAA dissolved in 0.1% EtOH at t=0. One (of three total) representative biological replicate is displayed. (B) Brightfield image of region of interest. (C) Representative composite image of merged CFP (excitation) and Venus (FRET) channels showing regions of interest represented in the above graph for cells of the epidermis (Ep), cortex (C), endodermis (En), and stele (S).
24
Auxin Does Not Elicit Detectable [Ca2+]cyt Changes in Cells of the Root Cap and Mature Root
Auxin traveling from the shoot down the root stele eventually reaches the root tip where
it is laterally redistributed within the cells of the columella, located in the root cap (Muday and
Rahman, 2008). Auxin is transported through the lateral root cap before entering the epidermis
and continuing to travel shootward (Muday and Rahman, 2008). This redistribution is altered in
gravistimulated roots to cause the asymmetric auxin flux needed to drive asymmetric growth to
return roots to their original orientation.
To determine whether the auxin-induced Ca2+ response is specific to the root elongation
zone, the [Ca2+]cyt of the columella and adjacent lateral root cap cells were monitored for evidence
of detectable Ca2+ signaling. The YC3.6 Ca2+ biosensor did not report a change in [Ca2+]cyt
following IAA treatment for either the columella or the lateral root cap (Figure 3-4A).
25
Figure 3-4: Cytosolic [Ca2+] of Arabidopsis columella and lateral root cap cells following exposure to 1 µM IAA. (A) Lines represent the average cytosolic [Ca2+] as YC3.6 FRET/CFP ratios in columella (red) and lateral root cap (black) cells of a growing Arabidopsis root imaged via laser scanning confocal microscopy. Images were captured every three seconds. Roots suspended in liquid growth medium were exposed to 1 µM IAA in 0.1% EtOH at t=0. Error bars represent standard deviation among 5 replicates. None of the cells showed a detectable IAA-induced [Ca2+]cyt
26
As evidenced by the relatively large standard deviations in this experiment, the baselines
varied more in the root tip than any other tissue in this study. The transient [Ca2+]cyt response
appeared weakly at approximately 80 um from the root apex and gradually increased to its full
amplitude in cells of the elongation zone. (Figure 3-5).
In the mature zone of the root, cell elongation ceases and trichoblasts begin to form root
hairs. Despite the fact that the plant no longer needs to regulate elongation rate these tissues still
utilize auxin, most notably in the initiation of lateral roots and growth of root hairs (DeSmet et al.,
2007). At auxin concentrations that trigger changes in [Ca2+]cyt in cells of the elongation zone (1
µM IAA), epidermal cells (Figure 3-6, B-F) located 1, 2, and 3 mm from the root apex (well
within the mature zone) were monitored for changes in [Ca2+]cyt. None of these tissues displayed a
noticeable change in [Ca2+]cyt in response to auxin (Figure 3-6A).
response. (B) Representative compositive image of merged CFP (excitation) and Venus (FRET) channels showing region of interest (yellow polygons) for columella (col) and lateral root cap (lrc) cells represented in the above graph. (C) Brightfield image of region of interest.
Figure 3-5: Weak changes in cytosolic [Ca2+] appear approximately 80 µm from the Arabidopsis root apex following exposure to 1 µM IAA. Visual representation of a representative auxin response in the root tip. Color represents the average cytosolic [Ca2+]cyt as YC3.6 FRET/CFP ratios based on laser scanning confocal microscopy (see key on right). The root tip of growing Arabidopsis roots was observed. Images were captured every three seconds. Roots suspended in liquid growth medium were exposed to 1 µM IAA dissolved in 0.1% EtOH at t=0.
27
Recently, yellow chameleon-Nano (YC-Nano) biosensors were developed with
significantly greater Ca2+ affinity (Horikawa et al., 2010). These sensors may be capable of
Figure 3-6: Cytosolic [Ca2+] of mature epidermal cells of Arabidopsis roots following exposure to 1 µM IAA. (A) Lines represent the average cytosolic [Ca2+] as YC3.6 FRET/CFP ratios in epidermal cells located 1 mm (black), 2 mm (red), and 3 mm (blue) from the root tip of Arabidopsis imaged via laser scanning confocal microscopy. Images were captured every three seconds. Roots suspended in liquid growth medium were exposed to 1 µM IAA in 0.1% EtOH at t=0. Error bars represent standard deviation among 5 replicates. None of the cells showed a detectable IAA-induced [Ca2+]cyt response. (B) Representative composite image of merged CFP (excitation) and Venus (FRET) channels showing region of interest (yellow polygon) for 1 mm from tip represented in the above graph. Similar regions of interest were chosen for 2 mm and 3 mm. (C) Brightfield image of region of interest at 40X objective. 10X brightfield images show location of region of interest for 1 mm (D), 2 mm (E), and 3 mm (F) from tip.
28
detecting more subtle changes in [Ca2+]cyt than YC3.6. Because it is unknown if [Ca2+]cyt
fluctuations of this small magnitude are capable of eliciting the Ca2+-dependent auxin responses
seen in the elongation zone, it will be necessary to perform these experiments in the future.
[Ca2+]cyt is Constant in the Growing Hypocotyl
In contrast to the auxin-induced growth inhibition displayed in the root, the elongation
rate of the growing hypocotyl is increased upon exposure to high IAA levels. Despite this
difference, the root and hypocotyl both display auxin-induced changes in growth rate rapidly. To
investigate the role of [Ca2+]cyt changes in rapid growth responses following auxin treatment in
the hypocotyl, the Ca2+ signaling dynamics of growing cells must be assessed.
In the hypocotyl of 4-d-old light-grown Arabidopsis seedlings, the majority of cell
expansion occurs toward the shoot apex below the cotyledons where the apical hook would be
present in etiolated seedlings (Kutschera and Niklas, 2013). The hydrophobic cuticle of the aerial
tissue complicates experiments involving exogenous application of the polar IAA molecule.
However, intact plants still display auxin-induced hypocotyl growth promotion (Carrington and
Esnard, 1987). Nevertheless, to account for the permeability of the cuticle, the synthetic auxin 1-
naphthaleneacetic (1-NAA) was used at a concentration where growth promotion has been
observed in whole seedlings in previous literature (Benkova et al., 2003). It is possible that the
uncharged 1-NAA more readily diffuses across these hydrophobic barriers than the organic acid
IAA.
Hypocotyl epidermal cells near the shoot apex (Figure 3-7D) were monitored for [Ca2+]cyt
transients upon global application of 1 uM IAA and 10 uM 1-NAA using the Ca2+ sensor YC3.6.
Neither auxin treatment elicited a detectable [Ca2+]cyt response (Figure 3-7A).
29
30
Auxin is also involved in shoot apical meristem patterning (Bowman and Floyd, 2008).
Unfortunately for the purposes of live cell imaging, this tissue is involved in the generation of
new, complex organs that surround and obscure the dividing cells. The confocal microscope laser
was unable to penetrate the plant tissue to the depth required to image the cells of the shoot apical
meristem. In the future, it may be possible to excise the organs surrounding the meristem to
obtain YC3.6 signal and investigate Ca2+ signaling. However, the effect of this drastic wounding
may influence [Ca2+] signatures and auxin sensitivity.
Discussion
Based on confocal imaging of YC3.6 in several tissues known to be responsive to auxin,
only the root elongation zone displayed a rapid, transient increase in [Ca2+]cyt in response to
global application of IAA. Among the wide range of physiological responses to auxin, rapid
inhibition of cell expansion also appears to be specific to this region.
The coincidence of these two phenomena may indicate that they are functionally related.
Furthermore, auxin triggers extracellular alkalinization in the root elongation zone and there is
substantial evidence that this type of alkalinization is downstream of Ca2+ signaling (Monshausen
et al., 2009). This is consistent with the acid growth hypothesis, where alkalinization of the cell
wall would lead to a decrease in cell expansion (Cosgrove, 2000).
Figure 3-7: Cytosolic [Ca2+] of Arabidopsis hypocotyl epidermal cells following exposure to auxin. (A) Lines represent the average cytosolic [Ca2+] as YC3.6 FRET/CFP ratios in Arabidopsis hypocotyl epidermal cells after exposure to 1 µM IAA (red) or 10 µM 1-NAA (black) in 0.1% EtOH at t=0 measured via laser scanning confocal microscopy. Images of roots suspended in liquid growth medium were captured every three seconds. Error bars represent standard deviation among 5 replicates. There was no detectable [Ca2+]cyt response to either treatment. (B) Representitive composite image of merged CFP (excitation) and Venus (FRET) channels showing region of interest at 20X objective. (C) Brightfield image of region of interest at 20X objective. (D) Brightfield and fluorescence composite image at 10X objective showing location of region of interest on hypocotyl near the shoot apex.
31
While such rapid growth inhibition is regulated through post-translational mechanisms,
sustained growth modulation during gravitropic growth or local auxin response likely involves
transcriptional regulation. Microarray experiments to test the effect of gravistimulation for less
than one hour on gene regulation in the growing root revealed 1,730 genes with altered transcript
abundance (Kimbrough et al., 2004). Because rapid auxin-induced Ca2+ signaling is unique to the
elongation zone and likely capable of affecting transcription (Bouche et al., 2002; Whalley et al,
2011), Ca2+-dependent transcription may be one way of fine-tuning the specific auxin response
found in the growing root.
32
Chapter 4
Analysis of Ca2+-Dependent Auxin-Regulated Gene Expression in the Growing Root Tip
Introduction
Because the auxin-induced Ca2+ response introduced in the previous chapter is unique to
the root tip, it may play a role in defining the specificity of the auxin-induced growth inhibition
response. Much of what we currently know about auxin-mediated transcriptional regulation is
based on the TIR1/AFB-Aux/IAA co-receptor pathway, involving repressor protein degradation
(Bouche et al., 2002). This, however, is not the only possible mechanism capable of mediating
transcription. Exposure to auxin is followed by a rapid change in [Ca2+]cyt. Ca2+-dependent
activation by CPK and Ca2+-dependent ROS signaling has been shown to modulate transcription
(Boudsocq et al., 2010; Segonzac and Zipfel, 2011). Several transcription factor families are also
known to bind Ca2+ ions directly or indirectly through the Ca2+ sensor calmodulin, altering their
activity and effect on gene expression (Galon et al., 2010a). These interactions may lead to
transcriptional effects downstream of the Ca2+ response specific to the growing root as described
in the previous chapter.
AUXIN-BINDING PROTEIN 1 (ABP1) is a well-known candidate in the search for an
auxin receptor other than TIR1/Aux-IAA (Hertel et al., 1972). Interestingly, transgenic
Arabidopsis defective in ABP1 activity also show altered auxin-dependent transcriptional
regulation. Following ABP1 inactivation by cellular immunization, the expression of several
auxin-induced Aux/IAA transcripts was rapidly reduced (Tromas et al., 2010). Although the link
between ABP1 and Ca2+-signaling has not yet been characterized, these data are consistent with a
33
link between Ca2+ signaling and gene expression in the tissue-specific auxin response of the
growing root tip.
Initial Investigations in Ca2+-Dependent Auxin-Regulated Gene Expression
To investigate the relationship between auxin-induced Ca2+ changes and auxin-induced
transcriptional responses, Arabidopsis root tips were treated with IAA to monitor auxin-induced
gene regulation. LaCl3 is a Ca2+ channel blocker shown to inhibit auxin-induced [Ca2+]cyt
responses (Monshausen et al., 2011). Gene expression was also measured in plants exposed to
IAA (with La3+) following a short pretreatment with La3+ only. A difference in magnitude of
IAA-induced upregulation of gene expression in the presence of La3+ indicates that auxin-induced
gene expression is dependent upon Ca2+ signaling. Treatment with La3+ only allowed verification
that any differences in gene expression between IAA treatments with or without La3+ were due to
Ca2+-dependent auxin-regulation and not the effects of La3+ alone.
Phosphate ions are precipitated upon the addition of La3+ to normal plant growth nutrient
solutions, resulting in a dramatic acidification (from 5.8 to 3.7 in HM) that is most likely capable
of affecting gene expression. For this reason, phosphate was omitted from all liquid and agar-
containing media for all four treatments. Seedlings were treated while still young (5 d old), before
pronounced phenotypes resulting from phosphorus-deficiency were observed. To ensure that
plants grown in these condition still displayed a normal [Ca2+]cyt increase in response to IAA
treatment, transgenic Arabidopsis expressing the YC3.6 biosensor were imaged to observe Ca2+
signatures. These experiments established that in seedlings grown under phosphorus-free
conditions, IAA treatment induced root [Ca2+]cyt transients similar to those observed in roots
grown in the presence of phosphorus (Figure 4-1A).
34
Figure 4-1: Auxin-induced change in cytosolic [Ca2+] of Arabidopsis epidermal cells in the root central elongation zone is unaffected by 5 days of phosphate starvation. (A) Lines represent the average cytosolic [Ca2+]cyt as YC3.6 FRET/CFP ratios based on laser scanning confocal microscopy. Epidermal cells of the central elongation zone of growing Arabidopsis roots were observed. Images were captured every three seconds. Roots suspended in phosphate-free HM medium were exposed to 1 µM IAA dissolved in 0.1% EtOH at t=0. Error bars represent standard deviation between 2 replicates. Only cells exposed to IAA (red) responded with a transient increase in [Ca2+]cyt. (B) Brightfield image of region of interest. (C) Representative composite image of merged CFP (excitation) and Venus (FRET) channels showing region of interest (yellow polygon) represented in the above graph; ROI was located approximately 300 µm from the root tip
35
Compared to other methods of gene expression analysis, fluorescence-based quantitative
real-time PCR has emerged as a reliable, sensitive, cost-effective method for the quantification of
relative gene expression (Bustin et al., 2010). Using this technology, candidate gene expression
levels following IAA incubation with or without La3+ pretreatment may be capable of providing
evidence for Ca2+-dependent auxin-regulated transcription.
ABP1-dependent genes were chosen as candidates for Ca2+ dependence based on La3+
pretreatment, but their induction by IAA was unaffected (Figure 4-2A). Note that the data
presented in Figure 4 are preliminary and represent one biological replicate with three technical
replicates. They are presented to explain the justification for further experimentation. All
subsequent figures presented consist of three biological replicates and follow the guidelines for
qRT-PCR as described by Bustin et al. (2010).
After this initial failure to observe Ca2+-dependent auxin-regulated gene expression, an
alternate method of candidate gene selection was sought. Artificial [Ca2+] elevations have been
generated in Arabidopsis using electrical stimulation to approximate endogenous Ca2+ responses
(Whalley et al., 2011). Following this stimulus, microarray analysis measured the global
transcriptional effects of a single transient increase in [Ca2+] similar to that observed in response
to auxin. The dataset from this experiment was used to manually select a second set of Ca2+-
dependent auxin-induced gene candidates based on comparison with published auxin-treated
microarray datasets (Paponov et al., 2008).
36
The auxin-dependent expression of two genes appeared strongly reduced by pre-
treatment with La3+ (Figure 4-2B). GA2ox6 expression was significantly upregulated by IAA
(from phosphate-free HM control) in a Ca2+-dependent manner. Control expression was unaltered
Figure 4-2: Preliminary qRT-PCR gene expression data indicates Ca2+-dependent auxin regulation of gene expression in the growing root tip. Five-d-old Arabidopsis seedlings were treated with liquid phosphate-free HM with 1 µM IAA (20 min), 1 µM IAA and 300 µM La3+ (20 min) following a pretreatment (3 min) with 300 µM La3+, and 300 µM La3+ (20 min). Gene expression was analyzed using quantitative real-time PCR. Gene expression values are displayed relative to a buffer only (phosphate-free HM) control. Each data point represents three technical replicates of one biological replicate. Therefore, this data should be considered exploratory. (A) Two ABP1-dependent candidate genes showed no Ca2+-dependence (La3+ pretreatment did not affect auxin-mediated induction). (B) Candidate genes selected based on reported Ca2+-induction exhibited induction by auxin that was significantly attenuated by La3+ pretreatment. P-values (Student’s T-Test) are shown.
37
by La3+ only treatment, while IAA induction was significantly decreased in the presence of La3+.
Control GH3.1 expression was decreased by approximately 50% upon La3+ only treatment. This
effect alone does account for the 80% decrease in IAA induction observed in the presence of
La3+.
Although these data provide evidence for the role of Ca2+ signaling in auxin-induced root
tip gene expression, they are based on the biased selection of candidate genes. Global
transcriptome analysis was used to apply an unbiased approach to the understanding of Ca2+-
dependent auxin-regulated gene expression and reveal novel candidate genes.
Analysis of RNA Sequencing Data
Recent advancements in DNA sequencing technology have allowed millions of bases to
be sequenced at a fraction of the cost of previously available methods. Access to this amount of
data has allowed for the development of experiments that would have been impossible in the past.
One exciting applications of this technology is RNA sequencing of an organism’s entire
transcriptome. Microarrays, another popular method for transcriptomic analysis, are limited to
known genes that can be added to an array. Over time, new transcripts, splice variants, and
improved reference genomes become available. The raw data from RNA sequencing can be
reanalyzed in the future to take advantage of these improvements that may not have been part of
the original experimental design.
Of the many next-generation sequencing technologies available today, the Illumina
platform is one of the most popular. In this study, transcriptomes from three biological replicates
of the four treatments described for qRT-PCR analysis were analyzed on an Illumina HiSeq 2000.
To begin, a cDNA template library was made from total RNA for each treatment. This cDNA,
which represents mature mRNA in both identity and abundance, is fragmented, purified by size,
38
and DNA barcoded for identification by sample. Adaptor sequences are then added to both ends
of each fragment. These adaptors hybridize to immobilized forward and reverse primers on a flow
chip within the instrument; template fragments are then amplified by PCR to create clusters of
identical fragments for enhanced signal through a process called bridge amplification. These
clusters thus contain DNA produced from forward and reverse primers in close proximity of the
original template. This spatial information is used to pair forward and reverse reads for each
fragment. A mixture of dNTPs bound to different fluorophores and modified with reversible
terminators is eluted over the flow chip where images are captured of each cluster. The
wavelength of light emitted from fluorophores reflects which base is added to each cluster one at
a time. After imaging, the fluorescent dye is cleaved, 3’-OH is restored, and the process is
repeated to determine the base pair sequence of amplified fragments for each cluster. This is
repeated for the reverse primer, which produces a second read of the fragment sequence from the
opposite direction (Egan et al., 2012).
At maximal efficiency, the HiSeq 2000 is capable of producing approximately 6 billion
paired reads in about 11 days. In this study, two of seven lanes containing mixed, barcoded
libraries of each sample were used to produce approximately 35 million reads per sample, or a
total of about 420 million reads. There are many ways to analyze next generation sequencing data
and no obvious pipeline has emerged for many applications. However, for transcriptomic
experiments in an organism with an annotated reference genome, such as Arabidopsis, the
Tuxedo suite of tools (e.g. Bowtie, Tophat, Cufflinks, and CummeRbund) provides those who do
not specialize in bioinformatics another method for data analysis (Trapnell et al., 2012).
Analysis begins by mapping the reads (sorted by sample based on sequenced barcodes)
using the program Bowtie. Bowtie efficiently locates read sequences within the reference
genome. However, it is unable to map non-continuous reads in a scenario where mRNA and
genomic DNA reference sequences differ due to intron spicing. To account for this problem
39
Bowtie is coordinated through Tophat, which separates unmapped reads into smaller segments.
These read segments are then individually mapped using Bowtie. Based on this information,
Tophat determines the location of the entire read within the reference genome, as well as the site
of intron splice junctions. The process of mapping paired end reads produces alignments that
represent the original cDNA fragments immobilized on the Illumina chip.
After several rounds of mapping while learning the software, the final transcriptome was
produced using a minimal number of analysis parameters that differed from the Tuxedo suite
defaults (Trapnell et al., 2006). Default intron lengths were based on animal gene models and
were updated to reflect the Arabidopsis reference genome. TAIR10 chromosome sequences and
gene annotations were obtained from The Arabidopsis Information Resource (Arabidopsis.org)
and used for mapping. Upon consultation with the DePamphilis lab, which has great expertise in
next-generation sequencing analysis, it was determined that precise mate pair gap distance values
would result in the most accurate mapping results.
Mate inner distance depends on the size of cDNA fragments obtained from kits used to
create cDNA libraries. On the HiSeq 2000, 100 base pair long reads are produced from each end
of the DNA fragment regardless of fragment length. In fragments that are not exactly 200 base
pairs long, this results in either a gap or overlap between reads. The Tophat default value for this
gap is 50, resulting from fragments 250 base pairs long. Fragments 150 base pairs in length were
purified for this experiment, resulting in an overlap of 50 base pairs. However, the size-based
purification procedure is not exact.
To quantify actual gap distances, a sample population of reads was mapped directly with
Bowtie to determine alignment length. These individual alignment lengths were ranked by size
and graphed to visualize distribution of alignment length. The red line in figure 4-3 shows that
there is a dramatic and sudden increase in alignment length among the few largest alignments.
This most likely represent erroneously mapped reads in distant chromosomal locations, creating
40
the illusion of very large cDNA fragments. The black line (and black scale bar) in figure 4-3
shows only alignments 300 base pairs or smaller in the same data set. This length appeared to be
where the exponential increase in alignment length begins. This subset of alignments was used to
calculate the mean (-44) and standard deviation (48) of the gap distance used by Tophat for
mapping.
The alignments are assembled after mapping to produce a new transcriptome. Past studies
show that the actual transcriptome varies from what is expected based on publically available
reference gene annotations (Trapnell et al., 2011). Alignments from each of the 12 samples are
Figure 4-3: Bowtie2 paired read alignment lengths used to determine mean and standard deviation mate pair distance for Tophat alignment. A selection of reads mapped by Bowtie2 ranked in order of size display a sharp increase in length among a small number of alignments (red line and red scale). These outliers affected the mean and standard deviation significantly. Alignments that were 300 bp or smaller (black line and black scale) were used to calculate the mean and standard deviation mate pair distance utilized by Tophat during initial read mapping of RNA sequencing data.
41
combined using the program Cufflinks to create “transfrags,” or transcriptome fragments. The
transfrags from all 12 samples are merged by the Cufflinks tool Cuffmerge to produce a full
transcriptome specific to this experiment. This transcriptome is annotated to the extent possible
based on known and predicted transcripts available online.
Finally Cuffdiff maps the Tophat alignments to the transcriptome, where the number of
reads per transcript is used to calculate the abundance of each transcript for each of the 12
samples. The program CummeRbund is then used to generate final data sets that include
expression levels and standard deviations for each annotated transcript.
RNA Sequencing Reveals Ca2+-Dependent Auxin-Regulated Gene Expression
The results analyzed in the previous section reveal not only Ca2+-dependent auxin-
regulation, but also the endogenous transcriptional response to auxin in the root tip. A published
microarray assessing short-term gene regulation by auxin in whole seedlings indicates the
expression of at most a few hundred genes to be significantly altered (413 in 30 minutes;
Nemhauser et al., 2004).
Despite the brevity of exposure to 1 µM IAA for 20 minutes, our RNA sequencing
revealed 1,391 genes differentially expressed after auxin exposure (1,112 upregulated and 279
downregulated). Of these genes, nearly half (692) displayed significantly altered expression
following pretreatment with 300 µM La3+. Genes with altered expression upon treatment with
La3+ alone were not included in this list. Of 32,808 Arabidopsis transcripts detected in root tips,
390 were differentially expressed upon a 20-minute exposure to La3+ (236 upregulated and 154
downregulated). The top 100 auxin up- or down-regulated and Ca2+-dependent auxin-regulated
genes are displayed in Appendix B.
42
Many aspects of the overall expression pattern of auxin-induced root tip genes were
similar to what is observed in whole seedlings. Many genes most highly upregulated by auxin in
root tips also appeared among the most auxin-inducible genes in whole seedlings (Nemhauser et
al., 2006). Though expression was generally slightly higher in whole seedlings than root tips
(most likely due to the additional 10 minutes of IAA treatment), the relative induction level of
several highly expressed auxin-induced genes was comparable between these tissues.
Interestingly, many Ca2+ or CaM binding genes and ion transporters that appeared highly
expressed in the root tip were not significantly induced in whole seedlings.
While not an auxin response, the response to fungal pathogens includes a Ca2+ response
similar to that observed upon auxin treatment in the root tip. Interestingly, the transcriptome of 6-
week-old Arabidopsis leaf tissue one hour after infection by Pseudomonas syringae displays
many similarities to the auxin-induced genes of the root tip not shared by whole seedling auxin-
induced data (Howard et al., 2013). These genes included members of CPK, metal transport and
detoxification, cyclic nucleotide gated channel, glutamate receptor, and mannose-binding lectin
protein families.
Overall, the nucleotide sequence of some transcripts revealed by RNA sequencing varied
from predicted gene annotations obtained from the TAIR website. Several genes displayed signs
of alternative splicing and appeared as multiple isoforms. Many single transcripts appeared to
span lengths of the genome that contained several smaller annotated genes. Furthermore, many
genes lacked known functions, annotations, or accession numbers. At this point, there is not much
we can deduce from this. It is evident that there is much more to learn about the contents of the
Arabidopsis genome.
Though increasing in popularity, next generation sequencing is an emerging technology.
Conversely, quantitative real-time PCR is a widely used and trusted method for analysis of gene
expression. To verify the accuracy of RNA sequencing data, the expression levels of two Ca2+-
43
dependent and independent genes were tested using qRT-PCR and compared to the results
obtained via RNA sequencing. Biological replicates differed between these two methods. Though
induction by IAA varied a small amount in some instances, the overall magnitude and trends
between various treatments remained the same (Figure 4-4). This provides confidence that the
results obtained through RNA sequencing are valid, though specific genes of interest must still be
validated by qRT-PCR when studied in greater detail.
Figure 4-4: RNA sequencing and quantitative real-time PCR display similar gene expression patterns. Five-day old Arabidopsis seedlings were treated with liquid phosphate-free HM with (i) 1 µM IAA (20 min), (ii) 1 µM IAA and 300 µM La3+ (20 min) following a pretreatment (3 min) with 300 µM La3+, and (iii) 300 µM La3+ (20 min). Following these treatments, gene expression was analyzed using quantitative real-time PCR and RNA sequencing. Biological replicates differ between methods. Gene expression values are displayed relative to the buffer-only (phosphate-free HM) control. Each data point represents three biological replicates with standard deviation error bars. Both methods display the same relative trends in gene expression for Ca2+-dependent and non- Ca2+ dependent genes.
44
To obtain an overview of the function of Ca2+-dependent auxin-regulated genes, gene
ontology (GO) enrichment analysis was performed using the GOslim_Plant simplified categories
of the Cytoscape 2.8 plugin BiNGO (Maere et al., 2005). The most highly overrepresented
categories included responses to abiotic and biotic stresses and signal transduction via kinases
and transcription factors (Figure 4-5).
Figure 4-5: Gene ontology enrichment analysis visualization of Ca2+-dependent auxin-regulated genes. Gene ontology enrichment analysis generated by the BiNGO plugin of Cytoscape 2.8 for all genes with significantly upregulation by IAA and with IAA induction significantly affected by La3+ pretreatment. Genes with expression significantly altered upon La3+ treatment alone were removed from this list. Enrichment based on a background of all Arabidopsis genes. Color of node represents enrichment significance (p-value, see scale). Size of node represents relative number of categories described by label. Simplified TAIR GoSLIM_plant categories are represented. Categories with p-value > 0.5 are omitted from figure.
45
A more detailed GO enrichment analysis was performed on the same genes in a
background of all Arabidopsis genes using the tool AmiGO, available through TAIR (Boyle et
al., 2004). Though more detailed and specific, these data appeared similar to the significant
GOslim_Plant categories, displaying enrichment of genes involved in abiotic and biotic stress
signaling mostly at the plasma membrane (Appendix C).
Gene ontology enrichment, though an interesting starting point, provides a limited
amount of biologically relevant information. To infer more meaningful information from these
data alone, a more directed approach must be taken. Emerging tools in systems biology allow the
integration of gene regulation data with complex regulatory, biochemical, and interaction
networks to make predictions about cell status based on vast amounts of available network data.
Using this approach, “modules” within a network most affected by altered gene regulation can be
statistically identified and used in the generation of novel hypotheses (Alm and Arkin, 2003).
These relationships are far too complex to manually notice in a table of data as large as one
obtains following RNA sequencing. Unfortunately, this field is still highly specialized and limited
in usefulness to the average researcher. Efforts to apply these techniques to the data presented in
this thesis were unsuccessful. As these methods develop and become more widely available and
user friendly, it may be possible to learn much more from these data than is feasible today. For
now, a candidate gene approach is more favorable and practical.
Because both the Ca2+ response and growth inhibition following auxin treatment are
specific to the root tip, we originally hypothesized that a large number of Ca2+-dependent auxin-
regulated genes would perform functions directly related to growth. It seems that in reality this
effect is subtler. For example, a small number of expansins and cell wall remodeling genes such
as xyloglucanases were represented in the Ca2+-dependent auxin-regulated dataset, but displayed
relatively small expression level changes in response to IAA and La3+.
46
The microarray results of many experiments involving auxin-regulated transcription have
been made publically available. When combined, these results help us understand gene regulation
by auxin across a wide variety of conditions and tissues (Papanov et al., 2008). According to this
research, three main gene families appear to be highly upregulated shortly (less than an hour)
after auxin treatment: the Aux/IAA transcriptional repressors of the TIR1-Aux/IAA coreceptor
pathway, GH3 family proteins involved in regulating active auxin levels, and the small auxin
upregulated RNAs (SAURs) which play a potential role in the regulation of cell elongation
(Spartz et al., 2012). Members of each of these families were differentially expressed following
auxin treatment in both Ca2+-dependent and -independent manners based on the RNA sequencing
experiments performed in this thesis.
Of five GH3 family members upregulated by IAA in this experiment, two (GH3.1 and
GH3.3) were affected by La3+ pretreatment and were among the top 3% most highly upregulated
genes following IAA treatment. Of the 29 known members of the Aux/IAA gene family, 8 were
upregulated by IAA in this study. Of these 8 genes, two showed Ca2+-dependent transcription.
One of these genes (IAA5) displayed a remarkable induction of nearly 200-fold upon IAA
treatment – the third highest of all genes detected. This induction was reduced by 50% upon La3+
pretreatment. Several of the 70 member SAUR family also appeared, with a mixture of Ca2+-
dependence and -independence.
Other common genes in previous microarray studies include the AUXIN RESPONSE
FACTOR (ARF) transcription factors, PIN auxin efflux transporters, and ETHYLENE
RESPONSE FACTOR (ERF) transcription factors (Papanov et al, 2008). Though no ARFs were
detected, all three of the most commonly auxin-induced PIN transcripts were differentially
expressed following IAA treatment in root tips. None however, were affected by La3+
pretreatment. Nine ERFs were induced by auxin treatment. Of these nine all but one appeared to
be Ca2+ dependent.
47
Analysis of cis-Elements Involved in Ca2+-Dependent Auxin-Regulated Transcription
Though systems analysis of the downstream effects of gene regulation based on
functional/interaction networks was unsuccessful, another common approach involves the use of
gene regulation data to determine conserved cis elements that may be involved in the regulation
of these transcripts. One difficulty in the case of RNA sequencing experiments such as this is the
lack of reliable tools capable of managing large data sets. Many such tools were developed at the
height of microarray popularity and use. These tools, many available online, are unable to accept
input for datasets as large as those produced by more sensitive detection methods such as RNA
sequencing.
The Arabidopsis thaliana expression network analysis (ATHENA) tool (O’Connor et al.,
2005) was used to discover known cis-regulatory elements in the promoters of Ca2+-dependent
auxin-regulated genes discovered in this experiment. Although several motifs were statistically
enriched from the genome as a whole, the frequencies were negligible. In many cases, promoters
displayed an enrichment of only 2-4%. To discover novel cis elements, promoters of Ca2+-
dependent auxin-regulated genes were compared to those unaffected by La3+ pretreatment using
the oligo-diff tool of the Regulatory Sequence Analysis Tools (RSAT) website
(http://rsat.ulb.ac.be/rsat). Again, there was no striking difference between these two large lists of
genes.
To determine the cis elements involved in the strongest IAA regulation, the top 25 Ca2+-
dependent and -independent genes with the greatest degree of auxin-induction were analyzed for
conserved hexameric sequences using the RSAT oligo-diff tool. Using this analysis, one simple
motif (AAACCG) was enriched by 650% (30 occurrences in top 25 Ca2+-dependent versus 4 in
Ca2+-independent auxin-regulated genes). When this same motif was searched for within the
promoters of the entire gene list, this enrichment was less pronounced (approximately 3500
48
versus 3000, an enrichment of only 17%). This motif was not found when lists of known
promoter motifs were manually searched. Attempts at further study were unsuccessful due to the
lack of availability or active maintenance found among the websites of many known analysis
tools. Broken links and inactive servers prevented many research attempts. In the future, custom
software must be developed to determine the nature of this motif. With the advancement and
proliferation of next-generation sequencing technology, there is a great need for the development
of these tools that may one day be made available to the scientific community.
The promoters of two Ca2+-dependent (GH3.1 and WRKY46) and -independent (IAA19
and IAA6) auxin-inducible genes were manually surveyed to locate known Ca2+ and auxin-
related cis elements. The ARF transcription factors involved in TIR1-Aux/IAA-mediated
signaling are known to bind two similar promoter motifs, the auxin response element (AuxRE)
and glucocorticoid hormone response element (GRE; Guilfoyle et al., 1998). These sequences
were present in the promoters of all four genes, though WRKY46 contained fewer occurrences (1
in WRKY46 vs. 3-8 in other genes). Promoter analysis of genes regulated by electrically induced
artificial Ca2+ changes revealed several conserved motifs believe to play a role in Ca2+-mediated
transcription (Whalley et al., 2011). Only Ca2+-dependent GH3.1 and WRKY46 contained the
CAMTA-binding motif (CAM box).
Discussion
Using a candidate gene based approach we showed that a subset of genes rapidly induced
by 1 µM IAA in the growing root tip was significantly affected by La3+ pretreatment, indicating
possible Ca2+-dependence in the auxin-regulated expression of these genes. To learn more about
this response, robust next-generation RNA sequencing was performed and uncovered nearly 1400
genes that display significant differential expression in response to a 1 µM IAA treatment. Of
49
these genes, nearly half were significantly affected by La3+ pretreatment, suggesting a role for
Ca2+ in the regulation of auxin-responsive transcription in the growing root. Though
transcriptional auxin-regulation has been extensively studied, fewer details regarding rapid IAA
responses are known. Due to the tissue specificity of this particular rapid Ca2+ response, the
downstream effects on transcription may be related to the maintenance or fine-tuning of the
growth inhibition that is also specific to this cell type.
Although the results of Ca2+-dependent auxin-regulated transcription were pronounced
and several obvious candidates do suggest a direct role in the regulation of cell expansion, a
majority of genes most affected by La3+ treatment indicate a more indirect role for the
relationship between rapid Ca2+ signaling and the growth response. GO enrichment analysis
suggests that signaling and response components are the primary targets of this system. This may
potentially alter the overall availability of relevant signaling proteins necessary for establishing
the sensitivity and response specificity within the cell to anticipate the requirement of future
signaling events following the perception of auxin. However, considering the timing of delayed
auxin-inducible gene expression discussed in the introduction, regulatory genes and transcription
factors identified in this study may be important for the subsequent expression of genes with a
more direct role in long-term, sustained growth inhibition.
A rapid transient auxin-induced increase in [Ca2+]cyt observed in Chapter 3 occurs only in
the root tip. If Ca2+-dependent auxin-induced gene expression shapes the cell type specific auxin
response in this tissue, the induction of auxin-regulated genes should not respond to La3+
pretreatment in tissues that lack [Ca2+]cyt responses. Though overall auxin-induced expression
levels will likely vary by tissue, this experiment remains a necessary next step.
50
Chapter 5
Tissue Specificity of Ca2+-Dependent Auxin-Regulated Gene Expression
Introduction
Physiological and transcriptional changes in response to auxin vary widely in different
tissues. Exclusively in the growing root tip, the auxin response involves rapid growth inhibition
accompanied by a virtually simultaneous transient increase in [Ca2+]cyt that is capable of altering
gene expression. The tissue-specificity of this Ca2+ response may be one factor involved in
establishing the particular auxin response observed in the growing root tip. In addition to the
immediate effects on growth inhibition, cell wall alkalinization, and extracellular ROS
production, the Ca2+ signaling in the root tip may fine tune the transcriptional auxin response or
facilitate long-term sustained growth inhibition following auxin treatment in the root tip.
To be consistent with the role of Ca2+ signaling in tissue-specific auxin responses, auxin-
induced gene expression should not be affected by pretreatment with La3+ in tissues that lack
[Ca2+]cyt responses. In Chapter 3, the Ca2+ sensor YC3.6 was used to assess Ca2+ signaling in a
variety of tissues. Several tissues lacked a Ca2+ response, including the columella, lateral root cap,
mature root, and hypocotyl. These tissues make great candidates for the investigation of tissue-
specific Ca2+-dependent auxin-induced gene expression.
Ca2+-Dependent Auxin-Regulated Gene Expression in the Mature Root
In the mature zone of the plant root, elongation ceases and specialized epidermal cell files
known as trichoblasts begin to form root hairs to increase the acquisition of water and nutrients.
51
Interestingly, this transition approximates the zone of conversion between elongating cells which
display a transient [Ca2+]cyt response and mature cells that do not. Using the same liquid
treatments of IAA with or without a La3+ pretreatment as in Chapter 4, both the apical 1-2 mm
(tip) and approximately 2-5 mm (mature) of the root tip were analyzed separately to investigate
Ca2+-dependent auxin-regulated gene expression in these tissues. These results were analyzed via
qRT-PCR using the same methods described in Chapter 4 (Figure 5-1). Candidate genes were
chosen to include examples of Ca2+-dependent and Ca2+-independent auxin-regulated gene
expression.
Figure 5-1: Effect of La3+ on auxin-regulated gene expression in the root tip and mature root. 5 day old Arabidopsis seedlings were treated with liquid phosphate-free HM with (i) 1 µM IAA (20 min), (ii) 1 µM IAA and 300 µM La3+ (20 min) following a pretreatment (3 min) with 300 µM La3+, and (iii) 300 µM La3+ (20 min). Following these treatments, gene expression was analyzed using quantitative real-time PCR. Tissue samples consisting of root tips approximately
52
In the mature root, IAA19, IAA6, and GH3.1 showed response patterns similar overall to
those seen in the tip, though IAA induction of IAA6 was less pronounced in the mature root.
Mean expression values of GH3.1 indicate a reduced sensitivity to La3+ pretreatment, but the
mature root expression for each treatment was within the standard deviation of each
corresponding root tip expression level and therefore inconclusive.
Compared to tissue collected for root tip only experiments, the overall level of IAA
upregulation varied substantially between biological replicates in this experiment. However, the
same general patterns observed among the means were consistent within each biological
replicate. Therefore, variation was due to erratic IAA upregulation that was consistently Ca2+-
dependent or independent regardless of the magnitude of upregulation. As in root tip only
experiments, IAA6 displayed the greatest variability in IAA induction among biological
replicates.
WRKY46 showed the strongest tissue-specific expression pattern. This tissue-specificity,
if consistent in other tissues throughout the plant, may explain why WRKY46 was not among the
genes discovered by the artificial electrically induced Ca2+ signal microarray experiments on
whole seedlings used to choose the original candidates for Ca2+-dependent auxin-regulated gene
expression (Whalley et al., 2011). In the mature root, IAA upregulation of WRKY46 in both the
presence and absence of La3+ was diminished. Expression of this gene also appears to have been
upregulated by La3+ alone, albeit within the relatively large standard deviations of this
experiment.
Although these data do not strongly support the hypothesis that Ca2+-dependent auxin-
regulated gene expression is specific to the root tip, the lack of convincing dissimilarities in tissue
1-2 mm from the root apex (tip) and approximately 2-5 mm of the mature root (mature) from the same plants were collected to produce these data. Gene expression values are displayed relative to a buffer-only (phosphate-free HM) control unique to each tissue. Each data point represents three biological replicates with standard deviation error bars.
53
specific responses may have been due to tissue contamination. To obtain sufficient quantities of
tissue for RNA extraction and cDNA production, many seedlings were grown on multiple plates
for each replicate. Arabidopsis roots of this age are small and vary in length. Tissue excisions
required precision to the millimeter scale. However, root tissue was collected as rapidly as
possible before flash freezing in liquid nitrogen to ensure the reliability of reported time points.
This resulted in the unavoidable collection of a small number of root tips in mature tissue samples
due to the high density of roots. On average, the mature root contained just slightly more than
1/20th the RNA as a comparable amount of root tip tissue. This is unsurprising considering the
increased transcription of the actively dividing and growing cells. Because it contains much
smaller cells than the mature root, the cell density in the meristem is also higher. When this tissue
contamination is combined with the sizeable variability in IAA induction, any differences in Ca2+
dependence between these tissues may have been decreased by contamination and further
obscured by large standard deviations.
To account for these possible sources of error, other tissues must be analyzed for the
same trends. Many tissues observed in Chapter 3 lacked a detectable Ca2+ response. Depending
on the feasibility of tissue collection as described in Chapter 4, these tissues should be able to
provide evidence for tissue-specific Ca2+-dependence in auxin-induced gene expression.
Ca2+-Dependent Auxin-Regulated Gene Expression in Aerial Tissues
Mature root cells are an ideal comparison to cells of the elongation zone but are difficult
to collect without contamination. The hypocotyl did not display a transient increase in [Ca2+]cyt
upon exposure to IAA when imaged with YC3.6 in Chapter 3. Although other auxin-responsive
shoot tissues could not be measured by YC3.6, there is currently no evidence for auxin-dependent
Ca2+ changes in the aerial tissue of Arabidopsis seedlings. Because of their alignment along the
54
cut edge of the nutrient medium and agar plate, efficient collection of this tissue for RNA
extraction is quite simple. However, overall transcriptional response to auxin is expected to vary
due to the drastic biological differences between the root and aerial tissues. Furthermore, to
account for the lower sensitivity of the hypocotyl to IAA-induced gene expression, the
concentration was increased from 1 to 5 µM, which has been shown to elicit transcriptional
effects (Chapman et al., 2012). All aerial tissue (including the hypocotyl, cotyledons, and shoot
apical meristem) was collected after submersion in IAA with and without La3+ pretreatment. As
before, qRT-PCR was performed on IAA6, IAA19, GH3.1, and WRKY46 (Figure 5-2).
Figure 5-2: Effect of La3+ on auxin-regulated gene in seedling aerial tissue. Five-day old Arabidopsis seedlings were treated with liquid phosphate-free HM with (i) 1 µM IAA (20 min), (ii) 1 µM IAA and 300 µM La3+ (20 min) following a pretreatment (3 min) with 300 µM La3+, and (iii) 300 µM La3+ (20 min). Following these treatments, gene expression was analyzed using quantitative real-time PCR. Gene expression values are displayed relative to a buffer-only (phosphate-free HM) control. Each data point represents three technical replicates of three biological replicates with standard deviation error bars.
55
One of the most obvious observations of this experiment is the variability among
biological replicates. As in all previous experiments, the auxin induction of IAA6 was the most
inconsistent. This variation is considerably smaller in the other measured genes. However, the
overall trend in expression is similar within the various biological replicates in most cases despite
the variable magnitude of IAA upregulation between replicates. The expression of both IAA19
and IAA6 is influenced to a lesser degree by IAA treatment in the hypocotyl compared to the root
and is unaffected by La3+ pretreatment. WRKY46 expression in aerial tissue is unaffected by IAA
treatment in contrast to the large induction observed in root tissue. Interestingly, both treatments
containing La3+ display a slight increase in transcript abundance.
The expression pattern of GH3.1 provides the most support to the hypothesis of tissue-
specific Ca2+-dependent auxin-mediated gene regulation. GH3.1 expression remains auxin
inducible in aerial tissues, though to a lesser degree than in the root tip. This may suggest an
additive effect for Ca2+ in gene expression resulting from upregulation by independent signaling
mechanisms.
The mean upregulation of GH3.1 is unaffected by La3+ pretreatment in the aerial tissues.
As in previous experiments, varying levels of auxin-induction between experiments performed on
different days produce large standard deviations. However, the expression patterns between
treatments were similar. Seedlings pretreated with La3+ on a day with greater auxin induction also
displayed an elevated expression level. GH3.1 expression was unaffected by La3+ treatment alone
(p=0.34). Taken together, the Ca2+-independent expression of GH3.1 and WRKY46 is the best
evidence for Ca2+ response specificity in the growing root tip.
To obtain more reliable results from these experiments in the future, more biological
replicates must be performed to decrease the standard deviations resulting from variable IAA
induction. Additionally, several more genes with confirmed Ca2+ dependence in the root tip must
be measured to indicate that these response patterns are not specific to GH3.1 and WRKY46
56
WRKY46 and Auxin-Induced Root Growth Inhibition
The results of this RNA sequencing experiment can still lead to the identification of
interesting candidate genes. For example, the transcription factor WRKY46 displayed greater
Ca2+-dependent auxin induction than over 96% of auxin-induced genes identified by RNA
sequencing. WRKY46 belongs to a family of transcription factors believed to contain up to 100
members by some estimates (Eulgem et al., 2000). WRKY proteins are involved in several plant
processes including pathogen defense, senescence and trichome development and are known to
bind the W-box promoter cis element [TTGAC(C/T); Eulgem et al., 2000]. This cis element
appears in both Ca2+-dependent and -independent auxin-regulated genes (from RNA sequencing)
and was enriched in Ca2+-dependent genes (977 occurences) by approximately 16% of the level
found in Ca2+-independent genes (839 occurences).
According to the ATTED-II coexpression database, WRKY46 is highly coexpressed with
three genes (BCS1, At3g50930; copper transport family protein, At5g52760; and Ca2+-binding
EF-hand protein, At5g39670; Obayashi et al., 2011). The W-box can appear as either of two 6bp
motifs, TTGACC and TTGACT. Both of these motifs are found once each in the promoters of all
three genes coexpressed with WRKY46. Furthermore, RNA sequencing indicated that all three of
these genes are highly induced by auxin in a Ca2+-dependent manner. This expression pattern
could be indirectly due to the Ca2+-dependent auxin-induction of WRKY46.
Temporally controlled expression of transcription factors following exposure to IAA
might be responsible for the chronologically dynamic sequence of early and late auxin responses.
In light of the coexpression data explained above, WRKY46 may play a role in the expression of
signaling modules required for a specific stage of auxin-induced root tip growth inhibition. One
way of testing this hypothesis would be to measure the expression of WRKY46 and coexpressed
genes shortly after IAA treatment (i.e. 5 minutes). Although some WRKY46 upregulation should
57
be detectable following this treatment, protein translation, folding, and subsequent WRKY46-
mediated gene expression will most likely require more time.
Preliminary results do not support this hypothesis (1 biological replicate, Figure 5-3). All
4 genes showed pronounced upregulation 5 minutes after IAA treatment. Though this most likely
indicates that WRKY46 is not responsible for the expression of these genes, little is known
regarding the time involved in production of functional WRKY46 protein following induction.
Figure 5-3: Short-term effect of La3+ on auxin-regulated gene expression of WRKY46 and coexpressed genes in the root tip. Five-day old Arabidopsis seedlings were treated with liquid phosphate-free HM with (i) 1 µM IAA (5 min), (ii) 1 µM IAA and 300 µM La3+ (5 min) following a pretreatment (3 min) with 300 µM La3+, and (iii) 300 µM La3+ (5 min). Following these treatments, gene expression was analyzed using quantitative real-time PCR. Gene expression values are displayed relative to a buffer-only (phosphate-free HM) control. Each data point represents three technical replicates of one biological replicate with standard deviation error bars.
58
Regardless of the expression of two WRKY46 coexpressed genes 5 minutes after IAA
treatment, WRKY46 remains an interesting candidate. Transgenic overexpression of a rice
WRKY transcription factor (OsWRKY31) resulted in decreased sensitivity to natural and
synthetic auxins in terms of lateral root growth inhibition (Zhang et al., 2007). This is similar to
the role of several other auxin-inducible proteins (such as GH3.1 and Aux/IAA proteins) in
possibly providing negative feedback through attenuation of the auxin response. There is also
evidence that some WRKY proteins are phosphorylated by CPKs, which may be capable of
regulating WRKY-mediated transcription in a Ca2+-dependent manner (Gao et al., 2013).
To confirm the presence of WRKY46 during root growth in vivo, transgenic WRKY46-
GFP fusion proteins under the transcriptional control of the native WRKY46 promoter were
stably transformed into Arabidopsis. When ready, these plants will be subjected to
gravistimulation. Accumulation of WRKY46 on the lower side of the root with the greatest
endogenous auxin-induced growth inhibition should be detectable. In addition, WRKY46 over-
and under-expression Arabidopsis lines will be created to determine if WRKY46 modulation
affects auxin sensitivity in the growing Arabidopsis root similar to OsWRKY31 in rice.
Discussion
The rapid Ca2+ response and growth inhibition unique to the root tip appears to
correspond with specificity in the Ca2+-dependence of auxin-induced gene expression. Due to
difficulties in mature root tissue collection, this inference is based on auxin-induced gene
expression of GH3.1 and WRKY46 that was unaffected by La3+ pretreatment in aerial tissue.
These transcriptional effects may contribute to the sustained growth inhibition of the root or fine
tune the auxin-mediated transcriptional response specific to the growing root tip.
59
As evidenced by the “aerial-like” expression pattern of WRKY46 in the mature root even
after root tip tissue contamination, the overall population of auxin-induced genes will still differ
between the mature and elongating root cells. To further complicate the matter, La3+ alone has an
effect on the expression of some genes. Attenuation of Ca2+ signaling without La3+ will be needed
to follow up on this research and to learn more about this signaling network as a whole. This can
be accomplished by alternate pharmacological Ca2+ channel blockers or more novel experimental
approaches such as the transgenic expression of Ca2+-buffering proteins
60
Bibliography
Abel, S. and A. Theologis. (2010). Odyssey of Auxin. In Cold Spring Harbor Perspectives in Biology. Edited by: Cold Spring Harbor Laboratory Press.
Alm, E. and A.P. Arkin. (2003). Biological Networks. Current Opinion in Structural Biology. 13: 193-202.
Badescu, G.O. and R.M. Napier. (2006). Receptors for auxin: will it all end in TIRs?. Trends in Plant Science. 11: 217-223.
Benjamins, R. and B. Scheres. (2008). Auxin: the looping star in plant development. Annu Rev Plant Biol. 59: 443-465.
Benkova, E., M. Michniewicz, M. Sauer, T. Teichmann, D. Seifertova, G. Jurgens, and J. Friml. (2003). Local, Efflux-Dependent Auxin Gradients as a Common Module for Plant Organ Formation. Cell. 115(5): 591-602.
Blilou, I., J. Xu, M. Wildwater, V. Willemsen, I. Papanov, J. Friml, R. Heidstra, M. Aida, K. Palme, and B. Scheres. (2005). The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots. Nature. 433: 39-44.
Bouche, N., A. Scharlat, W. Snedden, D. Bouchez, and H. Fromm. (2002). A novel family of calmodulin-binding transcription activators in multicellular organisms. J Biol Chem. 227(24): 21851-21861.
Boudsocq, M., M.R. Willmann, M. McCormack, H. Lee, L. Shan, P. He, J. Bush, S.H. Cheng, and J. Sheen. (2010). Differential innate immune signaling via Ca2+ sensor protein kinases. Nature. 464: 418-422.
Bowman, J.L. and S.K. Floyd. (2008). Patterning and polarity in seed plant shoots. Annu Rev Plant Biol. 59: 67-88.
Boyle, E.I., S. Weng, J. Gollub, H. Jin, D. Botstein, J.M. Cherry, and G. Sherlock. (2004). GO::TermFinder—open source software for accessing Gene Ontology information and finding significantly enriched Gene Ontology terms associated with a list of genes. Bioinformatics. 20(18): 3710-3715.
Bustin, S.A., J. Beaulieu, J. Huggett, R. Jaggi, F. Kibenge, P.A. Olsvik, L.C. Penning, and S. Toegel. (2010). MIQE Precis: Practical implementation of minimum standard guidelines for fluorescence-based quantitative real-time PCR experiments. BMC Mol Biol. 11: 74.
Calderon-Villalobos, L.I., X. Tan, N. Zheng, and M. Estelle. (2010). Auxin perception – structural insights. Cold Spring Harb Perspect Biol. 2:a005546.
61
Carrington, C.M. and J. Esnard. (1987). The Elongation Response of Watermelon Hypocotyls to Indole-3-Acetic Acid: A Comparative Study of Excised Segments and Intact Plants. J Exp Bot. 39(201): 441-450.
Cecchetti, V., M.M. Altamura, G. Falasca, P. Costantino, M. Cardarelli. (2008) Auxin regulates Arabidopsis anther dehiscence, pollen maturation, and filament elongation. Plant Cell. 20:1760+1774.
Chapman, E.J., K. Greenham, C. Castillejo, R. Sartor, A. Bialy, T. Sun, and M. Estelle. (2012). Hypocotyl Transcriptome Reveals Auxin Regulation of Growth-Promoting Genes through GA-Dependent and –Independent Pathways. PLoS One. 7(5): e36210.
Cosgrove, D.J. (2000). Loosening of plant cell walls by expansins. Nature. 407: 321-326.
Czechowski, T., M. Stitt, T. Altmann, M.K. Udvardi, and W.R. Scheible. (2005). Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiol. 139: 5-17.
Darwin, C. and F. Darwin. (1880). The power of movement in plants. London: John Murray.
DeSmet, I., T Tetsumura, B. DeRybel, N.F.D. Frey, L. Laplaze, I. Casimiro, R. Swarup, M. Naudts, S. Vanneste, D. Audenaert, D. Inze, M.J. Bennett, and T. Beeckman. (2007). Auxin-dependent regulation of lateral root positioning in the basal meristem of Arabidopsis. Development. 134: 681-690.
Dodd, A.N., M.K. Jakobsen, A.J. Baker, A. Telzerow, S.W. Hou, L. Laplaze, L. Barrot, R.S. Poethig, J. Haseloff, and A.A.R. Webb. (2006). Time of day modulates low-temperature Ca2+ signals in Arabidopsis. Plant J. 48: 962-973.
Dodd, A.N., J. Kudla, and D. Sanders. (2010). The Language of Calcium Signaling. Ann Rev of Plant Biol. 61: 593-620.
Egan, A.N., J. Schlueter, and D.M. Spooner. (2012). Applications of next-generation sequencing in plant biology. American Journal of Botany. 99(2): 175-185.
Erickson, R.O. and D.R. Goddard. (1951). Analysis of root growth in cellular and biochemical terms. Growth. 15: 89-116.
Eulgem, T., P.J. Rushton, S. Robatzek, and I.E. Somssich. (2000). The WRKY superfamily of plant transcription factors. Trends in Plant Sci. 5: 199-206.
Feraru, E. and J. Friml. (2008). PIN polar targeting. Plant Physiol. 147: 1553-1559.
Galon, Y., A Finkler, and H. Fromm. (2010a). Calcium-regulated transcription in plants. Molecular Plant. 3(4): 653-669.
Galon, Y., R. Aloni, D. Nachmias, O. Snir, E. Feldmesser, S. Scrase-Field, J.M. Boyce, N. Bouche, M.R., Knight, and H. Fromm. (2010b). Calmodulin-binding transcription activator 1 mediates auxin signaling and responds to stresses in Arabidopsis. Planta. 232(1): 165-178.
62
Gao, X., X. Chen, W. Lin, S. Chen, D. Lu, Y. Niu, L. Li, C. Cheng, M. McCormack, J. Sheen, L. Shan, and P. He. (2013). Bifurcation of Arabidopsis NLR immune signaling via Ca2+-dependent protein kinases. PLoS Pathog. 9: e1003127.
Gray, W.M., S. Kepinski, D. Rouse, O. Leyser, and M. Estelle. (2001). Auxin regulates SCFTIR1-dependent degradation of AUX/IAA proteins. Nature. 414: 271-276.
Guilfoyle, T.J., T. Ulmasov, and G. Hagen. (1998). The ARF family of transcription factors and their role in plant hormone-responsive transcription. Cell Mol Life Sci. 54: 619-627.
Guilfoyle, T.J. and G Hagen. (2007). Auxin response factors. Curr Opin Plant Biol. 10: 453-460.
Hasenstein, K.H. and M.L. Evans. (1986). Calcium dependence of rapid auxin action in maize roots. Plant Physiol. 81: 439-443.
Hertel, R., V.E.A, Russo, and K.S. Thomson. (1972). In-vitro auxin binding to particulate cell fractions from corn coleoptiles. Planta. 107: 325.
Hoagland, D.R. and D.I Arnon. (1950). The water-culture method for growing plants without soil. Circ. 347. Univ. of Calif. Agric. Exp. Station, Berkeley.
Horikawa, K., Y. Yamada, T. Matsuda, K. Kobayashi, M. Hashimoto, T. Matsu-ura, A. Miyawaki, T. Michikawa, K. Midoshiba, and T. Nagai. (2010). Spontaneous network activity visualized by ultrasensitive Ca2+ indicators, yellow cameleon-Nano. Nat Methods. 7: 729-732.
Howard, B.E., Q. Hu, A.C. Babaoglu, M. Chandra, M. Borghi, X. Tan, L. He, H. Winter-Sederoff, W. Gassmann, P. Veronese, and S. Heber. (2013). High-Throughput RNA Sequencing of Pseudomonas-Infected Arabidopsis Revelas Hidden Transcriptome Complexity and Novel Splice Variants. PLoS One. 8: e74183.
Ishikawa, H. and M.L. Evans. (1993). The role of the distal elongation zone in the response of maize roots to auxin and gravity. Plant Physiol. 102: 1203-1210.
Keller, C.P. (2007). Leaf expansion in Phaseolus: transient auxin-induced growth increase. Physiol Plant. 130: 580-589.
Kepinski, S. and O. Leyser. (2005). The Arabidopsis F-box protein TIR1 is an auxin receptor. Nature. 435: 446-451.
Kerr, E.M. and S.C. Fry. (2004). Extracellular cross-linking of xylan and xyloglucan in maize cell-suspension cultures: The role of oxidative phenolic coupling. Planta. 219: 73-83.
Kimbrough, J.M. R. Salinas-Mondragon, W.F. Boss, C.S. Brown, and H.W. Sederoff. (2004). The Fast and Transient Transcriptional Network of Gravity and Mechanical Stimulation in the Arabidopsis Root Apex. Plant Physiol. 136: 2790-2805.
Knight, M.R., N.D. Read, A.K. Campbell, and A.J. Trewavas. (1993). Imaging calcium dynamics in living plants using semi-synthetic recombinant aequorins. J Cell Biol. 121: 83-90.
63
Kutschera, U. and K.J. Niklas. (2013). Cell division and turgor-driven stem elongation in juvenile plants: a synthesis. Plant Science 207: 45-56.
Lucas, B.D. and T. Kanade. (1981). An iterative image registration technique with an application to sterio vision. In IJCAI81, Proceedings of the 7th international joint conference on artificial intelligence – Volume 2, 647-679.
Maere, S., K. Heymans, and M. Kuiper. (2005). BiNGO: a Cytoscape plugin to assess overrepresentation of gene ontology categories in biological networks. Bioinformatics. 21: 3448-3449.
McAinsh, M.R. and J.K. Pittman. (2009). Shaping the Calcium Signature. New Phytol. 181: 275-294.
Moloney, M.M., M.C. Elliott, and R.E. Cleland. (1981). Acid growth effects in maize roots: evidence for a link between auxin-economy and proton extrusion in the control of root growth. Planta. 152: 285-291.
Monshausen, G.B., T.N. Bibikova, M.A. Messerli, C. Shi, and S. Gilroy. (2007). Oscillations in extracellular pH and reactive oxygen species modulate tip growth of Arabidopsis root hairs. Proc Natl Acad Sci USA. 104: 20996-21001.
Monshausen, G.B., T.N Bibikova, M.H. Weisenseel, and S. Gilroy. (2009). Ca2+ regulates reactive oxygen species production and pH during mechanosensing in Arabidopsis roots. Plant Cell. 21: 2341-2356.
Monshausen, G.B., N.D. Miller, A.S. Murphy, and S. Gilroy. (2011). Dynamics of auxin-dependent Ca2+ and pH signaling in root growth revealed by integrating high-resolution imaging with automated computer vision-based analysis. Plant J. 65: 309-318.
Morris, A.K. and W.K. Silk. (1992). Use of a flexible logistic function to describe axial growth of plants. Bull Math Biol. 54: 1069-1081.
Muday, G.K. and A. Rahman. (2008). Auxin transport and the integration of gravitropic growth. In Plant tropisms. Edited by S. Gilroy and P.H. Masson. Blackwell; 47-77.
Nagai, T., S. Yamada, T. Tominaga, M. Ichikawa and A. Miyawaki. (2004). Expanded dynamic range of fluorescent indicators for Ca(2+) by circularly permuted yellow fluorescent proteins. Proc. Natl Acad. Sci. USA. 101: 10554-10559.
Napier, R.M, K.M. David, and C. Perrot-Rechenmann. (2002). A short history of auxin-binding proteins. Plant Mol Biol. 49: 339-348.
Nemhauser, J.L., T.C. Mockler, and J. Chory. (2004). Interdependency of Brassinosteroid and Auxin Signaling in Arabidopsis. PLos Biol. 2(9): e258.
Noh, B., A.S. Murphy, and E.P. Spalding. (2001). Multidrug resistance-like genes of Arabidopsis required for auxin transport and auxin-mediated development. Plant Cell. 13: 2441-2454.
64
Obayashi, T., K. Nishida, K. Kasahara, and K. Kinoshita. (2011). ATTED-II updates: condition-specific gene eoexpression to extend coexpression analyses and applications to a broad range of flowering plants. Plant Cell Physiol. 52: 213-219.
O’Connor, T.R., C. Dyreson, and J.J. Wyrick. (2005). Athena: an resource for rapid visualization and systematic analysis of Arabidopsis promoter sequences. Genome Analysis. 21(24): 4411-4413.
Palme, K. and L. Galweiler. (1999). PIN-pointing the molecular basis of auxin transport. Curr Opin Plant Biol. 2: 375-381.
Paponov, I.A., M. Paponov, W. Teale, M. Menges, S. Chakrabortee, J.A.H. Murray, and K. Palme. (2008). Comprehensive Transcriptome Analysis of Auxin Responses in Arabidopsis. Molecular Plant. 1(2): 321-337.
Perrot-Rechenmann, C. (2010). Cellular responses to auxin: division versus expansion. Cold Spring Harb Perspect Biol. 2:a001446.
Pfaffl, M.W. (2004). Relative quantification. In Real-time PCR. Published by International University Line. Edited by T. Dorak. 63-82.
Pierre-Jerome, E., B.L. Moss, and J.L. Nemhauser. (2013). Tuning the auxin transcriptional response. J Exp. Bot. 64(9): 2557-2563.
Ramakers, C., J.M. Ruijter, R.H. Lekanne Deprez and A.F.M. Moorman. (2003). Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci Letters. 339: 62-66.
Rayle, D.L. and R. Cleland. (1970). Enhancement of wall loosening and elongation by acid solutions. Plant Physiol. 46: 250-253.
Scarpella, E., M. Barkoulas, and M. Tsiantis. (2010). Control of leaf and vein development by auxin. Cold Spring Harb Perspect Biol. 2:a001511.
Schenck, D., M. Christian, A. Jones, and H. Luthen. (2010). Rapid auxin-induced cell expansion and gene expression: a four-decade-old question revisited. Plant Physiol. 152: 1183-1185.
Segonzac, C. and C. Zipfel. (2011). Activation of plant pattern-recognition receptors by bacteria. Curr Opin Micro. 14: 54-61.
Spartz, A.K., S.H. Lee, J.P. Wenger, N. Gonzalez, H. Itoh, D. Inze, W.A. Peer, A.S. Murphy, P.J. Overvoorde, and W.M. Gray. (2012). The SAUR19 subfamily of SMALL AUXIN RP RNA genes promote cell expansion. Plant J. 70: 978-990.
Stirnberg, P., S. Ward, and O. Leyser. (2010). Auxin and strigolactones in shoot branching: intimately connected? Biochem Soc Trans. 38: 717-722.
Takahashi, K., K. Hayashi, and T. Kinoshita. (2012). Auxin Activates the Plasma Membrane H+-ATPase by Phosphorylation during Hypocotyl Elongation in Arabidopsis. Plant Physiol. 159(2): 632-641.
65
Tan, X., L.I.A. Calderon-Villalobos, M. Sharon, C.X. Zheng, C.V. Robinson, M. Estelle, and N. Zheng. (2007). Mechanism of auxin perception by the TIR1 ubiquitin ligase. Nature. 446: 640-645.
Torres, M.A., J.L. Dangle, and J.D.G. Jones. (2002). Arabidopsis gp91 phox homologues AtrbohD and AtrbohF are required for accumulation of reactive oxygen intermediates in the plant defense response. Proc Natl Acad Sci USA. 99: 517-522.
Trapnell, C., A. Roberts, L. Goff, G. Pertea, D. Kim, D.R. Kelley, H. Pimental, S.L. Salzberg, J.L. Rinn, and L. Pachter. (2012). Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nature Protocols. doi:10.1038/nprot.2012.016.
Tromas, A., I. Papanov, and C. Perrot-Rechenmann. (2010). AUXIN-BINDING PROTEIN 1: functional and evolutionary aspects. Trends Plant Sci. 15: 436-446
Udvardi, M.K. (2008). Eleven Golden Rules of Quantitative RT-PCR. Plant Cell. 20: 1736-1737.
Ulmasov, T., J. Murfett, G. Hagen, and T.J. Guilfoyle. (1997). Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. Plant Cell. 9(11): 1963-1971.
Whalley, H.J., A.W. Sargeant, J.F.C. Steele, T. Cacoere, R. Lamb, N.J. Saunders, H. Knight, and M.R. Knight. (2011). Transcriptomic analysis reveals calcium regulation of specific promoter motifs in Arabidopsis. Plant Cell. 23(11): 4079-4095.
Wrzaczek, M., M. Brosche, and J. Kangasjarvi. (2013). ROS signaling loops – production, perception, regulation. Curr Opin in Plant Biol. 16: 575-582.
Wymer, C.L., T.N. Bibikova, and S. Gilroy. (1997). Cytoplasmic free calcium distributions during the development of root hairs of Arabidopsis thaliana. Plant J. 12(2):427-39.
Zhang, J., Y. Peng, and Z. Guo. (2007). Constitutive expression of pathogen-inducible OsWRKY31 enhances disease resistance and affects root growth and auxin response in transgenic rice plants. Cell Res. 18: 508-521.
Yang, Y.D., U.Z. Hammes, C.G. Taylor, D.P. Schachtman, and E. Nielsen. (2006). High-affinity auxin transport by the AUX1 influx carrier protein. Curr Biol. 16: 1123-1127.
66
Appendix A
Quantitative RT-PCR Primers
All primers were used with an annealing temperature of 55°C.
Gene Primer Sequence: 5'-‐3' ABP1 FP TGCTCATCAGGTCAAAAACACCG ABP1 RP AGCCCTGCAGCAGTGTGTGG GA2ox6 FP TGACTCCCTTCAGGCATTGACG GA2ox6 RP TCGCCGACATACGTGGCTTC GH3.1 FP AGGGTTGTGTCGGCGCATTT GH3.1 RP ACATGGGCCTGTCCTTATCTTCTCC IAA19 FP GACTCGGGCTTGAGATAAC IAA19 RP CGTGGTCGAAGCTTCCTTAC IAA6 FP AACTGTTGCTCGAACCAAGG IAA6 RP ACTGCCGGTTGTGAAGAGTC PP2AA3 FP TAACGTGGCCAAAATGATGC PP2AA3 RP GTTCTCCACAACCGCTTGGT Tubulin FP GCCAATCCGGTGCTGGTAACA Tubulin RP CATACCAGATCCAGTTCCTCCTCCC WRKY46 FP TCCGTATTTACCAGAATGCCA WRKY46 RP TTCTTCTCCGATACTTTCCTCTT
67
Appendix B
Selected RNA Sequencing Results
Genes most highly upregulated by IAA
Genes are sorted by greatest degree of IAA upregulation. 100 most upregulated genes shown. Values represent expression relative to buffer only control. IAA= 20 min, 1 µM IAA. La-IAA= 3 min, 300 µM La3+ pretreatment followed by 20 min, 1 µM IAA and 300 µM La3+. La= 20 min, 300 µM La3+. Accession Number IAA La-‐IAA La Name/Description
AT5G46013 #DIV/0 (undetectable in buffer
sample) unknown protein
AT5G57520 #DIV/0 (undetectable in buffer
sample) ZINC FINGER PROTEIN 2 (ZFP2)
AT1G30190 504.99 88.65 0.00 unknown protein; BEST match is: unknown protein (TAIR:AT2G34610.1)
AT5G52760 224.21 20.89 6.41 Copper transport protein family AT1G15580 194.26 82.74 0.73 INDOLE-‐3-‐ACETIC ACID INDUCIBLE 5 (IAA5) AT2G23170 94.62 33.78 1.03 (GH3.3) -‐ 62.07 9.38 0.84 unknown protein AT4G37390 51.12 28.64 0.17 (BRU6) -‐ 46.53 23.48 1.00 unknown protein AT2G17680 41.74 77.30 1.35 Arabidopsis protein of unknown function (DUF241) AT3G58190 41.58 30.28 1.54 LATERAL ORGAN BOUNDARIES-‐DOMAIN 29 (LBD29) AT4G21200 32.41 41.92 2.05 GIBBERELLIN 2-‐OXIDASE 8 (GA2OX8) AT1G68250 29.83 2.64 1.68 unknown protein AT4G37290 29.57 10.48 1.99 unknown protein; INVOLVED IN: response to karrikin AT3G49700 27.72 14.81 2.07 1-‐AMINOCYCLOPROPANE-‐1-‐CARBOXYLATE SYNTHASE 9 (ACS9) AT1G56060 26.31 9.19 2.14 unknown protein AT5G26920 24.58 3.69 0.61 CAM-‐BINDING PROTEIN 60-‐LIKE G (CBP60G) AT5G22520 21.46 3.77 0.21 unknown protein AT1G29510 18.90 17.38 0.27 SMALL AUXIN UPREGULATED 68 (SAUR68) AT5G54490 18.82 11.90 0.67 PINOID-‐BINDING PROTEIN 1 (PBP1) AT1G29500 17.15 16.72 0.12 SAUR-‐like auxin-‐responsive protein family AT2G42430 16.79 13.04 1.42 LATERAL ORGAN BOUNDARIES-‐DOMAIN 16 (LBD16) AT5G51190 16.73 5.90 0.49 encodes a member of the ERF (ethylene response factor) AT4G12410 16.01 9.81 0.97 SAUR-‐like auxin-‐responsive protein family AT1G76210 15.91 40.78 0.62 Arabidopsis protein of unknown function (DUF241) AT5G47440 15.79 12.12 0.91 Protein of unknown function DUF828 (InterPro:IPR008546) AT3G22910 15.25 8.46 2.92 ATPase E1-‐E2 type family protein AT2G41100 15.24 5.62 1.38 TOUCH 3 (TCH3) AT2G34650 14.38 8.06 0.36 PINOID (PID) AT3G06490 14.21 12.87 1.58 MYB DOMAIN PROTEIN 108 (MYB108) AT2G14960 13.80 5.16 0.81 (GH3.1) AT5G54710,AT5G54720 13.11 2.59 1.54 unknown protein AT4G11170 13.08 18.57 6.41 Disease resistance protein (TIR-‐NBS-‐LRR class)
68
AT3G21320 12.27 4.19 2.83 BEST match is: hydroxyproline-‐rich glycoprotein family protein AT1G72920 11.89 1.73 0.76 Toll-‐Interleukin-‐Resistance (TIR) domain family protein AT1G60010 11.51 7.14 0.49 glycine-‐rich protein AT3G56710 11.50 3.94 0.94 SIGMA FACTOR BINDING PROTEIN 1 (SIB1) AT5G52750 11.22 1.30 0.64 Heavy metal transport/detoxification superfamily protein AT5G53830 11.03 4.13 2.30 VQ motif-‐containing protein AT5G64870 11.03 3.78 1.06 SPFH/Band 7/PHB domain-‐containing membrane-‐associated family AT2G46400 10.81 2.66 1.23 WRKY DNA-‐BINDING PROTEIN 46 (WRKY46) AT1G07135 10.55 3.97 1.06 glycine-‐rich protein AT3G63350 10.16 1.28 0.62 (AT-‐HSFA7B) AT5G60350 10.05 7.39 2.77 glycine-‐rich protein AT3G15540 9.68 9.08 0.92 INDOLE-‐3-‐ACETIC ACID INDUCIBLE 19 (IAA19) AT3G02493 9.66 16.69 3.23 ROTUNDIFOLIA LIKE 19 (RTFL19) AT1G52830 9.53 7.02 0.54 INDOLE-‐3-‐ACETIC ACID 6 (IAA6) AT3G50930 9.20 2.98 1.13 CYTOCHROME BC1 SYNTHESIS (BCS1) AT4G32280 9.06 7.37 0.86 INDOLE-‐3-‐ACETIC ACID INDUCIBLE 29 (IAA29) AT1G08860 8.56 1.18 0.58 BONZAI 3 (BON3) AT1G09930 8.41 3.99 2.32 OLIGOPEPTIDE TRANSPORTER 2 (OPT2) AT5G42380 8.11 11.06 2.95 CALMODULIN LIKE 37 (CML37) AT4G22690 7.92 4.48 3.20 (CYP706A1) AT1G53163 7.92 8.26 1.01 unknown protein AT5G52900 7.90 7.66 0.97 MEMBRANE-‐ASSOCIATED KINASE REGULATOR 6 (MAKR6) AT5G47220 7.82 2.08 0.59 ETHYLENE RESPONSIVE ELEMENT BINDING FACTOR 2 (ERF2) AT1G29430 7.68 4.21 0.17 SAUR-‐like auxin-‐responsive protein family AT1G24140 7.63 1.64 0.65 Matrixin family protein AT5G39670 7.56 3.13 1.80 Calcium-‐binding EF-‐hand family protein AT2G32200 7.53 2.94 1.17 unknown protein AT2G45760 7.51 2.05 1.01 BON ASSOCIATION PROTEIN 2 (BAP2) AT2G42440 7.33 7.40 1.23 ASYMMETRIC LEAVES 2-‐LIKE 15 (ASL15) AT4G17490 7.23 4.30 1.20 ETHYLENE RESPONSIVE ELEMENT BINDING FACTOR 6 (ERF6) AT1G19050 7.23 6.00 0.48 RESPONSE REGULATOR 7 (ARR7) AT4G24570 7.21 4.08 1.20 DICARBOXYLATE CARRIER 2 (DIC2) AT3G47480 7.00 1.14 0.18 Calcium-‐binding EF-‐hand family protein AT1G57630 6.99 9.88 4.15 Toll-‐Interleukin-‐Resistance (TIR) domain family protein AT2G38823,AT2G38830 6.96 1.48 1.32 unknown protein AT3G44630 6.87 1.92 1.35 Disease resistance protein (TIR-‐NBS-‐LRR class) family AT4G27260 6.72 5.47 0.88 (WES1) AT3G60550 6.72 6.14 0.78 CYCLIN P3;2 (CYCP3;2) AT1G31290 6.72 1.20 0.77 ARGONAUTE 3 (AGO3) AT2G39370 6.71 6.38 0.98 MEMBRANE-‐ASSOCIATED KINASE REGULATOR 4 (MAKR4) AT4G22710 6.58 1.98 1.03 (CYP706A2) AT5G57560 6.55 8.93 1.08 TOUCH 4 (TCH4) AT4G12720 6.50 2.90 1.30 (NUDT7) AT1G78100 6.42 4.92 0.89 AUXIN UP-‐REGULATED F-‐BOX PROTEIN 1 (AUF1) AT4G12410 6.40 4.43 0.00 SAUR-‐like auxin-‐responsive protein family AT1G35210 6.39 2.90 0.61 unknown protein AT1G13480 6.38 1.06 0.50 Protein of unknown function (DUF1262) AT3G46080 6.28 5.69 3.38 C2H2-‐type zinc finger family protein AT5G45630 6.26 2.94 0.99 Protein of unknown function DUF584 AT1G57560 6.23 3.27 0.77 MYB DOMAIN PROTEIN 50 (MYB50) AT5G67430 6.23 0.60 0.65 Acyl-‐CoA N-‐acyltransferases (NAT) superfamily protein AT3G56400 6.20 4.57 1.60 WRKY DNA-‐BINDING PROTEIN 70 (WRKY70) AT5G51480 6.18 2.17 1.09 SKU5 SIMILAR 2 (SKS2) AT4G19520 6.14 3.90 2.42 disease resistance protein (TIR-‐NBS-‐LRR class) family
69
AT4G28640 6.10 4.63 0.92 INDOLE-‐3-‐ACETIC ACID INDUCIBLE 11 (IAA11) AT1G13245 5.98 3.70 0.58 ROTUNDIFOLIA LIKE 17 (RTFL17) AT4G14560,AT4G14570 5.98 2.99 0.66 unknown protein AT1G66090 5.87 10.90 3.61 Disease resistance protein (TIR-‐NBS class) AT3G50930 5.83 2.29 1.60 CYTOCHROME BC1 SYNTHESIS (BCS1) AT5G54510 5.83 3.57 0.84 DWARF IN LIGHT 1 (DFL1) AT2G40140 5.81 1.51 0.66 (CZF1) AT5G01540 5.80 1.78 1.21 LECTIN RECEPTOR KINASE A4.1 (LECRKA4.1) AT1G49200 5.77 5.87 1.23 RING/U-‐box superfamily protein AT2G39650 5.68 2.84 1.00 Protein of unknown function (DUF506) AT4G27280 5.68 8.31 1.63 Calcium-‐binding EF-‐hand family protein AT5G62280 5.64 4.09 0.49 Protein of unknown function (DUF1442) AT1G68240 5.63 0.89 0.95 basic helix-‐loop-‐helix (bHLH) DNA-‐binding superfamily protein
Genes most highly downregulated by IAA
Genes are sorted by greatest degree of IAA downregulation. 100 most downregulated genes shown. Values represent expression relative to buffer only control. IAA= 20 min, 1 µM IAA. La-IAA= 3 min, 300 µM La3+ pretreatment followed by 20 min, 1 µM IAA and 300 µM La3+. La= 20 min, 300 µM La3+. Accession Number IAA La-‐IAA La Name/Description AT5G65800 0.10 0.38 0.90 ACC SYNTHASE 5 (ACS5) AT5G37800 0.11 0.35 1.67 RHD SIX-‐LIKE 1 (RSL1) AT2G01020 0.18 0.18 0.28 rRNA; 5SrRNA AT2G23130 0.19 1.77 1.70 ARABINOGALACTAN PROTEIN 17 (AGP17) AT5G67020 0.20 0.44 0.91 unknown protein AT4G01630 0.21 0.91 2.04 EXPANSIN A17 (EXPA17) AT1G61840 0.23 0.44 1.36 Cysteine/Histidine-‐rich C1 domain family protein AT1G15405 0.23 0.24 0.36 Unknown gene AT2G07731 0.24 0.29 0.36 pseudogene AT2G17330 0.24 0.58 1.13 CYTOCHROME P450 51G2 (CYP51G2) AT4G34810 0.25 0.30 0.79 SAUR-‐like auxin-‐responsive protein family AT5G44770 0.26 0.70 1.36 Cysteine/Histidine-‐rich C1 domain family protein AT3G15115 0.27 0.96 1.57 unknown protein AT3G52561 0.27 0.51 0.83 unknown protein AT1G44608 0.27 0.60 1.21 unknown protein AT4G34800 0.27 0.23 0.78 SAUR-‐like auxin-‐responsive protein family AT5G25240 0.27 1.10 1.28 unknown protein AT3G10470 0.28 0.32 0.76 C2H2-‐type zinc finger family protein AT3G59130 0.28 0.68 1.13 Cysteine/Histidine-‐rich C1 domain family protein AT2G02950 0.29 0.75 1.28 PHYTOCHROME KINASE SUBSTRATE 1 (PKS1) AT2G42870 0.29 1.44 2.16 PHY RAPIDLY REGULATED 1 (PAR1) AT3G07425 0.29 0.64 1.15 unknown protein AT2G02620 0.30 0.59 1.39 Cysteine/Histidine-‐rich C1 domain family protein AT5G38100 0.31 0.47 0.71 S-‐adenosyl-‐L-‐methionine-‐dependent methyltransferases superfamily AT4G25250 0.31 1.03 1.68 Plant invertase/pectin methylesterase inhibitor superfamily protein AT4G28720 0.32 0.32 1.01 YUCCA 8 (YUC8) AT5G61570 0.32 0.88 1.07 Protein kinase superfamily protein
70
AT1G80520 0.32 0.26 0.40 Sterile alpha motif (SAM) domain-‐containing protein AT5G57780 0.33 0.58 1.05 P1R1 (P1R1) AT1G09540 0.33 0.51 0.82 MYB DOMAIN PROTEIN 61 (MYB61) AT5G14340 0.33 0.66 1.05 MYB DOMAIN PROTEIN 40 (MYB40) AT5G24100 0.34 0.56 0.96 Leucine-‐rich repeat protein kinase family protein AT2G17300 0.35 1.09 1.13 unknown protein AT1G44020 0.36 0.22 0.41 Cysteine/Histidine-‐rich C1 domain family protein AT4G25560 0.36 0.39 0.65 LONG AFTER FAR-‐RED LIGHT 1 (LAF1) AT3G23930 0.36 0.36 0.78 unknown protein AT1G05650,AT1G05660 0.36 0.48 0.94 unknown protein AT4G01140 0.36 1.37 1.71 Protein of unknown function (DUF1191) AT1G14280 0.37 1.07 1.10 PHYTOCHROME KINASE SUBSTRATE 2 (PKS2) AT5G02890 0.37 0.39 0.86 HXXXD-‐type acyl-‐transferase family protein AT2G20750 0.37 0.74 1.11 EXPANSIN B1 (EXPB1) AT2G40610 0.38 0.66 1.04 EXPANSIN A8 (EXPA8) AT2G18650 0.38 0.53 0.83 MATERNAL EFFECT EMBRYO ARREST 16 (MEE16) AT4G35720 0.38 0.85 0.95 Arabidopsis protein of unknown function (DUF241) AT3G48550 0.38 0.59 0.76 BEST match is: C2H2-‐like zinc finger protein AT3G58620 0.39 0.85 0.99 TETRATRICOPETIDE-‐REPEAT THIOREDOXIN-‐LIKE 4 (TTL4) AT5G62920 0.39 1.11 1.80 RESPONSE REGULATOR 6 (ARR6) AT3G60220 0.39 0.75 1.13 TOXICOS EN LEVADURA 4 (ATL4) AT3G19680 0.40 2.36 2.66 Protein of unknown function (DUF1005) AT1G04180 0.40 0.32 0.65 YUCCA 9 (YUC9) AT2G02610 0.40 0.57 1.14 Cysteine/Histidine-‐rich C1 domain family protein AT2G03370 0.40 1.60 1.83 Glycosyltransferase family 61 protein AT5G51930 0.40 0.40 0.74 Glucose-‐methanol-‐choline (GMC) oxidoreductase family protein AT5G03552 0.40 0.72 1.11 MICRORNA822A (MIR822A)
AT1G71050 0.41 0.68 1.23 HEAVY METAL ASSOCIATED ISOPRENYLATED PLANT PROTEIN 20 (HIPP20)
AT4G29310 0.41 1.39 1.25 Protein of unknown function (DUF1005) AT1G55430 0.41 0.70 1.13 Cysteine/Histidine-‐rich C1 domain family protein AT1G15180 0.42 1.11 1.27 MATE efflux family protein AT5G19190 0.42 2.05 1.84 unknown protein AT2G44740 0.42 0.75 0.94 CYCLIN P4;1 (CYCP4;1) AT3G62570 0.42 0.60 1.11 Tetratricopeptide repeat (TPR)-‐like superfamily protein
AT1G05100 0.42 1.42 1.72 MITOGEN-‐ACTIVATED PROTEIN KINASE KINASE KINASE 18 (MAPKKK18)
AT1G28170 0.42 0.79 1.19 SULPHOTRANSFERASE 7 (SOT7) AT2G02640 0.43 0.64 1.34 Cysteine/Histidine-‐rich C1 domain family protein AT2G47440 0.43 0.67 1.20 Tetratricopeptide repeat (TPR)-‐like superfamily protein AT1G05530 0.44 0.60 1.17 UDP-‐GLUCOSYL TRANSFERASE 75B2 (UGT75B2) AT4G18760 0.44 0.72 1.01 RECEPTOR LIKE PROTEIN 51 (RLP51) -‐ 0.45 0.49 0.81 unknown protein AT5G51810 0.45 0.79 0.90 GIBBERELLIN 20 OXIDASE 2 (GA20OX2) AT5G26660 0.45 0.53 0.75 MYB DOMAIN PROTEIN 86 (MYB86) AT2G02630 0.46 0.65 1.17 Cysteine/Histidine-‐rich C1 domain family protein AT1G16390 0.46 0.77 1.11 ORGANIC CATION/CARNITINE TRANSPORTER 3 (OCT3) AT3G21680 0.46 0.69 1.11 unknown protein AT4G00130 0.46 1.55 1.26 DNA-‐binding storekeeper protein-‐related transcriptional regulator AT2G19780 0.47 0.65 0.76 Leucine-‐rich repeat (LRR) family protein AT3G45230 0.47 1.15 1.31 hydroxyproline-‐rich glycoprotein family protein AT5G15948,AT5G15950 0.47 0.54 0.86 unknown protein AT3G14510 0.48 0.44 0.55 Polyprenyl synthetase family protein AT3G22250 0.48 1.22 1.85 UDP-‐Glycosyltransferase superfamily protein
71
AT2G07671 0.48 0.45 0.47 ATP synthase subunit C family protein AT2G42850,AT2G42860 0.48 0.81 1.23 unknown protein AT3G59850 0.48 0.53 0.91 Pectin lyase-‐like superfamily protein AT1G70230 0.48 0.81 1.18 TRICHOME BIREFRINGENCE-‐LIKE 27 (TBL27) AT3G23730 0.49 1.09 1.10 XYLOGLUCAN ENDOTRANSGLUCOSYLASE/HYDROLASE 16 (XTH16) AT5G49665 0.49 0.42 0.73 Zinc finger (C3HC4-‐type RING finger) family protein AT1G79180 0.49 0.49 0.92 MYB DOMAIN PROTEIN 63 (MYB63) AT4G31320 0.49 0.38 0.95 SAUR-‐like auxin-‐responsive protein family AT3G43720 0.49 0.88 1.07 lipid-‐transfer protein/seed storage 2S albumin superfamily protein AT2G43340 0.50 0.71 1.13 Protein of unknown function (DUF1685) AT3G49930 0.50 0.90 1.09 C2H2 and C2HC zinc fingers superfamily protein AT1G20070 0.50 1.01 1.41 unknown protein AT1G64910 0.50 0.59 0.92 UDP-‐Glycosyltransferase superfamily protein AT3G04140 0.51 0.63 0.91 Ankyrin repeat family protein AT3G50120 0.51 0.86 1.26 Plant protein of unknown function (DUF247) AT3G44326 0.51 0.39 1.03 F-‐box family protein AT3G50840 0.51 0.66 0.80 Phototropic-‐responsive NPH3 family protein AT5G10430 0.52 0.82 1.06 ARABINOGALACTAN PROTEIN 4 (AGP4) AT1G76890 0.52 0.80 1.04 (GT2) AT5G03960 0.52 0.92 1.09 IQ-‐DOMAIN 12 (IQD12) AT5G26230 0.52 0.73 1.22 MEMBRANE-‐ASSOCIATED KINASE REGULATOR 1 (MAKR1)
Genes most highly upregulated by IAA in a Ca2+-dependent manner
Genes are sorted by greatest degree of IAA upregulation. Only genes shown with a significant (p<0.05) difference between IAA and La-IAA treatments. Genes with a significant (p<0.05) difference between buffer control and La3+ only treatment have been removed. 100 most upregulated genes shown that meet these criteria. Values represent expression relative to buffer only control. IAA= 20 min, 1 µM IAA. La-IAA= 3 min, 300 µM La3+ pretreatment followed by 20 min, 1 µM IAA and 300 µM La3+. La= 20 min, 300 µM La3+. Accession Number IAA La-‐IAA La Name/Description AT1G30190 504.99 88.65 0.00 unknown protein AT5G52760 224.21 20.89 6.41 Copper transport protein family AT1G15580 194.26 82.74 0.73 INDOLE-‐3-‐ACETIC ACID INDUCIBLE 5 (IAA5) AT1G29430 94.62 33.78 1.03 (GH3.3) -‐ 62.07 9.38 0.84 unknown protein AT2G17680 41.74 77.30 1.35 Arabidopsis protein of unknown function (DUF241) AT3G58190 41.58 30.28 1.54 LATERAL ORGAN BOUNDARIES-‐DOMAIN 29 (LBD29) AT1G68250 29.83 2.64 1.68 unknown protein AT4G37290 29.57 10.48 1.99 unknown protein AT1G56060 26.31 9.19 2.14 unknown protein AT5G26920 24.58 3.69 0.61 CAM-‐BINDING PROTEIN 60-‐LIKE G (CBP60G) AT5G22520 21.46 3.77 0.21 unknown protein AT5G54490 18.82 11.90 0.67 PINOID-‐BINDING PROTEIN 1 (PBP1) AT2G42430 16.79 13.04 1.42 LATERAL ORGAN BOUNDARIES-‐DOMAIN 16 (LBD16) AT5G51190 16.73 5.90 0.49 ERF (ethylene response factor) subfamily AT1G76210 15.91 40.78 0.62 Arabidopsis protein of unknown function (DUF241) AT2G14960 13.80 5.16 0.81 (GH3.1)
72
AT5G54710,AT5G54720 13.11 2.59 1.54 unknown protein AT3G21320 12.27 4.19 2.83 BEST match is: hydroxyproline-‐rich glycoprotein family protein AT1G72920 11.89 1.73 0.76 Toll-‐Interleukin-‐Resistance (TIR) domain family protein AT3G56710 11.50 3.94 0.94 SIGMA FACTOR BINDING PROTEIN 1 (SIB1) AT5G52750 11.22 1.30 0.64 Heavy metal transport/detoxification superfamily protein AT5G53830 11.03 4.13 2.30 VQ motif-‐containing protein AT5G64870 11.03 3.78 1.06 SPFH/Band 7/PHB domain-‐containing membrane-‐associated family AT2G46400 10.81 2.66 1.23 WRKY DNA-‐BINDING PROTEIN 46 (WRKY46) AT1G07135 10.55 3.97 1.06 glycine-‐rich protein AT3G63350 10.16 1.28 0.62 (AT-‐HSFA7B) AT3G50930 9.20 2.98 1.13 CYTOCHROME BC1 SYNTHESIS (BCS1) AT1G08860 8.56 1.18 0.58 BONZAI 3 (BON3) AT1G09930 8.41 3.99 2.32 OLIGOPEPTIDE TRANSPORTER 2 (OPT2) AT5G47220 7.82 2.08 0.59 ETHYLENE RESPONSIVE ELEMENT BINDING FACTOR 2 (ERF2) AT1G24140 7.63 1.64 0.65 Matrixin family protein AT2G32200 7.53 2.94 1.17 unknown protein AT2G45760 7.51 2.05 1.01 BON ASSOCIATION PROTEIN 2 (BAP2) AT4G17490 7.23 4.30 1.20 ETHYLENE RESPONSIVE ELEMENT BINDING FACTOR 6 (ERF6) AT3G47480 7.00 1.14 0.18 Calcium-‐binding EF-‐hand family protein AT2G38823,AT2G38830 6.96 1.48 1.32 unknown protein AT3G44630 6.87 1.92 1.35 Disease resistance protein (TIR-‐NBS-‐LRR class) family AT1G31290 6.72 1.20 0.77 ARGONAUTE 3 (AGO3) AT4G22710 6.58 1.98 1.03 CYTOCHROME P450, FAMILY 706, SUBFAMILY A (CYP706A2) AT5G57560 6.55 8.93 1.08 TOUCH 4 (TCH4) AT4G12720 6.50 2.90 1.30 (NUDT7) AT1G78100 6.42 4.92 0.89 AUXIN UP-‐REGULATED F-‐BOX PROTEIN 1 (AUF1) AT1G35210 6.39 2.90 0.61 unknown protein AT5G45630 6.26 2.94 0.99 Protein of unknown function DUF584 AT1G57560 6.23 3.27 0.77 MYB DOMAIN PROTEIN 50 (MYB50) AT5G67430 6.23 0.60 0.65 Acyl-‐CoA N-‐acyltransferases (NAT) superfamily protein AT3G56400 6.20 4.57 1.60 WRKY DNA-‐BINDING PROTEIN 70 (WRKY70) AT5G51480 6.18 2.17 1.09 SKU5 SIMILAR 2 (SKS2) AT4G28640 6.10 4.63 0.92 INDOLE-‐3-‐ACETIC ACID INDUCIBLE 11 (IAA11) AT1G13245 5.98 3.70 0.58 ROTUNDIFOLIA LIKE 17 (RTFL17) AT4G14560,AT4G14570 5.98 2.99 0.66 unknown protein AT5G54510 5.83 3.57 0.84 DWARF IN LIGHT 1 (DFL1) AT5G01540 5.80 1.78 1.21 LECTIN RECEPTOR KINASE A4.1 (LECRKA4.1) AT2G39650 5.68 2.84 1.00 Protein of unknown function (DUF506) AT1G68240 5.63 0.89 0.95 basic helix-‐loop-‐helix (bHLH) DNA-‐binding superfamily protein AT1G69840 5.62 1.84 1.04 SPFH/Band 7/PHB domain-‐containing membrane-‐associated family AT5G03720 5.60 2.52 1.18 HEAT SHOCK TRANSCRIPTION FACTOR A3 (HSFA3) AT1G30040 5.53 1.15 0.94 GIBBERELLIN 2-‐OXIDASE (GA2OX2) AT2G38470 5.47 2.58 1.02 WRKY DNA-‐BINDING PROTEIN 33 (WRKY33) AT1G05575 5.37 1.22 0.66 unknown protein AT1G72940 5.33 0.90 0.79 Toll-‐Interleukin-‐Resistance (TIR) domain-‐containing protein AT3G18690 5.12 1.37 0.37 MAP KINASE SUBSTRATE 1 (MKS1) AT5G54470 5.08 2.21 0.72 B-‐box type zinc finger family protein AT4G08040 5.01 3.04 0.66 1-‐AMINOCYCLOPROPANE-‐1-‐CARBOXYLATE SYNTHASE 11 (ACS11) AT3G23630 4.99 2.17 1.13 ISOPENTENYLTRANSFERASE 7 (IPT7) AT5G65130 4.93 1.39 1.00 DREB subfamily A-‐6 of ERF/AP2 transcription factor family AT5G66650 4.87 2.63 0.76 Protein of unknown function (DUF607) AT1G14550 4.87 1.98 1.76 Peroxidase superfamily protein AT1G60190 4.86 0.56 0.29 PLANT U-‐BOX 19 (PUB19) AT2G22460 4.78 8.51 0.71 Protein of unknown function, DUF617
73
AT3G29000,AT3G29010 4.78 2.20 1.06 unknown protein AT3G45640,AT3G45650 4.69 1.72 1.17 unknown protein AT4G26400 4.69 1.70 0.94 RING/U-‐box superfamily protein AT5G47230 4.53 2.88 0.94 ETHYLENE RESPONSIVE ELEMENT BINDING FACTOR 5 (ERF5) AT4G02330 4.41 1.38 1.12 (ATPMEPCRB) AT3G50480 4.39 2.26 1.82 HOMOLOG OF RPW8 4 (HR4) AT2G32130,AT2G32140 4.37 2.46 1.17 unknown protein AT2G16900 4.34 1.56 1.18 unknown protein AT5G62020 4.34 1.35 0.69 HEAT SHOCK TRANSCRIPTION FACTOR B2A (HSFB2A) AT5G24320 4.30 3.01 0.94 Transducin/WD40 repeat-‐like superfamily protein AT3G52430 4.26 1.72 1.23 PHYTOALEXIN DEFICIENT 4 (PAD4) AT2G20142,AT2G20170 4.20 2.79 1.68 unknown protein AT3G17690,AT3G17700 4.20 0.81 0.83 unknown protein AT4G17250 4.19 1.65 0.98 unknown protein AT2G26150 4.15 2.23 0.96 HEAT SHOCK TRANSCRIPTION FACTOR A2 (HSFA2) AT3G56880 4.15 1.13 0.73 VQ motif-‐containing protein AT5G65140 4.12 2.93 0.97 TREHALOSE-‐6-‐PHOSPHATE PHOSPHATASE J (TPPJ) AT4G30370 4.08 2.93 0.79 RING/U-‐box superfamily protein AT4G25380 3.97 1.41 0.62 STRESS-‐ASSOCIATED PROTEIN 10 (SAP10) AT5G49450 3.94 2.78 0.62 BASIC LEUCINE-‐ZIPPER 1 (bZIP1) AT5G46710 3.93 1.22 0.70 PLATZ transcription factor family protein
AT4G11280 3.92 2.60 0.88 1-‐AMINOCYCLOPROPANE-‐1-‐CARBOXYLIC ACID (ACC) SYNTHASE 6 (ACS6)
AT1G69930 3.90 1.05 0.59 GLUTATHIONE S-‐TRANSFERASE TAU 11 (GSTU11) AT2G32020 3.85 1.76 0.72 Acyl-‐CoA N-‐acyltransferases (NAT) superfamily protein AT4G16940 3.82 1.57 1.22 Disease resistance protein (TIR-‐NBS-‐LRR class) family AT1G61340 3.76 1.41 0.82 F-‐BOX STRESS INDUCED 1 (FBS1) AT4G11660 3.69 1.00 0.63 (AT-‐HSFB2B) AT5G10370,AT5G10380 3.68 1.37 0.82 unknown protein AT1G25400 3.67 2.60 1.14 unknown protein
Genes most highly downregulated by IAA in a Ca2+-dependent manner
Genes are sorted by greatest degree of IAA downregulation. Only genes shown with a significant (p<0.05) difference between IAA and La-IAA treatments. Genes with a significant (p<0.05) difference between buffer control and La3+ only treatment have been removed. 100 most downregulated genes shown that meet these criteria. Values represent expression relative to buffer only control. IAA= 20 min, 1 µM IAA. La-IAA= 3 min, 300 µM La3+ pretreatment followed by 20 min, 1 µM IAA and 300 µM La3+. La= 20 min, 300 µM La3+. Accession Number IAA La-‐IAA La Name/Description AT5G24313 0.70 0.44 0.79 unknown protein AT2G30575 0.69 1.33 1.24 LOS GLYCOSYLTRANSFERASE 5 (LGT5) AT2G42760 0.69 0.39 0.77 unknown protein AT2G30930 0.69 0.91 1.09 unknown protein AT1G08500 0.69 1.09 1.07 EARLY NODULIN-‐LIKE PROTEIN 18 (ENODL18) AT4G37450 0.69 1.13 1.14 ARABINOGALACTAN PROTEIN 18 (AGP18) AT3G52920 0.68 1.10 1.15 Family of unknown function (DUF662) AT3G54810 0.67 1.07 1.14 BLUE MICROPYLAR END 3 (BME3)
74
AT3G20130 0.67 1.15 1.13 CYTOCHROME P450, FAMILY 705, SUBFAMILY A (CYP705A22) AT2G14890 0.67 0.89 0.91 ARABINOGALACTAN PROTEIN 9 (AGP9) AT3G54770 0.67 1.13 1.24 RNA-‐binding (RRM/RBD/RNP motifs) family protein AT5G16590 0.67 0.86 1.02 (LRR1) AT5G60890 0.66 0.92 1.08 MYB DOMAIN PROTEIN 34 (MYB34) AT4G26320 0.66 0.84 0.97 ARABINOGALACTAN PROTEIN 13 (AGP13) AT4G16563 0.66 1.08 1.12 Eukaryotic aspartyl protease family protein AT5G11000 0.65 0.91 1.21 Plant protein of unknown function (DUF868) AT4G00150 0.65 0.49 0.84 HAIRY MERISTEM 3 (HAM3) AT3G12110 0.65 1.04 1.10 ACTIN-‐11 (ACT11) AT1G36060 0.65 1.02 1.18 DREB subfamily A-‐6 of ERF/AP2 transcription factor family AT3G58120 0.64 0.99 1.11 (BZIP61) AT3G06070 0.63 1.12 1.11 unknown protein AT5G49360 0.63 1.02 1.15 BETA-‐XYLOSIDASE 1 (BXL1) AT1G33240 0.63 0.95 1.15 GT-‐2-‐LIKE 1 (GTL1) AT5G53250 0.63 1.10 1.15 ARABINOGALACTAN PROTEIN 22 (AGP22) AT1G10020 0.63 0.91 1.09 Protein of unknown function (DUF1005) AT3G06770 0.62 1.10 1.14 Pectin lyase-‐like superfamily protein AT3G09780 0.62 1.04 1.03 CRINKLY4 RELATED 1 (CCR1) AT1G70990 0.62 1.02 1.17 proline-‐rich family protein AT3G03690 0.62 0.90 1.05 UNFERTILIZED EMBRYO SAC 7 (UNE7) AT5G56320 0.61 0.44 0.82 EXPANSIN A14 (EXPA14) AT3G25700 0.61 1.01 1.02 Eukaryotic aspartyl protease family protein AT1G76090 0.61 1.08 1.18 STEROL METHYLTRANSFERASE 3 (SMT3) AT1G22550 0.60 0.87 1.12 Major facilitator superfamily protein AT3G16570 0.60 1.05 1.22 RAPID ALKALINIZATION FACTOR 23 (RALF23) AT1G03870 0.60 1.00 1.09 FASCICLIN-‐LIKE ARABINOOGALACTAN 9 (FLA9) AT1G64640 0.59 1.08 1.10 EARLY NODULIN-‐LIKE PROTEIN 8 (ENODL8) AT5G23280 0.59 0.87 1.23 TCP family transcription factor AT5G22940 0.59 0.92 1.03 FRA8 HOMOLOG (F8H) AT5G60660 0.59 0.80 1.06 PLASMA MEMBRANE INTRINSIC PROTEIN 2;4 (PIP2;4) AT1G22230 0.58 0.80 1.15 unknown protein AT5G53500 0.57 0.94 1.18 Transducin/WD40 repeat-‐like superfamily protein AT5G44417 0.57 1.37 1.39 pseudogene, similar to CPRD2 AT1G11545 0.57 0.92 1.00 XYLOGLUCAN ENDOTRANSGLUCOSYLASE/HYDROLASE 8 (XTH8) AT1G22330 0.57 0.94 1.05 RNA-‐binding (RRM/RBD/RNP motifs) family protein AT5G65390 0.57 1.07 1.22 ARABINOGALACTAN PROTEIN 7 (AGP7) AT3G22540 0.57 0.95 0.95 Protein of unknown function (DUF1677) AT2G43880 0.56 0.84 1.36 Pectin lyase-‐like superfamily protein AT4G30400 0.56 1.03 1.18 RING/U-‐box superfamily protein AT2G46780 0.56 0.93 1.31 RNA-‐binding (RRM/RBD/RNP motifs) family protein AT1G78260 0.55 0.87 1.17 RNA-‐binding (RRM/RBD/RNP motifs) family protein AT5G15150 0.55 0.78 1.11 HOMEOBOX 3 (HB-‐3) AT3G18710 0.55 1.01 1.27 PLANT U-‐BOX 29 (PUB29) AT1G55330 0.54 1.06 1.15 ARABINOGALACTAN PROTEIN 21 (AGP21) AT5G43040 0.54 1.15 1.36 Cysteine/Histidine-‐rich C1 domain family protein AT1G12420 0.54 1.40 1.13 ACT DOMAIN REPEAT 8 (ACR8) AT2G28200 0.53 1.26 0.85 C2H2-‐type zinc finger family protein AT5G03960 0.52 0.92 1.09 IQ-‐DOMAIN 12 (IQD12) AT1G76890 0.52 0.80 1.04 (GT2) AT5G10430 0.52 0.82 1.06 ARABINOGALACTAN PROTEIN 4 (AGP4) AT3G50120 0.51 0.86 1.26 Plant protein of unknown function (DUF247) AT1G20070 0.50 1.01 1.41 unknown protein AT3G49930 0.50 0.90 1.09 C2H2 and C2HC zinc fingers superfamily protein
75
AT2G43340 0.50 0.71 1.13 Protein of unknown function (DUF1685) AT3G43720 0.49 0.88 1.07 lipid-‐transfer protein/seed storage 2S albumin superfamily protein AT3G23730 0.49 1.09 1.10 XYLOGLUCAN ENDOTRANSGLUCOSYLASE/HYDROLASE 16 (XTH16) AT1G70230 0.48 0.81 1.18 TRICHOME BIREFRINGENCE-‐LIKE 27 (TBL27) AT3G45230 0.47 1.15 1.31 hydroxyproline-‐rich glycoprotein family protein AT4G00130 0.46 1.55 1.26 DNA-‐binding storekeeper protein-‐related transcriptional regulator AT3G21680 0.46 0.69 1.11 unknown protein AT1G16390 0.46 0.77 1.11 ORGANIC CATION/CARNITINE TRANSPORTER 3 (OCT3) AT2G02630 0.46 0.65 1.17 Cysteine/Histidine-‐rich C1 domain family protein AT4G18760 0.44 0.72 1.01 RECEPTOR LIKE PROTEIN 51 (RLP51) AT2G47440 0.43 0.67 1.20 Tetratricopeptide repeat (TPR)-‐like superfamily protein
AT1G05100 0.42 1.42 1.72 MITOGEN-‐ACTIVATED PROTEIN KINASE KINASE KINASE 18 (MAPKKK18)
AT2G44740 0.42 0.75 0.94 CYCLIN P4;1 (CYCP4;1) AT1G15180 0.42 1.11 1.27 MATE efflux family protein AT1G55430 0.41 0.70 1.13 Cysteine/Histidine-‐rich C1 domain family protein AT4G29310 0.41 1.39 1.25 Protein of unknown function (DUF1005) AT5G03552 0.40 0.72 1.11 MICRORNA822A (MIR822A) AT3G60220 0.39 0.75 1.13 TOXICOS EN LEVADURA 4 (ATL4) AT5G62920 0.39 1.11 1.80 RESPONSE REGULATOR 6 (ARR6) AT3G58620 0.39 0.85 0.99 TETRATRICOPETIDE-‐REPEAT THIOREDOXIN-‐LIKE 4 (TTL4) AT4G35720 0.38 0.85 0.95 Arabidopsis protein of unknown function (DUF241) AT2G20750 0.37 0.74 1.11 EXPANSIN B1 (EXPB1) AT1G14280 0.37 1.07 1.10 PHYTOCHROME KINASE SUBSTRATE 2 (PKS2) AT2G17300 0.35 1.09 1.13 unknown protein AT5G24100 0.34 0.56 0.96 Leucine-‐rich repeat protein kinase family protein AT5G14340 0.33 0.66 1.05 MYB DOMAIN PROTEIN 40 (MYB40) AT1G09540 0.33 0.51 0.82 MYB DOMAIN PROTEIN 61 (MYB61) AT5G61570 0.32 0.88 1.07 Protein kinase superfamily protein AT2G02620 0.30 0.59 1.39 Cysteine/Histidine-‐rich C1 domain family protein AT2G02950 0.29 0.75 1.28 PHYTOCHROME KINASE SUBSTRATE 1 (PKS1) AT3G59130 0.28 0.68 1.13 Cysteine/Histidine-‐rich C1 domain family protein AT5G25240 0.27 1.10 1.28 unknown protein AT1G44608 0.27 0.60 1.21 unknown protein AT5G44770 0.26 0.70 1.36 Cysteine/Histidine-‐rich C1 domain family protein AT2G17330 0.24 0.58 1.13 CYTOCHROME P450 51G2 (CYP51G2) AT1G61840 0.23 0.44 1.36 Cysteine/Histidine-‐rich C1 domain family protein AT2G23130 0.19 1.77 1.70 ARABINOGALACTAN PROTEIN 17 (AGP17) AT5G65800 0.10 0.38 0.90 ACC SYNTHASE 5 (ACS5)
Appendix C
Gene Ontology Enrichment Analysis
Gene ontology (GO) enrichment analysis of 691 Ca2+-dependent auxin-regulated genes.
By biological process
GO Term P-‐value Sample frequency
Background frequency
GO:0010200 response to chitin 2.45E-‐105 130/711 (18.3%) 422/30325 (1.4%) GO:0010243 response to organonitrogen compound 2.64E-‐104 131/711 (18.4%) 438/30325 (1.4%) GO:1901700 response to oxygen-‐containing compound 1.03E-‐84 241/711 (33.9%) 2459/30325 (8.1%) GO:1901698 response to nitrogen compound 2.76E-‐78 140/711 (19.7%) 792/30325 (2.6%) GO:0009719 response to endogenous stimulus 1.17E-‐72 198/711 (27.8%) 1879/30325 (6.2%) GO:0042221 response to chemical stimulus 7.47E-‐71 278/711 (39.1%) 3789/30325 (12.5%) GO:0050896 response to stimulus 6.12E-‐70 373/711 (52.5%) 6619/30325 (21.8%) GO:0010033 response to organic substance 9.38E-‐68 234/711 (32.9%) 2805/30325 (9.2%) GO:0006950 response to stress 6.86E-‐55 262/711 (36.8%) 4028/30325 (13.3%) GO:0006952 defense response 2.49E-‐54 164/711 (23.1%) 1667/30325 (5.5%) GO:0002376 immune system process 7.56E-‐50 125/711 (17.6%) 1032/30325 (3.4%) GO:0007165 signal transduction 2.61E-‐42 145/711 (20.4%) 1618/30325 (5.3%) GO:0031347 regulation of defense response 5.66E-‐41 85/711 (12.0%) 549/30325 (1.8%) GO:0002682 regulation of immune system process 1.62E-‐40 76/711 (10.7%) 430/30325 (1.4%) GO:0010941 regulation of cell death 2.89E-‐40 74/711 (10.4%) 407/30325 (1.3%) GO:0051707 response to other organism 3.76E-‐40 138/711 (19.4%) 1535/30325 (5.1%) GO:0009607 response to biotic stimulus 4.05E-‐40 138/711 (19.4%) 1536/30325 (5.1%) GO:0044700 single organism signaling 4.94E-‐40 146/711 (20.5%) 1713/30325 (5.6%) GO:0023052 signaling 5.30E-‐40 146/711 (20.5%) 1714/30325 (5.7%) GO:0045088 regulation of innate immune response 6.79E-‐40 75/711 (10.5%) 425/30325 (1.4%) GO:0035556 intracellular signal transduction 8.46E-‐40 73/711 (10.3%) 400/30325 (1.3%) GO:0045730 respiratory burst 8.57E-‐40 46/711 (6.5%) 122/30325 (0.4%) GO:0002679 respiratory burst involved in defense response 8.57E-‐40 46/711 (6.5%) 122/30325 (0.4%) GO:0050776 regulation of immune response 9.58E-‐40 75/711 (10.5%) 427/30325 (1.4%) GO:0080134 regulation of response to stress 2.67E-‐39 85/711 (12.0%) 576/30325 (1.9%) GO:0010363 regulation of plant-‐type hypersensitive response 6.93E-‐39 70/711 (9.8%) 373/30325 (1.2%) GO:0043067 regulation of programmed cell death 7.24E-‐39 72/711 (10.1%) 399/30325 (1.3%) GO:0006612 protein targeting to membrane 1.45E-‐38 70/711 (9.8%) 377/30325 (1.2%) GO:0090150 establishment of protein localization to membrane 2.10E-‐38 70/711 (9.8%) 379/30325 (1.2%) GO:0072657 protein localization to membrane 2.10E-‐38 70/711 (9.8%) 379/30325 (1.2%) GO:0080135 regulation of cellular response to stress 8.87E-‐38 70/711 (9.8%) 387/30325 (1.3%) GO:0051716 cellular response to stimulus 1.93E-‐37 187/711 (26.3%) 2811/30325 (9.3%) GO:0045087 innate immune response 2.02E-‐37 103/711 (14.5%) 914/30325 (3.0%) GO:0009626 plant-‐type hypersensitive response 2.44E-‐37 71/711 (10.0%) 406/30325 (1.3%) GO:0034050 host programmed cell death induced by symbiont 2.89E-‐37 71/711 (10.0%) 407/30325 (1.3%)
77
GO:0006955 immune response 3.65E-‐37 103/711 (14.5%) 920/30325 (3.0%) GO:0007154 cell communication 4.40E-‐37 157/711 (22.1%) 2073/30325 (6.8%) GO:0070887 cellular response to chemical stimulus 7.14E-‐37 129/711 (18.1%) 1445/30325 (4.8%) GO:0012501 programmed cell death 1.68E-‐35 73/711 (10.3%) 460/30325 (1.5%) GO:0016265 death 3.10E-‐35 76/711 (10.7%) 508/30325 (1.7%) GO:0008219 cell death 3.10E-‐35 76/711 (10.7%) 508/30325 (1.7%) GO:0009725 response to hormone stimulus 2.43E-‐34 135/711 (19.0%) 1662/30325 (5.5%) GO:0048583 regulation of response to stimulus 4.17E-‐34 88/711 (12.4%) 722/30325 (2.4%) GO:0071310 cellular response to organic substance 6.08E-‐34 116/711 (16.3%) 1261/30325 (4.2%) GO:0009753 response to jasmonic acid stimulus 2.79E-‐32 71/711 (10.0%) 482/30325 (1.6%) GO:0051704 multi-‐organism process 3.07E-‐32 142/711 (20.0%) 1905/30325 (6.3%) GO:0060548 negative regulation of cell death 6.61E-‐32 46/711 (6.5%) 173/30325 (0.6%)
By cellular component
GO Term P-‐value Sample frequency Background frequency
GO:0005886 plasma membrane 2.50E-‐13 151/711 (21.2%) 3258/30325 (10.7%) GO:0071944 cell periphery 1.18E-‐12 164/711 (23.1%) 3734/30325 (12.3%) GO:0005623 cell 2.28E-‐09 590/711 (83.0%) 21763/30325 (71.8%) GO:0044464 cell part 2.28E-‐09 590/711 (83.0%) 21763/30325 (71.8%) GO:0016020 membrane 3.95E-‐05 176/711 (24.8%) 5066/30325 (16.7%) GO:0005634 nucleus 1.39E-‐04 288/711 (40.5%) 9465/30325 (31.2%) GO:0031225 anchored to membrane 9.78E-‐04 21/711 (3.0%) 249/30325 (0.8%)
By molecular function
GO Term P-‐value Sample frequency Background frequency GO:0005515 protein binding 6.68E-‐08 99/711 (13.9%) 2116/30325 (7.0%) GO:0003700 sequence-‐specific DNA binding (TF) 7.17E-‐08 84/711 (11.8%) 1669/30325 (5.5%) GO:0001071 nucleic acid binding transcription factor activity 7.39E-‐08 84/711 (11.8%) 1670/30325 (5.5%) GO:0016301 kinase activity 6.46E-‐07 68/711 (9.6%) 1279/30325 (4.2%) GO:0005516 calmodulin binding 5.66E-‐06 21/711 (3.0%) 185/30325 (0.6%) GO:0016772 phorphorous group transferase activity 1.51E-‐05 70/711 (9.8%) 1441/30325 (4.8%) GO:0016773 phosphotransferase to alcohol group 4.24E-‐05 40/711 (5.6%) 637/30325 (2.1%) GO:0004672 protein kinase activity 2.36E-‐04 34/711 (4.8%) 525/30325 (1.7%) GO:0005488 binding 1.20E-‐03 209/711 (29.4%) 6570/30325 (21.7%) GO:0016740 transferase activity 5.45E-‐03 97/711 (13.6%) 2589/30325 (8.5%)