Plant Molecular Biology 12:709-711, 1989. © 1989 Kluwer Academic Publishers. Printed in Belgium.

Short communication

A plant pseudogene for U1 RNA

709

Tam/is Kiss, Steffen Abel ~ and Ferenc Solymosy Institute of Plant Physiology, Biological Research Center, Hungarian Academy of Sciences, H-6701 Szeged, P.O.B. 521, Hungary; i permanent address: Martin-Luther-Universitat Halle-Wittenberg, Sektion Biowisschenschaften, Pflanzenbiochem. Abt., Neuwerk, 1, 4020 Halle, GDR

Received 4 October 1988; accepted in revised form 14 February 1989

Key words: genome evolution, pseudogene, small nuclear RNA, tomato, U1 RNA

In vertebrates, the six abundant, capped, uri- dylate-rich small nuclear RNAs (U-snRNAs, U1 to U6 RNAs [ 16]) which, as the components of ribonucleoprotein complexes (U-snRNPs [ 15]), play an indispensable role in the splicing [17] of pre-mRNA or the processing of pre-rRNA (U3), are known to possess pseudogenes [3], in addi- tion to bonafide genes [3].

Whereas all major U-snRNAs [9-14] and a number of their genes [ 18-21 ] have been charac- terized in plants, nothing is known about the pos- sible occurrence of U-snRNA pseudogenes in the plant genome.

By screening phage clones carrying sequences related to plant U 1 RNA and obtained from a tomato genomic library constructed in Charon 4 (kindly provided by R.W. Breidenbach) we encountered (Fig. 1A) among eight probably bonafide genes (to be published) a 3.6 kbp Eco RI- EcoRI fragment (U l . l p s ) which proved to contain the sequence of U 1 RNA truncated at its 3' end (Fig. 1B).

The nucleotide sequence of tomato U 1. lps ex- hibits the following features (Fig. 1B).

(i) The 5' end flanking region lacks both the TATA box at around - 30 and the characteristic plant U-snRNA enhancer element, the ' - 70 box' (consensus sequence: RTCCCACATCG) the presence of both of which was discovered in the

A E H S B S E

U I . I D s I i I ~ , ~ I P 1 k b p 4 i ) i

B -160 -150 -IGO -130 -120 -110 -100 TGACATAAAAGAAAGACAGTAAATAGAIACAAGCTGACAACGCAIICGTTCAGATGGIGGAIGGTCAICT

-90 -80 -70 -60 -50 -40 -30 OAACAGGACAAGCAACITAOCAGTCAACAACT&TACACCCFC&AIAGT~TCTGCATAGAGCACTAAATGG

-20 -I0 1 I0 20 30 40 TGAGTCAAAATGACCTAGT&AGATACTTACGTGGACAIAGICAATCGAIGACCATTAAGGCCCATGGCAI

5D 60 70 80 90 100 110 AGGTI~GT~AC~TCCATAGCACTTTGGAGGGCIGCCCGCCIAAGGICAGCIIAGTICTTGCGIAGAAAAA

120 130 !40 150 160 170 18n CAAAAAAAAGGACATAGTAAGATCCT IAACCEACCCEAGTET TACCCCTGGAAGT IGGGACAAGCIIT TG

Fig. 1. Characterization of the tomato Ul . lps locus. (A) Restriction enzyme map of the tomato Ul . lps locus. Sequencing strategy is indicated by arrows below the map. Letter symbols represent restriction enzyme cleavage sites: B, Barn HI; E, Eco RI; H, Hind III; S, Sph I. (B) The DNA sequence of a 350-nucleotide-long stretch of the tomato U l . l p s locus. The UI RNA 'coding region' is underlined and the imperfect direct repeats are marked by arrows, with dots indicating mismatches between the upstream and down- stream repeats. Asterisks below the sequence refer to identi- cal nucleotides in the 3' terminal part (from nt position 100 to nt position 114) of the 'coding region' and a stretch (from nt position - 48 to nt position - 34) in the 5' flanking region that is similar in nucleotide sequence to a direct repeat in the

processed pseudogene for potato actin [5].

The nucleotide sequence data reported will appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession number X14177.

710

A

t t

~,,~e U-A AA- , \ u ~ C 2o-c-G

e ~ - Ue G , ,o /-K1- ~] so U

~-.~U~.~ A~ A ' I I ,~ • ~ . . "~C.1J~A C A U [-U-~G U U~G U G A C ~U C ~A~A~'~e

1 1 1 1 0 1 1 0 0 I I I I I I ] ~ ' l

[A--O-~C G C C C GI~ .~]G A~]G UU ..~en/t C J A I~-~ got e~ll G e e 0e/-~e \

F~*N 80 ~o

11o-G • U C~l-© III

U - A G--~u

C - G U C

• %. lOO

C

B

5" 5 ' s s r s z

n

Iv

D C

Fig. 2. Proposed secondary structure model for a hypothetical transcript of the 'coding region' (cf. Fig. IB)of thetomato Ul . lps locus. Stems are marked by Roman numerals and loops by capital letters. Nucleotide positions are numbered. Consensus sequences (cf. [6]), including transitions, are boxed. Evolutionarily highly conserved individual nucleotides not involved in transition are marked by dots. Nucleotide positions with point mutations in relation to the consensus sequence (cf. [6]) of U 1 RNA are designated by arrows with the corresponding 'consensus' nucleotides in boldface. Nucleoside modifications are not indicated. The inset shows a line drawing of the secondary structure of rat U1 RNA. Stems are marked by Roman numerals and loops by capital letters. Evolutionarily highly conserved regions of experimentally proven functional significance are

indicated: 5'ssrs, 5' splice site recognition sequence; Sm, Sm antigen binding site.

U2 RNA genes ofArabidops& thaliana by Vankan and Filipowicz [20], was later found in the U5 RNA gene cloned from this organism [21] and is also discernible in the U1 RNA genes of Phaseolus vulgaris [18] and Glycine max [19].

(ii) The 'coding region' is severely truncated at its 3' end. This becomes apparent when the se- quence from nt position + 1 to nt position + 113 of tomato U l . l p s (Fig. 1B) is folded (Fig. 2) into a phylogenetically highly conserved secondary structure model [2] which accommodates all full- length (162-164 nucleotides long) U1 RNAs.

(iii) The 3' end flanking region starts with a 14-nucleotide-long A-rich tail into which only one C residue has been inserted.

(iv) The sequence encompassing the truncated

'coding region' and the A-rich tail is flanked by two 23-nucleotide-long imperfect direct repeats with only three mismatches.

(v) The upstream direct repeat has a 7-nucle- otide-long overlap with the 'coding region'.

(vi) The downstream direct repeat has a 4-A- residue-long overlap with the 3' end of the A-rich tail.

The above results indicate that U l . lps is a pseudogene for tomato U 1 RNA and suggest that it has arisen by RNA-mediated events similar to those proposed in [ 1, 4, 7, 8] for the generation of human U-snRNA pseudogenes. This is the first report on the occurrence in a plant genome of a U-snRNA pseudogene with a truncated 'coding region'.

Acknowledgements

W e t h a n k D r R . W . B r e i d e n b a c h for supply ing us

wi th the t o m a t o genomic l ibrary a n d Professor

E.R. L e a d b e t t e r for va luab le c o m m e n t s on the

m a n u s c r i p t . T h a n k s are due also to Mr s

M. D o k t o r for typ ing the m a n u s c r i p t , to Mr s

G . K a l i c z k a for d r awing the figures a n d to M r

B. D u s h a for p r epa r ing the pho tog raphs . This

work was s u p p o r t e d by g ran t s O K K F T ( T t ) / 1 9 8 6 ,

O T K A 564/86 a n d O T K A 174/88 to F .S . f rom

the H u n g a r i a n A c a d e m y of Sciences , as well as by

a g ran t to F .S . f rom the H u n g a r i a n Min i s t ry of

I ndus t ry .

References

1. Bernstein LB, Mount SM, Weiner AM: Pseudogenes for human small nuclear RNA U3 appear to arise by inte- gration of self-primed reverse transcripts of the RNA into new chromosomal sites. Cell 32:461-472 (1983).

2. Branlant C, Krol A, Ebel JP, Gallinaro H, Lazar E, Jacob M: The conformation of chicken, rat and human UIA RNAs in solution. Nucleic Acids Res 9:841-858 (1981).

3. Dahlberg JE, Lund E: The genes and transcription of the major small nuclear RNAs. In: Birnstiel ML (ed) Struc- ture and Function of Major and Minor Small Nuclear Ribonucleoprotein Particles, pp. 38-70. Springer- Verlag, Berlin/Heidelberg (1988).

4. Denison RA, Weiner AM: Human U1 RNA pseudo- genes may be generated by both DNA- and RNA- mediated mechanisms. Mol Cell Biol 2:815-828 (1982).

5. Drouin G, Dover GA: A plant processed pseudogene. Nature (London) 328:557-558 (1987).

6. Guthrie C, Patterson B: Spliceosomal snRNAs. Ann Rev Genet 22:387-419 (1988).

7. Hammarstr6m K, Westin G, Pettersson U: A pseudo- gene for human U4 RNA with a remarkable structure. EMBO J 1:737-739 (1982).

8. Hammarstr0m K, Bark C, Westin G, Zabielski J, Pettersson U: Evolution of human loci for small nuclear RNAs. Chemica Scripta 26B: 165-170 (1986).

9. Kiss T, T6th M, Solymosy F: Plant small nuclear RNAs. Nucleolar U3 snRNA is present in plants: partial charac- terization. Eur J Biochem 152:259-266 (1985).

711

10. Kiss T, Antal M, Solymosy F: Plant small nuclear RNAs. II. U6 RNA and a 4.5 Sl-like RNA are present in plant nuclei. Nucleic Acids Res 15:543-560 (1987).

11. Kiss T, Antal M, Solymosy F: Plant small nuclear RNAs. III. The complete primary and secondary structure of broad bean U2 RNA: Phylogenetic and functional impli- cations. Nucleic Acids Res 15:1332 (1987).

12. Kiss T, Antal M, Hegyi H, Solymosy F: Plant small nuclear RNAs. IV. The structure of UI RNA from Chlorella saccharophila: A phylogenetic support, in terms of RNA structure, for the probable interaction between U1 and U2 RNPs during the splicing of pre-mRNA. Nucleic Acids Res 16:2734 (1988).

13. Kiss T, Jakab G, Antal M, P~.lfi Z, Hegyi H, Kis M, Solymosy F: Plant small nuclear RNAs. V. U4 RNA is present in broad bean plants in the form of sequence variants and is base-paired with U6 RNA. Nucleic Acids Res 16:5407-5426 (1988).

14. Krol A, Ebel JP, Rinke J, Liihrmann R: U1, U2 and U5 small nuclear RNAs are found in plant cells. Complete nucleotide sequence of the U5 RNA family from pea nuclei. Nucleic Acids Res 11:8583-8594 (1983).

15. Liihrmann R: snRNP proteins. In: Birnstiel ML (ed) Structure and Function of Major and Minor Small Nuclear Ribonucleoprotein Particles, pp. 71-99. Sprin- ger-Verlag, Berlin/Heidelberg (1988).

16. Reddy R, Busch H: Small nuclear RNAs: RNA sequences, structure and modifications. In: Birnstiel ML (ed) Structure and Function of Major and Minor Small Nuclear Ribonucleoprotein Particles, pp. 1-37. Sprin- ger-Verlag, Berlin/Heidelberg (1988).

17. Steitz JA, Black DL, Gerke V, Parker KA, Kr~imer A, Frendewey D, Keller W: Functions of the abundant U-snRNPs. In: Birnstiel ML (ed) Structure and Function of Major and Minor Small Nuclear Ribonucle- oprotein Particles, pp. 115-154. Springer-Verlag, Berlin/Heidelberg (1988).

18. van Santen VL, Spritz RA: Nucleotide sequence of a bean (Phaseolus vulgaris) UI snRNA gene: Implications for plant pre-mRNA splicing. Proc Natl Acad Sci USA 84:9094-9089 (1987).

19. van Santen VL, Swain W, Spritz RA: Nucleotide se- quences of two soybean UI snRNA genes. Nucleic Acids Res 16:4176 (1988).

20. Vankan P, Filipowicz W: Structure of U2 snRNA genes of Arabidopsis thaliana and their expression in electro- porated plant protoplasts. EMBO J 7:791-799 (1988).

21. Vankan P, Edoh D, Filipowicz W: Structure and expres- sion of the U5 snRNA gene ofArabidopsis thaliana. Con- served upstream sequence elements in plant U-RNA genes. Nucleic Acids Res 16:10425-10440 (1988).