Research Article

A high proportion of DNA variants of BRCA1 and BRCA2 is

associated with aberrant splicing in breast/ovarian cancer

patients

AUTHORS:

David J. Sanz,1 Alberto Acedo,1 Mar Infante,1 Mercedes Durán,1 Lucía Pérez-

Cabornero,1 Eva Esteban-Cardeñosa,2 Enrique Lastra,3 Franco Pagani,4 Cristina

Miner1 and Eladio A. Velasco.1,*

Affiliations: 1 Grupo de Genética del Cáncer, Instituto de Biología y Genética Molecular, Consejo Superior de Investigaciones Científicas (CSIC) - Universidad de Valladolid, Valladolid, Spain. 2 Laboratorio de Biología Molecular, Servicio de Biopatología Clínica, Hospital La Fe, Valencia, Spain. 3 Servicio de Oncología, Complejo Hospitalario de Burgos, Burgos, Spain. 4 International Centre of Genetic Engineering and Biotechnology, Padriciano 99, Trieste, Italy. *Corresponding author: Dr. Eladio A. Velasco Grupo de Genética del Cáncer (B-7) Instituto de Biología y Genética Molecular CSIC - UVa Sanz y Forés s/n 47003 Valladolid SPAIN Phone: +34 983184809 Fax: +34 983184800 e-mail: eavelsam@ibgm.uva.es Financial support: This work has been supported by grants PI061102, (Instituto de

Salud Carlos III, Ministerio de Ciencia e Innovación, Spain) and 200820I135 (Consejo

Superior de Investigaciones Científicas, Ministerio de Ciencia e Innovación, Spain)

and the Hereditary Cancer Prevention Programme of the Regional Government of

Castilla y León. F.P. is supported by a grant from the Associazione Italiana Ricerca

sul Cancro, Italy.

Running Title: Aberrant splicing of the BRCA genes in Breast/Ovarian

Cancer

Key words: breast/ovarian cancer; BRCA1; BRCA2; Splicing; Unclassified Variants.

Conflict of Interest Statement: The authors declare no conflict of interest.

Statement of Translational Relevance

A powerful, combined strategy has been developed to study the potential effect of

genetic variants on splicing efficiency: Bioinformatic analysis followed by functional

analyses by lymphocyte RT-PCR and/or ex vivo hybrid minigenes. We show that a

large proportion of BRCA1/2 variants, mostly of unknown clinical significance, are

associated with the anomalous splicing of their corresponding genes in Hereditary

Breast/Ovarian cancer. Anomalous splicing may therefore represent a relevant

ethiopathogenic mechanism whose study may notably increase the proportion of

HBOC families that may benefit from Genetic Counselling and tailored prevention

protocols. Appropriate functional splicing assays should be incorporated to the

screening of genetic diseases such as hereditary cancer in order to discriminate

between benign polymorphisms and pathogenic mutations.

ABSTRACT

Purpose:Most BRCA1/2 mutations are of unknown clinical relevance. An increasing

amount of evidence indicates that they can be deleterious effects through the

disruption of the splicing process. We have investigated the impact of aberrant

splicing of BRCA1/2 on Hereditary Breast/Ovarian Cancer (HBOC).

Experimental Design: DNA variants were analyzed with splicing prediction

programs to select putative splicing mutations. Splicing assays of 57 genetic variants

were performed by lymphocyte RT-PCR and/or hybrid minigenes in HeLa and non-

tumor breast epithelial cells.

Results: Twenty-four BRCA1/2 variants of Spanish HBOC patients were

bioinformatically preselected. Functional assays showed that twelve variants induced

anomalous splicing patterns, six of which accounted for 58.5% of BRCA1 families. To

further evaluate the defective splicing of BRCA1/2, we analyzed 31 BIC (The Breast

Cancer Information Core Database) and two artificial variants that were generated by

mutagenesis. Sixteen variants induced different degrees of aberrant splicing.

Altogether, anomalous splicing was caused by 28 BRCA1/2 variants of all types,

indicating that any DNA change can disrupt pre-mRNA processing. We demonstrate

that a wide range of regulatory elements can be involved, including the canonical

and cryptic splice sites, the polypyrimidine tract and splicing enhancers/silencers.

Twenty mutations were predicted to truncate the BRCA proteins and/or to delete

essential domains, thus supporting a role in HBOC.

Conclusions: An important fraction of DNA variants of BRCA1/2 presents splicing

aberrations that may represent a relevant disease-causing mechanism in HBOC. The

identification of splicing disruptions by functional assays is a valuable tool to

discriminate between benign polymorphisms and pathogenic mutations.

INTRODUCTION

Inactivating mutations in BRCA1 (MIM 113705) and BRCA2 (MIM 600185)

confer a high risk of developing breast (BC) and ovarian cancers (OC).[1,2] Both

genes are responsible for approximately 16% of the familial breast cancer risk.[3]

Genetic testing for BRCA1 and BRCA2 provides valuable information in determining

the clinical management of breast/ovarian cancer patients. However, the data it

provides is also difficult to interpret due to the identification of many DNA variants of

unknown physiological significance, or unclassified variants (UVs) that hamper

genetic counselling in Hereditary Breast/Ovarian Cancer (HBOC). The critical issue is

to identify whether a given nucleotide change results in a benign polymorphism or a

disease-causing mutation. In fact, approximately half of the 3,499 different sequence

variations of the BIC database1 are UVs and determining their biological impact

remains a challenge.[4,5]

Analysis of the deleterious effect of genetic variants in disease genes is usually

focused on the predicted effect on protein structure and function. However, precise

removal of introns from precursor mRNA or splicing is an essential step in eukaryotic

gene expression. In spite of the low conservation of the basic splicing signals

(donor/acceptor sites) in upper eukaryotes, exon recognition can be accurately

achieved by additional cis-Splicing Regulatory Elements (SRE) that promote

(enhancers) or repress (silencers) exon inclusion.[6,7] The study of the connections

between defective splicing and disease has become a central issue in Biomedicine as

a consequence of the growing list of point mutations linked to aberrant splicing.[6-

10] Any DNA variant that disrupts such elements can be a potential deleterious

mutation.[6] This feature is particularly interesting in synonymous mutations (no

change in protein sequence) which have traditionally been considered innocuous

polymorphisms. One of the first examples of mutations disrupting an SRE was the

BRCA1 mutation c.5080G>T,[11,12] which was correlated with exon 18 skipping.

Since then, numerous mutations affecting SREs have been reported in a wide range

of inherited diseases, such as Cystic Fibrosis (MIM 219700), Neurofibromatosis Type

I (MIM 162200) and hereditary cancer.[7,10,13] An unexpectedly large percentage

of mutations play a key role in human disease through the alteration of the pre-

mRNA processing step. In fact, it has recently been proposed that up to 60% of

mutations that cause genetic diseases alter the splicing process.[8,9]

The numerous and diverse cis-acting splicing elements present in human

genes, as well as the high density of mutations in BRCA1 and BRCA2 (~1 mutation/7

nucleotides), make these genes excellent models to study the correlation between

aberrant splicing and BOC. Our purpose was to reanalyze the BRCA genes from the

splicing perspective. We thus examined the functional consequences on splicing of 24

BRCA variants carried by our patients and another 33 putative splicing variants that

we created by direct mutagenesis. They were assayed by RT-PCR of lymphocyte

mRNA and/or hybrid minigene experiments in human cell lines. We detected 28

variants that altered the splicing process by different mechanisms, suggesting that

aberrant splicing of BRCA1/2 may represent an important ethiopathogenic

mechanism in HBOC.

1 http://research.nhgri.nih.gov/projects/bic/Member/index.shtml

MATERIALS AND METHODS

Patients, Nucleic Acid Isolation and Mutation Detection.

Breast/ovarian cancer patients of 688 unrelated families were selected in the

Genetic Counselling Unit according to the criteria previously described.[14] Written,

informed consent was obtained from all patients prior to blood extraction.

DNA and RNA were purified from peripheral blood lymphocytes by using the

QIAamp DNA and RNA blood mini kits (Qiagen, Hilden, Germany), respectively.

Mutation analysis of BRCA1/2 was carried out by heteroduplex analysis on an

ABI3130XL capillary DNA sequencer (Applied Biosystems, Foster City, CA).[15]

Mutation nomenclature follows the guidelines of the Human Genome Variation

Society2.

Splicing Prediction Programs

Mutant and normal sequences were analyzed with several bioinformatic tools

to identify potential splicing mutations. Disruption/creation of splice sites was

evaluated with NNSPLICE3.[16] Analysis of putative SREs was performed with two

web-based resources: ESEfinder4, that detects exonic splicing enhancers (ESE) for

the SR proteins SF2/ASF, SC35, SRp40 and SRp55;[17] and the ESRsearch tool5, that

identifies enhancers/silencers.[18] Besides its own algorithms, ESRsearch integrates

those of RESCUE-ESE6,[19] PESX7,[20] and detection of known regulatory motifs. To

2 (http://www.hgvs.org/mutnomen/). 3 http://www.fruitfly.org/seq_tools/splice.html 4 http://exon.cshl.edu/ESE/index.html. 5 http://ast.bioinfo.tau.ail/ 6 http://genes.mit.edu/burgelab/rescue-ese/. 7 http://cubweb.biology.columbia.edu/pesx/programs

ascertain the evolutionary conservation of ESE motifs, human BRCA1 and BRCA2

sequences were aligned with those of other organisms using CLUSTALW28.[21]

RT-PCR

Lymphocyte RNA was retrotranscribed with the SuperscriptIITM kit (Invitrogen,

Carlsbad, CA). Amplification was conducted with Platinum Taq (Invitrogen) and

flanking exonic primers (Supplemental Table S1). Twelve unrelated lymphocyte RNAs

and normal breast RNA were used as controls.

Construction of Minigenes

Mutant and wild type (wt) exons of BRCA1/2 and flanking intronic sequences

were amplified with PfuUltra High fidelity polymerase (Stratagene, La Jolla, CA) and

primers containing a 5’-tail with a restriction site for XhoI, BamHI or BglII

(Supplemental fig S1 and Table S2). After restriction enzyme digestion, fragments

were cloned into the exon trapping vector pSPL3 (Invitrogen) to transform

Escherichia coli DH5α cells. To confirm the fidelity of the cloned sequences, plasmids

were sequenced with the Big Dye 3.1 Sequencing Kit (Applied Biosystems) and

primers PSPL3-SEQ-FW (5’-CCTTGGGATGTTGATGAT-3’) and PSPL3-SEQ-RV (5’-

TTGCTTCCTTCCACACAG-3’). Minigenes were transfected into HeLa and non-

tumorigenic breast epithelial cells (MCF10A) [22] (ATCC, LGC Standards, Spain) with

Lipofectamine (Invitrogen). RNA was purified with Nucleospin-RNA-II (Macherey-

Nagel, Düren, Germany) and RT-PCR performed as indicated above. Normal and

anomalous bands in agarose gels were quantified with the Quantity One software

v4.5.2 (BioRad, Hercules, CA) and sequenced.

Site directed mutagenesis

8 http://www.ebi.ac.uk/Tools/clustalw2/index.html

Direct Mutagenesis was carried out according to the PCR mutagenesis

protocol9 with PfuUltra polymerase. Previously constructed minigenes of exons 5-6-7,

13 and 14 of BRCA1 and 3, 5-6-7 and 18 of BRCA2 were used as templates to

generate 31 mutations from the BIC database (Supplemental Data). Experiments

were performed by triplicate and densitometric results of exon inclusion/exclusion

bands between wild type and mutant minigenes and between HeLa and MCF10A

cells were compared with a t-test.

9 http://www.methodbook.net/PCR/PCRmut.html

RESULTS

A total of 167 DNA variants were detected in 688 BOC unrelated patients, 49

of which (103 unrelated families) were classified as deleterious. All the variants were

analyzed with NNSPLICE (splice sites) and ESEfinder and ESRsearch

(enhancers/silencers). Twenty-four mutations were selected because they affected

presumed SRE motifs or created/disrupted splice sites (Table 1; Supplemental Table

S3).

Analysis of putative splicing variants of our breast/ovarian cancer families

Splice site mutations

Six variants affected the natural splice sites (Table 1), BRCA1 c.211A>G,

c.212+1G>A, c.5153-1G>A, c.5277+1G>A, and BRCA2 c.68-7T>A and c.7007G>A,

and one created a cryptic donor site, BRCA2 c.1763A>G. These variants were tested

by lymphocyte RT-PCR and/or hybrid minigenes, except for c.5277+1G>A, since

patient RNA or DNA were not available.[23] All of them induced aberrant splicing of

their exons (fig 1A, Table 1).[24-26] Apart from the classical mutations of the donor

and acceptor splice sites, two variants should be highlighted. Firstly, the novel BRCA2

missense variant c.1763A>G (p.N588S, exon 10) affected a non-conserved residue of

the BRCA2 protein10 and could be considered neutral a priori. However, this DNA

change was predicted to create a strong cryptic donor site, which led to an

alternative transcript with an in-frame deletion of 147 nucleotides (fig 1) (predicted

effect: p.N588S and loss of 49 amino acids). Secondly, c.68-7T>A affected the

polypyrimidine tract of the acceptor site of BRCA2 intron 2. Minigene analysis

10 http://agvgd.iarc.fr/BRCA2_Align.htm

revealed partial exon 3 skipping (Supplemental fig S2) that had also been reported in

fibroblasts.[27]

SRE mutations

We also evaluated seventeen variants that disrupted putative SREs according

to ESEfinder and ESRsearch (Table 1, Supplemental Table S3). Five of them (29.4%)

showed different types of splicing alterations in RT-PCR analysis. The new BRCA1

variants c.4379G>A (silencer creation) and c.4392T>A (enhancer disruption),

appeared together in two unrelated patients. Lymphocyte RT-PCR revealed two

aberrant products that corresponded to skipping of exon 15 and exons 14+15 (fig

1B). BRCA1 c.5123C>A showed partial in-frame skipping of exon 18 (fig 1B,C) in

lymphocytes. This mutation eliminated one SC35 and one conserved SRp55

enhancers (ESEfinder) and generated one ESS (ESRsearch). RT-PCR analysis of the

new BRCA2 mutation c.439C>T (p.Q147X) showed significant exon 5 removal (fig

1B). It was suggested that this mutation disrupted one SRp40 motif and created two

silencers. The synonymous mutation c.9234C>T disrupted one SRp40 motif,

although it also created ESSs. Lymphocyte RT-PCR showed partial exon 24 skipping

(data not shown). Finally, the nonsense mutation c.145G>T, which disrupted one

conserved SF2/ASF motif, induced exon 3 skipping in minigene assays (fig 2A).

The remaining 12 variants did not show any remarkable splicing consequence

(Supplemental Table S3). The feature common to most negative SRE variants was

the absence of evolutionary conservation of the disrupted elements. In fact, several

of these variants had previously been suggested as non-deleterious DNA changes,

such as BRCA1 c.4535G>T, and BRCA2 c.125A>C, c.223G>C, c.1114C>A,

c.7397C>T and c.8182G>T.[4,5,28] Despite BRCA2 c.7994A>G and c.9375C>G

disrupted conserved ESEs, they did not affect splicing probably because they are

present in exons with strong splice sites which are supposed to be less dependent on

SREs.[29]

To summarize, 31 unrelated patients carried twelve different splicing variants,

seven of which affected splice sites (BRCA1-c.211A>G, c.212+1G>A and c.5153-

1G>A and c.5277+1G>A and BRCA2-c.68-7T>A, c.1763A>G and c.7007G>A) and

five altered SREs (BRCA1-c.4379G>A+c.4392T>A and c.5123C>A, and BRCA2-

c.145G>T, c.439C>T and c.9234C>T).

With regard to the protein effect (Table 1; Supplemental Table S4), three

variants were predicted to truncate the BRCA proteins, one variant (BRCA2-

c.145G>T) caused an in-frame deletion of the essential PALB2 binding domain of

BRCA2, four BRCA1 variants had a double effect, protein truncation and in-frame

deletion of critical protein domains (Ring Finger, SQ-cluster and BRCT domains of

BRCA1). Evaluation of co-occurrence and family history [4] of eight variants supports

their pathogenicity in six of them (probability of causality>0.99; Supplemental Table

S4). Moreover, another two mutations (BRCA1 c.5123C>A and c.5277+1G>A) were

previously predicted to be deleterious with odds in favour of causality >1011.[4]

Furthermore, the previously reported founder effects of BRCA1 splicing mutations

c.211A>G and c.5153-1G>A also support their pathogenic relevance.[24,30] On the

other hand, splicing variants BRCA1 c.4379G>A+c.4392T>A and BRCA2 c.1763A>G

reached P-values of 0.922 and 0.724, respectively. BRCA2 c.1763A>G was predicted

to cause an in-frame deletion of 49 amino acids of unknown importance since it

does not affect any recognized functional domain. Finally, three variants were

correlated with partial splicing outcomes with different interpretations. Only BRCA1

c.5123C>A (p.A1708E) was previously catalogued as deleterious by protein

functional assays and statistical evaluations.[4,31] Thus, it is plausible that the

pathogenicity of this variant may rely on both protein and splicing anomalies.

Splicing analysis of BIC and artificial mutations

To further evaluate the incidence of defective splicing in BRCA1/2, we

analyzed mutations from the BIC database. For this purpose, we included BIC

mutations from exons 5-6-7, 13 and 14 of BRCA1 and 3, 5-6-7 and 18 of BRCA2,

which were evaluated for splice site disruption or creation (NNSPLICE), disruption of

conserved ESEs and ESS creation (ESEfinder and ESRsearch). Thirty-one putative

splicing mutations were selected that comprised 28 nucleotide substitutions (22

missense, 3 nonsense, 1 synonymous, 2 IVS), one intronic deletion and, as

examples, two frameshift deletions. Another two artificial variants (BRCA1 c.165G>A

and BRCA2 c.439C>A) were designed with ESEfinder and ESRsearch to target

specific SREs. All of them were generated by site-directed mutagenesis taking

advantage of previous wt minigene plasmids.

Splicing functional assays showed that 16 variants (48.5%) caused different

degrees and types of aberrant splicing (P<0.05, 5 variants; P<0.005, 10 variants;

and P=0.13 for BRCA2-c.518G>T) (Table 2; figs. 2B-3; Supplemental figs. S2-S3).

Three variants affected the natural splice sites (BRCA1-c.212+3A>G, c.302-3C>G,

BRCA2-c.8331G>A), five created cryptic sites (BRCA2-c.467A>G, c.518G>T,

c.7988A>T, c.8035G>T and c.8168A>G), one disrupted the polypyrimidine tract

(BRCA2-c.426-12del5), and seven affected ESE/ESS (BRCA1-c.165G>A, c.178C>T,

BRCA2-c.93G>T, c.439C>A, c.455C>A, c.470del5 and c.473C>T). These mutations

had been reported 54 times in the BIC database. Most induced important or total

aberrant splicing of their exons (12/16), but four (BRCA2-c.455C>A, c.518G>T,

c.7988A>T, c.8168A>G) caused a partial effect (fig 2B, Supplemental figs. S2-S3).

BRCA1 c.211A>G, c.212+1G>A and c.212+3A>G caused a similar splicing

defect in minigene experiments (Tables 1 and 2, fig 3): exon 5 skipping and loss of

22 nucleotides due to the use of a cryptic donor site. In contrast, other exon 5

variants, such as c.165G>A and c.178C>T, just induced exon skipping.

Interestingly, the amino acid change p.W31C (BRCA2-c.93G>T) was

previously established to disrupt the DNA repair function of BRCA2.[32] However, we

have found that c.93G>T induced exon 3 skipping and thus the Cys31 codon will not

be present in the mature mRNA (Supplemental fig S2).

Four out of six variants of BRCA2 exon 5 displayed aberrant splicing. BIC

mutations at codon 147 (c.440A>G and c.441A>T) did not affect exon 5 splicing as

c.439C>T, despite the fact that they disrupted the same SRp40 motif (fig 2B).

However, neither variant created a silencer as with c.439C>T (ESRsearch). We then

designed mutation c.439C>A (SRp40 disruption and creation of three ESSs, Table 2)

that also induced exon 5 skipping (fig 2B).

Four out of nine variants caused abnormal splicing of BRCA2 exon 18

(Supplemental Fig. S3). Three of them created cryptic splice sites, causing a deletion

of 298 nucleotides (c.8035G>T) and partial loss of 164 (c.8168A>G), whereas

c.7988A>T induced partial exon skipping (reported in [33]), but also a deletion of

345 nucleotides. Finally, c.8331G>A affected the donor site and provoked total exon

18 skipping. None of the five missense mutations directed to conserved ESE

significantly altered splicing, although variant c.8165C>G [34] showed a weak exon

18 skipping in minigene context, also detected by other authors.[33,35]

Six positive splicing mutations showed simultaneous ESE disruption/ESS

creation by bioinformatic analysis (BRCA1-c.178C>T, BRCA2-c.93G>T, c.439C>A,

c.455C>A, c.470del5, c.473C>T). Only the synonymous mutation BRCA1 c.165G>A

was an apparent strict ESE mutation (three motifs) that caused exon 5 skipping (fig

3).

Seven variants were predicted to truncate the BRCA proteins (Table 2,

Supplemental Table 4), three variants were suggested to cause in-frame deletions of

essential domains (Ring Finger of BRCA1 and PALB2 binding domain of BRCA2), two

variants were predicted to produce both effects, and one missense change

(p.D2723G) with a partial splicing outcome was previously demonstrated to

inactivate BRCA2.[33] Moreover, four variants (BRCA1-c.212+3A>G, c.302-3C>G,

BRCA2-c.7988A>T and c.8168A>G) were previously estimated with odds in favour of

causality of at least 120:1. Altogether these observations support the pathogenicity

of 13 of these splicing variants. The disease causality of the remaining three variants

was uncertain since one of them (c.467A>G) deleted three non-conserved residues

of BRCA2 and two were non-conserved missense variants (BRCA2-c.455C>A and

c.518G>T) that caused partial splicing outcomes.

Regulation of alternative splicing is tissue-specific and it is well known that

tumor cells show global aberrant splicing patterns.[36] We proceeded to confirm all

the results in non-tumor cells from the target tissue of the disease. The positive

mutant minigenes were transfected into non-tumor breast cells (MCF10A). All

anomalous events were corroborated, albeit some quantitative differences between

both types of cells were observed (fig 3). For example, mutations c.165G>A,

c.178C>T, and c.212+1G>A of BRCA1 exon 5 led to almost total exon 5 skipping in

MCF10A, whereas this effect was apparently less pronounced in HeLa. However, the

differences in band intensities were not statistically significant (Fig. 3).

DISCUSSION

A high proportion of BRCA1/2 variants reported in the BIC database have not

been classified as either deleterious or neutral. In this work, we have developed a

powerful combined strategy to study the potential effect of genetic variants on

splicing efficiency: Bioinformatic analysis followed by functional analysis (average

successful rate of 49.1%). Predictions of the splicing software can be considered

useful, but only complementary, tools for identifying candidate splicing mutations

since they must necessarily be confirmed by a functional assay. ESEfinder and

ESRsearch were not so precise, since they systematically recognize all the motifs that

can act as putative regulators. Their sensitivity can be increased by filtering the

output data with other parameters such as strict evolutionary conservation of the

ESE motif, strength and proximity of the splice sites.[7,37,38]

Splicing Functional Assays

We found that 28/57 variants exhibited different degrees and types of

aberrant splicing (Tables 1-2). The minigene assay has been shown to be a

straightforward and reliable method for studying potential splicing mutations without

the need of patient RNA.[39] Results of lymphocyte RT-PCR were reproduced in

minigene experiments in variants tested by both methods,[24-26,33,40-44] except

for quantitative differences of aberrant isoforms.

All anomalous events of HeLa-minigenes were confirmed in breast epithelial

cells-MCF10A (fig 3). These results allowed us to discard possible artefacts derived

from the global alteration of splicing patterns in tumor cells that could have masked

the real splicing consequence.[36] Given that non-tumor breast tissue samples from

BRCA carriers are practically unavailable, the use of minigenes in MCF10A cells is an

excellent approach for reproducing the splicing outcome in this tissue. Finally, the

combination of minigene and PCR mutagenesis techniques allows the splicing

analysis of any DNA variant reported worldwide, as well as mapping of key SREs.

Disruption of splicing regulatory elements.

A wide variety of splicing elements were involved: the natural splice sites (7

mutations), the polypyrimidine tract (2 mutations), cryptic splice sites (7 mutations);

and different exonic SRE motifs (12 mutations), illustrating the high complexity of

exon recognition that depends on multiple parameters.[29] Moreover, an important

fraction of variants affected exonic motifs (12 SREs and seven cryptic splice sites), a

fact that supports the idea that any DNA change should be investigated in depth.

According to ESEfinder and ESRsearch, many different SRE motifs were

involved in aberrant splicing: SC35, SRp40, SRp55, SF2/ASF, hnRNPB and other SREs

without a known binding protein. Most functional SREs were placed in close proximity

to the splice sites, in keeping with the previously reported position effect of these

elements.[38] Computational SRE search produced conflicting results (enhancer

disruption/silencer creation) in 10 positive mutations, but the significance of these

data can only be solved experimentally. For example, in silico analysis of BRCA1

c.5080G>T predicted the disruption of one SF2/ASF enhancer, but it has recently

been demonstrated that the mutant sequence specifically binds to the repressor

factors hnRNPA1/A2 and DAZAP1.[11,12] We found that all the mutations at codon

147 of BRCA2 disrupted the same SRp40 motif, but only two (c.439C>T and

c.439C>A), which created silencers, caused exon 5 skipping, suggesting that the

binding of repressors is the underlying molecular mechanism. These results also

illustrate the fine balance between positive and negative determinants necessary for

exon identity.[45] Alternatively, strict ESE mutations seemed to be BRCA1 c.165G>A

and BRCA2 c.145G>T, which only disrupted conserved ESEs and were correlated

with skipping of their respective exons (figs 2-3).

The influence of the genomic context is another factor that regulates the

splicing process.[7] A representative example is the “splicing interdependence” of the

exon cluster 34-38 of the Neurofibromatosis type I gene, where a mutation of exon

37 (6792C>G) causes skipping of exons 36+37 and exon 37. Our results suggest

that variants c.4379G>A+c.4392T>A of BRCA1 exon 14 triggered skipping of exon

15 and exons 14+15. The exact, underlying mechanism is unknown and should be

confirmed with a minigene containing both exons.

Reclassification of mutations

Reclassification of UVs as deleterious under the splicing viewpoint may notably

increase the proportion of HBOC families who may benefit from tailored prevention

protocols. Thirteen missense, 3 nonsense, 4 synonymous, 1 frameshift and 7 intronic

variants produced abnormal splicing patterns, indicating that any DNA change should

be regarded as a potential splicing mutation. Of these, 20 (12 missense, 4

synonymous, 4 IVS) were previously considered UVs or mere polymorphisms.

Consequently, splicing should be considered a primary mechanism of pathogenicity

to be investigated in UVs. Nevertheless, effects on protein function must not be

disregarded, since several negative missense changes affected strongly conserved

amino acids, supporting their functional importance. Actually, several missense

changes were formerly demonstrated to inactivate BRCA1/2 at the protein

level.[31,33] Another interesting example is missense c.5123C>A (p.A1708E), which

inactivates BRCA1 through a double mechanism: alteration of the protein function

(disruption of the BRCT domain),[31] and a decrease of the exon 18 splicing

efficiency (fig 1) by the binding of specific repressors.[41] Also, BRCA2 c.8168A>G

(p.D2723G) of exon 18 (DNA binding domain) was demonstrated to inactivate BRCA2

at the protein level,[33] but we also found a splicing isoform with a deletion of 164

nucleotides. Intriguingly, the missense mutation p.W31C (c.93G>T) was reported to

disrupt the interaction BRCA2-PALB2, which is essential for recombinational repair

and checkpoint functions.[32] Conversely, our minigene experiment demonstrates

that this mutation induces the almost complete in-frame skip of BRCA2 exon 3 by

disruption of SREs (Table 2), thereby, this amino acid change will not be present in

the majority of mutant proteins and BRCA2-PALB2 interaction would be impeded as

well. It would also be interesting to test p.W31R (c.91T>C), which also abolished

PALB2-BRCA2 interaction,[32] but our bioinformatic analysis indicated no disruption

of the ultraconserved SC35 motif of c.93G>T. Reclassification of missense and

protein truncation mutations (e.g. BRCA2 c.439C>T or c.470del5) as splicing

alterations might also have an impact in the penetrance and expressivity of such

mutations. The reduced penetrance of BRCA1 c.211A>G lends further support to this

hypothesis.[46]

Genetic susceptibility to breast/ovarian cancer

A high proportion (28/57, 49.1%) of assayed mutations disrupted pre-mRNA

processing. This suggests that the prevalence of splicing mutations may have been

vastly underestimated. If we make a short review of the BIC mutations of exons 5-6-

7, 13, 14 of BRCA1 and 3, 5-6-7, 18 of BRCA2, we find 26 variants of the AG/GT

canonical splice sites which, together with our data of such exons, 4 BIC mutations

of our patients (c.211A>G, c.5153C>A, c.68-7T>A and c.145G>T) and 14 positive

engineered BIC mutations, account for 44 splicing variants. They therefore constitute

22.1% of variants of those exons reported in the BIC database, which may be even

higher, given that only two frameshift mutations (c.470_474delAGTCA and

c.594_595delAT) were examined in our study. In comparison, the low-penetrance

genes ATM, CHK2, PALB2 and BRIP1 scarcely make any contribution, with about 50

mutations to BC susceptibility after analysis of a large number of families (Human

Gene Mutation Database11), accounting for less than 2.3% of the familial risk of

breast cancer.[3] Moreover, splicing is the major pathogenic mechanism of BRCA1 in

our HBOC families (58.5% of BRCA1 families), although the mutations c.211A>G,

c.212+1G>A, c.5153-1G>A and c.5123C>A are very frequent in our population (21

families).[24,30] Furthermore, typical screening protocols only scan ~25 Kb out of

the 160 Kb of the genomic sequences of BRCA1/2, so deep intronic mutations may

be missed. For example, the GTAA deletion of intron 20 of the ATM gene promotes

the exonization of a cryptic exon.[47] However, other authors have suggested a

minor role for such mutations in the molecular spectrum of BRCA1/2. [48]

One important question is to elucidate the carcinogenic power of mutations

with incomplete splicing effects. Variants with strong effects (20 variants,

Supplemental Table S4) are probably deleterious, since they inactivate BRCA1/2

functions through protein truncation and/or deletion of essential protein domains.

Moreover, 12 variants have been predicted to be deleterious by an integrated

evaluation approach (Supplemental Table S4),[4] which provides additional support

to our findings. Nevertheless, the involvement in BC susceptibility of weaker splicing

variants, such as c.68-7T>A or c.518G>T of BRCA2 or missense changes with

11 http://www.hgmd.cf.ac.uk/ac/index.php

incomplete effects on protein function, is more uncertain.[27] This question should

be addressed by a more comprehensive study, including supplementary functional

assays and epidemiological and statistical analyses.[4,49] Partial splicing mutations

might contribute to the BOC genetic spectrum, providing low-moderate cancer

susceptibility alleles that might act synergistically with other low penetrance alleles to

increase the general risk of breast cancer. All these parameters should be integrated

in a unique model of BOC risk, which would include susceptibility and protector

alleles,[50] as well as environmental and lifestyle factors, with a view to providing

individual risk assessment, which seems to be one of the most laborious

undertakings.

In conclusion, we have shown that defective splicing is an important

inactivating mechanism of the BRCA genes. Our results also suggest that careful

interpretation is needed for the pathological nature of DNA variants, particularly

when changes in protein function cannot be evaluated. The implantation of simple,

cost effective splicing assays in the genetic diagnostic laboratory may contribute to

the classification of variants of unknown clinical significance. Finally, splicing analysis

of human disease genes also contributes to the basic knowledge of the regulatory

mechanisms of this process.

ACKNOWLEDGEMENTS

We would like to thank the patients and clinicians who collaborated in this

study. We would also like to thank Dr. Francisco E. Baralle, (International Centre of

Genetic Engineering and Biotechnology, Trieste, Italy) for introducing us to the

“minigene game”, Belén Pérez and Lourdes R. Desviat (Universidad Autónoma de

Madrid, Spain) for providing minigene plasmids and helpful suggestions with splicing

assays, and Alan F. Hynds for revising the manuscript. Finally, we are also grateful to

Lara Hernández Sanz and Noemi Martínez Martín for their technical support.

FIGURE LEGENDS

Figure 1. Analysis of putative splicing variants of the BRCA1 and BRCA2 genes by

RT-PCR of lymphocyte RNA from patients with flanking exonic primers. A) Analysis of

splice site variants. Products are visualized after ethidium bromide staining of 1.5-

2.0% agarose gels (inverted images). Boxes indicate exon composition. C, Control

RNA; St, DNA standard: ladder 123 bp (Invitrogen). B) Analysis of enhancer/silencer

variants. C) Evolutionary conservation of enhancers disrupted by mutation

c.5123C>A of BRCA1 exon 18. Conserved SRp55 motif is boxed and non-conserved

SC35 sequence is underlined in Homo sapiens.

Figure 2. Splicing Functional Assays of hybrid minigenes of BRCA2. Boxes indicate

exon structure: V1 and V2 are vector exons. A) Minigene constructions of BRCA2

exons 3 (left) and 23 (right): mutations c.145G>T (lane 2) of exon 3 and mutation

c.8997G>A (lane 5) of exon 23. Wild type minigenes of exons 3 and 23 are shown in

lanes 1 and 4, respectively. Exon 3 skipping caused by mutation c.145G>T is

indicated by an arrow whereas c.8997G>A had no effect on exon 23 splicing. B)

Combined inverted images of agarose gel electrophoreses of RT-PCR of minigenes 5-

6-7 of BRCA2 carrying different mutations. Upper panel: 1, wt minigene; 2, c.426-

12del5; 3, c.439C>T; 4, c.455C>A; 5, wild type minigene + pSPL3; 6, c.473C>T; 7,

c.439C>A; 8, double mutant c.455C>A+c.473C>T; 9, ladder 123 bp; 10,

c.470_474del5; 11, wt minigene. Mutations of lanes 2, 4, 6, 7, 8, and 10 were

created by site-directed mutagenesis. Lower panel: 12, c.455C>A; 13, c.467A>G; 14,

ladder 123 bp. Exon skipping or abnormal splicing are indicated by arrows. RT-PCR

product of c.467A>G slightly migrated below the normal band of the wt minigenes.

Direct sequencing of this band revealed a 9 nucleotide-deletion (right).

Figure 3. Reproducibility of splicing functional assays of BRCA1 minigenes in HeLa

and MCF10A cells. Mutant and wild type minigenes of exons 5-6-7 were tranfected

into HeLa cells (lanes 1-5) and MCF10A cells (lanes 7-11) and RT-PCR was carried

out with exonic vector primers SD6-PSPL3_RTFW and SA2-PSPL3_RTREV. Boxes

indicate exon structure: V1 and V2 are vector exons.An inverted image of a 1.5%

agarose gel is shown. Lanes: 1, wt-Minigene; 2, c.165G>A; 3, c.178C>T; 4,

c.212+1G>A; 5, c.212+3G>A. 6, ladder 123 bp; 7, wt-minigene; 8, c.165G>A; 9,

c.178C>T; 10, c.212+1G>A; 11, c.212+3G>A. These experiments were performed

at least in triplicate and HeLa/MCF10A densitometric values were compared with a t-

test: P=0.97 for c.178C>T (HeLa and MCF10A showed practically identical results),

P=0.29 for c.178C>T, P=0.69 for c.212+1G>A, and P=0.36 for c.212+3G>A.

References [1] Miki Y, Swensen J, Shattuck-Eidens D, et al. A strong candidate for the breast and ovarian cancer

susceptibility gene BRCA1. Science 1994;266:66-71.

[2] Wooster R, Bignell G, Lancaster J, et al. Identification of the Breast-Cancer Susceptibility Gene Brca2. Nature 1995;378:789-92.

[3] Stratton MR, Rahman N. The emerging landscape of breast cancer susceptibility. Nat Genet 2008;40:17-22.

[4] Easton DF, Deffenbaugh AM, Pruss D, et al. A systematic genetic assessment of 1,433 sequence variants of unknown clinical significance in the BRCA1 and BRCA2 breast cancer-predisposition genes. Am J Hum Genet 2007;81:873-83.

[5] Tavtigian SV, Deffenbaugh AM, Yin L, et al. Comprehensive statistical study of 452 BRCA1 missense substitutions with classification of eight recurrent substitutions as neutral. J Med Genet 2006;43:295-305.

[6] Cartegni L, Chew SL, Krainer AR. Listening to silence and understanding nonsense: Exonic mutations that affect splicing. Nat Rev Genet 2002;3:285-98.

[7] Buratti E, Baralle M, Baralle FE. Defective splicing, disease and therapy: searching for master checkpoints in exon definition. Nucleic Acids Res 2006;34:3494-510.

[8] Lopez-Bigas N, Audit B, Ouzounis C, Parra G, Guigo R. Are splicing mutations the most frequent cause of hereditary disease? FEBS Lett 2005;579:1900-3.

[9] Wang GS, Cooper TA. Splicing in disease: disruption of the splicing code and the decoding machinery. Nat Rev Genet 2007;8:749-61.

[10] Baralle D, Baralle M. Splicing in action: assessing disease causing sequence changes. J Med Genet 2005;42:737-48.

[11] Liu HX, Cartegni L, Zhang MQ, Krainer AR. A mechanism for exon skipping caused by nonsense or missense mutations in BRCA1 and other genes. Nat Genet 2001;27:55-8.

[12] Goina E, Skoko N, Pagani F. Binding of DAZAP1 and hnRNPA1/A2 to an exonic splicing silencer in a natural BRCA1 exon 18 mutant. Mol Cell Biol 2008;28:3850-60.

[13] Tournier I, Vezain M, Martins A, et al. A large fraction of unclassified variants of the mismatch repair genes MLH1 and MSH2 is associated with splicing defects. Hum Mutat 2008;29:1412-24.

[14] Infante M, Duran M, Esteban-Cardenosa E, Miner C, Velasco E. High proportion of novel mutations of BRCA1 and BRCA2 in breast/ovarian cancer patients from Castilla-Leon (central Spain). J Hum Genet 2006;51:611-7.

[15] Velasco E, Infante M, Duran M, et al. Heteroduplex analysis by capillary array electrophoresis for rapid mutation detection in large multiexon genes. Nat Protoc 2007;2:237-46.

[16] Reese MG, Eeckman FH, Kulp D, Haussler D. Improved splice site detection in Genie. J Comput Biol 1997;4:311-23.

[17] Cartegni L, Wang J, Zhu Z, Zhang MQ, Krainer AR. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res 2003;31:3568-71.

[18] Goren A, Ram O, Amit M, et al. Comparative analysis identifies exonic splicing regulatory sequences--The complex definition of enhancers and silencers. Mol Cell 2006;22:769-81.

[19] Fairbrother WG, Yeo GW, Yeh R, et al. RESCUE-ESE identifies candidate exonic splicing enhancers in vertebrate exons. Nucleic Acids Res 2004;32:187-90.

[20] Zhang XHF, Chasin LA. Computational definition of sequence motifs governing constitutive exon splicing. Genes Dev 2004;18:1241-50.

[21] Larkin MA, Blackshields G, Brown NP, et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007;23:2947-8.

[22] Soule HD, Maloney TM, Wolman SR, et al. Isolation and characterization of a spontaneously immortalized human breast epithelial cell line, MCF-10. Cancer Res 1990;50:6075-86.

[23] Tesoriero AA, Wong EM, Jenkins MA, et al. Molecular characterization and cancer risk associated with BRCA1 and BRCA2 splice site variants identified in multiple-case breast cancer families. Hum Mutat 2005;26:495.

[24] Vega A, Campos B, Bressac-de-Paillerets B, et al. The R71G BRCA1 is a founder Spanish mutation and leads to aberrant splicing of the transcript. Hum Mutat 2001;17:520-1.

[25] Thomassen M, Kruse TA, Jensen PK, Gerdes AM. A missense mutation in exon 13 in BRCA2, c.7235G>A, results in skipping of exon 13. Genet Test 2006;10:116-20.

[26] Beristain E, Martinez-Bouzas C, Guerra I, et al. Differences in the frequency and distribution of BRCA1 and BRCA2 mutations in breast/ovarian cancer cases from the Basque country with respect to the Spanish population: implications for genetic counselling. Breast Cancer Res Treat 2007;106:255-62.

[27] Vreeswijk MP, Kraan JN, van der Klift HM, et al. Intronic variants in BRCA1 and BRCA2 that affect RNA splicing can be reliably selected by splice-site prediction programs. Hum Mutat 2009;30:107-14.

[28] Wu K, Hinson SR, Ohashi A, et al. Functional evaluation and cancer risk assessment of BRCA2 unclassified variants. Cancer Res 2005;65:417-26.

[29] Hertel KJ. Combinatorial control of exon recognition. J Biol Chem 2008;283:1211-5.

[30] Infante M, Duran M, Acedo A, et al. BRCA1 5272-1G>A and BRCA2 5374delTATG are founder mutations of high relevance for genetic counselling in Breast/Ovarian cancer families of Spanish origin. Clin Genet 2009;doi: 10.1111/j.1399-0004.2009.01272.x.

[31] Vallon-Christersson J, Cayanan C, Haraldsson K, et al. Functional analysis of BRCA1 C-terminal missense mutations identified in breast and ovarian cancer families. Hum Mol Genet 2001;10:353-60.

[32] Xia B, Sheng Q, Nakanishi K, et al. Control of BRCA2 cellular and clinical functions by a nuclear partner, PALB2. Mol Cell 2006;22:719-29.

[33] Farrugia DJ, Agarwal MK, Pankratz VS, et al. Functional assays for classification of BRCA2 variants of uncertain significance. Cancer Res 2008;68:3523-31.

[34] Fackenthal JD, Cartegni L, Krainer AR, Olopade OI. BRCA2 T2722R is a deleterious allele that causes exon skipping. Am J Hum Genet 2002;71:625-31.

[35] Kuznetsov SG, Liu P, Sharan SK. Mouse embryonic stem cell-based functional assay to evaluate mutations in BRCA2. Nat Med 2008;14:875-81.

[36] Kim E, Goren A, Ast G. Insights into the connection between cancer and alternative splicing. Trends Genet 2008;24:7-10.

[37] Pettigrew C, Wayte N, Lovelock PK, et al. Evolutionary conservation analysis increases the colocalization of predicted exonic splicing enhancers in the BRCA1 gene with missense sequence changes and in-frame deletions, but not polymorphisms. Breast Cancer Res 2005;7:R929-R939.

[38] Fairbrother WG, Holste D, Burge CB, Sharp PA. Single nucleotide polymorphism-based validation of exonic splicing enhancers. Plos Biology 2004;2:1388-95.

[39] Bonnet C, Krieger S, Vezain M, et al. Screening BRCA1 and BRCA2 unclassified variants for splicing mutations using reverse transcription PCR on patient RNA and an ex vivo assay based on a splicing reporter minigene. J Med Genet 2008;45:438-46.

[40] Claes K, Vandesompele J, Poppe B, et al. Pathological splice mutations outside the invariant AG/GT splice sites of BRCA1 exon 5 increase alternative transcript levels in the 5' end of the BRCA1 gene. Oncogene 2002;21:4171-5.

[41] Millevoi S, Bernat S, Telly D, et al. The c.5242C>A BRCA1 missense variant induces exon skipping by increasing splicing repressors binding. Breast Cancer Res Treat 2009;DOI 10.1007/s10549-009-0392-3.

[42] Machackova E, Foretova L, Lukesova M, et al. Spectrum and characterisation of BRCA1 and BRCA2 deleterious mutations in high-risk Czech patients with breast and/or ovarian cancer. BMC Cancer 2008;8:140.

[43] Zhang L, Bacares R, Boyar S, Hudis C, Nafa K, Offit K. cDNA analysis demonstrates that the BRCA2 intronic variant IVS4-12del5 is a deleterious mutation. Mutat Res 2009;663:84-9.

[44] Kuznetsov SG, Liu P, Sharan SK. Mouse embryonic stem cell-based functional assay to evaluate mutations in BRCA2. Nat Med 2008;14:875-81.

[45] Pagani F, Stuani C, Tzetis M, et al. New type of disease causing mutations: the example of the composite exonic regulatory elements of splicing in CFTR exon 12. Hum Mol Genet 2003;12:1111-20.

[46] Milne RL, Osorio A, Cajal TR, et al. The average cumulative risks of breast and ovarian cancer for carriers of mutations in BRCA1 and BRCA2 attending genetic counseling units in Spain. Clin Cancer Res 2008;14:2861-9.

[47] Pagani F, Buratti E, Stuani C, Bendix R, Dork T, Baralle FE. A new type of mutation causes a splicing defect in ATM. Nat Genet 2002;30:426-9.

[48] Caux-Moncoutier V, Pages-Berhouet S, Michaux D, et al. Impact of BRCA1 and BRCA2 variants on splicing: clues from an allelic imbalance study. Eur J Hum Genet 2009.

[49] Kuznetsov SG, Liu P, Sharan SK. Mouse embryonic stem cell-based functional assay to evaluate mutations in BRCA2. Nat Med 2008;14:875-81.

[50] Cox A, Dunning AM, Garcia-Closas M, et al. A common coding variant in CASP8 is associated with breast cancer risk. Nat Genet 2007;39:352-8.

BRCA1

53 6

5Δ223 61312 14

12 14

BRCA2

C StSt Cc.212+1G>A c.7007G>A

3 6

10

10Δ147

BRCA2

C Stc.1763A>GA)

12 143 6

BRCA2c.439C>T

C St

BRCA1

1413 15

c.4379G>A +c.4392T>A

St C

BRCA1c.5123C>A

CSt

B)

SRp55

5 643

643

1413 15

1413

13

1817 19

17 19

Homo sapiens (c.5113-5133) CTAGGAATTGCGGGAGGAAAABos taurus CTGGGAATTGCAGGAGGAAAACanis familiaris CTGGGTATTGCAGGAGGAAAARattus norvegicus CTGGGCATTGCAGGAGGAAAG5242C>A CTAGGAATTGaGGGAGGAAAA

C)

Figure 1

A)A)

1 2 3 4 5

V1 V2 Ex23 V1 V2 Ex3

B)

V1 V2 V1 V2

2 3 4 5 6 7 8 9 10 111

V1 Ex5 Ex6 V1 Ex6

12 13 14 15

tacacatgtaacaccacaaagagtggtatgtgggagtttgtttc

DELETION 9 nt [ataagtcag]

exon 6exon 5

Figure 2

wt

Ex5 del22

Ex5 skipping

V1 Ex5 Ex6 Ex7 V2

V1 Ex5 Ex6 Ex7 V2

V1 Ex6 Ex7 V2

1 2 3 4 5 6 7 8 9 10 11

Figure 3.

Table 1. Bioinformatic analysis and RT-PCR results of mutations affecting pre-mRNA processing of BRCA1 and BRCA2.

DNA variant* (BIC) /Type

No. Fam.

Clinical characteristics† Bioinformatic study Splicing Regulatory Elements‡ mRNA Effect § Protein Effect|| Carriers

Untested Relatives

BRCA1 c.211A>G (330A>G) / Mis 5 5 BC +3 bBC 8 BC, 1 Cx, 1 CRC

Splice site disruption/Cryptic donor site 22 nt upstream -[NNSPLICE]

Ex 5del22 Ex 5 skipping [Ly-RT/MG]

PT (p.Cys64X) + IFD (p.Phe46_Arg71del)-Ring Finger

c.212+1G>A (331+1G>A) /IVS 3 2 BC+3 OC

3 BC, 2 OC, 1 Bla, 1 End, 1 CRC

Splice site disruption/ Cryptic donor site-[NNSPLICE]

Ex 5del22 Ex 5 skipping [Ly-RT/MG]

PT (p.Cys64X) + IFD (p.Phe46_Arg71del)-Ring Finger

c.4379G>A /Mis + c.4392T>A /Syn 2 2 BC 2 BC

ESS creation-[PESX] ESE disruption/SRp40,SC35-[ESEfinder]

Ex 15 skipping Ex 14-15 skipping [Ly-RT] ||

PT (p.Ser1496GlyfsX13) + IFD (p.Ala1453_Leu1588del) –SCD

c.5123C>A (5242C>A) /Mis 6 3 bBC, 4 BC

14 BC, 1 OC , 2 GC, 1 End, 1 CRC

ESE disruption/SC35,SRp55-[ESEfinder] ESS creation-[PESX/ESRsearch]

Partial exon 18 skipping [Ly-RT]

IFD (p.Asp1692Gly, Ala1693_Trp1718del)-BRCT + p.A1708E (P. F.)

c.5153-1G>A (5272-1G>A) / IVS 7

10 BC, 2 bBC, 2 OC + 1 CRC

10 BC, 4 OC, 4 GC, 10 others

Splice site / Cryptic acceptor site 1nt downstream -[NNSPLICE] 1 nt deletion [Ly-RT] PT (p.Val1719X)

c.5277+1G>A (5396+1G>A) / IVS 1 1 BC (5 OC) [23] 1 BC Splice site disruption-[NNSPLICE]

Retention 87 nt Intron 20, Ex 20 skipping

IFD (p.His1732_Lys1759del)-BRCT + PT (p.Lys1759_Ile1760ins29)

BRCA2 c.68-7T>A (296-7T>A) / IVS 2 2 BC

5 BC, 1 GC, 1 leukemia Polypyrimidine tract-[NNSPLICE] Partial ex 3 Skipping [MG] IFD (p.Asp23_Leu105del)-PBD + wt

c.145G>T (373G>T) /Non 1 2 BC 3 BC, 1 OC

ESE disruption/SF2/ASF-[ESEfinder/PESR] Ex 3 Skipping [MG] IFD (p.Asp23_Leu105del)-PBD

c.439C>T (667C>T) /Non 1 1 BC 2 BC, 1 bBC, 2 OC

ESE disruption/SRp40-[ESEfinder] ESS creation-[PESX] Ex 5 skipping [Ly-RT/MG] PT (p.Pro143GlyfsX22)

c.1763A>G (1991A>G) /Mis 1 1 bBC

Cryptic donor site 147 nt upstream-[NNSPLICE] Del 147 nt-ex10 [Ly-RT] IFD (p.Asn588_Gly637del, p.N588S)

c.7007G>A (7235G>A) /Mis 1 3 BC Splice site disruption-[NNSPLICE] Ex13 Skipping [Ly-RT] PT (p.Gly2313AlafsX40) c.9234C>T (9462C>T) /Syn 1 1 BC

ESE disruption/SRp40-[ESEfinder/PESR] ESS creation-[Rescue-ESE/PESX ]

Partial ex24 skipping [Ly-RT] PT (p.Val3040AspfsX18)+ wt

* Mutations described at the BIC database are shown in bold. The rest of the mutations were described by our group[14]. Descriptions of mutations follow the nomenclature guidelines of the Human Genome Variation Society (www.hgvs.org). BIC nomenclature is shown between parentheses. Types of mutations are indicated: Syn, Synonymous; Non, Nonsense; IVS, Intronic Variant; Mis, Missense. † BC, breast cancer; bBC: bilateral breast cancer; Bla, bladder cancer; Cx, cervix cancer, CRC, colorectal cancer; GC, gastric cancer; OC, ovarian cancer. Mutation c.7007G>A has been found in another family with bilateral breast cancer and male breast cancer.[25] ‡ ESE: Exonic Splicing Enhancer; ESS: Exonic Splicing Silencer; nt, nucleotide. Splicing prediction programs are shown between brackets: NNSPLICE, PESR, Rescue-ESE, PESX, PESR and ESRsearch. Full data of bioinformatic study are available upon request. § Method between brackets: Ly-RT, Lymphocyte RT-PCR; MG, Minigene assay; Ex; Exon; Del, deletion.. Effects of mutations c.211A>G, c.5153-1G>A, c.5277+1G>A and c.7007G>A on lymphocyte RNA have also been reported [23-26]. || Mutation designations (protein level) according to the Human Genome Variation Society (www.hgvs.org) are between parentheses. Protein Effect: PT, Protein Truncation; IFD, In-frame deletion; BRCT, BRCA1 C-Terminal Domains (amino acids 1,646-1,859); PBD, PALB2 Binding Domain; SCD, SQ-cluster domains (amino acids 1,280-1,524) that are preferred sites of ATM phosphorylation.

Table 2. BIC and artificial mutations engineered by site-directed mutagenesis that showed aberrant splicing in minigene assays.

DNA variant

(BIC) – Type of mutation* Exon # BIC records

Bioinformatic study Splicing Regulatory Elements † mRNA Effect§ Protein Effect§

BRCA1 c.165G>A (284G>A) /Syn 5 - ESE disruptions/2 SRp40, SF2-[ESEfinder] Ex5 skipping IFD (p.Phe46_Arg71del)-Ring Finger

c.178C>T (297C>T) /Non 5 4 ESE disruptions/2 SF2, SRp55 -[ESEfinder]ESS creation-[Rescue-ESE] Ex5 skipping IFD (p.Phe46_Arg71del)-Ring Finger

c.212+3A>G (331+3A>G) /IVS I-5 13 Donor site disruption-[NNSPLICE] Ex5del22 + ex 5 skipping

PT (p.Cys64X) + IFD (p.Phe46_Arg71del)-Ring Finger

c.302-3C>G (421-3C>G) /IVS I-6 3 Cryptic acceptor site-[NNSPLICE] 2 nt insertion ex7 PT (p.Ser72GlyfsX17)

BRCA2

c.93G>T (321G>T) /Mis 3 1 ESE disruption/SC35 -[ESEfinder/PESR] ESS creation-[ESRsearch] Ex3 skipping IFD (p.Asp23_Leu105del)-PBD

c.426-12del5 (654-12del5) /IVS I-4 1 Polypyrimidine tract-[NNSPLICE] Ex5 skipping PT (p.Pro143GlyfsX22)

c.439C>A (667C>A) /Mis 5 - ESE disruption/SRp40 -[ESEfinder] 3 ESS creation-[PESX] Ex5 skipping PT (p.Pro143GlyfsX22)

c.455C>A (683C>A) /Mis 5 1 ESE disruption/SRp40 -[ESEfinder] ESS creation-[PESX] Partial ex5 skipping PT (p.Pro143GlyfsX22) + p.T152K

c.467A>G (695A>G) /Mis 5 8 Cryptic donor 9 nt upstream-[NNSPLICE] 9 nt del ex5 IFD (p.Asp156_Ser158del) (N.C.)

c.470_474del5 (698del5) /Fr 5 1 ESE disruptions/SF2,SC35,SRp55 -[ESEfinder] ESS creation-[Rescue-ESE] Ex5 skipping PT (p.Pro143GlyfsX22)

c.473C>T (701C>T) /Mis 5 4 ESE disruptions/SF2,SRp55 -[ESEfinder] 5 ESS creation-[Rescue-ESE] Ex5 skipping PT (p.Pro143GlyfsX22)

c.518G>T (746G>T) /Mis 7 1 Cryptic donor site -[NNSPLICE] Partial ex7 skipping PT (p.Gly174SerfsX19)+ p.G173V (N.C.)

c.7988A>T (8216A>T) /Mis 18 9 Cryptic donor site-[NNSPLICE] Partial loss of 345 nt +Partial ex18 skipping

IFD (p.Glu2663_Lys2777del) + PT (p.Tyr2664PhefsX43)+p.E2663V-DBD

c.8035G>T (8263G>T) /Mis 18 1 Cryptic donor site-[NNSPLICE] Loss of 298 nt PT (p.Asp2679PhefsX43)-DBD c.8168A>G (8396A>G) /Mis 18 6 Cryptic donor site-[NNSPLICE] Partial loss of 164 nt PT (p.Gly2724PhefsX3)+p.D2723G (DBD-P. F.) c.8331G>A (8559G>A) /Syn 18 - Splice site disruption-[NNSPLICE] Exon 18 skipping PT (p.Tyr2664PhefsX43)

* Artificial mutations 284G>A and 667C>A are italicized whereas BIC mutations are shown in bold. BIC nomenclature of mutations is shown between parentheses. Types of mutations are indicated: Syn, Synonymous; Non, Nonsense; IVS, Intronic Variant; Mis, Missense; Fr, Frameshift. DNA change c.8331G>A (8559G>A) of the BIC database is incorrectly assigned to codon 2776 (p.K2777K). † ESE: Exonic Splicing Enhancer; ESS: Exonic Splicing Silencer. Splicing prediction programs are shown between brackets: PESR, Rescue-ESE, PESX and ESEfinder. Full data of bioinformatic study are available upon request. Evolutionarily conserved binding motifs of SR proteins are underlined. ‡ Ex, exon; del, deletion; nt, nucleotide § Mutation designations (protein level) according to the Human Genome Variation Society (www.hgvs.org) are between parentheses. Protein Effect: PT, Protein Truncation; IFD, In-frame deletion; PBD, PALB2 Binding Domain; DBD, DNA Binding Domain; N.C., Not conserved; P.F., Missense changes that affect the protein function.