A Dormant Internal Ribosome Entry Site Controls Translation of

JOURNAL OF VIROLOGY, Apr. 2008, p. 3574–3583 Vol. 82, No. 70022-538X/08/$08.00�0 doi:10.1128/JVI.02038-07Copyright © 2008, American Society for Microbiology. All Rights Reserved.

A Dormant Internal Ribosome Entry Site Controls Translation ofFeline Immunodeficiency Virus�

Valentina Camerini,1,2,3 Didier Decimo,1,2 Laurent Balvay,1,2 Mauro Pistello,3 Mauro Bendinelli,3Jean-Luc Darlix,1,2 and Theophile Ohlmann1,2*

Ecole Normale Superieure de Lyon, Unite de Virologie Humaine, IFR 128, Lyon F-69364, France1; INSERM, U758, Lyon F-69364,France2; and Retrovirus Center and Virology Section, Department of Experimental Pathology,

University of Pisa, Via San Zeno, 35, I-56127 Pisa, Italy3

Received 14 September 2007/Accepted 21 January 2008

The characterization of internal ribosome entry sites (IRESs) in virtually all lentiviruses prompted us toinvestigate the mechanism used by the feline immunodeficiency virus (FIV) to produce viral proteins. Variousin vitro translation assays with mono- and bicistronic constructs revealed that translation of the FIV genomicRNA occurred both by a cap-dependent mechanism and by weak internal entry of the ribosomes. This weakIRES activity was confirmed in feline cells expressing bicistronic RNAs containing the FIV 5� untranslatedregion (UTR). Surprisingly, infection of feline cells with FIV, but not human immunodeficiency virus type 1,resulted in a great increase in FIV translation. Moreover, a change in the cellular physiological conditionprovoked by heat stress resulted in the specific stimulation of expression driven by the FIV 5� UTR whilecap-dependent initiation was severely repressed. These results reveal the presence of a “dormant” IRES thatbecomes activated by viral infection and cellular stress.

Feline immunodeficiency virus (FIV) is a lentivirus discov-ered in 1987 by Pedersen and colleagues (29) by isolation fromperipheral blood lymphocytes of a domestic cat (Felis catus)with an immunodeficiency syndrome similar to AIDS. The FIVgenomic RNA is capped and polyadenylated and containsthree large open reading frames, gag, pol, and env, that code forthe structural, enzymatic, and envelope proteins, respectively.The extensive similarities between FIV and human immuno-deficiency virus type 1 (HIV-1) make FIV an important modelfor the development of anti-HIV-1 vaccines and therapies andthe starting point for the production of lentiviral vectors suit-able for gene transfer (reviewed in references 3 and 7).

Translational control plays a key role in the regulation ofgene expression in higher eukaryotes. For most eukaryoticmRNAs, translation commences with the binding of the 43Sribosome to the cap structure at the 5� end of the mRNA. Thispreinitiation complex, which is composed of Met-tRNAi, the40S ribosomal subunit, and associated initiation factors, is thenable to move along the untranslated region (UTR) in a 5�-to-3�direction (30). This process has been termed ribosomal scan-ning, as it allows progression of the translation preinitiationcomplex until an AUG codon is encountered (20). For efficientrecognition, this AUG (underlined) should be in the context(A/G)CCAUGG, the purine at position �3 being critical, to-gether with the G at the �4 position (19).

In the late 1980s, the study of picornavirus translation shedlight on an alternative mechanism of protein synthesis. It isnow well established that translation initiation on picornavirusRNAs, which are uncapped and present a long 5� UTR, takesplace by a cap-independent mechanism that is directed by an

internal ribosome entry site (IRES) located within the 5� UTRof the genomic RNA (2, 13, 14). Although considered anunconventional, marginal mechanism of translation initiation,this process has now been described in many other viruses anda growing number of cellular genes from yeast, drosophila, andmammals (for a recent review see reference 12). In a largenumber of studies, it has been shown that the mechanism ofinternal ribosome entry is mediated by the IRES structure (28,35, 42) with the potential involvement of noncanonical trans-lation factors named IRES trans-acting factors (ITAFs) (2, 38).

It has become clear that translational control plays an im-portant role in the replication cycle of retroviruses (1). Indeed,IRESs have been characterized within the genomic 5� UTRs ofsimple gamma retroviruses such as the Friend and Moloneymurine leukemia viruses (4, 9, 40) and in lentiviruses such asthe simian immunodeficiency virus (SIV) (24, 25), HIV-1 (5,6), and HIV-2 (11). It should be noted that lentiviral IRESsappear to be quite peculiar, as they are located within both the5� UTR and the gag coding region (for HIV-1 and SIV) orexclusively within the gag coding region (HIV-2) (1). As aresult, additional Gag isoforms have been characterized in thecases of HIV-1 (p40), SIV (p43), and HIV-2 (p50 and p44) thatare synthesized by the exclusive use of the IRES located withinthe gag coding region. These isoforms appear to play a role inviral replication as deletion or mutation of their AUG initia-tion start site results in profound modifications of viral growthand replication kinetics (6, 24).

These results prompted us to investigate the mechanism bywhich the FIV genomic RNA was translated. In vitro, proteinsynthesis driven by the FIV 5� UTR was very efficient in acapped monocistronic context but very weak once inserted intoa bicistronic vector. Furthermore, FIV translation was inhib-ited by cleavage of eIF4G and/or the presence of antisenseoligonucleotides that arrest ribosomal scanning from the mes-senger 5� end. Expression of a bicistronic vector containing the

* Corresponding author. Mailing address: INSERM, U758, LyonF-69364, France. Phone: (33) 4 72 72 89 53. Fax: (33) 4 72 72 81 37.E-mail: [email protected].

� Published ahead of print on 30 January 2008.

3574

on March 7, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

FIV 5� UTR was very low in Crandell feline kidney (CrFK)cells, indicating that internal initiation occurs at very low effi-ciency on the FIV genomic RNA. However, FIV infectionresulted in specific stimulation of the FIV IRES with no effecton other picornaviral or retroviral IRESs. In addition, chang-ing the physiological status of these cells by continuous heatshock resulted in a decrease in cap-dependent translation andstimulation of second gene expression. Taken together, theseresults show that the FIV genomic RNA contains a “dormant”IRES which can be activated under certain cellular conditions.

MATERIALS AND METHODS

Plasmid construction. Standard procedures were used for plasmid DNA con-struction, purification, and linearization. For pMono-AUG1, the sequence of theFIV DNA from the beginning of R (transcription start site) to AUG1 (nucleotide[nt] 412) was inserted into pMLV-CB93 (4) at the NheI site. For the constructionof all the bicistronic vectors used, sequences of FIV from R to AUG1 (pBi-AUG1) and from R to AUG at position 655 (pBi-AUG4) were amplified by PCRand inserted into the pBi-NL vector at the NheI site (described in reference 11).pBi-AUG1(�CMV) and pBi-AUG4(�CMV) were constructed from pBi-AUG1and pBi-AUG4, respectively, digested with NruI and HindIII to remove theentire cytomegalovirus (CMV) promoter.

The construction of pBi-EMCV (25), pBi-HIV2-AUG1, and pBi-PV has beendescribed previously (11). For the construction of pMono-EMCV, the encepha-lomyocarditis virus (EMCV) sequence contained in pBi-EMCV was digestedwith NheI and cloned into the NheI site of pMLV-CB93.

Production of T7 DNA fragments. In order to generate the constructs T7-5�UTR, T7-AUG1, T7-AUG2, T7-AUG3, and T7-AUG4, the DNA sequencecorresponding to the FIV coding region was amplified by PCR by using a 3�oligonucleotide starting at the end of the capsid region and a 5� oligonucleotidestarting with the T7 promoter sequence and complementary to the �1 region ofthe 5� UTR or to the AUG at position 412, 442, 532, or 655, respectively. Afterpurification of the PCR fragments, in vitro transcription was performed asdescribed below.

In vitro transcription and translation. In vitro transcription was carried out aspreviously described (34). The resulting capped and uncapped RNAs were trans-lated in Flexi RRL (Promega) in the presence of 75 mM KCl, 0.5 mM MgCl2, 20mM each amino acid (except methionine), and 0.6 mCi/ml [35S]methionine.Translation products were then separated by sodium dodecyl sulfate-15% poly-acrylamide gel electrophoresis (SDS-PAGE), and the gel was dried and sub-jected to autoradiography for 12 h with BioMax films (Eastman Kodak Co.). Theintensity of the bands was quantified with a STORM 850 PhosphorImager (Mo-lecular Dynamics, Sunnyvale, CA). Preparation of in vitro-translated foot-and-mouth disease virus (FMDV) L protease was carried out as previously described(31).

Annealing of 2�-O-methyloligoribonucleotides to RNA. Antisense 2�-O-meth-yloligoribonucleotides 5�AAUCUCGCCCCUGUCCAUUCCC3� and 5�AAGUCCCUGUUCGGGCGCCAA3� (Eurogentec), complementary to the sequenceencompassing the initiator AUG at position 412 or the primer binding site (PBS;nt 141 to 161), were hybridized to the RNA in 20 mM HEPES-KCl (pH 7.6) and100 mM KCl for 3 min at 65°C, and the temperature was decreased slowly priorto addition of the translation mixture.

Cell culture. CrFK and human epithelial 293T cells were maintained at 37°Cin a 5% CO2 atmosphere in Dulbecco’s modified Eagle’s medium (GIBCO,Invitrogen) supplemented with 10% fetal bovine serum (Bio West). Stable celllines were generated by DNA transfection of CrFK cells and selection with 1mg/ml G418 added to the culture medium. For gene expression analysis underheat shock conditions, the cells were seeded at 1.5 � 106 into 6-cm plates andmaintained for 15 h at 42°C.

Virus production, titration, and infection. For virus production, 3 � 106 293 Tcells were seeded into 10-cm plates at 24 h before transfection. Transfection wasperformed by the calcium phosphate method with 10 �g of FIV molecular clonepCMV/RU5 (23) (kindly provided by Tahir A. Rizvi) or of HIV-1 �env molec-ular clone pNL4.3 (27) and 4 �g of vesicular stomatitis virus Env (VSV-G)expression plasmid (21). The day after transfection, the medium was changed,and after 24 h, the supernatant was filtered (0.45-�m-pore-size filter) and eitherused for infection or centrifuged to concentrate the virus in order to evaluatevirus production by measurement of reverse transcriptase activity (see below).

For virus titration, 1.5 � 105 CrFK cells were seeded onto a 24-well plate andinfected with serial dilutions of pseudotyped FIV particles (produced as de-

scribed above). Twenty-four hours after infection, the medium was replaced withfresh medium containing 200 �g/ml hygromycin and the selection was main-tained for 3 weeks. The multiplicity of infection (MOI) was determined as thelowest dilution of the stock in which cellular clones could be detected.

For viral infection, 1.5 � 106 CrFK cells were seeded into 6-cm plates andexposed to the same amount of either FIV or HIV-1 (normalized by measure-ment of reverse transcriptase activity). After an additional 24 h, the medium waschanged, and 24 h later, supernatants were harvested, filtered (0.45-�m-pore-sizefilter), and centrifuged at 4°C at 75,000 rpm in a Beckman TL-100 for 1 h. Viralpellets were resuspended in 25 �l of reverse transcription (RT) buffer in order todetermine the reverse transcriptase activity.

Metabolic labeling. CrFK cells (6 � 105) stably expressing bicistronic plasmidpBi-AUG1 were seeded into a six-well plate and infected with an amount of FIVcorresponding to an MOI of 10. At 48 h postinfection, the culture medium wasreplaced with serum-free, L-methionine-free Dulbecco’s modified Eagle’s me-dium (GIBCO, Invitrogen). After 30 min of starvation, 10% serum and 100�Ci/ml [35S]methionine were added. After 1 h of incubation at 37°C, cells wereharvested, washed three times with 1� phosphate-buffered saline, and lysed.Equal amounts of proteins were resolved by SDS-15% PAGE and visualized byautoradiography.

Enzymatic activities. Protein concentration was determined with the Bio-Radprotein assay reagent. �-Galactosidase (�-gal) activity was determined by usingthe �-gal Reporter Gene Assay kit (chemiluminescent; Roche) as described bythe manufacturer. Neomycin phosphotransferase (Neo) activity was determinedby [�-32P]ATP phosphate transfer to kanamycin as described in reference 32.

RT-PCR. Cellular RNAs were extracted with TRIzol reagent (Invitrogen) andtreated with DNase (RQ1 DNase; Promega). After ethanol precipitation, 5 �g ofthese cellular RNAs was subjected to RT with the Superscript II RT system(Invitrogen) and primer annealing on LacZ. RT reactions were amplified byPCR with Go Taq DNA polymerase (Promega) and with the T7 oligonucleotide5� TAATACGACTCACTATAG 3� as the 5� primer and the �40 LacZ oligo-nucleotide 5� GTTTTCCCAGTCACGAC 3� as the 3� primer.

Reverse transcriptase activity. Ten microliters of concentrated virus suspen-sion, prepared as described above, was added to 40 �l of RT cocktail [60 mMTris-HCl (pH 8), 180 mM KCl, 6 mM MgCl2, 6 mM dithiothreitol, 0.6 mMEGTA, 0.12% Triton X-100, 6 �g of oligo(dT)/ml, 12 �g of poly(rA)/ml, 0.05mM [�-32P]dTTP (800 Ci/mmol)] and incubated for 1 h at 37°C. Ten microliterswas spotted onto DE-81 paper and washed three times with 2� SSC (1� SSC is0.15 M NaCl plus 0.015 M sodium citrate). A PhosphorImager (MolecularDynamics) was used to quantify the radioactivity incorporated.

RESULTS

FIV translation in a monocistronic context. A segment ofthe FIV genomic RNA comprising the complete FIV 5� UTRfollowed by the gag coding region (positions �1 to 1487) wasgenerated from the pSP64-FIV plasmid (22). Capped and un-capped mRNAs were transcribed in vitro and translated in therabbit reticulocyte lysate system (RRL) at various concentra-tions (Fig. 1). Gag synthesis from the capped transcripts wasabout three- to fourfold more efficient than expression fromthe uncapped RNAs (compare lanes 1 to 5 to lanes 6 to 10),suggesting that translation occurs via a cap-dependent mech-anism. It should be noted that downstream initiation products(a, b, and c in Fig. 1) were observed following capped anduncapped RNA translation. The relative intensity of the fast-migrating bands (a, b, and c) was stronger from the uncappedtranscript than from the capped one (compare lane 3 and 8),suggesting that they are not breakdown products from Gag butrather appeared to be due to initiation at downstream sites.

The complete FIV 5� UTR, from �1 to the AUG codon(�412), was then inserted upstream of the LacZ reporter gene,and the resulting capped and uncapped RNAs were translatedin the RLL (Fig. 1, lanes 11 to 20). Once again, protein syn-thesis was more efficient from capped RNAs (compare lanes11 to 15 with lanes 16 to 20), indicating that translation occurspredominantly by 5�-end-dependent ribosomal scanning.

VOL. 82, 2008 A DORMANT IRES IN FIV 3575


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Next, we examined the translation of both capped FIV-Gagand capped FIV-LacZ RNAs in the presence of increasingamounts of FMDV L protease (Fig. 2). This protease has theability to cleave initiation factor eIF4G at a unique site, thus

resulting in the inhibition of cap-dependent translation,whereas IRES-driven translation is either unaffected or stim-ulated (18, 26). In the RRL, addition of the viral proteaseresulted in the inhibition of translation of FIV-Gag (lanes 1 to

FIG. 1. FIV translation is cap dependent in the RRL. Capped and uncapped FIV-Gag and FIV-LacZ transcripts (schematically representedon the upper part of each panel) were translated in the RRL at various RNA concentrations, as indicated. After 45 min of incubation at 30°C inthe RRL, the samples were analyzed by 12% SDS-PAGE and the dried gel was submitted to autoradiography. The shorter Gag isoforms (a, b, andc) and the molecular weight markers are indicated. Data are representative of at least three experiments. MW, molecular mass.

FIG. 2. The FMDV L protease inhibits translation driven by the FIV 5� UTR. (A) The RRL was preincubated for 10 min without (lanes 1, 4,7, and 10) or with 0.4 �l (lanes 2, 5, 8, and 11) or 0.6 �l (lanes 3, 6, 9, and 12) of in vitro-expressed FMDV L protease. Different capped RNAtranscripts, namely, FIV-Gag (100 ng), FIV-LacZ (100 ng), globin-lacZ (10 ng), and EMCV-LacZ (100 ng), were translated. After 45 min ofincubation at 30°C in the RRL, the samples were analyzed by 12% SDS-PAGE and the dried gel was submitted to autoradiography. The relativeintensities of the bands were quantified, and the results, expressed as percentages of the control (no protease added), are presented in thehistogram at the bottom of each panel. The Gag isoforms are indicated by the arrows (a, b, and c). Data are representative of at least threeexperiments. (B) At the end of the 10-min preincubation period, samples (1 �l) from the experiment described above were subjected to 10%SDS-PAGE and the proteins were transferred to polyvinylidene difluoride membrane and incubated with antibodies specific to the C-terminal partof eIF4GI. The positions of the intact molecule and the cleavage products (Cp) are indicated on the right. MW, molecular mass.

3576 CAMERINI ET AL. J. VIROL.


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

3) and FIV-LacZ (lanes 4 to 6) mRNAs together with a re-duction in the expression of globin-lacZ mRNAs (lanes 7 to 9).As expected, translation directed by the EMCV IRES was notaffected and even stimulated by the cleavage of eIF4G follow-ing the addition of the L protease (lanes 10 to 12). It is note-worthy that the level of smaller Gag proteins, namely, a, b, andc, resulting from alternative initiation (lanes 1 to 3) was notaffected by the proteolytic cleavage of eIF4G, suggesting thatthey may use an internal initiation mechanism. Proteolyticcleavage of eIF4G was verified by Western blot analysis, whichrevealed that most of the endogenous eIF4G was cleaved aftera 10-min incubation with the L protease (Fig. 2B).

Taken together, these data indicate the requirement of in-tact eIF4G for efficient initiation of FIV translation at AUG1and confirm that translation proceeds mainly through a cap-dependent mechanism in the RRL.

Both the 5� UTR and the gag coding region are capable ofweak internal initiation in a bicistronic context. Additionalexperiments were then carried out in which the FIV 5� UTRalone or the FIV 5� UTR followed by a segment of the gagcoding region encompassing AUG1 to AUG4 (nt 412 to 655)was inserted into a bicistronic vector coding for neomycin (firstgene) and LacZ (second gene). Bicistronic and monocistronicLacZ RNAs were translated in the RRL at the same molarconcentration to allow direct comparison of translational effi-ciencies. As a control, we used mono- and bicistronic RNAs inwhich the EMCV IRES was driving LacZ expression (Fig. 3Acontains a description of the plasmids). As expected, expres-sion from the capped and uncapped EMCV RNAs occurredwith similar efficiencies (Fig. 3B, compare lanes 1 and 2 to

lanes 3 and 4) and insertion of the EMCV IRES into a bicis-tronic RNA resulted in substantial expression of the secondgene (Fig. 3B, lanes 5 and 6).

In contrast, translation from the monocistronic FIV con-structs was stimulated by the 5� cap structure (Fig. 3B, lanes 7and 8 versus lanes 9 and 10 and lanes 11 and 12 versus lanes 13and 14), as previously observed, and �-gal expression from thebicistronic FIV constructs was very weak (lanes 15 and 16).Extension of the FIV insert to the gag coding region led to theproduction of longer isoforms of �-gal (Fig. 3B, lanes 11 to 14,17, and 18), which most probably resulted from initiation atone, or several, of the downstream in-frame AUG codons.However, the overall yield of �-gal produced was only moder-ately stimulated by insertion of the gag coding region.

Given these data, a critical issue was to determine whetherthe low level of expression detected in a bicistronic context wasdue to readthrough, reinitiation, or leaky ribosomal scanningor rather could be considered a mechanism of weak but gen-uine internal initiation. Thus, antisense 2�-O-methyloligoribo-nucleotides complementary to different sequences of the FIVgenomic RNA were used (Fig. 4). Upon hybridization, theseoligoribonucleotides form a very stable oligonucleotide-RNAduplex molecule that is not unwound by scanning 40S ribo-somes (15). The first antisense oligonucleotide was comple-mentary to the gag AUG initiation site (oligonucleotideAUG1), while the second was complementary to the 20-ntregion of the PBS (oligonucleotide PBS; nt 141 to 161). Com-plete annealing of the oligonucleotides and integrity of theresulting oligonucleotide-target mRNA duplex was verified ona nondenaturing gel (Fig. 4C). Expression of the oligonucleo-

FIG. 3. In vitro translation driven by the FIV 5� UTR is inefficient in a bicistronic vector. (A) Schematic diagram of the constructs used.(B) Capped and uncapped monocistronic transcripts together with uncapped bicistronic transcripts containing the EMCV IRES (left panel), theFIV 5� UTR alone (lanes 7 to 10, 15, and 16), or the FIV 5� UTR followed by the gag coding region (lanes 11 to 14, 17, and 18) were translatedin the RRL at two different concentrations (23 and 29 nM) as indicated. After 45 min of incubation at 30°C, the samples were processed by 12%SDS-PAGE and submitted to autoradiography. Data are representative of at least three experiments. MW, molecular mass.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

tide AUG1-mRNA duplex revealed that translation was inhib-ited by about 90% as a result of blockage of the AUG initiationsite (Fig. 4A, lanes 1 to 3). However, annealing on the PBSresulted in severe but not complete inhibition of Gag produc-tion (about 60% inhibition), suggesting that a substantialamount of the ribosomes may land downstream of the PBS(Fig. 4A, lanes 4 to 6). Hybridization of oligonucleotide AUG1to the Bi-5�UTR-AUG4 bicistronic construct resulted in totalloss of the full-length protein but did not affect the yield of theshorter proteins detected (Fig. 4B, compare lane 1 to lanes 2and 3). This confirms that they originate from independenttranslation initiation events and not from a posttranslationmodification or degradation of Gag. Interestingly, annealing ofthe oligonucleotide PBS did not affect the weak translationobserved in a bicistronic setting (Fig. 4B, compare lanes 4 and5 with lane 3), indicating that the FIV genomic RNA is capableof internal initiation, although this is clearly not the predom-inant mechanism used to initiate protein synthesis.

Translation initiation in feline cells. Next, we examinedwhether the poor FIV IRES activity detected in the RRL wasdue to the use of a heterologous in vitro system that may lacka specific ITAF. Therefore, the CrFK cell line was chosenbecause these cells support rapid replication of FIV (41).CrFK cells were transfected with the construct pBi-5�UTR-AUG1, pBi-5�UTR-AUG4, pBi-PV (containing the poliovirus[PV] IRES in an intercistronic position), or pBi-HIV-2-AUG1(with the HIV-2 5� UTR in an intercistronic position) and thenselected for neomycin resistance. After 3 weeks of selection,the polyclonal cell population was assessed for neomycin and�-gal activities.

As a negative control, CrFK cells were transfected either

with constructs in which the CMV promoter had been entirelydeleted (�CMV) or with the CMV-containing parental plas-mids. The lack of �-gal expression from the �CMV constructsindicated that no cryptic promoter was used to generate mono-cistronic RNAs (Fig. 5A). In addition, an RT-PCR analysis wascarried out on stably transfected CrFK cells, and this failed todetect any shorter isoform of the pBi-5�UTR-AUG1 and pBi-5�UTR-AUG4 bicistronic RNAs, suggesting that no aberrantsplicing events had taken place (Fig. 5B).

For each of the four bicistronic constructs that were ex-pressed in CrFK cells, the ratio of �-gal/neomycin activitieswas measured (Fig. 5C). The results showed that �-gal expres-sion driven by the construct containing the FIV 5� UTR wasvery weak compared to the PV control (arbitrarily set at100%). In fact, the �-gal/neomycin ratio from the pBi-5�UTR-AUG1 construct was similar to that obtained with the HIV-2 5�UTR previously considered to be unable to drive internal ini-tiation (11). Furthermore, addition of the gag coding region didnot rescue protein synthesis, as the activity of the bicistronicconstruct pBi-5�UTR-AUG4 was even lower since the �-gal/neomycin ratio was barely above the threshold detection level.An inhibitory effect of the insertion of the gag coding regioninto a bicistronic construct had been previously observed forHIV-1 (5) and HIV-2 (11) by a still unknown mechanism.

Taken together, these data confirmed that, under normalconditions, FIV translation occurs almost exclusively via a cap-dependent mechanism.

FIV IRES activity is enhanced by FIV infection. Next, we setout to study the impact of FIV infection and replication on thetranslation of its cognate genomic RNA. As a control, a similarexperimental procedure was used in parallel with the related

FIG. 4. The FIV 5� UTR has genuine IRES activity. (A) Increasing concentrations (10 and 25 �M, denoted by the triangle) of 2�-O-methyloligoribonucleotides that are complementary to the region downstream of AUG1 or of the PBS region were annealed to 0.3 pmol of cappedFIV-Gag RNA or (B) uncapped bicistronic transcript containing the FIV 5� UTR followed by a segment of the gag coding region. The positionof annealing of the 2�-O-methyloligoribonucleotides on the two transcripts is schematically represented at the top of each panel. After 45 min ofincubation at 30°C in the RRL, the samples were processed by 12% SDS-PAGE and submitted to autoradiography. (C) The resulting oligonu-cleotide-mRNA duplex that is formed upon hybridization of the 2�-O-methyloligoribonucleotides in panel A was visualized on a nondenaturingagarose gel. MW, molecular mass.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

virus HIV-1. Accordingly, FIV or HIV-1 virions were preparedby transfecting 293T cells with viral clone pCMV/RU5 FIV(23) or HIV-1 pNL4.3 (27). It should be noted that bothviruses were pseudotyped with VSV-G in order to allow effi-cient entry into CrFK cells (21). CrFK stable cell lines express-ing the Bi-5�UTR-AUG1, the Bi-PV, or the Bi-HIV-2 con-struct were infected with FIV or HIV-1 at an MOI of 10.

Surprisingly, infection of the cells with FIV resulted instrong stimulation of translation driven by the FIV 5� UTR, asmonitored by the increase in �-gal expression (Fig. 6A). Inaddition, the translation driven by the active PV IRES or thenegative control HIV-2 5� UTR was not enhanced, thus sug-gesting a very specific role for FIV infection in its cognate 5�UTR (Fig. 6A). In agreement with this, we also failed tomonitor any stimulation of translation when the cells wereinfected with HIV-1.

The next step was to investigate whether the increase in FIVIRES activity could be directly correlated with the amount ofviral particles delivered to the cells. Thus, CrFK cells stablyexpressing the Bi-5�UTR-AUG1 construct were infected withFIV at MOIs ranging from 0.01 to 100; at 48 h postinfection,neomycin and �-gal activities were determined, and the resultsshow that stimulation of FIV IRES activity occurs in a dose-dependent manner with a mere sixfold increase in �-gal pro-

duction at the highest MOI (Fig. 6B). It should be noted thatthe presence of a putative cryptic promoter was ruled out bytransfecting bicistronic constructs in which the CMV promoterwas previously deleted as described in the legend to Fig. 5(data not shown).

Surprisingly, translation of the first gene (neomycin) wasalso increased in a dose-dependent manner by FIV infection(Fig. 6B). RT-PCR analysis was carried out on stably trans-fected CrFK cells, and this failed to detect any shorter isoformof the pBi-5�UTR-AUG1 bicistronic RNAs, suggesting that noaberrant splicing events had taken place during the course ofviral infection (Fig. 6C).

A priori, this suggests that FIV infection could stimulateboth cap-dependent and IRES-driven translation. However,this does not seem to be the case since the metabolic labelingof total cellular protein synthesis remained unchanged (Fig.6D). Thus, in view of the recent data obtained by Niepmannand colleagues (16), it is likely that the massive increase inIRES-driven gene expression (�-gal) results in the concomi-tant stimulation of the upstream reporter gene (neomycin).

Prolonged heat shock increased FIV IRES activity. How-ever, to definitely exclude the possibility that the �-gal activitybenefits in some way from the increased expression of the firstgene, we investigated the FIV IRES activity under conditions

FIG. 5. The FIV 5� UTR is inefficient at supporting internal initiation in CrFK cells. (A) Comparative analysis of �-gal activity expressedfrom the CMV and �CMV pBi-5�UTR-AUG1 and pBi-5�UTR-AUG4 plasmids that were transiently transfected into CrFK cells. Resultsare expressed as percentages of the �-gal activity from each parental plasmid (containing the CMV promoter and set at 100%). (B) Agarosenondenaturing electrophoretic analysis of 5 �g of total cytoplasmic RNA extracted from CrFK cells stably expressing Bi-AUG1 andBi-AUG4 after RT and PCR (lanes 4 and 7) or PCR without prior RT (lanes 3 and 6) or RT-PCR without RNAs (lane 1). PCR productsfrom the parental plasmids pBi-5�UTR-AUG1 and pBi-5�UTR-AUG4 (lanes 2 and 5) were run in parallel as size markers. The regionamplified by PCR is schematically depicted at the top of the panel. (C) Translational activities of the bicistronic constructs pBi-5�UTR-AUG1, pBi-5�UTR-AUG4, pBi-PV, and pBi-HIV2 that were stably transfected into CrFK cells. The results are expressed as the ratio of�-gal (second gene) to neomycin (first gene) activities and compared to the activity of the positive control, pBi-PV, which was arbitrary setto 100%.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

in which cellular cap-dependent translation was repressed.One way to create stress conditions and to inhibit cap-depen-dent translation is to submit cells to a prolonged heat shock aspreviously described (17). To this aim, CrFK cells constitu-tively expressing pBi-5�UTR-AUG1, pBi-PV, or pBi-HIV-2-AUG1 were subjected to a 15-h period of heat shock (seeMaterials and Methods). Metabolic labeling of the cells at37°C and 42°C was realized (Fig. 7A), and it shows an inhibi-tion of total protein synthesis and the induction of a proteinrunning at 90 kDa, which is likely to be heat shock protein 90

(Hsp90). Neomycin production was decreased by 50% in cellsincubated at 42°C (Fig. 7B, left panel), while the measurementof �-gal activity revealed an average twofold enhancementunder heat shock conditions in the case of the FIV constructwith no change for PV and only a marginal increase for thebicistronic construct bearing the HIV-2 5� UTR (Fig. 7B, rightpanel). It should be noted that the presence of a heat shock-inducible promoter was ruled out by expressing promoterlessbicistronic constructs and analyzing �-gal activity at both 37°Cand 42°C (Fig. 7C).

FIG. 6. FIV, but not HIV-1, infection enhances translational activity from its cognate IRES. (A) CrFK cells expressing the bicistronicconstruct pBi-5�UTR-AUG1, pBi-PV, or pBi-HIV2 were infected with equal amounts of VSV-G-pseudotyped FIV and HIV-1 at an MOIof 10 (see Materials and Methods). At 48 h postinfection, neomycin (left panel) and �-gal (right panel) activities in mock-infected (gray),FIV-infected (black), or HIV-1-infected (white) cells were measured. The Neo and �-gal activities in mock-infected cells were arbitrarily setto 100%. (B) CrFK cells expressing the pBi-5�UTR-AUG1 construct were infected with VSV-G-pseudotyped FIV virions at MOIs rangingfrom 0.01 to 100, as indicated. At 48 h postinfection, Neo and �-gal activities were determined and plotted as percentages of the control(mock-infected cells, set at 100%). (C) Agarose nondenaturing electrophoretic analysis of 5 �g of total cytoplasmic RNA extracted fromCrFK cells stably expressing Bi-AUG1 and infected with FIV at MOIs of 0 (lanes 2 and 5), 10 (lanes 3 and 6), and 100 (lanes 4 and 7). RNAwere analyzed after RT and PCR (lanes 5, 6, and 7) or PCR without prior RT (lanes 2, 3, and 4) or RT-PCR without RNAs (lane 1). PCRproducts from the parental plasmid pBi-5�UTR-AUG1 (lane 8) were run in parallel as size markers. Molecular size markers were run at theright side of the gel, and the sizes of the bands are indicated in kilobases. (D) CrFK cells stably transfected with bicistronic plasmidpBi-5�UTR-AUG1 were infected with pseudotyped FIV particles (MOI 10). The effect on the overall cellular translation was analyzed byincubating the cells with [35S]methionine for 1 h. Cell extracts were processed by SDS-PAGE followed by autoradiography. The intensitiesof the bands, corresponding to global protein synthesis, were quantified, and the results, expressed as percentages of the noninfected cells,are presented in the histogram on the right of the autoradiogram.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Therefore, these data indicate that the FIV genomic RNAcan use an IRES-dependent mechanism when cap-dependenttranslation is restricted.

DISCUSSION

The identification and characterization of IRES elements inthe genomic RNA of lentiviruses such as HIV and SIV (1)prompted us to investigate whether the FIV 5� UTR could alsofunction as an IRES. In vitro experiments performed with theRRL revealed a pronounced cap dependence of FIV RNA(Fig. 1). This was observed when the 5� UTR was driving thesynthesis of a reporter gene or the Gag polyprotein. In thelatter case, the effect was accompanied by the appearance offast-migrating bands corresponding to weak alternative trans-lation initiation at three AUG codons located in the matrixcoding region of gag (Fig. 1 and 2). However, the synthesis androle of these Gag isoforms were not investigated further in thiswork as we focused instead on translational events that takeplace at the authentic AUG initiation site. Interestingly, theaddition of the FMDV L protease and the hybridization of anantisense 2�-O-methyloligoribonucleotide complementary tothe PBS (nt 141 to 161) only partially inhibited the translationof the capped monocistronic RNAs (Fig. 2 and 4), thus sug-gesting that an alternative mechanism of translation is alsoprobably used. Moreover, insertion of the FIV 5� UTR into a

bicistronic vector resulted in weak (about 1/30 of the yield fromthe corresponding capped monocistronic construct; Fig. 3) butdetectable expression of the second gene. In addition, the useof 2�-O-methyloligoribonucleotides revealed that initiationproceeded by internal entry of the ribosome and was not theresult of leaky scanning or reinitiation from the 5� gene (Fig.4). However, with respect to translational efficiency, the use ofinternal initiation by the FIV 5� UTR is clearly a secondarymechanism compared to the use of 5�-dependent ribosomalscanning (Fig. 3). Such poor efficiency in vitro could reflect theneed for some ITAFs that may be absent from the RRL. Thus,we performed experiments with fibroblastic cat cells that werestably expressing bicistronic vectors (Fig. 5). This feline cellline is widely used to study FIV replication and efficientlysupports FIV protein production (41). However, the low ex-pression of �-gal (second gene) in these cells confirmed thatthe FIV 5� UTR supports only weak internal initiation (Fig. 5).These results contrast with data obtained with other membersof the lentiviral family such as HIV-1, HIV-2, and SIV, as theyall contain one or several IRESs within their genomes (1).

Thus, we next set out to examine the effect of FIV infectionon the translation of its cognate genomic RNA. Remarkably,under these experimental conditions, the production of �-galfrom the bicistronic construct containing the FIV 5� UTR wasincreased, whereas it remained virtually unaffected whendriven by the PV IRES or the HIV-2 5� UTR. This enhanced

FIG. 7. Prolonged heat shock reveals FIV IRES activity. CrFK cells stably expressing bicistronic plasmids pBi-AUG1, pBi-PV, and pBi-HIV2(see Fig. 5) were exposed to heat shock at 42°C for 15 h. (A) The effect of heat shock on cellular translation was quantified by labeling the cellswith [35S]methionine for 1 h. Cell extracts were then processed by SDS-PAGE followed by autoradiography. The position of heat shock proteinHsp90 is indicated. (B) Analysis of the effects of heat shock on neomycin and �-gal activities (left and right panels, respectively) for each of theconstructs described above. The results are expressed as percentages of the activity at 37°C. (C) Activity of �-gal expressed by bicistronic vectorspBi-AUG1 and pBi-PV with or without a CMV promoter at 37°C or 42°C. Results are expressed as percentages of �-gal activity.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

activity correlated nicely with the input of FIV delivered to thecells and was not observed following infection with the closelyrelated virus HIV-1 (Fig. 6).

These results are of particular interest as they show for thefirst time that a lentiviral IRES can be specifically stimulatedby homologous viral infection. Preliminary data indicate thatthis effect is the result of pleiotropic cellular and viral geneexpression, as neither one of the individual viral FIV genes wasable to stimulate IRES activity when transfected on its own(data not shown).

However, it could be argued that the enhancement of �-galexpression could be somehow influenced by the concomitantincrease in the activity of the first gene. Therefore, in order toexclude this possibility, cap-dependent translation was inhib-ited by submitting the CrFK stable cell lines to a prolongedheat shock for 15 h. After this treatment, the activity of the firstcapped cistron (neomycin) was decreased by 50% for all of theconstructs. Interestingly, �-gal production driven by the HIV-2and PV 5� UTRs remained virtually unchanged, whereas FIVexpression was stimulated twofold (Fig. 7). Several reportshave implied a role for heat shock in IRES-dependent trans-lation (17, 39), although the mechanism(s) by which this occursremains largely unknown. Another possible explanation is thatthe strong inhibition of cap-dependent translation creates acompetitive advantage for IRES-driven translation. Whatevermechanism is at play, the result confirms that the FIV 5� UTRhas the ability to function as an IRES under stress conditions.It is noteworthy that the mechanism used by FIV is quitedistinct from that of some cellular mRNAs, such as c-myc,which is capable of using either 5� ribosomal scanning or in-ternal initiation (8, 36). Indeed, c-myc clearly exhibits featuresof a classical IRES as it works well in a bicistronic setting andits translation is not disrupted by eIF4G cleavage (37). Thesituation for FIV is different, as it exhibits features of a cap-dependent gene by all criteria, i.e., high translational efficiency,translational enhancement by the presence of a 5� cap moiety,inhibition by the cleavage of eIF4G, ribosomal scanning fromthe 5� end, and virtually no activity in a bicistronic setting. Infact, under normal conditions the FIV IRES is somehow in a“dormancy” state and its participation in viral protein synthesisis only marginal. However, it can become active following heatshock and/or FIV infection.

In any case, the ability of the FIV genomic RNA to use twomechanisms for translation initiation is likely to provide a verystrong competitive advantage to promote viral protein synthe-sis at all times during infection of the host cell. Thus, probablyduring the early step of viral infection, FIV translation pro-ceeds almost exclusively by canonical 5� cap-dependent ribo-somal scanning, which is far more efficient than IRES-driventranslation. This ensures rapid and efficient production of thestructural proteins and enzymes. However, a large number ofevents, such as availability of the eIF4E initiation factor, pro-gression through the cell cycle, heat shock, or hypoxia (10, 33),can selectively compromise cap-dependent initiation. There-fore, the activation of the IRES mechanism would ensurecontinuous protein production independently of the physiolog-ical status of the cell. In agreement with this hypothesis, it isnoteworthy that the FIV protease has the ability to partiallycleave initiation factor eIF4G (data not shown).

In summary, our data clearly show that the FIV genomic

RNA can use two major distinct mechanisms for translationinitiation and their use is conditioned by progression throughviral infection or cellular stress conditions. Future work willaim at characterizing the molecular determinants involved inthis mechanism.

ACKNOWLEDGMENTS

We acknowledge Cecile Herbreteau for helpful discussions andcomments throughout this work, Tahir A. Rizvi (Department of Med-ical Microbiology, Faculty of Medicine and Health Sciences, UnitedArab Emirates University Al Ain, UAE) for kindly donating thepCMV/RU5 vector, and S. J. Morley for providing eIF4G antibodies.

V.C. was funded by Pisa University, Universite Franco-Italienne,and FRM grants. This work was supported by grants from the ANRS,ANR, INSERM, ACI, and TRIOH from EC 6th PCRD.

REFERENCES

1. Balvay, L., M. L. Lastra, B. Sargueil, J.-L. Darlix, and T. Ohlmann. 2007.Translational control of retroviruses. Nat. Rev. Microbiol. 5:128–140.

2. Belsham, G. J., and N. Sonenberg. 2000. Picornavirus RNA translation: rolesfor cellular proteins. Trends Microbiol. 8:330–335.

3. Bendinelli, M., M. Pistello, S. Lombardi, A. Poli, C. Garzelli, D. Matteucci,L. Ceccherini-Nelli, G. Malvaldi, and F. Tozzini. 1995. Feline immunodefi-ciency virus: an interesting model for AIDS studies and an important catpathogen. Clin. Microbiol. Rev. 8:87–112.

4. Berlioz, C., and J.-L. Darlix. 1995. An internal ribosomal entry mechanismpromotes translation of murine leukemia virus gag polyprotein precursors.J. Virol. 69:2214–2222.

5. Brasey, A., M. Lopez-Lastra, T. Ohlmann, N. Beerens, B. Berkhout, J.-L.Darlix, and N. Sonenberg. 2003. The leader of human immunodeficiencyvirus type 1 genomic RNA harbors an internal ribosome entry segment thatis active during the G2/M phase of the cell cycle. J. Virol. 77:3939–3949.

6. Buck, C. B., X. Shen, M. A. Egan, T. C. Pierson, C. M. Walker, and R. F.Siliciano. 2001. The human immunodeficiency virus type 1 gag gene encodesan internal ribosome entry site. J. Virol. 75:181–191.

7. Burkhard, M. J., and G. A. Dean. 2003. Transmission and immunopatho-genesis of FIV in cats as a model for HIV. Curr. HIV Res. 1:15–29.

8. Byrd, M. P., M. Zamora, and R. E. Lloyd. 2005. Translation of eukaryotictranslation initiation factor 4GI (eIF4GI) proceeds from multiple mRNAscontaining a novel cap-dependent internal ribosome entry site (IRES) that isactive during poliovirus infection. J. Biol. Chem. 280:18610–18622.

9. Deffaud, C., and J.-L. Darlix. 2000. Characterization of an internal ribosomalentry segment in the 5� leader of murine leukemia virus env RNA. J. Virol.74:846–850.

10. Gebauer, F., and M. W. Hentze. 2004. Molecular mechanisms of transla-tional control. Nat. Rev. Mol. Cell Biol. 5:827–835.

11. Herbreteau, C. H., L. Weill, D. Decimo, D. Prevot, J.-L. Darlix, B. Sargueil,and T. Ohlmann. 2005. HIV-2 genomic RNA contains a novel type of IRESlocated downstream of its initiation codon. Nat. Struct. Mol. Biol. 12:1001–1007.

12. Jackson, R. J. 2005. Alternative mechanisms of initiating translation ofmammalian mRNAs. Biochem. Soc. Trans. 33:1231–1241.

13. Jackson, R. J., S. L. Hunt, C. L. Gibbs, and A. Kaminski. 1994. Internalinitiation of translation of picornavirus RNAs. Mol. Biol. Rep. 19:147–159.

14. Jackson, R. J., and A. Kaminski. 1995. Internal initiation of translation ineukaryotes: the picornavirus paradigm and beyond. RNA 1:985–1000.

15. Johansson, H. E., G. J. Belsham, B. S. Sproat, and M. W. Hentze. 1994.Target-specific arrest of mRNA translation by antisense 2�-O-alkyloligoribo-nucleotides. Nucleic Acids Res. 22:4591–4598.

16. Junemann, C., Y. Song, G. Bassili, D. Goergen, J. Henke, and M. Niepmann.2007. Picornavirus internal ribosome entry site elements can stimulate trans-lation of upstream genes. J. Biol. Chem. 282:132–141.

17. Kim, Y. K., and S. K. Jang. 2002. Continuous heat shock enhances transla-tional initiation directed by internal ribosomal entry site. Biochem. Biophys.Res. Commun. 297:224–231.

18. Kirchweger, R., E. Ziegler, B. J. Lamphear, D. Waters, H.-D. Liebig, W.Sommergruber, F. Sobrino, C. Hohenadl, D. Blaas, R. E. Rhoads, and T.Skern. 1994. Foot-and-mouth disease virus leader proteinase: purification ofthe Lb form and determination of its cleavage site on eIF-4. J. Virol.68:5677–5684.

19. Kozak, M. 1991. Structural features in eukaryotic mRNAs that modulate theinitiation of translation. J. Biol. Chem. 266:19867–19870.

20. Kozak, M. 1989. The scanning model for translation: an update. J. Cell Biol.108:229–241.

21. Mangeot, P. E., D. Negre, B. Dubois, A. J. Winter, P. Leissner, M. Mehtali,D. Kaiserlian, F. L. Cosset, and J.-L. Darlix. 2000. Development of minimallentivirus vectors derived from simian immunodeficiency virus (SIVmac251)



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

and their use for gene transfer into human dendritic cells. J. Virol. 74:8307–8315.

22. Moscardini, M., M. Pistello, M. Bendinelli, D. Ficheux, J. T. Miller, C.Gabus, S. F. Le Grice, W. K. Surewicz, and J.-L. Darlix. 2002. Functionalinteractions of nucleocapsid protein of feline immunodeficiency virus andcellular prion protein with the viral RNA. J. Mol. Biol. 318:149–159.

23. Mustafa, F., P. Jayanth, P. S. Phillip, A. Ghazawi, R. D. Schmidt, K. A. Lew,and T. A. Rizvi. 2005. Relative activity of the feline immunodeficiency viruspromoter in feline and primate cell lines. Microbes Infect. 7:233–239.

24. Nicholson, M. G., S. M. Rue, J. E. Clements, and S. A. Barber. 2006. Aninternal ribosome entry site promotes translation of a novel SIV Pr55Gag

isoform. Virology 349:325–334.25. Ohlmann, T., M. Lopez-Lastra, and J.-L. Darlix. 2000. An internal ribosome

entry segment promotes translation of the simian immunodeficiency virusgenomic RNA. J. Biol. Chem. 275:11899–11906.

26. Ohlmann, T., M. Rau, S. J. Morley, and V. M. Pain. 1995. Proteolyticcleavage of initiation factor eIF-4 in the reticulocyte lysate inhibits trans-lation of capped mRNAs but enhances that of uncapped mRNAs. NucleicAcids Res. 23:334–340.

27. Ottmann, M., C. Gabus, and J.-L. Darlix. 1995. The central globular domainof the nucleocapsid protein of human immunodeficiency virus type 1 iscritical for virion structure and infectivity. J. Virol. 69:1778–1784.

28. Otto, G. A., and J. D. Puglisi. 2004. The pathway of HCV IRES-mediatedtranslation initiation. Cell 119:369–380.

29. Pedersen, N. C., E. W. Ho, M. L. Brown, and J. K. Yamamoto. 1987. Isolationof a T-lymphotropic virus from domestic cats with an immunodeficiency-likesyndrome. Science 235:790–793.

30. Prevot, D., J.-L. Darlix, and T. Ohlmann. 2003. Conducting the initiation ofprotein synthesis: the role of eIF4G. Biol. Cell 95:141–156.

31. Prevot, D., D. Decimo, C. H. Herbreteau, F. Roux, J. Garin, J.-L. Darlix, andT. Ohlmann. 2003. Characterization of a novel RNA-binding region ofeIF4GI critical for ribosomal scanning. EMBO J. 22:1909–1921.

32. Ramesh, N., and W. R. Osborne. 1991. Assay of neomycin phosphotransfer-ase activity in cell extracts. Anal. Biochem. 193:316–318.

33. Richter, J. D., and N. Sonenberg. 2005. Regulation of cap-dependent trans-lation by eIF4E inhibitory proteins. Nature 433:477–480.

34. Ronfort, C., S. De Breyne, V. Sandrin, J.-L. Darlix, and T. Ohlmann. 2004.Characterization of two distinct RNA domains that regulate translation ofthe Drosophila gypsy retroelement. RNA 10:504–515.

35. Spahn, C. M., E. Jan, A. Mulder, R. A. Grassucci, P. Sarnow, and J. Frank.2004. Cryo-EM visualization of a viral internal ribosome entry site bound tohuman ribosomes: the IRES functions as an RNA-based translation factor.Cell 118:465–475.

36. Stoneley, M., T. Subkhankulova, J. P. Le Quesne, M. J. Coldwell, C. L.Jopling, G. J. Belsham, and A. E. Willis. 2000. Analysis of the c-myc IRES;a potential role for cell-type specific trans-acting factors and the nuclearcompartment. Nucleic Acids Res. 28:687–694.

37. Thoma, C., G. Bergamini, B. Galy, P. Hundsdoerfer, and M. W. Hentze.2004. Enhancement of IRES-mediated translation of the c-myc and BiPmRNAs by the poly(A) tail is independent of intact eIF4G and PABP. Mol.Cell 15:925–935.

38. Vagner, S., B. Galy, and S. Pyronnet. 2001. Irresistible IRES. Attracting thetranslation machinery to internal ribosome entry sites. EMBO Rep. 2:893–898.

39. Vagner, S., C. Touriol, B. Galy, S. Audigier, M. C. Gensac, F. Amalric, F.Bayard, H. Prats, and A. C. Prats. 1996. Translation of CUG- but notAUG-initiated forms of human fibroblast growth factor 2 is activated intransformed and stressed cells. J. Cell Biol. 135:1391–1402.

40. Vagner, S., A. Waysbort, M. Marenda, M. C. Gensac, F. Amalric, and A. C.Prats. 1995. Alternative translation initiation of the Moloney murine leuke-mia virus mRNA controlled by internal ribosome entry involving the p57/PTB splicing factor. J. Biol. Chem. 270:20376–20383.

41. Yamamoto, J. K., E. Sparger, E. W. Ho, P. R. Andersen, T. P. O’Connor,C. P. Mandell, L. Lowenstine, R. Munn, and N. C. Pedersen. 1988. Patho-genesis of experimentally induced feline immunodeficiency virus infection incats. Am. J. Vet. Res. 49:1246–1258.

42. Yaman, I., J. Fernandez, H. Liu, M. Caprara, A. A. Komar, A. E. Koromilas,L. Zhou, M. D. Snider, D. Scheuner, R. J. Kaufman, and M. Hatzoglou.2003. The zipper model of translational control: a small upstream openreading frame is the switch that controls structural remodeling of an mRNAleader. Cell 113:519–531.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Documents

A Dormant Internal Ribosome Entry Site Controls Translation of