RESEARCH ARTICLE

A Dysfunctional Sense of Smell: The Irreversibility of OlfactoryEvolution in Free-Living Pigs

Valeria Maselli • Gianluca Polese • Greger Larson • Pasquale Raia •

Nicola Forte • Daniela Rippa • Roberto Ligrone • Rosario Vicidomini •

Domenico Fulgione

Received: 11 March 2013 / Accepted: 4 November 2013 / Published online: 13 November 2013

� Springer Science+Business Media New York 2013

Abstract Artificial selection began to override natural

selection in domesticated wild boar and other species about

10,000 years ago. The intentional selection of a desired

phenotypic trait is a complex process, and comes along

with unexpected or even unwanted changes in other traits,

because of epistatic gene effects, and ontogenetic con-

straints. The loss of brain mass in domestic ungulates is

related to selection for reduced reaction to external stimuli.

Evolutionary losses in body structures and genes were once

considered mostly irreversible, in keeping with Dollo’s

law. Here we studied the biochemical and the histological

functioning of the free-living pigs (FLPs) olfactory system,

to see if and to what extent does FLPs regain a full sense of

smell, as compared to the domestic pigs and wild boar Sus

scrofa. In our samples both wild boars and FLPs have

significantly larger brain per unit mass than domestic pigs,

and FLPs’ brains are not significantly smaller than wild

boar’s. Similarly, both wild boars and FLPs have signifi-

cantly higher cell density than domestic pigs in the olfac-

tory mucosa. Yet, at the functional level, olfactory marker

protein and neuropeptide Y, both of which are important to

the correct functioning of the sense of smell, are fully

expressed only in wild boar. These results suggest that

FLPs reacquired structural, but not the biochemical capa-

bility in their olfactory system.

Keywords Smell � Free-living pig � Evolution �Domestication � Wild boar � Brain

Introduction

Artificial selection started to override natural selection in

domesticated breeds of wolves, wild boar and a few other

species some 10,000 years ago (Bokonyi 1974; Hemmer

1990; Giuffra et al. 2000; Larson et al. 2007). Humans took

a leading role in these species evolution since, by

exploiting existing genetic variation in their livestock and

pets in order to fulfil their own economic interests (Roots

2007). To successfully manage domesticates, early farmers

selected animals with reduced wariness and aggressiveness

(Price 1998, 2002; Albert et al. 2012; Zeder 2012). Asso-

ciated with this selection was a strong reduction in brain

size in the domesticates. The extent of brain mass loss goes

from about 10 % in pet rodents, to 15–25 % in domestic

ungulates, to[30 % in pigs and carnivores (Kruska 1988).

Not all brain structures were affected equally. The

greatest loss of the cerebral mass took place in the telen-

cephalon, and in the limbic system in particular. This is

unsurprising since the limbic system controls behavioral

Valeria Maselli and Gianluca Polese have contributed equally to this

study.

V. Maselli � R. Ligrone

Department of Environmental Biological and Pharmaceutical

Sciences and Technologies, Second University of Naples SUN,

Via Vivaldi 48, 81100 Caserta, Italy

V. Maselli � G. Polese � N. Forte � D. Rippa � R. Vicidomini �D. Fulgione (&)

Department of Biology, University of Naples Federico II,

Campus Monte S. Angelo, 80126 Naples, Italy

e-mail: fulgione@unina.it

G. Larson

Durham Evolution and Ancient DNA, Department of

Archaeology, University of Durham, Durham DH1 3LE, UK

P. Raia

Department of Earth Sciences, Resources and Environment,

University of Naples Federico II, Largo San Marcellino 10,

80138 Naples, Italy

123

Evol Biol (2014) 41:229–239

DOI 10.1007/s11692-013-9262-3

responses to external stimuli (reviewed in Zeder 2012).

Thus, reduction in limbic structures is directly linked to

selection for reduced wariness and aggressiveness. Despite

the generalized nature of these observations across species

as phylogenetically distant as cats and birds (Kruska 1988;

Ebinger and Rohrs 1995; Price 2002), there are notable

differences in brain functioning among domestic species.

For instance, brain parts involved in the senses of hearing

and smell in pigs are less reduced than visual centers, as

compared to other domesticates (Plogmann and Kruska

1990).

Evolutionary losses in body structures and genes were

once considered mostly irreversible. In evolutionary biol-

ogy, this idea is known as Dollo’s law (Dollo 1893, 1922;

Gould 1970; Porter and Crandall 2003). Although Dollo’s

law is pervasive, exceptions are common. Evolutionary

reversals have been shown to occur in the dentition of the

lynx (Kurten 1963), limb muscles in birds (Raikow et al.

1975), life cycle in marsupial frogs (Wiens et al. 2007),

sight in blind cavefish (Borowsky 2008), oviparity in sand

boas (Lynch and Wagner 2010), and might be even more

common among invertebrates. The number of exceptions

undermines the interpretation of Dollo’s idea as a ‘‘law’’

(Collin and Miglietta 2008). In particular, the most logi-

cally prominent explanation for Dollo’s law, i.e. the

accumulation of deleterious mutations in genes coding for

no longer expressed phenotype, is regarded as potentially

ineffective. Given normal mutation rates, it may take up to

10–20 million years to inactivate these genes, leaving a

large window of time for the lost phenotype to reappear.

Genes linked to pleiotropic pathways may survive in a

functionally unaltered manner even longer. Overall, this

suggests that evolutionary reversals are quite possible

(Collin and Miglietta 2008).

Like the observations that gave rise to Dollo’s Law,

phenotypic changes that result from the domestication

process are often described as irreversible. For instance,

populations of once-domestic species that have lived for

many generations outside human influence (a process

known as feralization) do not regain brain mass. This is

true of feral sheep (Groves 1989), dingoes (Schultz 1969),

and a variety of other mammals (Birks and Kitchener

1999). In contrast, a study of feral pigs in the Galapagos

that lived in the wild for 150 years, found a significant

size increase in brain structures related to olfaction, which

still suggests that pigs may retain a large fraction of their

olfactory system functionality (Plogmann and Kruska

1990). In fact, the positive relationship between the pro-

portional size of brain structures related to olfaction and

olfactory capability was proven for a variety of mammals

(Barton and Harvey 2000), including carnivores (Gittle-

man 1991), primates (Barton et al. 1995; Barton 1996),

‘‘insectivores’’ (Barton et al. 1995), and chiropters (Barton

et al. 1995; Hutcheon et al. 2002; Safi and Dechmann

2005). Here, in order to test the degree to which domestic

pigs can regain a full sense of smell once freed from

captivity, we studied the biochemical and histological

functioning of suid olfactory system in wild boar,

domestic pig, and Sardinian free-living pig (FLP)

populations.

According to the zoo-archaeological record Sus scrofa

presence in Sardinia traces back to the first human settle-

ments on the islands, during the early Neolithic (Wilkens

2003; Albarella et al. 2006). The Sardinian wild boar

population is supposed to have originated when pigs

escaped from human control and became wild during the

Neolithic (Albarella et al. 2006; Scandura et al. 2011).

Sardinian populations of wild boar and pig breed have

experienced a multi-millennial history of independent

evolution (geographic isolation) (Scandura et al. 2008,

2009; Larson et al. 2005; Randi 1995) followed by intro-

gressive hybridisation, and by gene flow with continental

wild boars transplanted on the island only in recent years

(Scandura et al. 2011). Nowadays FLPs live in open air

conditions since a number of generations, therefore they

are domesticated pigs which are exposed to the same

selective pressures as wild boars. In summary, two genet-

ically distinct free populations exist in Sardinia: wild boars,

deriving from the mentioned ancient introduction, and

FLPs, of uncertain origin.

Here, we compared the density of receptor cells of the

olfactory epithelium in wild boar, domestic pig, and FLP

individuals. Receptor cells are the primary sensory neu-

rons. In addition to structural differences among the three

strains analysed, we assayed quantitatively expression

levels in both the olfactory marker protein (OMP), and

neuropeptide Y (NPY). The OMP is a protein involved in

signal transduction, found in mature olfactory receptor

neurons of all vertebrates. OMP is a modulator of the

olfactory signal-transduction cascade. The NPY is a

widespread polypeptide in the central nervous system and

the autonomic nervous system. It participates to the regu-

lation of hunger, and to the modulation of the vasocon-

strictor response triggered by noradrenergic neurons

(Mousley et al. 2006; Di Bona 2002). The NPY is a key

molecule in the development and regeneration of the

olfactory epithelium (Hansel et al. 2001). It was shown that

NPY is expressed at the level of microvillous cells with

axonal process of the olfactory mucosa (Montani et al.

2006).

We compared the expression patterns of two olfactory

sensory neurons (OMP and NPY) in Sardinian FLP and

Southern Italian wild boar. In addition, we compared them

to domestic pigs. We first verified that domestic pigs show

proportionally smaller brains than wild boar, as extensively

reported in literature. Then, we tested if Sardinian FLPs

230 Evol Biol (2014) 41:229–239

123

have regained brain mass and complete olfactory function

through the ‘‘feralization’’ process they underwent. If FLP

shows brain size and OMP and NPY functionality com-

parable to wild boar, our data would indicate that the loss

of functioning in the olfactory system which is common in

domestic pigs was probably reversed by free living life

style.

Materials and Methods

Wild boars, domestic pigs, and FLPs were tested for

morphological and bio-molecular differences in the olfac-

tory epithelium and brain size. To perform the experiments,

we sacrificed 10 individuals for each category (Fig. 1c, d,

e). It is obviously not possible to test the domestic ances-

tors of Sardinian FLP, since they are no longer existent. As

such, we compared Sardinian FLP, and wild boar to

commercial pig individuals we sampled from 3 different

slaughterhouses in peninsular Italy. All adult domestic pigs

were [1 years old and weighing between 160 and 200 kg.

FLP and wild boar were both culled in the field. FLPs came

from Sardinia, in the occidental part of the Ogliastra region

(Lanusei, Punta Marmora). All the culled individuals were

adult (mean height at the withers = 50 cm, ran-

ge = 44–62 cm), and weighing between 50 and 70 kg

(mean = 58 kg). These are in fact FLPs, deliberately

reared in open-air and infrequently provided with supple-

mental food by local people, yet used to search for food on

their own. We urge the reader to consider that we were not

interested here in sizing up the extent of olfactory system

recovery (if any) in Sardinian FLP. Rather, we tested

whether the Sardinian FLP regained functional olfactory

system as free-living animals, after they passed through

domestication.

Wild boars came from wild populations living in the

Cilento and Vallo di Diano National Park (Southern Italy).

They were all adults, [1 years old as judged from coat

Fig. 1 Morphology of Olfactory Mucosa and diversity of samples. a Sagittal section of a pig head; b transversal section of Olfactory Mucosa

stained with Mayer’s Acid Alum Hematoxylin; the diversity of three forms is exemplified in pictures of c wild boar; d domestic pig; e FLP

Evol Biol (2014) 41:229–239 231

123

pattern and medium height at the withers (mean height at

the withers = 65 cm) and then confirmed by inspection of

the dentition after culling. The culled animals weighted

between 65 and 80 kg (mean = 71 kg).

We analysed the highly polymorphic melanocortin

receptor 1 (MC1R) coat colour gene because it might be a

useful marker for detecting natural hybridisation between

FLPs and wild boars (Frantz et al. 2012, 2013; Krause-

Kyora et al. 2013). Various studies support the use of this

gene as a tool for distinguishing breeds in a range of animal

species. In particular, MC1R allelic variants are closely

associated to particular breeds and colour morphs in S.

scrofa (Johansson Moller et al. 1996; Kijas et al. 1998,

2001; Marklund et al. 1996; Giuffra et al. 2002; Pielberg

et al. 2002; Fang et al. 2009; Koutsogiannouli et al. 2010).

For each specimen, we amplified fragments of MC1R with

different pairs of primers to analyse all the polymorphisms

in the coding region [MERL1, EPIG1, EPIG3R (Kijas et al.

1998); MF1 MR1 (Li et al. 2010)]. We determined the

entire MC1R coding sequence (963 bp). The amplifications

were carried out on 50 ng of genomic DNA in a 25 ll final

volume containing 2.5 ll PCR buffer (10x), 200 mM of

each dNTP, 20 pmol of each primer and 1 U Phusion High-

Fidelity DNA Polymerase (Thermo Scientific). PCR reac-

tion times were: 4 min of initial strand denaturation at

94 �C, followed by 40 cycles each comprising 30 s of

strand denaturation at 94 �C, 40 s of annealing at 58 �C

and 40 s of extension at 72 �C and a final extension of

5 min. PCR products were purified by Exo/SAP digestion

were directly sequenced using the forward primer the

BigDye Terminator kit version 3.1 (Applied Biosystems).

Fragments were finally purified in columns loaded with

DyeEx 2.0 Spin Kit (Qiagen); and run in an ABI PRISM

3100 Avant automatic sequencer (Applied Biosystems).

Ambiguous positions were verified by re-sequencing the

target region with the internal reverse primer. The

sequences of MC1R were aligned and edited by Geneious

version 5.4 (Drummond et al. 2011) analysing nucleotide

composition and variable sites polymorphisms, compared

with GenBank Sequences and assigned to different breeds.

We performed all of the analyses on all specimens

(n = 30). All the activities were performed in full respect

of the Italian law.

Morphological, Histological and Immunohistochemical

Analyses

Brain Size

To assess the relative size of the brain, we weighed the

brain mass and computed the brain to body mass ratio. The

olfactory mucosa was separated and fixed in Bouine’s fluid.

For each individual a tissue sample was isolated in order to

perform DNA extraction. We relied on known phenotypic

changes with ontogeny in both wild boar and FLP to select

animals that were approximately 1 year old.

Histological and Immunohistochemical Analyses

of the Olfactory System

We fixed strands of the olfactory mucosa for each speci-

men in Bouine’s fluid and stained as follows. After fixa-

tion, horizontal sections (7 lm thick) were cut, mounted on

slides and stained using the classical histochemical meth-

ods hematoxylin-eosin (HE). The One-Way ANOVA with

post hoc was used to compare in the means in neuronal

counts among samples.

Immunohistochemical analyses were developed on two

markers of neurons’ functionality: NPY and OMP. The

sections of olfactory mucosa were incubated in serum at a

1:100 dilution in PBS (Normal Goat Serum and Normal

Rabbit Serum for NPY and OMP, respectively) for 20 min,

washed and then incubated in primary antibody (Rabbit

anti-NPY, 1:3000 in PBS, 1:10000 in PBS, Goat anti-OMP,

1:10000 in PBS) for 24 h. After washings the sections were

incubated in secondary antibody 1:200 dilution in PBS

(Goat anti-Rabbit biotinylated and Rabbit anti Goat bio-

tinylated, respectively) for 45 min. After second washings

the sections were incubated in streptavidine horseradish

peroxidase (HRP) conjugated, 1:200 dilution in PBS. After

the HRP-diaminobenzidine reaction, sections were viewed

and photographed using a Laica optical microscope.

Gene Expression

To determine OMP and NPY mRNA expression levels,

total cellular RNA was isolated from tissues using TRI

Reagent (SIGMA) according to manufacturer’s recom-

mendations. The quantity and quality of total RNA was

determined by spectrometry and agarose gel electrophore-

sis, respectively. The RNA was purified using RQ1 RNase-

Free DNase (Promega).

Table 1 Sequence of primers and size of amplicones used in the semi

quantitative and quantitative PCR

Primer Sequence Amplicone size

NPY 50CTCGGCGTTGAGACATTACA

30CACTTCCCATCACCACACAG

157 bp

OMP 50ACCTCACCAACCTCATGACC

30CCCGAAGGAGATGAGGAAAT

170 bp

ACTB 50AGAGCGCAAGTACTCCGTGT

30AAAGCCATGCCAATCTCATC

210 bp

NPY neuropeptide Y, OMP olfactory marker protein, ACTB beta actin

232 Evol Biol (2014) 41:229–239

123

cDNA was synthesised using a Superscript III First-

Strand Synthesis System with Random Hexamers (Invit-

rogen) and as control of the cleaning from DNA, RT(?)

and RT(-) in order to amplify the collinear 5S gene were

performed. Gene expression levels were measured using

semi-quantitative PCR performed with Dream Taq (Fer-

mentas). The actin gene was analysed simultaneously as a

control, and used for normalisation of data. The PCR

conditions were 94 �C for 2 min, followed by 28 cycles at

94 �C for 10 s, 60 �C for 30 s, 72 �C for 30 s and 72 �C

for 1 min in the end. The primers used for each gene are

described in Table 1.

To examine whether differences in expression levels of

NPY and OMP can discriminate activity of cells in

olfactory mucosa of wild boar, pig and FLP we conducted

gene expression assays through quantitative-PCR (q-

PCR). Quantitative analysis was performed by using the

iQTM 5 Multicolor Real-Time PCR Detection System

(Bio-Rad). The PCR reactions were performed in a final

volume of 15 microliters using 1 microliter of cDNA,

5 pmol of each primer and 7.5 microliter of iQTM SYBR

Green Supermix 2X (Bio-Rad). PCR cycling profile

consisted of a cycle at 95 �C for 3 min and 40 two-step

cycles at 95 �C for 10 s and at 60 �C for 30 s.

Quantitative real time PCR analysis was carried out using

the 2(-Delta Delta C(T)) method (Livak and Schmittgen

2001). In all qPCR experiments the data were normalized

to the expression of the b-actin housekeeping gene.

Negative controls included omission of template dissoci-

ation curves, gel analysis and sequencing of certain PCR

products confirmed gene specific product amplification.

Three different RNA preparations were tested for each

sample, and each reaction was run in triplicate. Data are

representative of three independent experiment.

Results

No interbreeding in domestic pigs and wild boars was

detected in our samples by using MC1R assay, in the entire

MC1R coding sequence (963 bp). The nuclear markers

show that wild boar have a typical wild type sequences of

MC1R (Accession Number KF780580; 0101 genotype,

according to Fang et al. 2009 allele nomenclature). The

sequences of FLP revealed nucleotide substitutions at two

diagnostic position (one of them heterozygote) consistent

with recessive red phenotype (Accession number

KF780579; 0401–0401* genotype). The domestic pigs can

Table 2 Mutations in MC1R gene in the three samples analyzed. On the top: genotype mutation pattern described in Fang et al. 2009

On the bottom: genotype mutation pattern in our samples. Domestic pigs can be assigned to Large white pig breed (0501 genotype). Wild boar is

a typical wild type sequences of MC1R (0101). FLP were consistent with the 0401 genotype

Evol Biol (2014) 41:229–239 233

123

be assigned to Large white pig breed (Accession number

KF780581; 0501 genotype) (Table 2).

On average, the relative brain size of FLP (accounting

for body mass) was approximately 96 % of the wild boar

brain (Figs. 2, 4). In stark contrast, domestic animals

showed an extremely reduced brain size that is only 35 %

of the wild boar brain size. These differences are signifi-

cant (ANOVA: F = 447.6 df = 2, 27, p � 0.001). Post-

hoc test indicated that both wild boars and FLP have sig-

nificantly larger brains per unit mass than pigs (wild boar/

domestic pig, p \ 0.001, FLP/domestic pig, p \ 0.001),

and FLP’ brains were not significantly smaller than wild

boar brains (p = 0.225).

The olfactory mucosa in S. scrofa, as in all the other

mammals, is greatly folded on turbinate and ethmoid bones

(Fig. 1a). After several trials to get sagittal sections of the

entire mucosa, we standardized the procedure by taking

just a 5 mm2 piece of olfactory mucosa from the second

lamella (Fig. 1b).

In homolog sections of domestic pigs mucosa, we found

drastically smaller number of neurons as compared to wild

boars and FLPs (Figs. 3a, b, c, 4). The density of cells

changed statistically across wild boar, FLP and domestic

pig (ANOVA: F = 36.23 df = 2, 27 p � 0.001). Post-hoc

tests indicated that both wild boars and FLPs have signif-

icantly higher cell density than pigs (wild boar/domestic

pig, p \ 0.001, FLP/domestic pig, p \ 0.001), and FLP

had no fewer neurons per unit area than wild boars

(p = 0.459).

Olfactory marker protein immunoreactivity (OMP-ir) is

diffuse within the olfactory epithelia (Fig. 3d, e, f) showing

a qualitatively higher reactivity in the wild boar than in

wild and domestic pig.

Using an antibody against NPY, we found different

immunestaining among the three samples (Fig. 3 g, h, i).

Wild boar showed a high NPY immunoreactivity within

several olfactory receptor neurones; to the extent that even

some basal cells were labelled. In the FLP olfactory sen-

sory neurons NPY-ir and in the domestic pig the staining

was much weaker (Fig. 3g, h, i).

A rapid screenings using semi-quantitative PCR, target

to assay mRNA, showed the same differences seen with

immuno-technique assaying proteins within the three

samples. Primers for actin were used to normalise the

reaction (Fig. 5a). Moreover a quantitative total RNA was

screened for NPY and OMP mRNA transcripts by real-time

RT-PCR. A far larger amount of mRNA was seen in wild

boars (11.4 NPY and 6.0 OMP) than in FLPs (2.7 NPY and

3.1 OMP) as a fold of transcript in domestic pigs (Fig. 5b);

(ANOVA: F = 161.3 df = 2 p � 0.001).

Discussion

The timing of sensory systems adaptation to external

conditions ranges from milliseconds (receptor desensitiza-

tion) to years (plasticity of central representations). Pro-

longed sensory stimulation can strengthen, weaken, or even

eliminate the responsiveness of sensory neurons. The

consequences of stimulation depend on the strength and

duration of the sensory stimulus. They also vary with

developmental stage and stimulus context (Dudai 1989;

Ochoa et al. 1990; Hadcock and Malbon 1993; Raus-

checker and Korte 1993).

Fig. 2 Brain size. The relative brain size of wild boar (a), FLP

(b) and domestic pig (c) is shown in three typical sections of head.

Scale bar indicate 5 cm

234 Evol Biol (2014) 41:229–239

123

Fig. 3 Olfactory Mucosa

sections. Olfactory Mucosa

sections of wild boar (a, d, g),

FLP (b, e, h), and domestic pig

(c, f, i). Scale bar 50 lm.

Hematoxylin–eosin (HE) shows

the histological differences in a

section of the olfactory mucosa

(a, b, c) quantitative analysis are

in Fig. 4. Olfactory marker

protein (OMP)

immunoreactivity shows a few

and comparable stained cells in

FLP (e) and domestic pig

(f) than wild boar (d), in this

latter signal is evident and

strong. A comparable status was

found using neuropeptide Y

(NPY) immunoreactivity in wild

boar (g), FLP (h) and domestic

pig (i)

Fig. 4 Brain size and number

of cells in Olfactory mucosa.

Black bars indicate the brain

size and gray bars indicate

number of cells in the olfactory

mucosa in wild boar, FLP and

domestic pig (Values on the

right axis and left axis

respectively). Error bars

represent the standard deviation.

Asterisks indicate a statistically

significant difference

(p \ 0.001, see in the text)

Evol Biol (2014) 41:229–239 235

123

We found that the sense of smell in FLP in Sardinia,

now living in the wild, adapt to the far richer range of

sensory stimuli they experience, as compared to their fully

captive relatives. The extent of this sensory recovery,

though, is limited.

We examined (1) to what extent the olfactory mucosa

structure differs among wild boars, domestic pigs, and

FLPs in terms of the density of olfactory neurons; and (2)

the functionality of the mucosa in terms of expression

levels of OMP and NPY (i.e. how much functional the

olfactory neurons are in the three S. scrofa strains).

In our samples the density of neurons in the olfactory

mucosa is much higher in wild boar and FLP than in

domestic pig. This indicates that FLP reacquired high

cellular density in the mucosa through feralization. This is

probably important to FLP individuals’ fitness in the wild,

where a good sense of smell is crucial for survival (Man-

dairona et al. 2003).

The density of neurons in the Main Olfactory Bulb

depends on the intensity and variation in olfactory stimuli

during ontogeny (Frazier and Brunjes 1988; Brunjes 1994;

Cummings and Brunjes 1997; Cummings et al. 1997). This

means that living in the wild may have directly increased

neuron density in FLP olfactory mucosa via reduced neurons

degeneration during growth. The full recovery in relative

brain mass in FLP is yet another indication that life in the

wild promoted an inversion in evolution towards the ‘‘wild’’

phenotype. The quality of this recovery, though, is signifi-

cantly limited. Otherwise, if Sardinian FLP were similar to

wild boar once they became free on the island (rather than

having a fully domestic ancestry) it remains striking the

difference in NPY and OMP in FLP as compared to wild

boars. Whatever the case, FLPs are very much different

from wild boars at the functional, but not at the morpho-

logical (in terms of brain mass) level, which still suggest that

the two evolve at different rates through domestication, in

keeping with the notion of incomplete reversibility.

Both OMP and NPY do not show the same pattern of

recovery (in FLPs as compared to wild boars) than struc-

tural components. The binding of these proteins to the cell

receptors in the olfactory mucosa of both wild and

domestic pigs is highly inefficient. Although OMP and

NPY expression in FLPs are some 3 times as much as in

domestic pigs (Fig. 1), they are still 2–4 times as small as

in the wild boars. That is, the full recovery in olfactory

neurons density, and the huge recovery in brain mass is not

paralleled at the biomolecular level. This strongly suggests

that i) the functionality of the sense of smell in Sardinian

FLPs is very reduced as compared to wild boars, and ii)

although a structural recovery (in terms of density of

neurons in the olfactory mucosa and total brain mass) is in

fact evident in the FLPs the sense of smell in the latter is

most probably not even comparable to wild boars’. This is

particularly intriguing since the brain regions linked to

smell in pigs are comparatively far less reduced than in

other domestic species (Plogmann and Kruska 1990). We

cannot rule out a priori that the reduction of the olfactory

functions in the Sardinian FLP is associated to the envi-

ronmental conditions they experience at the ontogenetic

level (i.e. it is not heritable). Yet, it is now fairly evident

from the literature that genes linked to the sense of smell

are under the influence of selection, both natural and arti-

ficial (Amaral et al. 2012; Groenen et al. 2012). This

suggests that selection, rather than individual reaction

norms during ontogeny are responsible for the loss of NPY

and OMP functioning in wild Sardinian pigs.

The case study presented here is mostly consistent with

Dollo’s law, reversibility in the evolutionary loss in the

sense of smell quality in pigs is very limited, and very

probably linked to the fact that the ontogeny of olfactory

mucosa in S. scrofa is retained unaltered in the domestic

breeds.

These findings remain valid regardless of the extent to

which the first domestic pigs introduced to Sardinia (the

Fig. 5 Gene expression analysis. a Agarose gel of Reverse Trascrip-

tase PCR amplification of NPY, OMP and Actin mRNA from the

Olfactory Mucosa among three forms of Sus scrofa. NPY expression

in the wild boar was about three times higher than observed in wild

and domestic pig, in which value are comparable. OMP mRNA

expression was appreciable only in wild boar. b OMP and NPY real-

time RT-PCR amplification from wild boar, FLP, and domestic pig

olfactory mucosa. Relative fold change in gene expression was

calculated relative to gene expression 100 mg of olfactory mucosa.

Gene expression are statistically significant. Error bars represent the

standard deviation

236 Evol Biol (2014) 41:229–239

123

ancestors of the modern Sardinian FLP population) pos-

sessed a similar extent and quality of brain reduction to the

modern domestic pigs used in our analyses. It is unlikely

that aboriginal Sardinian domestic pigs were much differ-

ent from modern domestic pigs. For instance, it is known

that brain mass reduction with domestication is a rapid

process (Kruska 1996). This also means that the chance

that the FLP population in Sardinia was established from

large-brained pigs, presumably very shortly after pigs were

imported to the island, is small. Additionally, we know of

no pig breed today that possesses large brains. Indeed,

Albarella et al. (2006) suggested on biometric grounds

(teeth and long bone measurements) that Sardinian FLPs

escaped from captivity very early, preserving most of the

wild boar morphological status. In our case, rather than a

partial recovery from a fully domestic status (as we

assumed here), wild life style in the FLP were not enough

to recover a fully functional sense of smell. This is still

consistent with Dollo’s law. It is worth noticing, though

that teeth and long bone measurements are not the same

thing as (neither they are a proxy for) brain size and

functioning.

Our results provide a close look to the anatomy of

Dollo’s law. Sardinian FLPs are pressed by their life in the

wild to have a full-functional sense of smell. Yet, whereas

their olfactory mucosa adapted quantitatively by increasing

the density of sensory neurons, the biochemistry of olfac-

tion is qualitatively downgraded despite millennia of life in

isolation. This suggests that the change in the sense of

smell functionality that domestication brought about on

Sardinian FLPs domestic ancestors is unlikely to be

reversible.

Acknowledgments We are grateful to Daniele Carrada for assis-

tance in the sampling and Gian Carlo Carrada for their constructive

comments in preparing the manuscript. This work was supported by

Department of Biology University of Naples Federico II, the Cilento e

Vallo di Diano e degli Alburni National Park, and Ambito Territoriale

di Caccia delle Aree Contigue al Parco Nazionale del Cilento e Vallo

di Diano.

References

Albarella, U., Manconi, F., Rowley-Conwy, P., & Vigne, J.-D.

(2006). Pigs of Sardinia and Corsica: A biometrical re-evaluation

of their status and history. In U. Tecchiati & B. Sala (Eds.),

Archaeozoological studies in honour of Alfredo Riedel (pp.

285–302). Bolzano: Province of Bolzano.

Albert, F. W., Somel, M., Carneiro, M., Aximu-Petri, A., Halbwax,

M., Thalmann, O., et al. (2012). A comparison of brain gene

expression levels in domesticated and wild animals. PLoS

Genetics, 8(9), e1002962.

Amaral, A. D., Hernandez, R. N., Basabe, B. N., Rocandio, P. A. M.,

& Arroyo, I. M. (2012). Body satisfaction and diet quality in

female university students from the Basque Country. Endocri-

nology Nutrition, 59(4), 239–245.

Barton, R. A. (1996). Neocortex size and behavioural ecology in

primates. Proceedings of the Royal Society B: Biological

Sciences, 263, 173–177.

Barton, R. A., & Harvey, P. H. (2000). Mosaic evolution of brain

structure in mammals. Nature, 405, 1055–1058.

Barton, R. A., Purvis, A., & Harvey, P. H. (1995). Evolutionary

radiation of visual and olfactory brain systems in primates, bats

and insectivores. Philosophical Transactions: Biological Sci-

ences, 348, 381–392.

Birks, J. D. S., & Kitchener, A. C. (1999). The Distribution and status

of the polecat Mustela putorius in Britain in the 1990s. National

Museums of Scotland: The Vincent Wildlife Trust.

Bokonyi, S. (1974). History of domestic mammals in Central and

Eastern Europe (p. 597). Budapest: Akademiai Kiado.

Borowsky, R. (2008). Restoring sight in blind cavefish. Current

Biology, 18, R23–R24.

Brunjes, P. C. (1994). Unilateral naris closure and olfactory system

development. Brain Research Reviews, 19, 146–160.

Collin, R., & Miglietta, M. P. (2008). Reversing opinions on Dollo’s

Law. Trends in Ecology and Evolution, 23(11), 602–609.

Cummings, D. M., & Brunjes, P. C. (1997). The effects of variable

periods of functional deprivation on the olfactory bulb develop-

ment in rats. Experimental Neurology, 148, 360–366.

Cummings, D. M., Henning, H. E., & Brunjes, P. C. (1997). Olfactory

bulb recovery after early sensory deprivation. The Journal of

Neuroscience, 17, 7433–7440.

Di Bona, G. F. (2002). Neuropeptide Y. American Journal of

Physiology—Regulatory, Integrative and Comparative Physiol-

ogy, 282(3), R635–R636.

Dollo, L. (1893). Les Lois de l’evolution. Bulletin de la Societe beige

de Geologie, de Paleontologie & d’Hydrologie, 7, 164–166.

Dollo, L. (1922). Les cephalopodes deroules et l’irreversibilite de

l’evolution. In Leiden, E.J. Brill (Ed.), Bijdragen tot de

Dierkunde (pp. 215–227). Bijrd Dierk Amsterdam.

Drummond, A. J., Ashton, B., Buxton, S., Cheung, M., Cooper, A.,

Duran, C., et al. (2011). Geneious v5.4, Available from http://

www.geneious.com.

Dudai, Y. (1989). The neurobiology of memory: concepts, findings,

trends. Oxford: Oxford University Press.

Ebinger, P., & Rohrs, M. (1995). Volumetric-analysis of brain

structures, especially of the visual-system in wild and domestic

turkeys (Meleagris gallopavo). Journal of Brain Research, 36,

219–228.

Fang, M., Larson, G., Ribeiro, H. S., Li, N., & Andersson, L. (2009).

Contrasting mode of evolution at a coat color locus in wild and

domestic pigs. PLoS Genetics, 5(1), e1000341. doi:10.1371/

journal.pgen.1000341.

Frantz, A. C., Massei, G., & Burke, T. (2012). Genetic evidence for

past hybridisation between domestic pigs and English wild

boars. Conservation Genetics, 13, 1355–1364.

Frantz, A. C., Zachos, F. E., Kirschning, J., Cellina, S., Bertouille, S.,

Mamuris, Z., et al. (2013). Genetic evidence for introgression

between domestic pigs and wild boars (Sus scrofa) in Belgium

and Luxembourg—a comparative approach with multiple marker

systems. Biological Journal of the Linnean Society, 110(1),

104–115.

Frazier, L. L., & Brunjes, P. C. (1988). Unilateral odor deprivation

early postnatal changes in olfactory bulb cell density and

number. The Journal of Comparative Neurology, 269, 355–370.

Gittleman, J. L. (1991). Carnivore olfactory bulb size: Allometry,

phylogeny and ecology. Journal of Zoology (London), 225,

253–272.

Giuffra, E., Kijas, J. M. H., Amarger, V., Carlborg, O., Jeon, J.-T., &

Andersson, L. (2000). The origin of the domestic pig: indepen-

dent domestication and subsequent introgression. Genetics, 154,

1785–1791.

Evol Biol (2014) 41:229–239 237

123

Giuffra, E., Tornsten, A., Marklund, S., Bongcam-Rudloff, E.,

Chardon, P., Kijas, J. M. H., et al. (2002). A large duplication

associated with dominant white color in pigs originated by

homologous recombination between LINE elements flanking

KIT. Mammalian Genome, 13, 569–577.

Gould, S. J. (1970). Dollo on Dollo’s law: irreversibility and the status of

evolutionary laws. The Journal of the History of Biology, 3, 89–212.

Groenen, M. A. M., Archibald, A. L., Uenishi, H., Tuggle, C. K.,

Takeuchi, Y., Rothschild, M. F., et al. (2012). Analyses of pig

genomes provide insight into porcine demography and evolution.

Nature, 491, 393–398.

Groves, C. P. (1989). Feral mammals of the Mediterranean islands:

documents of early domestication. In J. Clutton-Brock (Ed.), The

walking larder (pp. 46–58). London: Unwin Hyman.

Hadcock, J., & Malbon, C. (1993). Agonist regulation of gene

expression of adrenergic receptors and G proteins. Journal of

Neurochemistry, 60, 1–9.

Hansel, D. E., Eipper, B. A., & Ronnett, G. V. (2001). Neuropeptide

Y functions as a neuroproliferative factor. Nature, 410, 940–944.

Hemmer, H. (1990). Domestication: the decline of environmental

appreciation. NY: Cambridge Univ. Press.

Hutcheon, J. M., Kirsch, J. A. W., & Garland, T, Jr. (2002). A

comparative analysis of brain size in relation to foraging ecology

and phylogeny in the Chiroptera. Brain, Behavior and Evolution,

60, 165–180.

Johansson Moller, M., Chaudhary, R., Hellmen, E., Hoyheim, B.,

Chowdhary, B., & Andersson, L. (1996). Pigs with the dominant

white coat color phenotype carry a duplication of the KIT gene

encoding the mast/stem cell growth factor receptor. Mammalian

Genome, 7, 822–830.

Kijas, J. M. H., Moller, M., Plastow, G., & Andersson, L. (2001). A

frameshift mutation in MC1R and a high frequency of somatic

reversions cause black spotting in pigs. Genetics, 158, 779–785.

Kijas, J. M. H., Wales, R., Tornsten, A., Chardon, P., Moller, M., &

Andersson, L. (1998). Melanocortin receptor 1 (MC1R) muta-

tions and coat color in pigs. Genetics, 150, 1177–1185.

Koutsogiannouli, E. A., Moutou, K. A., Sarafidou, T., Stamatis, C., &

Mamuris, Z. (2010). Detection of hybrids between wild boars

(Sus scrofa scrofa) and domestic pigs (Sus scrofa f domestica) in

Greece, using the PCR-RFLP method on melanocortin-1 recep-

tor (MC1R) mutations. Mammalian Biology, 75, 69–73.

Krause-Kyora, B., Makarewicz, C., Evin, A., Flink, L. G., Dobney,

K., Larson, G., et al. (2013). Use of domesticated pigs by

Mesolithic hunter-gatherers in northwestern Europe. Nature

comunications, 4, 2348.

Kruska, D. (1988). Mammalian domestication and its effect on brain

structure and behavior. In H. Jerison & I. Jerison (Eds.),

Intelligence and evolutionary biology (pp. 211–250). Springer

Verlag: New York.

Kruska, D. (1996). The effect of domestication on brain size and

composition in the mink (Mustela vison). Journal of Zoology

(London), 239, 645–661.

Kurten, B. (1963). Return of a lost structure in the evolution of the

felid dentition. Commentationes biologicae, Societas Scientia-

rum Fennica vol 26, (pp. 1–12).

Larson, G., Albarella, U., Dobney, K., Rowley-Conwy, P., Schibler,

J., Tresset, A., et al. (2007). Ancient DNA, pig domestication,

and the spread of the Neolithic into Europe. PNAS USA, 104,

15276–15281.

Larson, G., Dobney, K., Albarella, U., Fang, M., Matisoo-Smith, E.,

Robins, J., et al. (2005). Worldwide phylogeography of wild

boar reveals multiple centers of pig domestication. Science, 307,

1618–1621.

Li, J., Yang, H., Li, J.-R., Li, H.-P., Ning, T., Pan, X.-R., et al. (2010).Artificial selection of the melanocortin receptor 1 gene in

Chinese domestic pigs during domestication. Heredity, 105,

274–281.

Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene

expression data using real-time quantitative PCR and the 2(-

Delta Delta C(T)) method. Methods, 25, 402–408.

Lynch, V. J., & Wagner, G. P. (2010). Did egg-laying boas break

Dollo’s law? Phylogenetic evidence for reversal to oviparity in

sand boas (Eryx: Boidae). Evolution, 64(1), 207–216.

Mandairona, N., Jourdana, F., & Didiera, A. (2003). Deprivation of

sensory inputs to the olfactory bulb up-regulates cell death and

proliferation in the subventricular zone of adult mice. The

Journal of Neuroscience, 119(2), 507–516.

Marklund, L., Moller, M. J., Sandberg, K., & Andersson, L. (1996). A

missense mutation in the gene for melanocyte-stimulating

hormone receptor (MC1R) is associated with the chestnut coat

color in horses. Mammalian Genome, 7, 895–899.

Montani, G., Tonelli, S., Elsaesser, R., Paysan, J., & Tirindelli, R.

(2006). Neuropeptide Y in the olfactory microvillar cells. The

European Journal of Neuroscience, 24, 20–24.

Mousley, A., Polese, G., Marks, N. J., & Eisthen, H. L. (2006).

Terminal nerve-derived neuropeptide y modulates physiological

responses in the olfactory epithelium of hungry axolotls

(Ambystoma mexicanum). Journal of Neuroscience, 26(29),

7707–7717.

Ochoa, E., Li, L., & McNamee, M. (1990). Desensitization of central

cholinergic mechanisms and neuroadaptation to nicotine. Molec-

ular Neurobiology, 4, 251–287.

Pielberg, G., Olsson, C., Sivanen, A. C., & Anderson, L. (2002).

Unexpectedly high allelic diversity at the KIT locus causing

dominant White color in the domestic pig. Genetics, 160, 305–311.

Plogmann, D., & Kruska, D. (1990). Volumetric comparison of

auditory structures in the brains of European wild boars (Sus

scrofa) and domestic pigs (Sus scrofa f. dom.). Brain, Behavior

and Evolution, 13, 25–34.

Porter, M. L., & Crandall, K. A. (2003). Lost along the way: the

significance of evolution in reverse. Trends in Ecololy and

Evolution, 18, 541–547.

Price, E. O. (1998). Behavioral genetics and the process of animal

domestication. In T. Grandin (Ed.), Genetics and the behavior of

animals (pp. 31–65). New York: Academic Press.

Price, E. O. (2002). Animal domestication and behavior (p. 297). New

York: CABI Publishing.

Raikow, R. J., Borecky, S. R., & Berman, S. L. (1975). The

evolutionary reestablishment of a lost ancestral muscle in the

bowerbird assemblage. The Condor, 81, 203–206.

Randi, E. (1995). Conservation genetics of the genus Sus. IBEX

Journal of Mountain Ecology, 3, 6–12.

Rauschecker, J., & Korte, M. (1993). Auditory compensation for early

blindness in cat cerebral cortex. The Journal of Neuroscience,

13, 4538–4548.

Roots, C. (2007). Domestication. Greenwood Press, Connecticut,

USA (pp. 1–21)

Safi, K., & Dechmann, D. K. (2005). Adaptation of brain regions to habitat

complexity: a comparative analysis in bats (Chiroptera). Proceed-

ings of the Royal Society B: Biological Sciences, 272, 179–186.

Scandura, M., Iacolina, L., Cossu, A., & Apollonio, M. (2011).

Effects of human perturbation on the genetic make-up of an

island population: the case of the Sardinian wild boar. Heredity,

106, 1012–1020.

Scandura, M., Iacolina, L., Crestanello, B, Pecchioli, E., Bertorelle,

G., & Apollonio, M. (2009). Occurrence of a private mtDNA

clade in Italian wild boars. In: Nahlik, A., & Tari, T. (a cura di)

Proceedings of the 7th International Symposium on Wild Boar

(Sus scrofa) and on sub-order Suiformes. Lover Print Nyomdai-

pari Kft., Ungheria: 96–97.

238 Evol Biol (2014) 41:229–239

123

Scandura, M., Iacolina, L., Crestanello, B., Pecchioli, E., Di

Benedetto, M. F., Russo, V., et al. (2008). Ancient versus recent

processes as factors shaping the genetic variation of the

European wild boar: are the effects of the last glaciation still

detectable? Molecular Ecology, 17, 1745–1762.

Schultz, W. (1969). Zur Kenntis des Hallstromhunden (Canis hallstr-

omi, Troughton 1957). Zoologischer Anzeiger, 183(1/2), 47–72.

Wiens, J. J., Kuczynski, C. A., Duellman, W. E., & Reeder, T. W.

(2007). Loss and re-evolution of complex life cycles in

marsupial frogs: does ancestral trait reconstruction mislead?

Evolution, 61(8), 1886–1899.

Wilkens, B. (2003). La fauna sarda durante l’Olocene: le conoscenze

attuali. Sardinia, Corsica et Baleares Antiquae. An International

Journal of Archaeology, 1, 181–197.

Zeder, M. A. (2012). Pathways to animal domestication. In P. Gepts,

T. R. Famula, & R. L. Bettinger (Eds.), Biodiversity in

agriculture: Domestication, evolution and sustainability (pp.

227–259). Cambridge: Cambridge University Press.

Evol Biol (2014) 41:229–239 239

123