of 68 /68
FREE RUSSIAN - AMERICAN ADVERTISING REVIEW 37 63 19 New Jersey & New York Weekly Edition, Since 1995 MAY 27, 2015 № 917 (21) www.mysputnik.com Grand Opening of Viva MediSpa! Grand Opening Special - 25% off on all Spa Services offered. Hurry up and take advantage of this limited time offer. We look forward to pampering You! 1046 South Orange Ave. (Same building as Plastic Surgery Of Short Hills) Short Hills, NJ 07078 973-379-2127 We are excited to announce the Grand Opening of Viva MediSpa, where you'll be pampered through a variety of luxurious facial and body treatments, massages and skin tightening treatments such as: Viora ThermiSmooth Corrective Procedures with DermaPen (Combine with PRP for Vampire Facial) Dermasweep

917 sputnik

Embed Size (px)

DESCRIPTION

 

Text of 917 sputnik

  • FREE RUSSIAN - AMERICAN ADVERTISING REVIEW

    37

    63

    19

    New Jersey & New York Weekly Edition, Since 1995 MAY 27, 2015 917 (21) www.mysputnik.com

    Grand Opening of Viva MediSpa!

    Grand Opening Special - 25% o on all Spa Services oered. Hurry up and take advantage of this limited time oer.

    We look forward to pampering You!

    1046 South Orange Ave.(Same building as Plastic Surgery Of Short Hills)

    Short Hills, NJ 07078

    973-379-2127We are excited to announce the Grand Opening of Viva MediSpa, where you'll be pampered through a variety of luxurious facial and body treatments, massages and skin tightening treatmentssuch as: Viora ThermiSmooth Corrective Procedures with DermaPen (Combine with PRP for Vampire Facial) Dermasweep

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-66682

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 3

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-66684Russian Army Knife Fighting Seminar

    Regular Registration: $150 for one day .

    Sign up now: 347.749.9136 or [email protected]

    Discover the SecretsOf Slavic Warriors!

    Russian Army Knife Fighting System is a Unique Training Method That Unlocks Your Natural Fighting Potential and

    Master Instructor: Colonel Andrey Nikolayevich Kochergin, master of sport USSR, the chief of the Special Martial Combat department of The Military Institute of Physical Culture.

    You are going to get great seminar of solid training under the watchful eye of a Russian Martial Arts Expert and Special Forces Veteran Andrey Kochergin directly from St Petersburg, Russia!

    SATURDAY JUNE 6ITC OF New York Club, 22-55 31st street Astoria, NY 11051

    Covers Every Ground: Multiple Opponents Fighting in Difficult Conditions Special physical training

    Combat knife, the preferable target zones Counter Knife Work

    and much, much more

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 5

    Neck (lower face) - Reg. Price $5900 Promotional Price - $3900Full Abdomen - Reg. Price $8900 Promotional Price - $5900Thighs (Front or back) - Reg. Price $6900 Promotional Price - $4550Arms - Reg. Price $6900 Promotional Price - $4500

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-66686

    LAW OFFICES

    -

    Abe Jaloudi, Esq. Attorney at Law

    Hala A. Jaloudi, Esq. Attorney at Law

    1555 Main AvenueClifton, NJ 07011

    Tel: 973-928-4000Fax: 973-928-4444

    Certified Manager Paralegal

    Certified Manager Paralegal

    TF

    Jaloudi & Associates, LLCJaloudi & Associates, LLC

    -

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 7

    !

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-66688

    - :

    www.Xeniaresort.net

    518-263-4391

    , .

    , , .

    Xenia Resort, 10241 Route 23A, Hunter, NY 12442.GPS location 10306 Highway 23 A, Jewett Township, NY

    ,

    :

    :

    Memorial Weekend 2015. .

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 9

    , . -. , , - . , , .

    ?, .

    . - , . , . ., . . :

    -, . , .

    , , , , .

    , . .

    ,

    . - , .

    ? , .

    , , . :

    ( ). .

    (, ).

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666810

    Address: Sputnik13-33 River Road

    Fair Lawn, NJ 07410-8364

    . , Sputnik .

    Reproduction in whole or in part of any material in this publication is permitted only with the written consent of the publisher. Publisher reserves the right to reject any advertising matter. Publisher assumes no responsibility for the contents of advertisements. Although every effort was extended to assure the accuracy of all data, Publisher assumes no responsibility for inconveniences caused by errors and changes in the contact information of the businesses listed in the directory.

    ( ) , , . , .

    :1 ;1 ;2 ;2 ;

    ( );

    1 ;1 . ; . ;5 ( ); , , , .

    , - . . - . -, , , -. -, . -, - , . . - , , . : , . - , , - , .

    , - . , -, , - . : , . , .

    . , .

    : .

    , . , . (, ), .

    . -. , . , . . . - , .

    ( , : , - ). . . . . . , , , . (, --) . . - . , - . - . , , 10-15 . , . - .

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 11

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666812

    - -- .

    1. : .

    2. : ?

    3. : .

    4. : .

    5. : .

    6. : .

    7. : , - .

    8. : .

    9. : , .

    10. : .

    . . , , . .

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 13

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666814

    , . - . : .

    ?

    , . - , , -. - , , .

    , - , -: . - , .

    : - . , , . - . -, , . : . , , .

    , - . : . - . , -.

    . . .

    ,

    . . - . -, . -: , -, . - : , , . - , . - , .

    , , , - , . . : - .

    , , . - , . - . , , . , , - .

    .

    , , . - ( ), . . . , .

    , 40 , -. . -, : , . . D. . 15 , .

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 15

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666816

    , . . - . - ? -.

    -?

    , . , , . , . , . , , . , - .

    . - , . - : , , , , . , , . . , , .

    , , 75% , -, . , , . - , - . -, , .

    ?

    -. . 6 7 , 15 . - . - .

    , ? . .

    , , . -. , , , . , . , .

    -?

    , . , . , , -, . , .

    - , ,

    ? . -

    , . . . , . . , , -- . - . - , .

    -?

    , . , . , , , . , , - , .

    , , ?

    , , , , . . , - , , .

    . , , -, . , .

    , ?

    , . , . -, , , -. , - .

    , , , .

    . ?

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 17

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666818

    ? . -, . - - -, , ? -.

    - , .

    ,

    . : - , - .

    -: - , . - : - 30-35 . , - . . , . , , - .

    -

    , -. - - , , . , , , , . , . , - ,

    . - - , . , -, - . . , , . . - . , , , .

    -

    - , . -, - , : - , - . , : - , - .

    , . - , , , . -, , - -, . - -. , , - . - - , . , . , . , , -. : , . - , , . , - .

    ?

    . - , . . -. -- , -. . - -- . - - , . -, . - , - , -. 2-3 , . , .

    - . - . , , - , , . - . , , , , , . , : - , - , . . - , . - - : , . , - .

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 19

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666820

    , - , - , .

    - 37 , 67 . , 500 . . -,

    ( , , , ) 8%. , , , .

    , . , , . , .

    , , , - , - , .

    Skype

    , LCSW, Sc.D.

    Psychological Consulting and Therapy

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 21

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666822

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 23

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666824

    . , , - .

    , - 27 , , - , .

    , . . , , - . .

    . -, . - $100 000. 1953 . , . 27.

    , . , -, . , , - . . , .

    1. -

    - . . , . , , -

    , , , , .

    - , - 17 . , , - Harpers Bazaar, . - , . . , , . Chanel 5.

    2. -

    , . , . , , - . , - - . , , - . , - .

    . - , , -. , - -.

    , . , . - , .

    ? , , :

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 25

    732-607-0909LONG LASTING WRINKLE CORRECTION

    LOOK AS YOUNG AS YOU FEEL

    New Jersey State Certi ed for Botox & Dermal Fillers

    2515 Highway 516 Old Bridge

    Located InsideEMPIREDENTAL

    Before After

    FacialAestheticsCARE CENTER

    The Next Generation in Dermal Fillers

    Radiesse Juvederm RestylaneBelotero Botox Xeomin

    Instant Rejuvenation Look Years Younger Safe, Convenient

    BOTOX ORXEOMIN

    JUVEDERMOR RESTYLANE

    RADIESSE

    Perfect for:Forehead Frown Lines

    Crows Feet TMJ Treatment 1.5cc Syringe1 SyringeNot to be combined. Valid for1 person only. Expires 6/23/15

    Not to be combined. Valid for1 person only. Expires 6/23/15

    Not to be combined. Valid for1 person only. Expires 6/23/15

    $10/unit $450 $450

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666826

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 27

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666828

    , , . , , .

    , , -, . , - , .

    !

    . , - , . , . -, . - , .

    . - -. , ? - , , , , ?

    -

    -. , , . . - , . , - !

    ?

    , . . , . , - , .

    .

    - - . , . , , . -, ( 40 ) (100 ) . , - .

    - .

    ,

    ? , .

    - . , . . - , .

    ,

    . , .

    ,

    ,

    -. - . .

    - , - , , -. , .

    . ! -

    . , .

    , -

    . , . : , , . , .

    , - . - , , , , - .

    , , - , . -, .

    : -

    . : - . , - . . , , - , , .

    ? !

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 29

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666830

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 31

    M Medicaid,

    Medicare (part D)

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666832

    18 - , 60- . 1965- , 50 .

    -, - , , , -.

    , , . , , - .

    - , - . , , . , , , , .

    : , - , . , . , , , - . . - , . , , , .

    1924 -

    -, . 1949 , - . 50- , - . , , . 1956 - . - , . , - .

    1960 , - , - . - , .

    , ,

    , - . , -, .

    , , - . -. .

    1965 - , , . - , : - .

    , - , - . , . 18 1965 .

    , - , - . , - .

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 33

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666834

    5 0 1

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 35

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666836

    ERRICO & BARAKH, LLCALEXANDRA ERRICO, ESQ. ALEXANDER BARAKH, ESQ.

    Tel: 201.224.9904 fax: 201.224.9906260 COLUMBIA AVE., SUITE 18, FORT LEE, NJ 07024 3142 KENNEDY BLVD., 2 ND FL., JERSEY CITY, NJ 07306

    E

    (tickets)

    ,

    - -

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 37

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666838

    100 , 20 1915 , - - . , , .

    - , , . , , - , .

    , , . , , . , - . , , . , , . .

    1967 , , , , - - . , , , , - .

    , , -. , . , , . ( , . . .) , .

    , 1973 . , . 14- , - ( ). , 41-, , - , Ebay 75 . .

    , - . , - 1953-. - .

    . . 1959- , - .

    : - , . , - , . - , , . -, , - 1920- .

    - -. - 1965 , ( ).

    , 1963 - , , 1967 , -

    , .

    - , - . , .

    - . 45 . , 1969 , , - , , , , , . , , . , . .

    , - , -. , . - , . , 36 .

    , - . - . , , - -. , .

    1977 : - -

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 39

    . , . , - .

    - ( ), 1981 . , , , , . , - , .

    , -, , Moshe Dayan: Israels Controversial, 2012 . - , , , . 1980 . , , , .

    , , -. . . , .

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666840

    , 1 7.30 8.00 ( ) 8.15 10.10 11.00 ( ) 11.45 12.10 ! 13.05 14.00 14.30 - 16.20 17.00 17.15 . 17.50 / 19.00 19.15 . 20.00 ! 21.00 22.00 22.30 . . 0.20 0.50 1.45 2.30 3.00 3.15 3.40 ! 4.35 ! 5.00 ( ) 5.20 ! 5.50 6.40 /

    , 2 7.30 8.00 ( ) 8.15 10.10 11.00 ( ) 11.45 12.10 ! 13.05 14.00 14.35 . . 16.20 17.00 17.15 . 17.50 / 19.00 19.15 20.00 ! 21.00 22.00 22.35 . . 0.20 0.55 1.50 2.30 3.00 3.15 3.40 ! 4.35 ! 5.00 ( ) 5.20 ! 5.50 6.40 /

    , 3 7.30 8.00 ( )

    8.15 10.10 . 11.00 ( ) 11.45 12.10 ! 13.05 14.00 14.35 . 16.20 17.00 17.15 . 17.50 / 19.00 19.15 .20.00 ! 21.00 . 22.00 22.35 . - 0.20 0.55 1.50 2.30 3.00 3.15 . 3.40 ! 4.35 ! 5.00 ( ) 5.15 ! 5.50 6.40 /

    , 4 7.30 8.00 ( ) 8.15 10.10 11.00 ( ) 11.45 12.10 ! 13.05 14.00 14.35 -. . 16.20 17.00 17.15 . 17.50 / 19.00 19.15 .20.00 ! 21.00 22.00 22.35 . - 0.20 0.55 1.45 2.30 3.00 3.15 3.40 ! 4.35 ! 5.00 ( ) 5.15 ! 5.50 6.40 /

    , 5 7.30 8.00 ( ) 8.15 10.10 11.00 ( )

    11.45 12.10 ! 13.05 14.00 14.30 -. 16.20 17.35 / 19.00 19.10 20.00 - 21.00 22.00 22.30 , 1.40 2.30 / 3.00 ( ) 3.15 . 4.10 ! 5.00 ( ) 5.10 ! 5.20 6.10 /

    , 6 7.20 / 8.00 ( ) 8.10 . 8.50 / 10.20 , ! 11.00 ( ) 11.15 . 11.40 12.20 12.35 13.05 . . 14.00 14.20 15.10 , , - , - . 16.55 . , -

    19.20 19.55 . : 22.00 22.20 . 23.45 ! 2.10 - , - 3.00 ( ) 3.15 - , - . 4.25 , , 5.00 ( ) 5.15 . 6.05 , , !

    , 7 7.30 8.00 ( ) 8.15 / 10.00 10.25 . - 10.50 11.45 12.00 12.40 13.10 14.00 .15.30 . . 18.15 . 20.05 --. 22.00 23.30 ? ? ? 0.35 . 1.10 - 3.00 3.15 - 4.35 , 5.00 ( ) 5.20 .

    1 7

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 41

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666842

    , 1 08:00 09:00 - 10:00 M10:08 11:00 1 12:00 M12:08 01:00 / 02:30 . 03:00 M 03:25 04:00 04:30 . 05:00 06:00 07:00 07:25 08:00 2 09:00 8 10:00 10:30 11:00 11:30 12:15 2 01:15 01:45 02:30 03:30 . 04:00 . 05:30 06:00 8 07:00 07:30 , 2 08:00 09:00 8 10:00 M10:08 11:00 2 12:00 M12:08 01:00 . 02:30 . 03:00 M 03:25 04:00 04:30 . 05:00 06:00 07:00 07:25 08:00 3 09:00 9 10:00 10:30 11:00 11:30 12:15 3 01:15 01:45 02:30 03:30 . 04:00 / 05:30 06:00 9 07:00 07:30 , 3 08:00 09:00 9 10:00 M10:0 11:00 3

    12:00 M 12:08 01:00 02:30 . 03:00 M 03:25 04:00 04:30 . 05:00 06:00 07:00 07:25 08:00 4 09:00 10 10:00 10:30 11:00 11:30 12:15 4 01:15 01:45 02:30 03:30 . 04:00 / 06:00 10 07:00 07:30 , 4 08:00 09:00 10 10:00 M 10:08 11:00 4 12:00 M12:08 01:00 / 03:00 M 03:25 04:00 04:30 . 05:00 06:00 07:00 07:25 08:00 5 09:00 11 10:00 10:30 11:00 11:30 12:15 5 01:15 01:45 02:30 03:30 . 04:00 06:00 11 07:00 07:30 , 5 08:00 09:00 11 10:00 M10:08 11:00 5 12:00 M12:08 01:00 03:00 M 03:25 04:00 04:30 . 05:00 06:00

    07:00 - 08:00 6 09:00 12 10:00 - 11:00 11:30 12:15 01:15 01:45 02:30 03:30 . 04:00 . 05:30 06:00 12 07:00 , 6 08:00 09:20 / , 11:00 12:00 M12:30 01:00 . 02:30 . 03:00 - 04:00 05:30 . 06:00 07:00 07:30 08:00 09:00 10:30 . 11:00 - 12:00 , 01:30 . 02:00 .

    03:30 04:00 / 05:30 . 06:30 . 07:00 , 7 08:00 09:10 . 10:30 11:00 - . 12:00 M12:30 01:00 . 03:00 04:00 06:00 - 07:00 PM 07:30 08:00 - . 09:00 11:00 12:00 . 02:00 04:00 . 05:30 06:00 . 06:30 . 07:00 07:30

    RTVI 1 7

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 43

    Danu Radio 105.1 FM HD-2, iHeartRADIO DaNuRadio.com

    - 10:20 ,

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666844

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 45

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666846

    2015-2016

    22

    22

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 47

    Moonlight Dance StudioPresents

    BALLROOM BLITZ

    BALLROOM BLITZ

    June 20 th5 p.m.

    June 20 th5 p.m.

    . 201-389-3835www.moonlightdancestudio.org

    Also includes Girls Runway Fashion Show ( )

    Location Fair Lawn Community Center George Frey Center and Recreation

    10-10 20th Street, Fair lawn, NJ 07410

    Tickets: $25 - adult $15 - senior sitizen $10 - children

    AAAAAlAlAlAlAlAlAlAlAlAlAlsosososososososososososo iiiiiiiiiiiiiincncncncncncncncncncncnclllllulululululululudddddededdedededededededesssssss s s s GGGGGiGiGiGiGiGiGiGiGiGiGi lllrlrlrlrlrlrlrls s s s ssss ss RuRuRuRuRRuRuRuRuRuRuRuRunwnnwwnwnwnwnwwayayayayayayayayayayayayayyy FFFFFFFFFFFFFasasasasasasasasasasashihihihihihihhihihihihihihihiononononononononononononon SSSSSSSSSSSSSShohohohhhhhohohohohohohohow w w w w w w w w w ww ((((((((((((((( ))))))))))))))

    LoLoLoLoLoLoLoLLoLoLoLoLoLoLoccccacacacacacacacacatttttititititititititititionononononononnon FFFFFFFFFFFFFaiiiiiiiiaiaiaiaiaiair r r r r r r r LaLaLaLaLaLaLaLaLLaLaLaLaLaLawnwnnnwnwnwnwnwn CCCCCCCCCCCCCCComomomomomomomommumumumumumumumu iiiiiiinininininininitytytytytyyytytytytytytytyty CCCCCCCCCCCCCCCenenenenenenenntttttttteteteteteteteterr r r r r r r GGGeGeGeGeGeGeGeGeGeGeGeGeGeorororororororororororgegegeeegegegegegegegege FFFFFFFFFFFFFrererererererererey y y y y y y y y y y y yy CCeCeCeCeCeCeCeCeCeCeCeCeCeCe ttttttntntntntntntntntntererererererererererer aaaaaaaaaaaaa dddndndndndndndndndndndndnd RRRRRRRRRRRRRecececececcececececececrereerererererereere ttttatatatatatatatatatatatiiioioioioioioioioionnnnnnnnnn

    1111111111111110-0-0-0-0-0-0-0-0-0-0-0-0-0-11010101010101010101010101010 2222222222222220t00t0t0t0t0t0t0t0t0t0thhhhhhhhhhhh h h h SStStStStStStStStStStStStStrererererererererere ttttetetetetetetetetetetet, , ,, , , ,,, FaFaFaFaFaFaFaFaFaFaFaFaFaFaFaiiiiriririririririririririr lllllllllllawawawawawawawawnnnn,n,n,n,n,n,n,n,n,n, NNNNNNNNNNNNNJJJJJJJJJJ 0007070707070707070707070741414141414414141414141414100000000000000

    TTiTiTiTiTiTiTiTiTiTiTiTTT ckckckkkkkkkckckckckckck ttttttetettetetetetetets:s:s:ss:s:s:s:s: $$$$$$$$$$$$$252552525252525252525 ------------ aaaaaaaaaaaaaaddddudududududududududududulltltltltltltltltltlt $$$$$$$$$$$$$$1551515151515151515151515 ------------ sssssssssssssseneneneneneneneneneniiiioioioioioioioioioioior r r r r rr rr r r r sisisisisisisisisisisisisisititititititititititizezezezezezezezezezennnnnnnnnn $$1$1$1$1$1$1$1$1$1$1$1$10000 000 0 0 0 0 0 0 ----------- chchchchchchchchchchchchchchchiiiiiiilililililililildrdddddddrdrdrdrdrdrdrenenenenennenenenen

    Also includes Girls Runway Fashion Show ( )

    Location Fair Lawn Community Center George Frey Center and Recreation

    10-10 20th Street, Fair lawn, NJ 07410

    Tickets: $25 - adult $15 - senior sitizen $10 - children

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666848

    ! -----! . ?

    - :

    ?! .

    , . : , , -

    ? -

    : ! ,

    , . -!

    -, - , :

    ! , ?!

    , - :

    , ? : ! ! -

    . , , , .

    , , , , , - .

    - .

    , :

    ? ,

    -, -.

    . , , -

    . , ? : ,

    . ,

    ! ,

    , ! . ! ! ! , !

    . - .

    -, -.

    , , , , !

    - !

    , , - .

    , !

    , - .

    , , -- !

    , , - - ? .

    : ! ,

    ! , ! -. , ?

    - :

    , . ! !

    ! - . - ?

    :

    , ! - . -. ,

    ! ! - . - . , , , .

    , , .

    , , .

    . ,

    ! -, .

    .

    , :

    ! , : , ?! , , , , ! , ! - , - -, , - ! . !

    , .

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 49

    Formerly A-Z AcademyMARLBORO PREP

    Nearby park location provides daily sports activities

    ** offer expires June 1st

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666850

    ABOVE GROUND LEVEL LLC

    Home Improvement

    R o o f i n g G u t t e r s C h i m n e y s M a s o n r y Free Estimates & Fully Insured Lic# 13VH08362000

    25 YEARSEXPERIENCE

    10% Off Senior Citizens

    & VeteransOwner Operated& Present On

    Every Job

    With coupon. Coupon must be presented at time of estimate.Not valid with any other offers.

    With coupon. Coupon must be presented at time of estimate.Not valid with any other offers.

    With coupon. Coupon must be presented at time of estimate.Not valid with any other offers.

    With coupon. Coupon must be presented at time of estimate.Not valid with any other offers.

    With coupon. Coupon must be presented at time of estimate.Not valid with any other offers.

    With coupon. Coupon must be presented at time of estimate.Not valid with any other offers.

    15% OFF15% OFFAny Roof or

    Chimney Repair

    Any New Roof or Siding Job

    $29$29

    $45$45$850 OFF$850 OFF $100 OFF$100 OFF

    $49$49Chimney Cleaning

    Gutter Cleaning & Flow Check

    Chimney Cap

    Pavers/Mason Work

    $250 OFF$250 OFFAny Job Over $500

    Any Job Over $1000Starting

    at

    1-877-779-7027 201-509-3545

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 51

    732.447.3595

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666852

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 53

    1-800-735-1482 * (908) 810-5000 * Fax: 908-445-4264737 Boulevard, Kenilworth, NJ 07033

    www.njmirror.com

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666854

    ####################### -

    . , . - . - -. -.

    . -.

    - ?- ,

    .- ,

    . , ?!

    ####################### , -

    , .

    #######################

    , ? - - !

    #######################

    - :

    1. .2. -

    .3.

    , , .

    #######################

    - !

    - 20 20 - - .

    -.

    #######################

    - , , .

    - , - ?

    - , , - , , -.

    - .#######################

    - - , : , , - , - .

    #######################

    , .

    !

    , .#######################

    .

    - -. -: - ? :

    -, ?. - : ! ?

    #######################

    -. - .

    - , ?- , -

    !#######################

    - .

    --.

    -.

    .

    -.

    . ,

    , :- , -, -

    ?- - ,

    , - -.

    #######################

    - ?

    - -!

    , , - - !

    , !

    #######################

    , - . , , ...

    #######################

    - -!

    - . - .

    #######################

    , .

    #######################

    .- , -

    ?- ,

    , - .

    #######################

    - - , : - .

    #######################

    : -?:

    .: , -

    .#######################

    .

    - , - , .

    #######################-

    -

    .-

    ?-

    !#######################

    - .- .- !- , -

    .- , !

    .- ,

    , ! -, .

    #######################

    . . -

    . . . .

    #######################

    , , - , . - .

    #######################

    , , !..

    , , !

    #######################

    ! ! !

    #######################

    , - . - :

    - , .-

    .#######################

    - , - -. .

    - , - .

    #######################

    , : , -, , !

    #######################

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 55

    SPUTNIK online

    WWW.MYSPUTNIK.COM

    , , .

    . - .

    . 732-252-5251, 732-939-1328, 732-810-0240 : [email protected] -

    PARALEGAL .

    . . -

    (Separation). . - . Advanced

    Directive. . x . . + Apostille.. 732-234-6934 / 718-310-7471 E-mail: [email protected]

    www.notaryandparalegalservices.com

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666856

    MAC PC

    , -. -

    . -

    . - . -

    -. .: 201-873-5218

    New Jersey, Freehold

    732-431-3070 16-18

    ,

    201-937-2745 15-20

    C L A S S I F I E DFull Cleaning Service

    - , ,

    .

    201-588-5555 NJ212-645-5555 16-27 NYCprint cupon w/10% off

    ZhannasCleaning.com

    FOR RENT/SALE

    :

    , , , . . : 845-300-280506-17-$ 96 3797-4319-8011-007 07/17 8751 10977

    201-873-847917-20

    Cleaning Service , , .

    . . -

    . 732-421-4999 .b/w96-21

    , -

    , . , -

    . Cell: 973-919-958214-49

    , , - . . 10 . .

    347-328-3336 NJ00-25

    Residential, Commercial

    Industrial Lic.#15210917-328-525608-17

    Denny K Masonary LLC All type of Masonry work - Bricks, Blocks, Concrete

    sidewalks, Stone Steps, New foundations, Removing, Dirt, Waterproofing basements, Driveways, Concrete Pavers,

    Asphalt, Chimmny, Patios, Bathrooms tile, Roofing, Garbage removal.

    Residential and Commercial. Tel. 201-741-9543 81-32 $655k

    , -. .

    . 917.853.7773 34-39f

    . 917-238-8508 09-?

    - 2BD apt. 2-. , - - Clifton

    . / . $950/+ \- $550/+

    . 973-979-6098 16-17

    - Fair Lawn

    . 201-835-7708 13-15f

    Medical Transportation CO. 9 , , gross income 500-600 K.

    Logistic Care 609-287-8606 ask Maureen OMelySpeak English

    $16x4 $64 973-914-9446 14-17 color

    , -

    (crown

    moldings, fireplaces and much more),

    . 732-407-4285 16-19,20

    .

    , mahogany

    dining room set, living room set. Marlboro. 917-975-0969

    16-17 732 861 6205

    , Eagle Lake Community, 2 bedroom trailer

    . Tel. 609-306-8357 Paula Tel. 609-306-7521 Jack

    Speak English 16-18 FREE

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 57

    C L A S S I F I E D Piano Academy of Fort Lee Zhanna Rubinshteyn

    / / .

    , , .

    Phone: 201-294-7047 426 Central Blvd., Fort Lee NJ 07024 08-17 $140

    ,

    908-420-0597732-780-0368

    , PhD - - -

    . , SAT, ACT,

    PARCC, GMAT. - ( Precalc., Calculus) -

    . Bergen Academy.

    201-658-6719 Len 15-24 $120

    Certified math teacher with 20 years of experience in NJ

    schools and colleges.All subjects, all tests.

    973-220-4747 08-20$112

    201-233-9799 16-23

    732-777-515809-18 $80

    - -, - - CDL

    - . www.jerseyru.com732-890-1895 15-18

    dultcare bookkeeping. Tel. 973-896-2426 15-18 -

    - - 1-2

    Montville, NJ (Morris County) Alena

    Tel: 973-262-2306 ( ) 15-18

    . -, .

    Tel: 201-390-1998 16-17

    Freehold Infants and Toddlers: 732-303-8585 14-17,18 o

    -

    quickbooks. 347-749-1516$32 paid 14-17

    - Passaic, - CNC (stamping, bending), -

    , . . . 347-834-2707

    $40 14-17 color

    / New

    Brunswick. - , . , -

    , .

    ( ). -: , , . 201-704-9707 $14

    x 4 14-17

    truck shop - - , -

    . . 347-749-1516$32 Paid 14-17

    Rockaway NJ.

    862-219-1930 14-17,18 - .

    . 347-749-1516$32 14-17 NJ.

    Te - . - : ,

    - .

    : 201-248-4449 16-19

    SPUTNIK

    online WWW.MYSPUTNIK.COM

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666858

    CHHA, , o , e ,

    Randolph -12 hours Ledgewood - 14 hours

    Red Bank - 15 hrJersey City - 25 hr

    . 201.598.3394 64-69

    , CDL license . - NJ, NY, DE.

    973-928-3404 15-18,19

    CDL Class A (- hazmat and tanker).

    .

    T: 732.740.3681 17-20

    Hoboken Day Spa. Free parking.

    Tel. 908-510-1734 16-17 8--

    .

    NJ. Tel. 973-498-8533 15-18 347-546-1159 .

    . Maplewood.

    973-336-9585 17-18

    --

    , - North

    Jersey, - -. CDL BP,

    CDL AP. $25 .

    201-703-7979 201-615-2122 31-93

    T Graphic Designer -

    Adobe Illustrator, Photoshop, Indesign...Part Time, Fair Lawn,

    NJ 201-538-5955HVAC company

    .

    Tel. 732-816-3332 16-19

    Kids Unlimited Wayne

    646-737-3726 17-20

    Livingston -

    . 973-422-1033 06-14

    5-

    8- Fort Lee, . Part time: 20-26 . 917-657-5815

    15-18,19

    DL owner

    operator and company drivers c NJ/NY port c TWIC card -

    T. 732-668-9333 98-17 -10%

    -

    (East Brunswick), - ,

    CDL . T: 1-800-515-7914,

    732-2549155 8:00 18:0017-18 t. 732-322-1439 margorita

    -

    . Bergen County. 201-615-0010 12-19

    M Fair Lawn 201-970-4943

    - Granite and marble

    polishers. .

    . 203-936-7624 Robbie.

    08-12x2 Thomas 201-440-6779

    Looking for website developers.

    Wordpress, some PHP. Full time. Send

    resumes to [email protected]

    Good pay, insurance. 08-12x2 Thomas 201-440-6779

    -

    Ridgefield Park NJ. . 203-936-7624 Robbie.

    08-12x2 08-12x2 Thomas 201-440-6779

    C L A S S I F I E D

    Adult Day Care, NJ c :

    - - - T. 646-496-5190 16-19f

    Elizabeth NJ,

    ( D) .

    SS , .

    : 646-283-2243 14-17 x$16

    Howell, NJ

    Tel: 848-222-1560 17-18

    5 , 5-6 , - 18- . West

    Caldwell, NJ 201-220-5365 17-19

    , -

    , companion, rehab ,

    Nursing home New Jersey. Certificate CHHA

    201-446-8799 16-20

    201-243-0035 14-17

    for Exclusive SPA in Montvale NJ 07645. Excellent money.

    T. 201.802.9777, 201.327.0680must speak English 15-1820

    for Exclusive Salon in Montvale NJ 07645. Excellent money. T. 201.802.9777, 201.327.0680

    must speak English 15-1820

    T NJ CDL

    TEAM CA.

    . - owner

    operators. 908-472-5666 15-18 d$120

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 59

    -! Ads Market,

    .

    .

    : 718.907.3222

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666860

    DORINA HALIFMAN 201-857-3111BASS IRINA 201-773-6171 201-357-5929

    908-624-0090GELLIS DANA 201-265-5000ITSkHOkI-LEvAN Y 201-791-9340 201-567-4488LEvYkH-CHASE R. 201-791-8689 201-291-0401

    LIppE S. DAvID 201-291-0401

    OSMANOFF GARY 732-617-2830 201-797-6790DUkLER MARINA 732-462-0430 . 201-346-4660 . 732-545-7776 . 908-259-0505SHULMAN Anita & Michael

    201-840-7777, 973-478-4111SHIkHMANTER v. 732-617-8411

    - . Sp. Lic#5170 201-568-9098

    201-461-5655

    ., .

    201-797-3310, 973-736-4030 . 201-398-0020

    201-794-7566

    pASTERNAk pHILIp 732-901-4300

    OvCHINSkY A. 973-379-0101

    . 201-943-0022 . 973-427-4864 . 201-838-7722SHOLOMON R. 201-797-2747

    201-797-8333 . 201-943-6464

    201-796-4600 973-771-519946-

    . 201-282-8356

    BAREMBOYM M. 732-340-1006GONT ARRIO 201-398-0020GONT ROMAN 201-398-0020

    pUSHNYA NIkOLAI 201-265-5000 &

    732-698-7108

    -RAMON (philipin.) 201-398-0020 201-291-0401

    TSYpIN GALINA 201-398-0020

    BAkSHIEv REGINA 201-398-0020

    A-+ pHARMACY 732-308-9099llTown pHARMACY 732-542-7773FAIR LAWN pHARMACY 201-773-6090GARDEN pHARMACY 201-797-6888NATURE MED 201-945-8006FUTURE pHARMACY 732-431-8170

    CONFIDENT CARE 201-498-9400ALWAYS HOME CARE 201-598-3394BAYADA 973-857-8333

    ADULT DAY CAREGOLDEN YEARS 973-782-4112LONG LIFE 201-943-7111FIvE STAR 908-486-5750

    201-968-5700GRIGOLIA LEO 201-487-0555GREENMAN SAL 201-796-4455SHMARUk BORIS 855-887-5297 . 973-258-1414 201-848-1005kISSEN A. 347-268-3707 - 888-566-8258

    - . 201-475-0999 732-390-1660 908-433-9132

    732-536-0485SUSLOv SERGEI 732-306-7929

    INSURANCEA 201-300-6275 201-773-8521

    MORTGAGE & LOANSMORTGAGE DOCTOR 201-819-3486

    TREYSTER ANETA 732-221-6287TSIN BELLA 732-522-3838 732-690-6996 347-753-4050GARBUZ MICHAEL 201-697-9953 917-443-4699 A 201-819-9779SALMAN MICHAEL 201-745-1471

    ESCApE 201-580-0977CRYSTAL pALACE 732-972-5959pETER The GREAT 732-6502-6500ClASSIQUE 732-316-9100kABARE 732-723-0200

    MAGIC GARDEN CENTR 201-562-6552FIRST STEp CHILD CARE 201-703-1279MARLBORO pREp 732-617-2606 732-252-8103CHESS ACADEMY 201-797-0330 201-790-6996 732-416-6604

    GENIUS kIDS 732-851-6427 862-452-7245ADv. LAND 201-342-7001SCHOOL pLUS 732-246-4150

    973-815-1500Intellichild Academy 201-696-1330ELITE kIDS ACADEMY 973-342-3221

    ANICHkOv MOST 201-794-7737HAppY WORLD 201-796-3388pARADISE Travel 732-583-7260

    A AAQUASpA 732-422-5005 NEW IMAGE 732-698-9801

    /BROOk pLUMBING 201-945-8004 201-290-0475pICASSO 201-926-1703NJ MIRROR & GLASS 800-735-1482GARAGE DOOR 732-986-7937

    B&B INTERNATIONAL: DELI 201-794-0115 Wines & LIQUER 201-773-6064M Gaiser's 908-206-9822 , 917-549-7393BROADWAY FOOD 201-203-4843BODY SHOp 908-245-7788 201-960-6965 888-633-7853

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 61

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666862

    David Barthold Inna Kazatsky

    AMAZING PRICE FOR TRI-SPLIT LEVEL HOME WITH 4 BEDROOMS AND 2 BATH AND A BONUS

    APARTMENT ON THE THIRD FLOOR

    $384,500Waldwick

    BEAUTIFUL 4 BEDROOM, 2 BATH COLONIAL WITH MODERN KITCHEN, FENCED YARD AND

    MUCH MORE. ONES OF THE BEST SCHOOL SYSTEM AND CLOSE TO PARKS, NY TRANSPORT.

    WELL MAINTAINED 3 BEDROOMS,1,1 BATH COLONIAL SET ON A LARGE LOT IN BLUE RIBBON

    SCHOOL DISTRICT.

    $479,500Waldwick$315,000

    Price Just ReducedWaldwick!!

    IN CENTRAL, MIDDLESEX, MONMOUTH, MERSER, OCEANCOUNTIES - I WILL FIND YOUR DREAM HOME!

    Single family home - 4 bedrooms, 4 bathrooms, pool, basement & more offered for $650,000 and up.... any homes for any budget!Townhouses - 2 or 3 bedrooms, basement, 4 bathrooms, elevator...

    2 bedrooms, 2 bath and balcony condos - $250,000

    Bella Tsin, 15 - YEARS REALESTATE PROFFESIONALMy clients call me the best negotiator Primary: 732-536-5355 Ext.107 Mobile: 732-522-3838

    New Jersey New Jersey New JerseyE-mail: [email protected]

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 63

    !

    - - ,

    (REAL ESTATE TAX),

    10-

    VALUE ESTATE CONSULTING, LLC(Licensed and insured in New York and New Jersey)

    347-351-5211 201-233-4007

    , ,

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666864

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 65

    15 years in business18 years in business

    !!!

    , ,

    201-819-3486201-819-3486

    we heard a lot of horror stories

    about mortgages and closings. Happily,

    we have no complaints about ours.Beth J. - Brooklyn

    Beth J. - Brooklyn

    ...

    ,

    .

    .

    .

    .

    .

    .

    - Fair Law

    n- Fair

    Lawn

    . - Jackson Heights

    . - Jackson Heights

    , ,

    .

    ...

    I am in the Real Estate business for many

    years and I see a lot of mortgage reps who

    promise everything and deliver nothing.

    You are a well-needed exception.

    Inna P. - Tenafly

    Inna P. - Tenafly

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666866

  • Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-6668 www.mySPUTNIK.com May 27, 2015 917 67

  • 917 May 27, 2015 www.mySPUTNIK.com Tel.: 201-538-5955, 973-886-2284, 201-398-0033 * Fax: 201-797-666868