2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1

8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1

http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 1/140

Molecular cloning and characterization of

the phycocyanin genes from Spirulina platensis C I

Miss Wattana Jeamton B.Sc. (Agriculture)

A Thesis Submitted in Partial Fulfillment of the Requirements

for the Degree of Master of Science

Biotechnology Program

School of Bioresources and Technology

King Mongkut’s Institute of Technology Thonburi

1997

Thesis Committee

5 lg&,&L&&~. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Chairman

. . . . . . . . . . . . . . . . . . . . . . . . . . . Co-Chairman

(Asst. Prof. Suchada Chaisawadi)

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . Member

(Assoc. Prof. Dr. Sakarindr Bhumiratana)

. . . . . . . . . . . .f:. . . . . .f&h?.!?? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Member

(Dr. Patcharaporn Deshnium)

:414. . . . . . . . . . . .Y., CL&’

l.‘Gh. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .Member

(Asst. Prof. Dr. K. J. Reddy)

ISBN 974-624-075-7

Copyright reserved



ii

Thesis Title

Thesis Credits

Candidate

Supervisors

Degree of Study

Department

Academic Year

Molecular cloning and characterization of the phycocyanin

genes from Spirulina platensis Cl

1 2

Miss Wattana Jeamtdn

Asst. Prof. Dr. Supapon Cheevadhanarak

Asst. Prof. Suchada Chaisawadi

Assoc. Prof. Dr. Morakot Tanticharoen

Master of Science

Biotechnology

1997

Abstract

In this study, three strategies were employed in the isolation of the

phycocyanin genes (cpcBA) from S. platensis Cl. These include cloning phycocyanin

genes by inverse polymerase chain technique (IPCR), by screening genomic and

partial library. The phycocyanin genes were successfully obtained from the genomic

library. The cpcA specific probe designed from the conserved amino acid sequences

of cpcA genes of various cyanobacteria and one red alga (Cheevadhanarak,

unpublished) was used as a homologous probe to screen hDASHI1 genomic DNA

library of S. platensis Cl. One out of twenty positive recombinant h clones containing

phycocyanin genes was isolated and their sequences were determined. Two open

reading frames of 5 16 bp and 486 bp corresponding to cpcB and cpcA genes,

encoding p and a subunits, respectively, were found in the EcoRV fragment of the



. . 111

genomic DNA. The cpcH and cpcl gene encoding rod-rod linker proteins were also

found downstream of the cpcA gene. The identity of the deduced amino acid

sequences of cpcB and cpcA genes compared to those of Synechocystis PCC6701,

Synechococcus elongatus, Pseudoanabaena PCC7409 and Agaothamnion neglectum

were 82.5, 8 1.9, 79.6 and 70.9% for cpcB gene and 79.6, 75.3, 79.6 and 70.9% for

cpcA gene, respectively. For the cpcH and cpcI genes, their partial amino acid

sequences revealed the highest score of identity with those of Synechococcus

PCC6301 as 53.1% and 69.5%, respectively. Expected chromophore attachment sites

were found at cysteines position 84 of the a-subunit and position 82 and 153 of the

P-subunit. DNA sequence and restriction mapping analysis revealed that the obtained

genes form cpcBAHI operon with a putative transcriptional start and termination

sites. The putative transcriptional initiation site of this operon was located 290

nucleotides upstream from the translation start site of the cpcB gene. Additionally,

the sequences similar to Escherichia coli consensus promoter sequences were also

found at the putative promoter regions of the cpcBAHI operon of S. platensis Cl.

These results suggest that the obtained genes form cpcBAHI operon and

encodes the phycocyanin and rod components of S. platensis C 1.

Keywords: Spirulina platensis /phycocyanin genelcpcBAHI operon/

cyanobacterium/phycocyanin



iv



V



vi

Acknowledgments

I am very grateful to Asst. Prof. Dr. Supapon Cheevadhanarak, School

of Bioresources and Technology,’ King Mongkut’s Institute of Technology

Thonburi (KMITT), for her advice on all aspects of the work, reading and

kindly suggesting improvements of the manuscript and Asst. Prof. Suchada

Chaisawadi, Pilot Plant Development and Training Institute (PDTI), for her

excellent technical assistance, reading and discussion the manuscript. I also

wishes to thank Assoc. Prof. Dr. Morakot Tanticharoen, Assoc. Prof. Dr.

Sakarindr Bhumiratana, and Dr. Patcharaporn Desnium, National Center for

Genetic Engineering and Biotechnology (BIOTEC) and Asst. Prof. Dr. K. J.

Reddy, State University of New York at Binghamton, for their guidance,

discussion and reading the manuscript.

Lastly, without all the encouragement, understanding and support

from everyone in Gene Technology Laboratory, this thesis would not have

been completed. Their contribution is greatly appreciated. This thesis was

supported in part by a grant from the National Center for Genetic Engineering

and Biotechnology (BIOTEC).



vii

Contents

English abstract

Thai abstract

Acknowledgments

Contents

List of Tables

List of Figures

Abbreviations

Chapter 1 Introduction

1.1 Background

1.2 Objectives

1.3 Scopes

Chapter 2 Literature Review

2.1 Cyanobacteria

2.2 Spirulina

2.3 Phycobilisome

2.3.1 Phycobilisome structure

2.3.2 Phycobiliprotein

2.3.2.1 PBPs constituting the PBS core

2.3.2.2 Phycobiliprotein constituting the PBS rod

2.3.3 Linker polypeptide

Page

ii

iv

vi

vii

xi

xii

xvi

1

1

2

2

4

4

7

11

1 3

1.5

1 9

2 2

2 5



..~V l l l

2.3.4 Chromophore

2.3.5 Organization and transcription of the genes

encoding the PBS component

2.3.6 Energy transfer in the phycobilisomes

2.3.7 Regulation of phycobilisomes by environments

2.3.7.1 Control of the PBS size and number

by light intensity

2.3.7.2 Effect of light quality on PBS structure

2.3.7.3 Regulation of the PBS by nutrient

2.4 Studies of PBS in Spirulinaplatensis

Chapter 3 Material and Methods

3.1 Strains and Plasmids

3.1.1 Cyanobacterium strain

3.1.2 Bacterial strains

3.1.3 Plasmids

3.2 Chemicals

3.3 Enzymes

3.4 Media and culture condition

3.4.1 Cyanobacteria

3.4.1.1 Culture medium

3.4.1.2 Culture condition

3.4.2 Bacteria

3.4.2.1 Culture medium

2 7

3 0

3 7

3 8

3 8

4 0

4 2

4 3

4 5

4 5

4 5

4 5

4 5

4 6

4 6

4 6

4 6

4 6

4 8

4 8

4 8



ix

3.4.2.2 storage and culture

3.5 Primers/Synthesis nucPeotides

3.6 Buffers and solutions

3.7 Molecular biology techniques

3.7.1 General procedures

3.7.2 Plasmid extraction

3.7.3 Bacterial transformation

3.7.4 Subcloning of DNA fragments

3.7.5 DNA labelling

3.8 Cloning of phycocyanin gene from S. platensis Ct Strain

3.8.1 Preparation of genomic DNA

3.8.2 Phycocyanin probe

3.8.3 Genomic library construction

3.8.4 Plating bacteriophages

3.8.5 Screening of the DNA library

3.8.6 Preparation of DNA from bacteriophage

3.8.7 Partial genomic DNA library construction

3.8.8 Screening the partial genomic DNA library

3.8.9 Isolation of PC gene by inverse polymerase chain

technique (IPCR)

4 8

4 9

4 9

5 3

5 3

5 6

5 7

5 8

5 9

5 9

5 9

6 0

6 2

6 3

6 4

6 5

6 6

6 8

6 8

3.8.10 Characterization of positive clones 6 9

3.8.10.1 Southern blot analysis 6 9

3.8.10.2 Restriction mapping analysis 6 9



X

3.8.10.3 Sequencing analysis

3.8.11 Analysis of the copy number of phycocyanin gene

Chapter 4 Results and Discussions

4. 1 Isolation of phycocyanin gene from S. platensis

4.1.1 Isolation of phycocyanin gene from h genomic

DNA library

4.1.2 Isolation of phycocyanin genes from partial

genomic DNA library

4.1.3 Isolation of phycocyanin gene by using inverse

polymerase chain reaction technique (IPCR)

4.2 Characterization of the phycocyanin genes

Chapter 5 Conclusion and Suggestion

5.1 Conclusion

5.2 Suggestion

References

7 0

7 1

7 2

7 2

7 2

8 3

84

88

106

106

107

108



xi

List of Tables

Table Page

2. 1 Abbreviations for the biliprotein subtiits and for linker polypeptides 3 1

2.2 Phycobilisome polypeptides and their genes 3 2



xii

List of Figures

Figure

2. 1

2.2

2.3

2.4

Schematic diagram of thin section of a cyanobacterial cell

Morphology of Spirulina

Life cycle of Spirulina

Page

6

9

1 0

1 2

2.5

A model of the phycobilisomes attached to thylakoid membrane

from Cyanophora paradoxa

Phycobilisome structures

2 . 6 Crystal structure of C-phycocyanin monomer ~~~~~~~~ in a

boomerang shape from Mastigocladus laminosus

Crystal structure of trimeric C-phycocyanin (opc(3pc)~ from

Mastigocladus laminosus

1 3

1 7

2 . 7 1 7

2. 8 Schematic side view of a phycocyanin haxamer (apcppc)s from

Mastigocladus laminosus

1 8

2 . 9 General features of allophycocyanin subunits (a and p subuits) 2 1

2.10 General structure, common features and chromophore

variability of phycocyanins

2.11 Phycobilin and their peptide linkages in phycobiliproteins

2.12 Phycobilin biosynthesis pathway

2.13 The organization and transcription of genes encoding

phycobilisome component of cyanobacteria Synechococcus PCC7002,

Synechococcus PCC6301 and Anabaena PCC7 120

2 3

2 7

2 9

3 5





xiv

S. platensis Cl in plasmid pGT52 and subcloning of EcoRIIClaI

and ClaIIXhoI fragments of that into plasmid pGEM7Z+

4.8 (A)Amplification of phycocyanin gene from S. platensis Cl

genomic DNA by using IPCR technique (B) Southern blot analysis

of 4.2 kb amplified fragment with homologous cpcA probe

4 . 9 Amplification of IPCR product by using PCR technique

4 . 1 0 The nucleotide and deduced amino acid sequences of cpcBA genes

of S. platensis Cl

4.11 Comparison of the deduced amino acid of a subunit of phycocyanin

of S. platensis Ci (Spi) with those of Synechocystis PCC 6701

(Syn 6701), Synechococcus elongatus (Syn), Pseudanabaena PCC7409

(Pseu) and Agaothamnion neglecturn (Agao)

4.12 Comparison of the deduced amino acid of p subunit of phycocyanin

of S.. platensis Cl (Spi) with those of Synechocystis PCC 6701

(Syn 6701), Synechococcus elongatus (Syn), Pseudanabaena PCC7409

(Pseu) and Agaothamnion neglecturn (Agao)

4.13 Comparison of the deduced amino acid of a subunit and p subunit

of phycocyanin (PC) and allophycocyanin (APC) of S. platensis Cl

4.14 Comparison of the promoter sequences found upstream of the

transcriptional start sites of cpcBA from Anabaena 7120 (Ana),

8 6

8 7

8 9

9 0

9 1

9 4

9 7

Cyanophoraparadoxa (Cya) and putative promoter of S. platensis Cl (Spi)

4.15 Comparison of the promoter sequences found upstream of the 9 8

transcriptional start sites of cpcBA from cyanobacteria Anabaena 7 120 (Ana),



x v

4 . 1 6

4 . 1 7

Synechococcus PCC 7002 (Syn), Calothrix PCC 7601 (Cal) and

putative promoter of S. platensis Cl (Spi)

The possible terminator sequence of cpcBA operon of S. platensis Cl

form Stem and Hairpin loop ’

The partial nucleotide and deduced amino acid sequences of cpcH

(the first openreading frame) and cpcl (the second openreading frame)

genes of S. platensis Cl

100

1 0 1

4.18

4 . 1 9

Comparison of deduced amino acid of partial cpcH and cpcl of 102

S. platensis Ci (Spi) with the rear part and the first part of cpcH

and cpcl genes of Synechococcus PCC 6301 (Syn), respectively

Southern blot analysis of genomic DNA of 5’. platensis Cl 104

digested with EcoRV, EcoRI, EcoRV and EcoRI, ClaI, EcoRV and ClaI,

EcoRI and ClaI and HindIIUEcoRI hmarker probing with 700 bp

CZaIIHindIII fragment contained a part of cpcB and cpcA genes

4.20 Organization and restriction map of cpc genes of 5’. platensis Cl 1 0 5



xvi

Abbreviations

D N A

%

w

k b

O.D.

PCC

PCR

RNase

DNase

l-43

Pl

A P C

P C

P E

P E C

Deoxyribonucleic acid

nanogram

miligram

kilobase (1 kb = 6.7~ 1 O5 daltons = 1000 base pairs)

optical density

Pasteur Culture Collection

Polymerase Chain Reaction

Ribonuclease

Deoxyribonuclease

revolution per minute

microgram

microlitre

allophycocyanin

phycocyanin

phycoerythrin

phycoerythrocyanin



Chapter 1

Introduction

1.1 Background

Spirulina sp. is a filamentous cyanobacterium of industrial importance. It

has been used as feed for fish, poultry and farm animals [ 11. It is used also as a

supplement in human diets as it contains a lot of vitamins and minerals, and is

specially rich in protein containing about 55-60 % of cell dry weight [2].

Furthermore, it contains phycocyanin, p-carotene, chlorophyll a [3], and gamma-

linolenic acid, a polyunsaturated fatty acid [4]. Of all these substances, phycocyanin,

a blue pigment, is of high commercial value. In Japan, phycocyanin from Spirulina is

used as a natural blue-pigment for food coloring. In addition, owing to its

fluorescence property, pure phycocyanin is used as labeling substance in

immunoassays, microscopy and cytometry [5]. Moreover, it has been demonstrated

that Spirulina has therapeutic effects against hyperlipidemia [6]. Therefore, there is a

potential for future pharmaceutical use of Spirulina to produce many health related

products. It may be possible to further enhance the production of certain compounds

such as p-carotene in Spirulina through genetic engineering.

Phycocyanin is a major blue-colored pigment, phycobiliprotein, of S.

platensis other than allophycocyanin [7], constituting macromolecule structures,

phycobilisome, mediated by noncolored linker polypeptides. In 5’. platensis,



2

phycocyanin is located in phycobilisome rods radiating from the allophycocyanin

which constitutes the core portion. These phycobilisomes reside on the

photosynthetic membrane (thylakoid) and are important in photosynthesis in

harvesting light energy from sunlight. The absorbed light energy is transferred very

rapidly, from phycocyanin to allophycocyanin that act as the final energy transmitters

from the phycobilisome to reaction center of PSI1 [8,9].

Spirulina is the only cyanobacterium grown in large industrial scale as

human food or animal feed, and it is cultivated mainly under outdoor conditions.

Hence light intensity plays a major role in the production of cell mass, as well as in

the quantity and quality of photosynthetic pigments such as phycocyanin in the cells.

Thus the aim of this study is to clone and characterize the phycocyanin (cpcBA)

genes from the cyanobacterium, S. platensis C i strain, resulting in providing

important tools for understanding the physiology and biochemistry of the

phycocyanin at a molecular level.

1. 2 Obiectives

1 . To clone the phycocyanin (cpcBA) operon from S. platensis C i strain.

2 . To characterize the obtained operon.

1.3 Scope

1 . Construction of h genomic DNA and partial genomic DNA library of

S. platensis Ci strain.



2. Screening of phycocyanin (cpcBA) operon from 5’. platensis Cl h

genomic DNA and partial genomic DNA library using amplified partial cpcA gene of

S. platensis Cl strain.

3. Isolation of the phycocyanin (cpcBA) operon by using the inverse

polymerase chain technique.

4. Characterization of the obtained gene by restriction mapping, DNA

sequencing and comparison of the gene products with those from other organisms.



Chapter 2

Literature Review

2.1 Cyanobacteria

Cyanobacteria are members of the Kingdom Prokaryotae and are included in

the Division Gracilicutes (bacteria with a Gram-negative cell wall). They are

assigned to the Class Photobacteria within Subclass Oxyphotobacteriae, Order

Cyanobacteriales [lo]. Cyanobacteria are probably the most diverse group of

prokaryotes in the number of species, type of habitat, morphology and physiological

properties [l 11. Besides their prokaryotic nature, the unifying property of

cyanobacteria is their ability to perform oxygenic photosynthesis by mechanisms

similar to those of algae and higher plants. Because cyanobacteria can live in many

different ecological niches, they have experienced different environmental stresses

and may thus, have evolved specialized adaptation mechanisms. Some strains are

strict photoautotrophs, others can alternatively use exogenous carbon sources such as

glucose [ 111. Moreover, some strains are able to fix nitrogen. These strains have

developed the ability to differentiate highly specialized nitrogen-fixing cells, so

called heterocysts, when facing an environment in which combined nitrogen becomes

limited [ 121. Other differentiation processes, mainly directed towards reproduction

and dissemination of the species, resulted in the evolution of three different cell

types: akinetes, baeocytes and hormogonia [ 121. The general organization of



5

cyanobacterial cell as shown in Figure 2.1 was reviewed by Starrier and Cohen-

Bazire [ 13,141. Almost all the cyanobacteria possess classical thylakoid membranes

with two photosystems (photosystem I and photosystem II). However, unlike most of

the photosynthetic eukaryotes (with the exception of eukaryotic red algae), they do

not contain chlorophyll b, but harvest light energy primarily through unique

multimolecular structures, the phycobilisomes. Cyanobacteria also often contain a

large variety of intracellular inclusions, some of which are surrounded by a non-unit

membrane and most of which have reserve function (also see in Figure 2.1). These

inclusion bodies are accumulated under adverse conditions of nutrient imbalance

[ 121. The nitrogen is stored in the form of cyanophycin granules which contain high

molecular mass non-ribosomally synthesized polymers consisting of equimolar

quantities of arginine and aspartate. They are nitrogen reserves uniquely to but not

universally present in cyanobacteria [ 121. In addition, under certain circumstances,

phycobiliproteins which represent the major components of the phycobilisomes may

also serve as a nitrogen source. Carboxysomes are polyhedral bodies containing

carbonic anhydrase and ribulose-1 &bisphosphate carboxylase-oxygenase (Rubisco),

the key enzyme required for the assimilation of inorganic carbon, as well as a few

additional enzymes related to carbon metabolism [ 121. Polyglucose (glycogen bodies)

and poly+-hydroxybutyrate are reserves of carbon and energy, while polyphosphate

bodies are storage of phosphate.



I

6

Figure 2.1 Schematic diagram of thin section of cyanobacterial cell. CM; cell

membrane, TH; thylakoid, PBl and PB2; face and side views of

phycobilisomes attached to adjacent thylakoids, GG; glycogen granules,

CY; cyanophycin granule, C; carboxysome surrounded by nucleoplasm,

R; ribosomes, G; gas vesicles. Insert A; enlarged view of the cell

envelope showing the outer membrane, peptidoglycan wall layers and the

cytoplasmic membrane. Insert B; enlarged view of part of a thylakoid

showing the paired unit membrane with attached phycobilisomes in side

view [14].



7

2.2 Spirulina

Spirulina is a multicellular filamentous cyanobacterium. It belongs to

Phylum Cyanophyta, Family Oscillatoriaceae [ 151. Spirulina is a ubiquitous

organism which can be found in a variety of environments such as soil, sand,

marshes, brackish water, seawater and fresh water [ 161. Spirulina appears to be

capable of adaptation to very different habitats and colonizes harsh environments

where life is very difficult for other organisms. Spirulina is a thermophilic alga, the

optimal temperature for its growth falls between 35 to 37’C. The salt concentration

(mostly carbonates and bicarbonates) plays a direct role in the growth of Spirulina

[ 161. The growth of S. platensis is optimal at salt concentrations ranging from 20 to

70 g per liter, however S. platensis was found in water containing from 85 to 270 g of

salt per liter. In the lakes containing salt concentrations more than 30 g per liter,

Spirulina was the only organism present in significant quantities [ 161.

Under a microscope, Spirulina appears as blue green filaments composed

of cylindrical cells arranged in unbranched, helicoidal trichomes (Figure 2.2). The

filaments are motile, gliding along their axis and heterocysts are absent [ 161. The

helical shape of trichome is characteristic of the genus but the helical parameters (i.e.,

pitch length and helix dimensions) vary with the species, and even within the same

species [ 171. However, the helical shape is maintained only in liquid media, in solid

media the filaments become true spirals [ 181.

The diameter of the cells ranges from 1 to 3 pm in the smaller species and

from 3 to 12 pm in the larger ones. The cytoplasm of the smaller species appears

homogenous, with no gas vacuoles and scarcely visible septa. On the contrary, the



8

large species such as S. platensis (6-8 pm cell diameter) and S. maxima (4-6 pm cell

diameter) have a granular cytoplasm containing gas vacuoles and easily visible septa.

The most prominent cytoplasmic structure is the system of thylakoids originating

from the plasmalemma [19,20,21,22 j. Like other cyanobacteria, there are

phycobilisomes, high-molecular weight aggregates of phycobiliprotein, appear to be

attached to the thylakoids [22] as expected on the basis of their function as light-

harvesting antennae.

The genome sizes of 128 strains representing all major taxonomic groups

of cyanobacteria have been determined by renaturation kinetics analysis [23]. The

value of 2.53 x lo9 daltons found for an identified species of Spirulina and these

values are similar to many bacteria such as Escherichia cob.



I



10

The life cycle of Spirulina is shown in the Figure 2.3 [16]. A mature

trichome is broken into several pieces through the formation of specialized cell,

necridia, that undergo lysis, giving rise to biconcave separation disks. The

fragmentation of the trichome at necridia produces, short (two to four cells) chains of

cells, the hormogonia, that move away from the parental filament to give rise to a

new trichrome. The cells in the hormogonium lose the attached portions of the

necridial cells, becoming rounded at the distal ends with little or no thickening of the

walls. During this process, the cytoplasm appears less granulated and the cells

assume a pale blue-green color. The number of cells in hormogonia increases by cell

fission while the

green color. By

helicoidal shape.

cytoplasm becomes granulated, and the cells assume a brilliant blue

this process trichomes increase in length and assume the typical

Figure 2.3 Life cycle of Spirulina [ 161.



11

Spirulina is utilized as food in the area around Lake Chad for long time

ago, and is marketed as a healthy aliment in the United States and Japan. It has been

used as feed for fish, poultry and farm animals [ 11. S. platensis is the only species of

cyanobacteria grown on an industrial scale [ 11. It is a rich source of protein, minerals

vitamin B 12 and essential fatty acids like y-linolenic acid [4]. Moreover, some

preclinical testing suggests that Spirulina has several therapeutic properties such as

hypocholesterolemic, immunological, antiviral and antimutagenic activity other than

its nutritive value [24].

A novel sulfated polysaccharide named calcium spirulan (Ca-SP) has been

isolated from S. platensis [25,26]. This polysaccharide was composed of rhamnose,

ribose, mannose, fructose, galactose, xylose, glucose, glucuronic acid, galacturonic

acid, sulfate and calcium. Ca-SP was found to inhibit the replication of several

enveloped viruses, including Herpes simplex virus type 1, human cytomegalovirus,

measles virus, mumps virus, influenza A virus and HIV- 1. It was revealed that Ca-SP

selectively inhibited the penetration of virus into host cells.

2.3 Phycobilisome

The major light-harvesting antennae in eukaryotic red algae and

prokaryotic cyanobacteria are called phycobilisomes (PBSs) [ 131. Although

functionally analogous to the light-harvesting chlorophyll-protein complexes of

higher plants, these water-soluble structures are attached to but not embedded in the

photosynthetic membranes as shown in Figure 2.4. Phycobilisomes were first

purified from the red alga Porphyridium cruentum [27] and postulated to represent an



1

1 2

order array of the pigmented phycobiliproteins that associate with the thylakoid

membrane and harvesting light energy for the photosynthetic reaction centers.

Figure 2.4 A model of the phycobilisomes attached to thylakoid membrane from

Cyanophora parudoxa showing the phycobilisomes attached to 1 0-mn

EF particles [28]. CFo and CFr; subunits of coupling factor. P;

Protoplastmic leaflet (cytoplasmic or stromal). E; exoplasmic leaflet



1 3

2.3.1 Phycobilisome structure

The structure of the PBS was characterized by examination of

images obtained from electron microscopy. Based upon their appearance in electron

micrographs, the PBS can be divided into four structural classes, bundle shaped [29],

block shaped [30], hemiellipsoidal shaped [30] and hemidiscoidal shaped PBS [3 I].

The most common PBS structural form is the hemidiscoidal class that have been

most extensively characterized. In general, hemidiscoidal PBS have a fanlike

appearance (Figure 2.5) with a molecular mass of 7~10~ to 15~10~ Da [32,33], a

diameter of 32 to 70 nm, a height of 25 to 45 nm and a thickness of 12 to 40 nm .

These appearances depend on organisms and the conditions in which the organism

are grown.

Figure 2.5 Phycobilisome structures. (A) The PBS from Synechococcus 7942 with

bicylinder core. (B) The PBS with tricylindrical core as for

Synechocystis 7601. The numbers indicate the molecular mass of the

rod l inker polypeptides in kDa. PC; phycocyanin , APC;

allophycocyanin [35].



1 4

The PBS are arranged into two substructure, the core attached to

the thylakoid membrane and the peripheral rods fanning out from the core. The core

of PBS is comprised of either two [29] or more generally three [29,30,31,33]

cylindrical subassemblies (Figure 2.5) and each of which has a diameter of about 11

nm and a length of 14-l 7 nm. Each of these core cylinders is formed from the

stacking of four disc-shaped molecules. Each disc molecule comprising of 3 sets of a

and p subunits (oApcpApc) so called trimers about 3.5x1 1 m-n [3 11. In the case of

bicylindrical cores the two cylinders lie side by side and in the tricylindrical cores the

third cylinder is stacked on top of the two basal cylinders to produce a structure that

approximates a pyramid (Figure 2.4). In addition to the major PBP allophycocyanin,

the core substructure of a hemidiscoidal PBS is comprised of the minor aAPC-like

polypeptide and pAPC -like polypeptide. These minor aAPC and PAP’ like polypeptides

play special roles in energy transfer from the PBS to the chlorophyll a of PSI1

and

could play special roles in the assembly and attachment of PBS to the thylakoid

surface [36].

The second structural domain of hemidiscoidal PBS, the peripheral rods

radiating from the surfaces of the core subassembly, are not in contact with the

thylakoid membrane [3 I]. Most hemidiscoidal PBS have six peripheral rods attached

to their cores [36]. The peripheral rods are comprised of phycocyanin (PC) solely or

in combination with phycoerythrin (PE) or phycoerythrocyanin (PEC) [31]. Each

peripheral rod is a cylinder approximately 11 nm in diameter, the length of the rod

cylinders depends on the organism and the growth conditions and can vary between

12 to 36 nm [36]. The fundamental building block of the peripheral rods is a disc-

shaped molecule of about 3 x 11 nm comprising 3 sets of a and /3 subunits ~~~~~~~~



1 5

so called trimers (Figure2.7). Pair of these molecules are stacked together face-to-

face to produce 6 x 11 nm disc. Hexamers are then stacked tail-to-tail to produce the

peripheral rods. The latter interaction depends on the presence of specific linker

polypeptides. Three to six linker polypepfides are typically required for the assembly

of the peripheral rods [31,33,34,37].

The phycobilisome is assembled from two types of polypeptides. The first

polypeptide is phycobiliprotein (PBPs) binding with pigment molecules, the

chromophores that serve to harvest light energy. The second are linker polypeptides

that involve in arranging the PBPs into a functional phycobilisome and may also bind

chromophores. The PBPs generally comprise about 85-90% of the PBS mass with the

linker polypeptides comprising the remainder.

2.3.2 Phycobiliprotein

Phycobiliproteins (PBPs) are coloured water soluble pigment

protein complexes. The colors of the PBPs originate mainly from covalently bound

open chain tetrapyrrole chromophores known as phycobilin. On the basis of their

visible absorption properties, the PBPs have been assigned to four spectroscopic

classes. These are phycoerythrocyanin (PEC) with absorption maxima at 590 run,

phycoerythrin (PE) with absorption maxima in the range 490 to 570 mn, phycocyanin

(PC) with absorption maxima in the range 610 to 630 nm, and allophycocyanin

(APC) with absorption maxima in the range 650 to 670 nm [36]. PEC was primary

found in certain filamentous heterocyst-forming cyanobacteria such as Fischerella sp.

(also known as Mastigocladus Zaminosus), Anabaena sp. and Nostoc sp. [38]. PEC

and PE are found at the core-distal ends of the peripheral rods of phycobilisome. PC

constitutes the portion of the peripheral rods adjacent to the core while the APC



1 6

forms the major component of the PBS core substructure. The allophycocyanin

family includes minor phycobiliproteins such as an aAPC-like polypeptide (denoted

aAPmB) and a PAPc-like polypeptide (denoted p’6.5) which form complexes with APC

[W ~

Phycobiliproteins from cyanobacteria and red algae are hetero-

monomers consisting of two different subunits, a and p, which are present in

equimolar stoichiometry (ap) and this ap monomer has the shape of a boomerang

(Figure 2.6). Each phycobiliprotein subunit differ in molecular mass (160-l 84 amino

acid residues each), amino acid sequence and chromophore content. Phycobiliprotein

subunit carries at least one and as many as three chromophores bound to a single

polypeptide [34,37]. The chromophores are covalently attached to PBP polypeptide

chains by either one and occasionally two cysteinyl thioether linkages [34]. The

fundamental assembly unit for all PBS is a disc-shaped trimer (ap)3 (Figure 2.7)

forming a toroidal shaped aggregate with a diameter of 11 nm and a thickness of 3-

3.5 nm with a central hole 3 nm in diameter [39]. PC, PE and PEC also form (ap),j

hexamer structures (Figure 2.8), 11 nm in diameter and 6 nm in thickness by face-to-

face joining of two trimers [40,41].



I

17

Crystal structure of C-phycocyanin monomer ~~~~~~~~ in a boomerang

shape from Mastigocludus luminosus [42].

Figure 2.7 Crystal structure of trimeric C-phycocyanin (cxpc~pc)~ from

Mastigocladus laminosus [42].



Figure 2.8 Schematic side view of a phycocyanin hexamer (aPCpPC)6 from

Mastigocladus iaminosus [42].



1 9

2.3.2.1 PBPs constituting, PBS core

The major phycobiliprotein constituting PBS core is

allophycocyanins (APCs). APC is comprised of two different subunits, a and p,

encoded by apeA and apcB genes, respectively. Phycocyanobilin (PCB) is the

chromophore typically found associated with both subunits of APC at Cys 82

(cysteine 82) as shown in Figure 2.9. APC occurs mainly in the trimeric form

(ahPCf3”C)3. APC s assemble the PBS core with the assistance of three types of linker

polypeptides: the large core-membrane linker phycobiliprotein (LcM), rod core linker

polypeptides (Lac) and with small Lc linker polypeptides. Complexes containing

APC are the longest wavelength absorbing and fluorescing unit in the PBS. In

addition to the major phycobiliprotein APC, the PBS core is also comprised of

another allophycocyanin family, namely, allophycocyanin-B (AP-B or aAPmB) and

p16,5 subunit [36,42]. The complex containing minor allophycocyanin is formed as

(CIAP-BCI* hpcP3Apc)Lc8~9 in which an aAPC subunit is substituted by a structurally

similar but distinctive aAPmB subunit [43]. The CI‘@-~ subunit is encoded by the apcD

gene. Another minor allophycocyanin subunit is p’6.5 subunit encoded by apcF gene.

This subunit formed a complex with the composition ~~~~~~~~~~~~~~~~~~~~ of PBS

core of Synechococcus PCC6301 [43]. Both of these genes, apcD and apcF encode

minor components of the PBS core which are believed to play important roles in

energy transfer and in the structural asymmetry required to assemble the core on the

thylakoid surface. However from the mutagenesis study of apcD and apcF in

Synechococcus PCC7002 [36] demonstrated that the czAPsB and p16.5 subunits play



2 0

important role in energy transfer from PBS to PSI and PSI1 reaction center but are not

obligately required for PBS assembly and function.

The core membrane linker phycobiliprotein, denoted LCM, is

the apcE gene product. It is the largest chromoprotein in the PBS and has a molecular

mass that varies from 70-128 kDa depending on the organism [42]. Two copies of

this polypeptide occur in the PBS core. This polypeptide has been proposed to play

extremely important roles in attachment of PBS to the thylakoid membrane and in the

transfer of excitation energy from the PBS to the chlorophyll a associated with PSI1

[36]. The apcE gene of Synechococcus PCC7002 has been insertionally inactivated

or completely deleted. No intact PBS could be isolated from this mutant, although

both APC and PC are synthesized in essentially normal amounts. These result

showed that the LCM polypeptide plays a central role in the PBS assembly and

architecture [36].



2 1

Allophycocyanin

common features

a-APC

PCB 82

----------__-------- I---__---------------160 amino acid residues

P-APC

PCB 82________________________________________ 58-167 amino cid esidues

Figure 2.9 General features of allophycocyanin subunits (a and p

subunits). The broken lines represent the linear polypeptide

chain of allophycocyanin and the PCB-binding sites are

indicated by bars (one per subunit at homologous positions)

[421*



2 2

2.3.2.2 Phycobiliprotein constituting PBS rod

There are three types of phycobiliproteins found in the

PBS rod structure; phycocyanin (PC), phycoerythrin (PE) and phycoerythrocyanin

(PEC) [36]. Tw o types of phycobiliprotein complex are required to assemble the

peripheral rods. The first complex is (c@)bLa hexameric subassemblies that

contained only PC, PE or PEC in association with the appropriate rod-linker

polypeptides. The second type of complex is (ap)bLac hexameric subassembly,

composed of a constitute PC type and its associated rod-core linker polypeptide at the

core-proximal end of the rod. The position of these phycobiliprotein subassemblies

within the rod is determined by their linker polypeptides and correlates with their

absorption properties such that complexes absorbing higher energy wavelengths are

more distal from the core [42].

Although many cyanobacteria do not synthesize either PE

or PEC, all cyanobacteria have been found to produce PC [38]. Hexameric

complexes of PC and linker polypeptides, (cI~~P~~)~L~ or (c~~~~~~)~Lac, are required

to assemble the peripheral rods, typically one complex of the latter type and two to

four of the former type are found in a rod. Phycocyanobilin (PCB) is the

chromophore typically found associated with the subunits of PC at Cys 84 for a-

subunit and Cys 85 for P-subunit as shown in Figure 2.10. The blue colored, deeply

red-fluorescent C-phycocyanin (C-PC) is the predominant form and it contains only

three PCB chromophores per (ap) monomer. The other forms of PC that found in

some red algae and cyanobacteria are R-phycocyanins. These are R-PC-I, R-PC11 and

R-PC-III in which one or two PCB is replaced by PEB and R-PC-IV in which PCB







2 5

two PCBs on the P-subunit [45]. PEC encoded bypee& genes is induced under low-

light conditions and occupies the core-distal position in the rods of phycobilisome.

2.3.3 Linker polypeptide

The assembly of the PBPs into PBS is now known to depend on the

presence of a small number of polypeptides known as linker polypeptides [29,33,34].

Some of these polypeptides, first reported to be PBS components by Tandeau de

Marsac and Cohen-Bazire [46], are required for assembly of typical PBS. It is

presently believed that the linker polypeptides interact with the PBPs by binding to

the trimers or hexamers in the central cavity of these torus-shaped molecules [36]. In

addition to their roles in the assembly of PBPs into phycobilisomes, the linker

polypeptides produce subtle changes in spectroscopic properties of the PBPs to

which they bind [33,34,37]. These minor spectroscopic changes are believed to be

extremely important in producing a unidirectional transfer of excitation energy from

the periphery of the PBS to the core and from the core to the PSI1 reaction centers

embedded in thylakoid membranes [37]. Zilinskas and Greenwald (1986) [47] have

discussed the function of three classes of linker polypeptides, not all of which are

colorless. Group I ( 70-120 K ) attaches the PBS to the thylakoid membranes and

contain PCB. Group II ( 30-70 K ) maintain rods structure by linking hexamers.

Group III ( 25-30 K ) attach rod to the APC core of the PBS, and appear to terminate

elongation of rods [47].

According to their functions and location in the PBS, linker

polypeptides also can be divided into two groups [42]: the linker polypeptides found

in PBS core and the linker polypeptides found in PBS rod. Two types of linker

polypeptides are found in PBS core, the small core linker polypeptides (L,) and the





2 7

2.3.4 Chromophore

The brilliant colors of the phycobiliproteins (PBP) originate from

covalently attached, linear tetrapyrrole prosthetic groups, known as phycobilins or

chromophores. To date, four types of chromophores have been identified: the blue-

colored phycocyanobilin (PCB), the red-colored phycoerythrobilin (PEB), the

yellow-colored phycourobilin (PUB) and the purple-colored phycobiliviolin (PXB)

with the absorption maxima of 590-670, 535-567, 498 and 568 nm, respectively.

Figure 2.11 shows the structures and modes of attachment to the PBP polypeptide.

As many as three chromophores may be found attached to a single a- or P-type

polypeptide [34,37]. Phycobilin are generally bound to the polypeptide chain at the

conserved position(s) either by one cysteinyl thioether linkage through the vinyl

substituent on the pyrrole ring A of the tetrapyrrole or occasionally by two cysteinyl

thioether linkages through the vinyl substituent on both the A and the D pyrrole rings.

The different absorption properties of the phycobilins are predominantly caused by

differences in the number of conjugated double bonds and the side chains in the

tetrapyrrole prosthetic groups [42].

Figure 2.11 Phycobilin and their peptide linkages in phycobiliproteins [50].



2 7

2.3.4 Chromophore

The brilliant colors of the phycobiliproteins (PBP) originate from

covalently attached, linear tetrapyrrole prosthetic groups, known as phycobilins or

chromophores. To date, four types of chromophores have been identified: the blue-

colored phycocyanobilin (PCB), the red-colored phycoerythrobilin (PEB), the

yellow-colored phycourobilin (PUB) and the purple-colored phycobiliviolin (PXB)

with the absorption maxima of 590-670, 535-567, 498 and 568 nm, respectively.

Figure 2.11 shows the structures and modes of attachment to the PBP polypeptide.

As many as three chromophores may be found attached to a single a- or P-type

polypeptide [34,373. Phycobilin are generally bound to the polypeptide chain at the

conserved position(s) either by one cysteinyl thioether linkage through the vinyl

substituent on the pyrrole ring A of the tetrapyrrole or occasionally by two cysteinyl

thioether linkages through the vinyl substituent on both the A and the D pyrrole rings.

The different absorption properties of the phycobilins are predominantly caused by

differences in the number of conjugated double bonds and the side chains in the

Figure 2.11 Phycobilin and their peptide linkages in phycobiliproteins [50].



2 8

Most of the studies on chromophore biosynthesis have been carried

out in the red alga C’anidium caldarium [35]. Heme, protoporphyrin IXa and

biliverdin were shown to be intermediates in phycocyanobilin (PCB) biosynthesis in

this alga [5 11. Using increasing pure fraction of cell extract from C. caldarium, it was

shown that biliverdin could be converted to PCB via 15,16-dihydrobiliverdin IXa

and phycoerythrobilin as shown in Figure 2.12 [51]. The biosynthesis of other

chromophores such as phycourobilin and phycobiliviolin is not known at the present

moment.

Although it has been known for a long time that the chromophores

are attached covalently through a thioether linkage to a specific cysteine residues

[52], little information is available concerning the mechanism of chromophore

attachment to the polypeptide backbone in PBPs. Recently two genes (cpcE and

cpcF) in the PBS rod operon of S’nechococcus 7002 were cloned, sequenced and

inactivated [53]. The phenotype of CpcE‘ and CpcF- mutants showed a specific

reduction in chromophore attachment of a-PC. This suggested that the CpcE and

CpcF polypeptides were necessary for the chromophore attachment of a-PC [53,45].

Subsequently, it was demonstrated that the CpcE/CpcF polypeptides function as a-

phycocynobilin lyase, enzyme involved in chromophore attachment [54].







31

Table 2.1 Abbreviations for the biliprotein subunits and for linker

polypeptides [3 51.

Type of polfpeptide

Phycoerythrin subunits

Phycoerythrocyanin subunits

R-Phycocyanin subunits

C-Phycocyanin subunits

Allophycocyanin subunitsAllophycocyanin B a subunit

P-type core biliprotein subunit

Rod linker polypeptides

Linker attaching rod elements to core

Core linker polypeptides

Linker attaching core to membrane

Abbreviation

aPE, pPE,yPE

aPEC7 PPEC

a RPC

2RPC

czpc, ppc

CLAP, PAP

aAPB

P

MW

LRMW

LRC

MW

L c

MW

LC M

MW

PE, phycoerythrin; PEC, phycoerythrocyanin; RPC, R-phycocyanin; PC, C-

phycocyanin; AP, allophycocyanin; APB, allophycocyanin-B; L, linker polypeptide;

MW, apparent molecular weight; R, rod; C, core; M, thylakoid membrane.





3 3

The species of the transcripts encoding PBS components varies in

different cyanobacteria (about 5-9 species), and the distribution of genes within these

species is also variable. The organization and transcription patterns for genes

encoding PBS components of several cyanobacteria were recently summarized by

Bryant (199 1) as shown in Figure 2.13 and Figure 2.14 [3 61. From these transcription

patterns, there are two distinct transcriptional units, monocistronic unit of which only

one gene is transcribed as separate unit and polycistronic unit of which more than one

gene are cotranscribed in the same transcriptional unit.

The cpc operons are composed of genes encoding PBS rod

components and sometime also contain genes encoding polypeptides that are

involved in chromophore attachment to cl” -subunit [32,45,53,54]. The cpcG gene(s)

encoding the L ac is contained in the large operon in Anabaena PCC 7120 whereas in

Synechococcus PCC7002, the cpcG gene forms a separate transcription unit. In all

cyanobacteria studied to date, the cpcA gene encoding the cl” subunit is located

downstream from the cpcB gene encoding ppc subunit. The same order of genes as

seen in the cpeBA operon encoding the PPE and aPE subunits [57,58] and for pecBA

operon [45]. The genes encoding the PC or PEC subunits are typically followed by

genes encoding the La linker polypeptides and/or the genes for chromophore

attachment to the a-subunit. Additionally, in some species of cyanobacteria, there are

more than one copy of cpcBA genes, e.g. three copies for Calothrix PCC7601 [60],

two copies for S’nechococcus PCC6301 [61] and Pseudanabaena PCC7409 [62].

The reverse order is found in all apt operons, the apcA gene

encoding the aAPC is found upstream to the apcB gene encoding the PAP’ [36]. The





Figure 2.13 The organization and transcription of genes encoding phycobilisome

component of cyanobacteria S’nechococcus PCC7002, 5’ynechococcus

PCC6301 and Anabaena PCC7120 [36]. The width of the arrows is

proportional to abundance of transcripts.







3 8

23.7 Regulation of phycobilisomes bv environments

Because cyanobacteria are found in many different ecological

niches and can be found in locations which exhibit widely fluctuating chemical and

physical parameters including nutrient availability, light intensity and light

wavelength, they have evolved specialized mechanisms to exist in those fluctuating

environments. Alteration of PBS components is one such mechanism found when

cyanobacteria are exposed to those environments.

2.3.7.1 Control of the PBS size and number by light intensity

As for all photosynthetic organisms, an inverse correlation

exits between the amount of light harvesting pigments and the light intensity that

reaches the cells [50]. The PBS size and the number of PBS are strictly regulated by

ix-radiance with the size of the PBS being inversely related to the irradiance. In

Anacystis nidulans, pigment concentration and thylakoid content vary inversely with

the light intensity [56]. It was found that upon transferring cells from high intensity to

low intensity light, the phycocyanin and chlorophyll content per cell of A. nidulans

increased. An immediate response was also seen for the two phycobilisome rod

linker polypeptides. The increase in phycocyanin and rod linker polypeptide results in

the size of the antenna, first increases (by elongation of phycobilisome rods) followed

by an increase in number of phycobilisomes per unit area of thylakoid membrane

[56]. The phycocyanin/allophycocyanin ratio can vary over a two fold range as a

result of an increase in the number of phycocyanin hexamers and of the two rod-

associated linker polypeptides (LR) [63]. In contrast, it has also been shown that

growth of Synechococcus 6301 at successively higher light intensities results in PBS

with shorter rods [64].







4 1

Tandeau de Marsac (1977) studied in PE-containing

(group II) chromatic adaptation Synechocystis 6701. The growth of this strain under

green light results in a stimulation of green light-absorbing PE and the synthesis of

PE associated rod-linkers [69]. In the group III strains, red light promotes the

synthesis of second phycocyanin species, phycocyanin-2 which is repressed by green

light, while expression of phycocyanin-1 is light-wave length independent. From the

many physiological and biochemical studies Tandeau de Marsac and Houmard

concluded some features for strain of group III [ 121. They found that there is no

specific turnover of phycocyanin and phycoerythrin and acclimation occurring via de

ylovo synthesis during the adaptation process. Only the distal part of phycobilisomes,

the rod, is modified while the core being unchanged. Moreover under the red light,

rods contain only phycocyanin-1 and phycocyanin-2 while under green light, they

contain both phycocyanin-1 and phycoerythrin in which specific linker polypeptides

being associated with each of these phycobiliproteins. In additional the pigment

content of darkness grown cells is equivalent to that found in cells grown under red

light.

The transcriptional studies on PBS components by light

quality in Fremyella diplosiphon was studied by Oelmuller et al. (1988) [70]. It was

found that the levels of transcripts encoding APC, the core linker polypeptide and the

constitutive phycocyanin subunit remained the same while the levels of other

transcripts changed dramatically. Transcripts encoding the inducible phycocyanin

subunits are barely detected in green light grown cells and very abundant in red light

grown cell corresponding to their protein while the level of phycoerythrin mRNA

approximately IO-fold more in green light than in red light grown cells which



4 2

corresponded to their protein. These results showed that the changing of each PBP

level to light quality related with the RNA encoding them.

2.3.7.3 Regulation of the PBS bv nutrient

A dramatic response i.e. decrease in abundance of pigment

molecules is exhibited by cyanobacteria when the level of the nutrient such as

carbon, nitrogen and sulphur are limited during growth [50]. The first quantitation of

pigment levels during nutrient-limited growth was performed by Allen and Smith

(1969) [71]. Cultures of A na cy stis n id da ns maintained for 30 hours in medium

devoid of nitrogen had no detectable PC while the levels of carotenoids and

chlorophyll did not change. During sulphur and nitrogen starvation, there is a rapid

degradation of the PBS. Degradation of the PBS could provide the cell with amino

acids used for synthesis of proteins important for acclimation process. These amino

acids may also be converted into carbon skeletons and used to produce other cellular

constituents [50]. The use of phycobiliproteins as amino acid storage molecules may

be important for marine cyanobacteria, since nitrogen is frequently limited in marine

environments [72].

It is well known that subjecting cells to nitrogen starvation

results in the degradation of PBS rods [71,73,74,75]. Phycobilisome degradation is

an orderly and stepwise process, at least in Synechococcus 6301 and Synechococcus

7492. Upon nitrogen starvation, the most distal hexamer in the PBS rods (attached by

30 kDa rod linker) is degraded first, followed by the hexamer attached by the 33kDa

rod linker and so on [74,75]. Such a bleaching response is also observed upon

sulphur starvation in Synechococcus 7942 [74].



4 3

In contrast, Calothrix PCC7601 has developed a unique

strategy to cope with sulphur starvation. In addition to the constitutive and red light-

inducible PC gene cluster, a sulphur starvation-inducible PC gene cluster also exists

[12]. Thus, it is obvious that cyanobacteria possess a multitude of strategies to cope

with nutrient starvation,

2.4 Studies of PBS in Spirulina platensis

At present, the information on PBS in S. platensis is very limited. PBS

structure of S. platensis is hemidiscoidal PBS comprised three core and six rod

cylinder [76]. PC and APC are only two PBPs found in S. platensis [7]. These PBPs

have been resolved by gel electrophoresis [77] and both phycocyanin and

allophycocyanin appear to be oligomeric complexes composed of at least two

different subunits. The a and p subunits of phycocyanins showed mobilities

corresponding to molecular weights of ca. 44000. Allophycocyanin was found to be

composed of subunits with molecular weight of ca. 18,000 and 20,000 to give an

oligomer with a minimum molecular weight of ca. 38,000. Absorption and

fluorescence spectra were similar to those reported for phycocyanins and

allophycocyanins isolated from other cyanobacteria [77].

Phycocyanin of 5‘. platensis may serve also as a storage material since it

has been found that the phycocyanin concentration was highest when S. platensis was

cultivated under favorable nitrogen concentrations [78]. If the level of available

nitrogen in the medium decreased, or the cultures were completely deprived of





Chapter 3

Material and methods

3.1 Strains and plasmids

3.1.1 Cyanobacterium strain

Cyanobacterium used in this work was Spirulina platensis Cl, a kind

gift from Prof. Dr. Avigad Vonshak, Algal Biotechnology, Ben-Gurian University of

the Negev, Israel.

3.1.2 Bacterial strains

The bacteria used as recipient for propagation of different plasmids

during this work was Escherichia coli DH5a (supE44, Alac U169, ($80, ZacZAM15),

hsdR17, recA1, endAl, gyrA96,thil, relA1}[80,81].

The recipient strain used to propagate recombinant lambda

bacteriophages was E. coli XLl-Blue MRA(P2) {A(mcrA)183, A(mcrCB-hsdSMR-

mrr)l73, endAl, supE44, thi-1, gyrA96, relA1, lac (P2 lysogen)} [82].

3.1.3 Plasmids

Plasmid pGEM4, containing amplicillin resistance gene was used for

subcloning the cpcBA genes.

Plasmid pGEM7Z+, containing amplicillin resistance gene was used

for subcloning the DNA fragments in DNA sequencing.



4 6

Plasmid pPM564 containing partial cpcA gene of 5’. platensis Cl, was

used as a source of cpcA probe for isolation of cpcBA genes from S. platensis Cl

(Cheevadhanarak, unpublished data).

3.2 Chemicals

All chemicals were of reagent and molecular biology grade.

3.3 Enzymes

Restriction enzymes used in cloning were purchased from either Boehringer

Mannheim or BRL company. The ligase was obtained from Promega company. The

lysozyme, RNaseA and DNaseI were obtained from Sigma chemical company.

3.4 Media and culture condition

Unless specifically stated all the media were sterilized for 15 min at 15

p.s.i., 120 OC.

3.4.1 Cyanobacteria

3.4.1.1 Culture medium, Zarrouk’s medium [83]

For the solid medium, 3% sterilized agar was added into the

sterilized medium (with 2x concentration) for 1.5% final concentration.





48

Co(N03)*.6H*O

3.4.1.2 Culture condition

4.4

S. platensis Ci was grown at 35’C with shaking at 150 rpm

in Zarrouk’s medium under illumination of incandescent lamps ( 80 pE me2 S” ). For

stock culture, cells were transferred every two weeks into Zarrouk’s medium. A 10

ml of stock culture was used to start new culture in 100 ml of Zarouk’s medium in

250 ml flask. Cultures at the exponential phase (OD560=0.45 or 4-5 days after

inoculation) were harvested and used as source of genomic DNA.

3.4.2 Bacteria

3.4.2.1 Culture medium is LB-medium (Luria-Bartoni Medium)

Sambrook, et al., 1989 [84]

For the solid media, 8 g L-’ (soft-agar medium) or 15 g L-’

of bacto-agar (agar medium) was added before sterilization.

In g L-’

Bacto-tryptone 1 0

Bacto-yeast extract 5

NaCl 1 0

pH adjusted to 7.0

3.4.2.2 Storage and culture

For storage of E. coli strains, sterile glycerol was added to

overnight culture into 15% glycerol concentration. The mixture was aliquoted in to

eppendorf tubes and then stored at -7O’C. These stock tubes (50 ~1) were used to start

overnight cultures in bottles containing 5 ml of LB (supplemented with appropriate

antibiotics when necessary) at 37’C in 250 rpm shaking incubator.



4 9

3 5 Primers/Synthesis nucleotides

The primers were synthesized by Bio Service Unit, National Center for

Genetic Engineering and Biotechnology and used for sequencing.

Sequence number : 1739 : 5’-ATTGAATTCACCTAACTACGCGGCAG-3’

Sequence number : 1740 : 5’-ATTGAATTCTAGCAGCTTCCAGACCA GC-3’

Sequence number : 2483 : 5’-TCGCCACACACCGCACCA-3’

Sequence number : 2484 : 5’-ACAATTGCGCCGTGGTCC-3’

Sequence number : 2485 : 5’-CGCTGCTGGTGAAGCTAA-3’

3.6 Buffers and solutions (Sambrook, et al. 1989) [84]

3.6.1 TE buffer pH8.0

10 mM Tris.Cl (pH 7.4)

1 mM EDTA (pH 8.0)

Sterilize by autoclave

3.6.2 10 x TBE buffer (stock solution, L-l)

Tris base 108 g

Boric acid 55 g

0.5 M EDTA (pH 8.0) 20 ml

3.6.3 STET

0.1 M NaCl

10 mM Tris.Cl (pH 8.0)

1 mM EDTA (pH 8.0)



5 0

5% Triton X-100


3.6.4 Lysozyme solution

Lysozyme (Sigma L6876) was dissolved at a concentration

of 10 mg/ml in 10 mM Tris.Cl (pH 8.0).

3.6.5 Ribonuclease A (RNase A) stock solution

RNase A (Sigma RSOOO) was dissolved at a concentration

of 10 mg/ml in 10 mM Tris.Cl (pH 7.5), 15 mM NaCl. The solution was heated at

100°C for 15 min, then allowed to cool slowly to room temperature, aliquoted and

stored at -2OOC.

3.6.6 DNase I stock solution

DNase I (Sigma D4263) was dissolved at a concentration of

1 mg/ml in TM buffer, aliquoted and stored at -2O’C .

3.6.7 DNaseI working solution

To remove contaminate DNA, the fresh DNase I solution

was prepared by diluting stock solution to 50 pg/ml concentration in double distilled

water (DDW).

3.6.8 TM buffer (L-l)

1 M Tris.Cl (pH 7.5) 50 ml

MgS04.7H20 2g


3.6.9 SM buffer (L-r)

NaCl 5.8 g





5 2

3.6.15 Denaturing solution

1.5 M NaCl

0.5 M NaOH

3.6.16 Neutralizing solution

1.5 M NaCl

0.5 M Tris-HCl pH 7.2

0.001 M EDTA

3.6.17 100 x Denhard’s solution

2% (w/v) BSA (bovine serum albumin/Fraction V;Sigma)

2% (w/v) Ficoll (Type 400, Phamacia)

2%(w/v) PVP (polyvinylpyrrolidone)

The solution was filtered and stored at -20°C.

3.6.18 Heat denatured sheared calf thvmus DNA

The calf thymus DNA was dissolved in DDW at the

concentration of 10 mg/ml. This solution was stirred by a magnetic bar on a magnetic

stirrer for 16-l 8 hr at 4OC. Subsequently, the DNA was sheared by sonication. After

the viscosity of solution became low, the solution was then boiled for 10 min and

cooled on ice. The solution was stored at -2O’C in small aliquots.

3.6.19 Transformation Buffer I (TFB I) 1851

30 mM Potassium Acetate

100 mM Rubidium Chloride

10 mM CaC12.2H20

50 mM MnCL4H20



5 3

15%v/v Glycerol

sterilize.

Adjusted to pH 5.8 with 0.2 M Acetic acid and filter

3.6.20 Transformation Buffer II (TFB II) 1851

10 mM MOPS

75 mM CaC12.2H20

10 mM Rubidium chloride

15%v/v Glycerol

Adjusted to pH 6.0 with KOH and filter sterilize.

3.6.21 6 x gel loading buffer

0.25% bromophenol blue in 40% water

stored at 4°C

3.7 Molecular biology techniques

Most of the molecular biology techniques used have been described in

detail by Sambrook, et al (1989) unless otherwise stated.

3.7.1 General procedures

3.7.1.1 Phenol extraction

The phenol extraction was performed to remove proteins

from preparations of nucleic acids. An equal volume of phenol:chloroform solution

was added to the DNA solution. The mixture was vortexed vigorously for 10 se t and

then spun at room temperature in a microcentrifuge for 5 min. The top aqueous phase

containing the DNA was removed carefully using a 200 1 .11 pipettor and transferred to



5 4

a new tube. The phenol extraction was repeated until the DNA solution was clear or a

white precipitate was not present at the aqueous/organic interface.

3.7.1.2 Chloloroform extraction

The phenol eitraction was followed by chloroform

extraction to remove remain phenol in DNA solution. The equal volume of

phenol:chloroform solution was replaced by chloroform:isoamyl alcohol (24: 1)

solution and added to the DNA solution.

3.7.1.3 Ethanol precipitation

In a 1.5 ml microcentrifuge tube, a 0.1 volume of 3 M

sodium acetate, pH 5.2 and 2 volumes of cold ethanol was added to the solution of

DNA, mixed by flicking the tube several times with a finger and placed in a -20°C

freezer for at least 30 min. Then the solution was centrifuged at 4’C for 30 min at

14,000 rpm and the supernatant was poured off. The tube was added with 1 ml of

70% ethanol and inverted several times. The DNA was pelleted by centrifugation at

4’C for 5 min at 14,000 rpm and air dried pellet was dissolved in TE buffer or TDW.

3.7.1.4 Measurement of DNA concentration

The amount of DNA was quantitated by spectrophotometric

measurement. The reading at 260 nm of diluted DNA solution was calculated for the

concentration of nucleic acid in the sample. For double-stranded DNA, an OD260 of 1

corresponds to approximately 50 pg/ml was used for calculation. An estimate the

purity of DNA was assessed by the ratio between the reading at 260 nm and 280 mn

(OD2&OD280). This ratio of the pure DNA should have been 1.8. If there were any

contaminates such as phenol or protein, the OD260/OD 280 would be significantly less





56

Photographs of the gels were made using an Tominon MP-4 Polaroid camera with a

red filter.

3.7.1.7 DNA elution

The DNA fragments were eluted from the gel by using silica

matrix of Prep-A-Gene DNA purification kit (Bio-Rad, USA), following the

procedure from the company.

3.7.2 Plasmid extraction

3.7.2.1 Small scale

The boiling method was used for making small scale

preparation of plasmid DNA from E. coli.

A 1.5 ml of overnight culture in an eppendorf tube was

centrifuged at 12,000 g for 30 se t at room temperature. After removing the medium,

the bacterial pellet was resuspended in 450 pl of STET (0.1 M NaCl, 10 mM Tris.Cl

pH 8.0, S%Triton X-100), added 50 ~1 of a freshly prepared solution of lysozyme (10

mg/ml in 10 mM Tris.Cl pH 8.0) and mixed by vortexing for 3 sec. The tube was

placed in a boiling water bath for exactly 40 set, the bacterial lysate then was

centrifuged immediately at 12,000 g for 10 min at room temperature. The pellet of

bacterial debris was removed from the eppendorf tube with sterile toothpick. For the

plasmid DNA precipitation, a 40 ~1 of 2.5 M sodium acetate (pH 5.2) and 500 ~1 of

isopropanol was added to the supernatant, mixed and placed for 10 min at room

temperature. The plasmid DNA was recovered by centrifugation for 30 min at 4 ‘C,

rinsed with 1 ml of cold 70% ethanol and recentrifuged for 5 min at 4OC. The air

dried pellet was resuspended in 50 ~1 of DDW.



5 7

The DNA solution was used directly for restriction analysis

(5 ul per reaction).

3.7.2.2 Large scale

The large amounts of pure plasmid was prepared by using

the QIAGEN kit (Germany).

A 0.5 ml of overnight culture of recombinant plasmid or

glycerol stock culture was inoculated in 100 ml of LB medium containing amplicillin

at the concentration of 100 pg/ml in 250 ml flask. The culture was incubated on a

rotary shaker at 37 ‘C, 200 rpm, 12 to 16 hr. The cells were harvested by centrifuged

at 6,000 r-pm at room temperature for 10 min. The QIAGEN protocol as

recommended by the company was followed. This method gave high plasmid yields.

3.7.3 Bacterial transformation

3.7.3.1 Preparation of the competent cells

The competent E. coli cells were prepared by using the

rubidium chloride method [85]. The single colony of E. coli strain DHScx was

inoculated in 10 ml of LB broth, incubated overnight at 37’C. A 100 ml of LB in a

250 flask was inoculated with 1 ml of overnight culture and incubated at 37°C with

agitation. Approximately 2-2.5 hr after inoculation, the ODsso of the culture was

around 0.5 and the culture was transferred to two 50 ml sterile centrifuge tubes,

chilled on ice for 5 min. The cell pellet was centrifuged at 4,000 r-pm for 10 min at

4’C, resuspended in 4 ml of ice cold transformation buffer I (TFB I, see section

3.6.19) by gently shaking on ice. The cell pellet was recentrifuged and resuspended in

4 ml of ice cold transformation buffer II (TFB II, see section 3.6.20) by gently



5 8

shaking on ice. The 200 ~1 of competent cells was dispensed into prechilled

eppendorf centrifuge tubes and freezed immediately at -7O’C .

3.7.3.2 Bacterial transformation

The introduction of plasmid DNA into E. coli cells was

done by using chemical transformation. The competent cells were allowed to thaw on

ice and each 100 ul of them was dispensed into an eppendorf tube containing plasmid

or recombinant plasmid DNA. The tube was gently swirled to mix and placed on ice

for 30 min. The cells were heat shocked by placing tube into 42°C water bath for 2

min and then cold shocked by immediately replacing tube on ice. A 1 ml of LB was

added into each tube which then agitated on a rotary shaker at 37°C for 1 hr. The

transformed cells of 100 to 200 ~1 was transferred onto the agar LB medium with 100

ug/ml of amplicillin, gently spread, inverted and incubated at 37’C. The transformed

bacteria could be appeared within 16 hr after incubation. The plates containing

transformants were either stored at 4’C or picked up and grown overnight in LB

medium for further screening.

3.7.4 Subcloning of DNA fragments

In order to construct recombinant plasmid DNA molecules, the

starting DNAs, interested DNA, plasmid DNA, were treated with appropriate

restriction endonucleases and incubated at appropriate temperature at least 1 hr. The

5’ phosphates were removed by treating with calf intestine phosphatase at 37’C for 1

hr to prevent self ligation. After the reaction of those enzymes was completed, they

were inactivated by heating at 75’C for 15 min. The desired DNA fragments were

isolated by agarose gel electrophoresis and recovered by using Prep-A-Gene DNA

Purification kit (Bio-Rad, USA) following the procedures from the company. The









6 2

3.8.3 Genomic library construction

S. platensis genomic DNA isolated as described above was partially

digested with Sau3A1, a restriction enzyme which gives compatible insert DNA with

the hDASHI1 arms of lambda DASHIIIBamHI Vector Kit (Stratagene, USA). The

lambda DASHII vector can accommodate inserts ranging from 9 to 23 kb, so the

digested DNA fragments were fractionated on 0.7% agarose gel and the fraction

containing 9 to 23 kb was isolated. These DNA fragments were recovered from the

gel with silica matrix of Prep-A-Gene DNA Purification kit (Bio-Rad, USA). The

ends of recovered DNA fragments were treated with calf intestine alkaline

phosphatase (CIAP) to prevent multiple inserts. The reaction of calf intestine alkaline

phosphatase was performed at 37’C for 1 hr, then EDTA was added to 5 mM final

concentration and heated at 75’C for 10 min to stop calf intestine alkaline

phosphatase activity. The calf intestine alkaline phosphatase was removed from

reaction by phenol-chloroform extraction. The treated DNA fragments was recovered

by precipitating with 1M final concentration LiCl and 2 volume absolute ethanol at -

20°C for 2 hr. The precipitated DNA was collected by centrifugation, 14,000 r-pm at

4°C for 30 min, and rinsed with 70% ethanol and absolute ethanol respectively. The

air dried DNA was dissolved in water. The concentration of the DNA was estimated

by visual comparison to the 0.25 pg/pl pMEIBamH1 12 kb test insert on 0.7%

agarose containing 1 pg/ml ethidium bromide.

The Sau3AI insert about 0.3 pg was ligated with 1 I-18 of the lambda

DASHIIIBamHI vector using T4 DNA ligase in total volume 5 pl at 4’C overnight

and then stored at -20°C. This ligation containing 1.3 pg of total DNA, which





6 4

ml LB agar. Plaques appeared after incubating at 37°C for 8-16 hr. Plates were stored

at 4OC for further screening.

3.8.5 Screening the DNA library

5’. platensis genomic ‘DNA library was screened using the

phycocyanin probe described in section 3.82. The screening involving the blotting

and hybridization was according to the protocol described by Amersham

International plc. (U.K.) for hybond N membranes.

The bacteriophage lambda were plated as described in section 3.8.4

to a density about 1000 plaques per 90 mm petri dish for 7 dishes. The nylon

membranes from Amersham were prepared in suitable size and carefully placed onto

the agar surface. The membranes and agar plates were orientated by using a sterile

needle (l&gauge) to punch 9 holes through the membrane and agar asymmetrically

around the outer edge. After 1 min the membrane was lifted and placed, colony side

up, on a pad of absorbent filter paper (Whatman 3MM) soaked in denaturing

solution, for 7 min. The membrane was then transferred, colony side up, onto a pad

of absorbent filter paper soaked in neutralizing solution, for 3 min. The neutralization

step was repeated with a fresh pad soaked in nutralizing solution. Finally the

membrane was washed with 2 x SSC and transferred onto a dry filter paper. After

drying, the DNA was fixed by baking at 80°C for 2 hr or UV crosslinking.

The membranes were prehybridized in a sealed hybridization bag

containing 6 x SSC, 5 x Denhard’s solution, 0.1% SDS and 100 pg/ml sonicated,

denatured calf thymus DNA at 65°C for 1 hr. For hybridization, the CX~~P labelled

probe (cpd gene of S. platensis) prepared with Prime-A-Gene Labeling System

(Promega, USA) was added into the bag that already cut open at one end. The bag



6 5

was resealed and incubated at 65’C, overnight. The membranes were then washed

twice in 2 x SSC, 0.1% SDS at room temperature for 10 min, once in 1 x SSC, 0.1%

SDS at 65’C for 10 min and twice in 0.1 x SSC, 0.1% SDS at 65’C for 10 min,

respectively. The membranes were kept det in a sealed plastic bag and exposed to an

X-ray film (Kodak) at -7O’C with intensifier screens. After autoradiography, plaques

from the areas of positive signals were isolated using a pastuer pipette and plated out

at a density of 200-300 plaques per 90 mm plate. Plaque lifts and hybridizations were

performed to confirm the previous result. Single positive clones were picked and

stored in SM buffer at 4°C for further characterization by restriction and Southern

blot analysis.

3.8.6 Preparation of DNA from bacteriophage

3.8.6.1 Preparation of clear lysate

A sterile pastuer pipette was used to pick up an agar plug

containing a single positive plaque and then inoculated into 50 ml LB broth

supplemented with 10 mM MgS04 and 200 1-11 of plating cells in 250 ml flask. The

culture was incubated for 10-l 6 hr at 37’C, 250 rpm. The culture then became cloudy

and subsequently cleared after lysis . Two ml of chloroform was added into the flask,

and the flask was incubated for 15 min at 37’C, 250 rpm. Bacterial debris was then

removed by centrifugation at 5,000 rpm for 10 min at room temperature. The

supernatant was transferred to a sterile bottle and 500 ~1 of 1M MgS04 was added.

This lysates could be stored at 4OC for several months.

3.8.6.2 DNA preparation

For phage DNA preparation, 10 ml of TM buffer and 320 ~1

DNaseI working solution were added to 10 ml lysate and then mixed by gentle





6 7

rinsed twice with DDW and then denatured in 0.5 M NaOH for 30 min with gentle

shaking. The gel was placed on nylon membrane prewetted with 10 x SSC. The DNA

was transferred onto the membrane by using Vacuum (Vacuum Blotter, Bio-Rad,

USA) for 90 min following the instruction manual. After the DNA was completely

transferred, the wells were marked with pencil. The membrane was rinsed with 2 x

SSC and the DNA was fixed by UV crosslinking or braking at 80°C for 2 hr.

The membrane was prehybridized in 6 x SSC, 5 x

Denhard’s solution, 0.1% SDS and 100 pg/ml sonicated, denatured carf thymus DNA

at 65’C for 1 hr then hybridized with the a3*P labeled cpcA probe at 65’C overnight.

After autoradiography, the positive signal from the various digested reaction of each

clone was characterize.

3.8.7.2 Cloning single positive fragment into plasmid

In order to construct recombinant plasmid DNA molecules,

interested DNA and plasmid DNA, were treated with appropriate restriction

endonucleases and incubated at appropriate temperature at least 1 hr. The 5’

phosphates of the end of plasmid DNA also treated with calf intestine phosphatase at

37’C for 1 hr to prevent self ligation of plasmid DNA. After the reaction of those

enzymes was complete, inactivated them by heating at 75OC for 15 min. The desired

DNA fragments were isolated by agarose gel electrophoresis and recovered by using

Prep-A-Gene DNA Purification kit (Bio-Rad, USA) following the procedures from

the company. The interested fragment about 0.2 to 0.3 pg was then ligated to 0.1 pg

of plasmid DNA using 2.5 units of T4 DNA ligase (Promega, USA) in a total volume

of 10 ~1. Half or all of the ligation mixture was used to transform E. coli DHSa as







7 0

3.8.10.3 Sequencing analysis

Sequencing of phycocyanin gene (cpcBA) of Spirulina

platensis Cl strain was performed by the dideoxy chain termination method using the

Sequenase Version 2.0 DNA Sequencing Kit (United States Biochemical, USA).

Double stranded DNA was used as the template for sequencing, following the

protocols described in the Sequenase Version 2.0 manual.

a. Preparation of sequencing reaction

The interested fragment containing cpcBA gene or partial

cpcBA gene subcloned into pGEM4 or pGEM7Z+ plasmid was first denatured using

alkaline-denaturation method. The DNA was denatured by adding 0.1 volumes of 2

M NaOH, 2mM EDTA and incubated for 30 min at 37°C. The DNA then neutralized

by adding 0.1 volumes of 3 M sodium acetate (pH 4.5-5.5) and precipitated with 2

volumes of ethanol, placed at -7O’C for 15 min. After washing the pelleted DNA

with 70% ethanol, it was dissolved in 6 ~1 of TDW and 2 ~1 of sequenase reaction

buffer and 2 ~1 of primer solution was added. The annealing of primer was carried

out by warming the mixture to 37’C for 30 min after that the DNA synthesis was

performed in two steps. In the first step, The primer was extended by sequenase

(bacteriophage T7 DNA polymerase contained no 3’--+5’ exonuclease activity), using

limiting concentration of the deoxynucleoside triphosphates (dGTP, dCTP, dTTP,

3.0 PM each), including radioactively labeled a3’S dATP (5 PM of lOOOCi/mmol)

for 3-5 min at room temperature. In the second step, the concentration of all

deoxynucleoside triphosphates was increased and a dideoxynucleoside triphosphate

was added. The reaction was terminated by the addition EDTA and formomide







73

that only two positive clones from the same original positive clone were obtained

after autoradiograph. These clones were designated hPC39A and hPC39B. The h

DNA from these clones was prepared as described in section 3.8.6 and used for

restriction mapping and Southern blot analysis. Although these clones transferred

from the same original positive clone, the restriction analysis by digestion of h DNA

of them with EcoRI as shown in Figure 4.1 indicated that they contained different

insert. This result indicated that there might be some contamination in original clone.

However the digested h DNA with EcoRI and CluI of both clones were transferred

into nylon membrane for Southern blot analysis. After hybridization and

autoradiograph, the positive fragment could not be found (Figure 4.2). This suggests

that there was no phycocyanin gene in these clones and the positive signal obtained

from the previous plaque hybridization should be false positive signal. The genomic

DNA~ library was rescreened several times with homologous probe, however the

positive clone containing phycocyanin gene could not be obtained.





I

7 5

Figure 4.2 Southern blot analysis of recombinant lambda DNA of hPC39A and

hPC39B positive clones hybridized with homologous partial cpcA

probe. Lane A and B : DNA from hPC39A and hPC39B digested with

EcoRI. Lane C and D : DNA from hPC39A and hPC39B digested

with CM. Lane E : 400 bp partial cpcA fragments positive control.

Lane F : Lambda DNA digested with Hk&II and EcaRI.





Figure 4.3 The autoradiograph of plaque hybridization of genomic DNA library II

of S. platensis Cl with homologous partial cpcA probe. A solid dot “0”

shows positive signal.





79

- 0.9 kb

Figure 4.5 Southern blot analysis of recombinant lambda DNA of hPC30 (A),

C I EIKI S I E V SI/EV5 : I \ I \ I \ I \ I \

A B A B A B A B A B A B

-21.0 kb- 5.1 kb- 3.5 kb

- 2.0 kb- 1.5 kb

hPC39 (B) positive clones and h marker digested with Hindl1IIEcoR.I

(C) hybridized with homologous partial cpcA probe. SI:SalI,

EV:&oRV, EI:EcoRI, CI:CZuI.



80

A B C D E

Figure 4.6 Southern blot

- 21.2 kb

- 5.1 kb

- 3.5 kb

g- 2.0 kb

analysis of genomic DNA of S . platensis C l digested

with EcoRV (A), BamHI (B), EC&I (C), ClaI (D) and HindlIIlEcoRI

h marker (E) probing with amplified partial cpcA fragments.







8 3

4.1.2 Isolation of phycocvanin genes from partial genomic DNA library

During the rescreening of genomic DNA library I, the other

strategy was perused for isolating phycocyanin gene from S. platensis Cl. The partial

genomic library was employed as an alternative to whole genomic library as a source

of phycocyanin gene. The advantage of this library is the enrichment of possible

recombinant clones containing the desired gene(s). The Southern blot analysis of

genomic DNA of S. platensis Cl was performed to construct the restriction map and

to identify the site of the phycocyanin gene. The genomic DNA was completely

digested with various restriction enzymes, EcoRI, CZaI, BamHI and EcoRV. The

digested DNA fragments were transferred into nylon membrane and hybridized with

the cpcA probe as described in section 3.8.7.1. The result of Southern blot is shown

in Figure 4.6. Four single positive fragments were obtained. They were 2.7 kb CZaI,

4.2 kb EcoRV and high molecular weight BamHI and EcoRI fragments. The high

molecular weight BamHI and EcoRI fragments were too large to be cloned into the

plasmid vector. As a result, the 2.7 kb CZaI and 4.2 kb EcoRV fragments were chosen

for construction of partial genomic DNA library. A 20 ug of genomic DNA of S.

platensis Ci was completely digested with each restriction enzyme, CZaI and EcoRV.

The digestedDNAs

from each reaction were separated by electrophoresis in a 0.7%

agarose gel, subsequently, the 2.7 kb CZaI and 4.2 kb EcoRV fragments were isolated

from the gel using silica matrix of Prep-A-Gene DNA purification kit (Bio-Rad,

USA). Each 0.2 ug of 2.7 kb CZaI and 4.2 kb EcoRV fragments was cloned into

plasmid pGEM7Z+ and pGEM4, respectively. All of the ligation mixture was used to

transform E. coli DH5a. Because of the digested fragments were two base overhang





8 5

oligonucleotides (sequence number : 1739 and 1740, see section 3.5) designed from

the known sequence of the amplified partial cpcA gene were used as primers. The

procedure and conditions used for IPCR was described in section 3.8.9.1. The result

of IPCR is shown in Figure 4.8. The product of IPCR contained multiple bands,

however the expected 4.2 kb fragment was also obtained. The 4.2 kb EcoRV

fragment was eluted from the agarose gel and hybridized with homologous cpcA

probe. The result as shown in Figure 4.8 indicated that this fragment contained

phycocyanin gene. To increase the expected 4.2 kb fragment, this IPCR product was

used as the template for the next round of amplification. This template was amplified

by using usual polymerase chain reaction technique. The same oligonucleotides

primer as used in IPCR amplification were used. The result of this amplification gave

no distinct band instead a smear was seen (Figure 4.9). The PCR smearing might be

due to the excessive amounts of Taq DNA polymerase, inordinate long extension

times or cycling parameters. The amount of Tag DNA polymerase was decrease in

the later amplification and the first IPCR product used as the template, however the

PCR product is still smear. The amplification by using the first IPCR product and the

product of self ligation of 4.2 kb EcoRV fragment as the template was performed

several times. The amount of the template and Taq DNA polymerase and the

condition of amplification were varied, nevertheless the product was still smear.

Since the phycocyanin genes were successfully isolated from h

genomic DNA library II, further attempt to isolate phycocyanin genes by IPCR

technique was then ceased.





8 7

Figure 4.9

A B C D E F

21.0 kb-

2.0 kb-

Amplification of IPCR product by using PCR technique. Lane A :

Hi&III and &MU digested lambda DNA. Lane B-F : Amplified

products using IPCR product at various concentration as template and

known sequences of amplified partial cpcA gene as primers.













9 3

PAsp85 and PAsp39, at which the chromophores aCys84, pCys82 and pCys153,

respectively are held in the arched configuration of C-phycocyanin of Mastigocladus

laminosus [99] are also conserved in the phycocyanin amino acid sequence of S.

platensis Cr. The PArg57 which builds a salt bridge with a side chain of the a-84

chromophore of C-phycocyanin of A4. Zaminosus was also found at the same position

in the primary structure of the phycocyanin of S. platensis Cl.









9 7

-35 -10

Spi TTTAATAAATTTTAACAAACTAAAAGGCACTGGCAGTGTATAAAT'GATATTTGAAGGGG------- -----

Ana ATTCACAATTTGTAACAAAATAAGGATCTATAGCATTGTATPAAC'AT AAGCTGGAGGGG

Cya TTTGATAAATTGTAACAAACAAAGTTAAAAAAA CACGATATAAMUdTATATAGCAATC

E. coli

consensus

TTGACA TATAAT

Figure 4.14 Comparison of the promoter sequences found upstream of the

transcriptional start sites of cpcB4 from Anabaena 7120 (Ana),

Cyanophora paradoxa (Cya) and putative promoter of 5’. platensis Cl

(Spi). Nucleotides which are identical in all sequences are indicated by

an *. The “ - 10” and “-35” regions are underlined. The transcriptional

start sites of both organisms and the possible transcriptional start site

of S. platensis are indicated by arrows.



98

-35 -10

Spi (cpcBA) TTTAATAAATTTTAACYAACTAAAAGGCACTGGCACTGGCAGTGTATAAATG

Ana (cpcBA) ATTCACAATTTGTAACAAAATAAGGATCTATAGCATTGTATAAACA

Syn (cpcB1Al) -GTAATGTTTAAATGCCGGCAGACGTTGTATAACATTTACCTAA

Syn (cpcBZA2) -GCCAAGGTGAAAAACAAGCAAAAATAGCT-GACACTCTTAATTGG

Cal (cpcBlA1) ---CAATTCGTAATAAACACGATC-CAACGATATAGTATAAACAA

Cal (cpcBZA2) --ACA-AA?iTTTGCACAAAATTTAACACAAAG-CAATTGCTTTAA

* *

Figure 4.15 Comparison of the promoter sequences found upstream of the

transcriptional start sites of cpcBA from cyanobacteria Anabaena 7120

(Am), Synechococcus PCC 7002 (Syn), Calothrix PCC 7601 (Cal> and

putative promoter of S. platensis Cr (Spi). Nucleotides which are

identical in all sequences are indicated by an*. The ‘-10’ and ‘-35’

regions are underlined. The rightward most base of each sequence is

the transcriptional start site.









10 2

(4Spi

Syn

SYSRYTVAYE QLSGQLQRIN AWGGRVISVT PA

SNATYFVSYE KLNATLQRVH AQGGRIVSIT PA

Spi -AITTQASRL GTTAFQESSL VELRPNWSRD NAQEVIRAVY RQLLGNDYLM

Syn MAITVASSRL GTAPFSNAAP VELRPDGDRD QVQAVIRAVY RQVLGNDYIM

Spi SSERLTSAES LLCDGSITVR ELVRCVAKSE LYKKKFFYPN FQTRVIELNY

Wn KSERLTAAES LLVNGSISVR DF'VRAVAKSE LYKTKFFYNN FQTRVIELHC

Spi KHLLGRAPYD ESEWFHLDL YQNEGYDADG D

S yn KHLLGRAPYS EAEVIEHLDR YETQGYDADV D

Figure 4.18 Comparison of deduced amino acid of partial cpcH (A) and cpcl (B) of

S. platensis Cl (Spi) with C terminal of cpcH and N terminal of cpcl

genes of Synechococcus PCC 6301 (Syn), respectively. The identical

amino acids are shown in boldface type.











Chapter 5

Conclusion and Suggestion

5.1 Conclusion

The cpc genes encoding phycobilisome rod components were not obtained

either from partial genomic DNA library screening or from cloning by inverse

polymerase chain technique, but were obtained from hDASHI1 genomic DNA. From

this h genomic DNA library, the genes encoding the phycobilisome rod components,

cpcB and cpcA genes encoding phycocyanin a and p subunits, and cpcH and cpcl

encoding rod-rod linker polypeptides of S. platensis Ci were cloned. The complete

sequences of cpcB , cpcA and partial sequences of cpcH and cpcl genes were

determined. These genes form an operon cpcBAHI with possible cpcD downstream

of cpcl. There is one putative transcriptional start site in the upstream and one

putative termination site in the downstream of the cpcBA genes. The cpcBA genes

present as a single copy per genome. The promoter region of the cpc operon

resembles the consensus promoter sequences of E. coli.

The organization of genes is arranged in the following order cpcB , cpcA ,

cpcH, cpcI and there should be also cpcD which showed similarity to some other

cyanobacteria. The deduced amino acid sequences of cpc genes products are similar

to those products of either cyanobacteria and red algae. The identity of deduced

amino acid sequence products of cpcB and cpcA genes compared to those of



107

Synechococcus PCC7601, Synechococcus elongatus, Pseudanabeana PCC7409 and

Agaothamnion neglectum were 82.5, 81.9, 79.6 and 70.3% for cpcB gene and 79.6,

75.3, 79.6 and 70.3% for cpcA gene, respectively. For cpcH and cpcl genes, the

identity of partial amino acid sequences ‘between S. platensis Cr and Synecococcus

PCC6301 were 53.1% and 69.5% respectively. The predicted masses of the

phycocyanin subunit apoprotein are 19,111 and 18,000 daltons for p and a subunits,

respectively.

5. 2 agestion

1. To confirm whether the obtained genes are the cpc genes of S. platensis

Cl, the immunochemical method using antibodies against phycocyanin could be used

to screen E. coli colony which contain cpc genes.

2. The primer extension should be performed to analyze the transcriptional

start site of cpc genes.

3. From the Southern blot analysis of h positive clones, the 9 kb EcoRI

fragment of h39 positive clone could be subcloned and sequenced to obtain the

complete cpcBAHID operon.

4. If the non-produce phycocyanin mutant can be constructed and the

transformation system of S. platensis Cr is performable, the study of the expression

of cpc genes in S. platensis Cr can be done, which will provide information for

understanding the physiology and biochemistry of phycocyanin at molecular level.

5. The constructed ?L genomic DNA library is valuable as genomic DNA

source for isolation of the other genes of S. platensis Cl.







110

1 8 .

1 9 .

2 0

21.

22.

23 .

24 .

25 .

Van Eykelenburg, C., 1980, “Rapid reversible macromorphological changes in

Spirulina platensis,” Naturwissenschaften, Vol. 67, pp. 200-201.

Becker, E.W., 1978, “The legislative background for utilization of microalgae

and other types of single cell protein,” Archives of Hydrobiology, Vol. 11, pp.

56-64.

Hedenskog, G. and Hofsten, A.V., 1970, “The ultrastructure of Spirulina

platensis-a new source of microbial protein,” Physiology Plant, Vol. 23, pp.

209-216.

Holmgren, P.R., Hostetter, H.P. and Scholes, V.E., 197 1, “Ultrastructural

observation of crosswalls in blue green alga Spirulina major,” Journal of

Phycology, Vol. 7, pp. 309-3 11.

Van Eykelenburg, C ., 1979, The ultra structure of Spirulina platensis in

relation to temperature and light intensity,” Antonic van Leeuwenhoek

Journal of Microbiological Serology, Vol. 45, pp. 369-390.

Herdman, M., Janvier, M., Rippka, R. and Stanier, R.Y., 1979, “Genome size

of cyanobacteria,” Journal of Genetic Microbiology, Vol. 111, pp. 73-85.

Chamorro, G., Salazar, M, Favila, L. and Bourges, H., 1996, “Pharmacology

and toxicology of Spirulina alga,” Reviews of Investigative Clinic, Vol. 48,

No. 5, pp. 389-399.

Hayashi, K., Hayashi, T. and Kojima, I., 1996, “A natural sulfated

polysaccharide, calcium spirulan, isolated from Spirulina platensis: in vitro and

ex vivo evaluation of anti-herpes simplex virus and anti-human

immunodeficiency virus activities,” AIDS Research of Human Retroviruses,

Vol. 12, No. 15, pp. 1463-1471.







1 1 3

4 2 Sidler, W., 1994, “Phycobilisome and Phycobiliprotein Structures,” in The

Molecular Bioligy of cyanobacteria, Edited by Brayant, D.A., Dordrecht,

Academic Publishers, pp. 139-2 16..

43 . Ley, A.C., Butler, W.L., Bryant, D.A. and Glazer, A.N., 1977, “Isolation and

function of allophycocyanin B of Porphyridium cruentum,” Plant Physiology,

Vol. 59, pp. 974-980.

44. Lundell, D.J. and Glazer, A.N., 1983, Molecular architecture of a light-

harvesting antenna. Core substructure in Synechococcus 630 1 phycobilisome:

two new allophycocyanin and allophycocyanin B complexs,” Journal of

Biological Chemistry, Vol. 258, pp. 902-908.

45 . Swanson, R.V., de Lorimier, R. and Glazer, A.N., 1992, “Genes Encoding the

phycobilisome Rod Substructure Are Clustered on the Anabaena Chromosome:

Characterization of the Phycoerythrocyanin operon,” Journal of Bacteriology,

Vol. 174, No. 8, pp. 2640-2647.

46 . Bryant, D.A., Glazer, A.N. and Eiserling, F.A., 1976, “Characterization and

structural properties of the major biliproteins of Anaebaena sp,” Archives of

Microbiology, Vol. 110, pp. 61-75.

47. Zilinskas, B.A. and Greenwald, L.S., 1986, “Phycobilisome structure and

function,” Photosynthesis Reserch, Vol. 10, pp. 7-35.

48. Maxson, P., Sauer, K., Zhou, J., Bryant, D.A. and Glayzer, A.N., 1989,

“Spectroscopic studies of cyanobacterial phycobilisomes lacking core

polypeptides,” Biochemica et Biophysics Acta, Vol. 977, pp. 40-5 1.



114

49 . de Lorimier, R., Bryant, D.A. and Stevens, S.E. Jr., 1990, “Genetic analysis of

a 9 kDa phycocyanin-associates linker polypeptide,” Biochimica et Biophysics

Acta, Vol. 1019, pp. 29-41.

50 . Grossman, A.R., Schaefer, M.R., Chiang, G.G., 1933, “The phycobilisome, a

light-Harvesting Complex Responsive to Environmental Conditions,”

Microbiology Reviews, Vol. 57, No. 3, pp. 725-749.

5 1. Rhie, G. and Beale, S.I., 1994, “Regulation of Heme Oxygenase Activity in

Cyanidium caldarium by light, Glucose, and Phycobilin Precursors,” The

Journal of biological chemistry, Vol. 269, No. 13, pp. 9620-9626.

5 2 Willium, V.P. and Glazer, A.N., 1978, Structural studies on phycobiliproteins.

I. Bilin-containing peptides of C-phycocyanin,” The Journal of Biological

Chemistry, Vol. 253, pp. 202-211.

53 . Zhou, J., Gasparich, G.E., Stirewalt, de Lorimier, R. and Bryant, D.A., 1992,

“The cpcE and cpcF Genes of Synechococcus sp. PCC7002,” The Journal of

Biological Chemistry, Vol. 267, No. 23, pp. 16138-16145.

54 . Fairchild, C.D., Zhao, J., Zhou, J., Colson, S.E., Bryant, D.A. and Glazer, A.N.,

1992, “Phycocyanin a-subunit phycocyanobilin lyase,” Proceeding of The

National Academy of Science of The United States of America,” Vol. 89,

pp. 7017-7021.

55. Fuglistaller, P., Suter, F. and Zuber, H., 1985, Linker polypeptides of the

phycobilisome from the cyanibacterium Mastigocladus Zaminosus: Amino acid

sequences and relationships. Biological Chemistry Hoppe-Seyler, Vol, 366,

pp. 993-1001.





116

62 . Dubbs, J.M. and Bryant, D.A., 1987, “Organization of the genes encoding

phycoerythrin and the two differentially expressed phycocyanins in the

cyanobaterium Pseudanabaena sp. PCC 740,” Progress in Photosynthesis

Research, Vol. 5, pp. 765-768. ’

63. Grossman, A.R., 1990, “Chromatic adaptation and the events involved in

phycobilisome biosynthesis,” Plant Cell Environmental, Vol. 13, pp. 65 l-

666.

64 . Lonneborg, A., Lind, L.K., Kalla, S.R., Gustafsson, P. and Oguist, G., 1985,

“Acclimination process in the light-harvesting system of Cyanobacterium

Anacystis nidulans following a light shift from white to red light,” Plant

Physiology, Vol. 78, pp. 1 l-l 14.

65 . Rap, S., Wyman, K., Siegelman, H.W. and Falkowski, P.G., 1983, “Adaptation

of the cyanobacterium Microcystis aeruginosa to light intensity,” Plant

Physiology, Vol. 72, pp. 829-832.

66 . Garnier, F., Dubaeq, J.P. and Thomas, J.C., 1994, “Evidence For a Transient

Association of New Proteins with the Spirulina maxima Phycobilisome in

Relation to light Intensity,” Plant Physiology, Vol. 106, pp. 747-754.

67 . Garnier, F. and Thomas, J.C., 1993, “Light regulation of phycobilliproteins in

Spirulina maxima,” Bullentin de’ Institut oceanograique Monaco: no

special, Vol. 12, pp. 41-48.

68 . de Lorimier, R.M., Smith, R.L. and Stevens, S.E. Jr, “Phycobilisome structure

and gene expression by light intensity,” Plant Physiology, Vol. 98, pp. 1003-

1010.







119

83.

84.

8.5 .

86

87.

88.

89.

90.

Zarrouk, C., 1996, Construction a 1’ Etude d’ une Cyanophycae Influence de

divers Facteurs Physiques et Chimi ques sur las Croissance et la Photosysthes

de Spirulina maxima, Thesis, University of Paris, 84 p.

Sambrook, J., Fritsch, E.F. and Maniatis, T., 1989, Molecular Cloning. A

Laboratory Manual. 2nd ed., New York, Cold Spring Harbor Laboratory Press,

pp. 1.1-18.88.

Hanahan, D., 1983, “Studies on transformation of Escherichia coli with

plasmids,” Journal of Molecular Biology, Vol. 166, No. 4, pp. 557-580.

Glatron, M.F. and Rapoport, G., 1972, “Biosynthesis of the parasporal

inclusion of Bacillus thuringiensis : half-life of its corresponding messenger

RNA,” Biochime, Vol. 54, pp. 1291-1301.

Marzel, D., Houmard, J. and Tandeau de Marsac, N., 1988, “A multigene

family in Caothrix sp. PCC 7601 encodes phycocyanin, the major component

of the cyanobacterial light-harvesting antenna,” Molecular and General

Genetics, Vol. 211, pp. 296-304.

Davis, L.G., Dibner, M.D. and Battey, J.F., 1986, Basic methods in Molecular

Biology, New York, Elsevier, 388 p.

O&man, H., Gerber, A.S. and Hartl, D.L., 1988, “Genetic application of an

inverse polymerase chain reaction,” Genetics, Vol. 120, pp. 62 l-623.

Deshnium, P., 1992, Molecular cloning of the gene for Al2 desaturase from

Spirulina platensis Italy strain, Master of Science Thesis, Biotechnology

Program, King Mongkut’s Institute of Technology Thonburi, 80 p.







Documents

2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1