80th AnnuAl MeetingOctober 27-29, 2016 | hyatt Regency la Jolla at Aventine, San Diego, CA

1936Dr. t. D. Beckwith, first president of SCASM

1950’sDr. John Pickett, president of SCASM

1958early leadership of SCASM Mr. Price, Dr. Weimer, Dr. Rasmussen, Dr. Boak, Dr. Carpenter, Dr, Kessel, Dr. howard, Dr. hildemann

1960’sBench lab in Southern California

1970’sDr. linus Pauling, SCASM Speaker

1972Ruth Russell, president of SCASM

1995Presidents at SCASM 60th anniversary

2016Cedar Sinai Medical Center in l.A.

2016Mark Dubar, president of SCASM

Celebrating

years of sCasM

1936 - 2016

80

Platinum SPonSorS

gold SPonSorS Silver SPonSorS bronze SPonSorS

Brochure Printing Sponsored by Accelerate Diagnostics

SPeCial thankS to our SPonSorS...

Alere

Great Basin Scientific

Hardy Diagnostics

Accelerate Diagnostics

Cepheid, Inc.

DiaSorin Molecular, LLC

GenMark Diagnostics, Inc.

POCARED Diagnostics

Quidel

BD Diagnostics

Copan Diagnostics, Inc.

Medical Chemical Corp.

Roche Diagnostics

1950’sDr. John Pickett, president of SCASM

1945Fleming, Chain and Florey receive the nobel Prize for discovering penicillin

1946lederberg and tatum demonstrate that DnA can be transferred from one bacterium to another

1953James Watson and Francis Crick, with help from Rosalind Franklin’s work, determine the structure of DnA

1936Dr. t. D. Beckwith, first president of SCASM

1935electron microscope developed

Please join your fellow microbiologists and me at the 80th Annual Meeting of the Southern California branch of the American Society for Microbiology at the Hyatt Regency, La Jolla, October 27-29, 2016. We will be celebrating 80 years of SCASM - 1936 to 2016.

Our charter is educational support of clinical, academic and industrial microbiology in Southern California. Some of the most outstanding contributors to our corner of science are active in our branch today.

We will be selecting another individual for the T.D. Beckwith Honorary Award for Outstanding Contributions in Microbiology—Southern California. Dr. Beckwith was the 1st SCASM chapter president in 1936. This is a tribute to his vision of our branch and will highlight documented contributions to microbiology each year. Criteria for this award to include:

• MustbecurrentSCASMmember

• Oneindividualperyearonly

• OpentoClinical,Industrial,Academic,PublicHealthMicrobiology, and Veterinary Microbiology

• Mustbenominated,withexplanationofaccomplishmentandout-come to the science of microbiology and/or patient care improvement

We will include corporate sponsored talks on Friday and Saturday morn-ing. The talks will provide us with opportunities to interact with leading expertsinthefieldandgainexposuretothelatesttechnology.Pleaseplan which sessions you would like to attend as seating is first come – first serve and each session will be limited to the first 50.

There will be a great line-up of speakers for the general session, starting with the ASM CEO Dr. Stefano Bertuzzi. Topics include: futures in microbiology, digital microbiology, new methods for detection, lean processes, foodborne pathogens and case studies on cutting edge challenges and solutions.

Ifyouknowofanunder-graduateand/orgraduatestudentwhomightbenefit from attending the Annual Meeting, please encourage them to attend. Students can present their research during the poster session on Saturday.SCASM,withsupportfrombioMérieux,Inc.,willawardthetopthreeposterpresentersanall-expensespaid,studenttravelaward,toattend the National ASM 2017 meeting.

We are also offering a limited number of scholarships to new technologists. These scholarships support a new technologist with a free registration to the Annual Meeting and one night hotel accommodations at the meeting.

OnFridaynightwewillhaveaHalloweenthemeforthePresident’sReception poolside at the Hyatt, with a live band. Enjoy the festivities withfellowmicrobiologists,vendorsandgoodfood.Prizeswillbegivenfor the most creative Halloween dress up with a microbe theme! This event is included in your meeting registration fee for full conference registrants.

Nearly50vendorswillberepresentedintheexhibithall,withthe newest technologies in microbiology to share with you.

Pleasegoonlinetoregister,orreturnyourreservationformasearlyaspossibletoensurethatyouwillbepartofthisexcitingeducationalevent. There are special room rates at the Hyatt available for all attend-ees of the meeting. Refer to www.scasm.org for updates to the meeting and information concerning registration.

Ilookforwardtoseeingyouatthemeeting.EnjoyandbeactivewithSCASM!

Mark Dubar, BS President, SCASM

1958early leadership of SCASM Mr. Price, Dr. Weimer, Dr. Rasmussen, Dr. Boak, Dr. Carpenter, Dr, Kessel, Dr. howard, Dr. hildemann

1964epstein, Achong, and Barr show that a virus (eBV) can cause cancer in humans

1960’sBench lab in Southern California

1970’sDr. linus Pauling, SCASM Speaker

1972Ruth Russell, president of SCASM

PReSiDent’S letteR

FaCulty Faranak Atrzadeh GenMarkDiagnostics,Inc. Carlsbad, CA faranak.atrzadeh@genmarkdx.com

Joan-Miquel Balada-Llasat, PharmD, PhD, D(ABMM) Ohio State University Columbus, OH joan.balada@osumc.edu

Anne Beall, BA bioMérieux,Inc. Raleigh, NC anne.beall@biomerieux.com

Stefano Bertuzzi, PhD American Society for Microbiology Washington, DC sbertuzzi@asmusa.org

Kelly Burke, MS College of the Canyons Santa Clarita, CA kelly.burke@canyons.edu

Susan Butler-Wu, PhD, D(ABMM) LACountyPublicHealth Los Angeles, CA sbutler-wu@dhs.lacounty.gov Hencelyn Chu, PhD, MLS (ASCP) College of the Canyons Santa Clarita, CA hencelyn.Chu@canyons.edu

Diane Citron, M(ASCP), F(AAM) R.M. Alden Research Lab Culver City, CA d.m.citron@gmail.com

Marc Roger Couturier, PhD, D(ABMM) ARUPLaboratories Salt Lake City, UT marc.couturier@aruplab.com

Jennifer Dien Bard, PhD, D(ABMM), FCCM Children’sHospitalLosAngeles Los Angeles, CA jdienbard@chla.usc.edu

Ann Grasmick, MT(ASCP) bioMérieux,Inc. Los Angeles, CA ann.grasmick@biomerieux.com

Jeannette Harris MultiCare Health Systems Enumclaw, WA jeanette.harris@multicare.org

Janet Hindler, MT(ASCP), F(AAM) UCLA Los Angeles, CA jhindler@ucla.edu

Barbara Juncoso, PhD Citrus College Glendora, CA bjuncosa@citruscollege.edu

Nathan Ledeboer, PhD, D(ABMM) Medical College of Wisconsin Milwaukee,WI nledeboe@mcw.edu

Phil Liang, MBA Riverside Community Hospital Riverside, CA Phillip.Liang@hcahealthcare.com

Yvette McCarter, PhD, D(ABMM) University of Florida Jacksonville, FL yvette.mccarter@jax.ufl.edu

Shelly Miller, PhD, D(ABMM) UCLA Los Angeles, CA smiller@mednet.ucla.edu

Margie Morgan, PhD, D(ABMM) Cedars Sinai Medical Center Los Angeles, CA morganma@cshs.org

Chris Newhouse, PhD RocheDiagnostics,Inc. Indianapolis,IN chris.newhouse@roche.coml

Susan Novak-Weekley, PhD, D(ABMM) SCPermanenteMedicalGroup North Hollywood, CA susan.m.novak@kp.org

Tamara Ranalli, PhD Quidel Corporation San Diego, CA tranalli@quidel.com

Steven Ricke, PhD University of Arkansas Fayetteville, AR sricke@uark.edu

George Sakoulas, MD Sharp Health System San Diego, CA George.Sakoulas@sharp.com

Erin Sanders, PhD UCLA Los Angeles, CA erins@ceils.ucla.edu

Susan Sharp, PhD, D(ABMM), F(AAM) KaiserPermanente Portland,OR susan.e.sharp@kp.org

Tom Thomson, PhD, D(ABMM), F(AAM) Evanston Hospital Evanston,IL rthomson@northshore.org

Photo Credit: Centers for Disease Control and Prevention’s Public Health Image Library (PHIL)

1995Presidents at SCASM 60th anniversary

1983Montagnier and gallo independently isolate and characterize hiV as the cause of AiDS

1988Kary Mullis develops the method of DnA amplification called Polymerase Chain Reaction (PCR)

1980the World health Organization declares eradication of smallpox in the world

1973herbert Boyer and Stanley Cohen, using plasmids, are the first to clone DnA

eleCted board memberS OmaiGarner,PhD,D(ABMM) SusanVergara,MT(ASCP)

annual meeting CommitteeS Continuing Education MickeyAmos,MBA,(ASCP)SM Marilou Fonacier Cruz, MT SandySaeki,MT(ASCP) JuanYbarra,MT(ASCP)

Program Planning DianeM.Citron,M(ASCP),F(AAM) OmaiGarner,PhD,D(ABMM) JanetHindler,MT(ASCP),F(AAM) MargieMorgan,PhD,D(ABMM) SusanNovak-Weekley,PhD,D(ABMM)

Exhibits LaRondaFrazier,MT(ASCP),MS Mark Helak BradPeterson

SCaSm oFFiCerS President Mark Dubar, BS mark_dubar@bd.com

President-Elect LaRondaFrazier,MT(ASCP),MS laronda.s.frazier@kp.org

Immediate Past-President ElizabethMarlowe,PhD,D(ABMM) marlowe_beth@yahoo.com

Secretary NicoleGreen,PhD,D(ABMM) nicgreen@ph.lacounty.gov

Treasurer JoseOrtez,MT(ASCP) jhortez@gmail.com

Councilor SusanNovak-Weekley,PhD,D(ABMM)susan.m.novak@kp.org

Councilor-Elect ZaffarHussain,MS,MT(ASCP) zaffar.hussain@kp.org

2016Cedar Sinai Medical Center in l.A.

2016Mark Dubar, president of SCASM

2014ebola outbreak reaching the uS for the first time

2009h1n1 influenza outbreak

Fundraising RomneyHumphries,PhD,D(ABMM) SusanNovak-Weekley,PhD,D(ABMM)

New Technologist Outreach JanetHindler,MT(ASCP),F(AAM) ZaffarHussain,MS,MT(ASCP) SusanVergara,MT(ASCP)

Student Posters AnnGrasmick,MT(ASCP)

2003A new, mysterious respiratory disease (SARS) that kills healthy young adults becomes epidemic

2003the human genome Project is completed, providing location and sequence info of human genes on all 46 chromosomes

2001Bioterrorism event occurred caused by mailed anthrax spores

1995Venter, Smith and Fraser elucidate the first complete genome sequence of a microorganism -haemophilus influenzae

2006new vaccine for hPV is introduced

2008harald zur hausen awarded nobel Prize for discovery of human papilloma viruses causing cervical cancer

CATATGGCTATCGACATCGAGAACCTCATATGGCTATCGACATCGAGAACCT

SCheDule

Friday, oCtober 287:00am - 5:00pm Registration - Grand Foyer

7:00am - 7:45am Continental Breakfast Location: Aventine Ballroom Sponsored by: Roche Diagnostics

7:45am - 8:45am SESSION F-1 COuRSE 16-075-03 1 Contact Hr. CORPORATE SPONSORED SESSIONS

The 7:45am scientific session will be a selection of five corporate sponsored sessions, with nationally known speakers presenting topical information about new methods and instrumentation. Please select your session from the following topics, and come early to get a seat…first come – first 50 served. No tickets will be issued this year for these sessions.

(1) Cobas 4800 Menu and Mixed Run Processing & Roche Microbiology Investments [Chris Newhouse, PhD] Location: Palatine A

Overview of the cobas 4800, current menu, how menu expansion and mixed run processing can increase your laboratory’s workflow efficiency. How Roche is investing in novel solutions like Smarticles to provide future testing solutions for microbiologists. Sponsored by: Roche Diagnostics

(2) Performance of Next-Generation Phenotypic Susceptibility Testing for Blood Cultures [Shelley Miller, PhD, D(ABMM)] Location: Palatine B

Morphokinetic Cellular Analysis (MCA) is an inno-vative, next-generation method for phenotypic antimicrobial susceptibility testing that yields diagnostic results substantially faster than traditional methods for positive blood culture samples. Fully automated, this information-rich method decreases the time to clinically actionable results and enables clinicians to optimize antimicrobial therapy earlier for patients suffering from serious infections. . Sponsored by: Accelerate Diagnostics

(3) The Value of BioMarkers & Rapid Microbiology [George Sakoulas, MD] Location: Portofino A

Healthcare systems are being challenged today to improve quality of care and health outcomes for its patients. At the same time, there are an increasing number of patients diagnosed with sepsis requiring more resources to drive improvements in survival rates. The microbiology laboratory can help by incor-porating newer technologies to provide physicians with more rapid actionable information and results. Sponsored by: bioMérieux, Inc.

(4) Looking to the Future: How Digital Microbiology Can Grow the Value of Microbiology [Nathan Ledeboer, PhD, D(ABMM)] Location: Portofino B

Technology is changing the field of clinical microbiol-ogy dramatically. The advent of laboratory automation and digital imaging has changed how laboratories manage specimens and read cultures. The ses-sion will evaluate the prospects of digital imaging and automated plate reading and discuss how medical laboratory professionals will need to adapt to changes in technology and how the lab runs. Sponsored by: Copan Diagnostics, Inc.

(5) Advances in Molecular Testing for Respiratory Pathogens [Tamara Ranalli, PhD] Location: Delphi A/B (2nd floor)

Molecular testing has been a mainstay in the laboratory for more than a decade. Advances in technology have allowed testing to be performed outside of the traditional lab setting. This talk will discuss the technology and assays now available for molecular testing closer to the point of care. Sponsored by: Quidel

FRIDAY SCIENTIFIC SESSIONS: As part of our 80th anniversary celebra-tion, we are very pleased that our current President of ASM, Dr. Susan Sharp and ASM’s CEO, Dr. Stefano Bertuzzi will be coming from Washington D.C. to provide their views on the future of our profes-sion. We will learn about newer technological developments including digital microbiology. We will also learn more about the pros and cons of implementing molecular panels for GI pathogen detection. Next, we will hear about the ways in which we can process and report results from blood cultures to provide the greatest benefit to our patients. Friday’s session will end with a discussion of several challenges we all face on a day-to-day basis in the clinical microbiology laboratory and how we can streamline processes to make these less burdensome.

9:00am - 10:00am SESSION F-2 COuRSE 16-075-04 2 Contact Hrs. Location: Vicino Ballroom

Moderator: Susan Novak-Weekley, PhD, D(ABMM)

9:10am What Lies Beyond? The Future of Microbiology [Stefano Bertuzzi, PhD, and Susan Sharp, PhD, D(ABMM), F(AAM)]

10:00am - 11:00am ExHIBITS OPEN – KNOWLEDGE QuEST COuRSE 16-075-05 1 Add’l Contact Hr. Location: Aventine Ballroom Coffee break sponsored by: Cepheid

11:00am Face Time with Microbes (Digital Microbiology) [Tom Thomson, PhD, D(ABMM), F(AAM)]

12:00pm - 1:30pm Exhibits Open & Lunch Location: Aventine Ballroom Sponsored by: Medical Chemical Corp.

1:30pm - 4:45pm SESSION F-3 COuRSE 16-075-06 3 Contact Hrs. Location: Vicino Ballroom Moderator: Janet Hindler, MT (ASCP), F(AAM)

1:30pm Newer Methods for Detection of GI Pathogens [Mark Roger Couturier, PhD, D(ABMM)]

2:30pm Dexter-Howard Memorial Lecture: Maximizing the Value of Blood Exam for Microbial Pathogens [Jennifer Dien-Bard, PhD, D(ABMM), FCCM]

Friday, oCtober 28 (Cont’d)thurSday, oCtober 272:00pm - 7:00pm Exhibitor Set up - Aventine Ballroom

3:00pm - 5:00pm Registration - Grand Foyer

6:30pm - 9:00pm Board Meeting & Dessert - Portofino AB Sponsored by: Pocared Diagnostics

SCheDule

3:30pm - 4:00pm Exhibits Open & Break Location: Aventine Ballroom Sponsored by: Copan Diagnostics, Inc.

4:00pm Common Problems in Micro labs – Lean the Process, Change the Outcome! [Anne Beall, BA]

6:00pm - 9:00pm President’s Reception and Social Location: Hyatt Poolside Co-sponsored by: BD Diagnostics & Qiagen Entertainment Sponsored by: Copan Diagnostics, Inc.

Saturday, oCtober 297:00am - 2:00pm Registration - Grand Foyer

7:00am - 7:45am Continental Breakfast Location: Aventine Ballroom Sponsored by: BioFire Diagnostics

7:45am - 8:45am SESSION S-1 COuRSE 16-075-08 1 Contact Hr. CORPORATE SPONSORED SESSIONS

The 7:45am scientific session will be a selection of five corporate sponsored sessions, with nationally known speakers presenting topical information about new methods and instrumentation. Due to limited space, please select your session from the following topics, on your registration form. More information on each can be found on the program insert.

(1) Replacing Cultures with Molecular Methods for Enterics [Shelley A. Miller, PhD, D(ABMM)] Location: Palatine A

In this presentation both the advantages and disadvantages of replacing cultures with molecular methods will be explored. Pre-implementation considerations will also be mentioned along with the rationale as to why UCLA decided to use the BD Max™ for molecular testing of Enteric Organisms. Sponsored by: BD Diagnostics

(2) An Advanced Syndromic Approach to Respiratory Testing: Simplified [Faranak Atrzadeh] Location: Palatine B

GenMark’s passion for developing diagnostic innovations has led to rapid advances in management of infectious diseases, improved laboratory workflow, and output of the clinical laboratory to impact patient care. In this workshop you will learn about: The current molecular landscape and today’s key challenges and the role that the ePlex sample-to-answer system can play in empow-ering your lab to deliver fast, actionable results. Sponsored by: GenMark Diagnostics, Inc.

(3) From TB to CP-CRE: Impact of Rapid Molecular Diagnostics at One of California’s Largest Public Health Hospitals [Susan Butler-Wu, PhD, D(ABMM)] Location: Portofino A

In this session, we will discuss our experience with using the GeneXpert system. The impact of rapid molecular diagnostic testing on costs, patient care and infection prevention will be reviewed. Sponsored by: Cepheid, Inc.

(4) The Power of Flex Testing on the Nanosphere Verigene System [Margie Morgan, PhD, D(ABMM)] Location: Portofino B

This workshop will feature a presentation that highlights the clinical and economic value of Nanosphere’s newly FDA-cleared Respiratory Pathogens Flex Test (RP Flex). The first test of its kind, RP Flex features Nanosphere’s novel Flex™ software, which allows the 16 viral and bacterial targets identi-fied by RP Flex to be reported as a full multiplex panel or in various user-defined subsets. Labs pay only for the targets ordered for each patient sample. Sponsored by: Nanosphere

(5) Rapid Diagnostics/Anti-fungal Stewardship [Phil Liang, MBA] Location: Delphi A/B (2nd floor)

The application of same day rapid sepsis detection, direct from whole blood, culture independent, as a routine diagnostic tool in the microbiology laboratory has proven to be accurate and efficient. This ses-sion will discuss the experience of fully integrating T2 Biosystems in a microbiology laboratory along with the successful collaboration between infectious diseases, pharmacy, critical care, and hospital admin-istration from test justification to implementation. Sponsored by: T2 Biosystems, Inc.

Collegiate PoSterS

8:30am - 2:45PmModerator: Ann Grasmick, MT(ASCP)

8:30am - 9:00am Poster Set-up: Barcino

9:00am - 10:00am Career Session: San Remo

10:00am - 11:00am Poster Judging: Barcino

11:00am - 12:00pm Guided Tour of Exhibits: Aventine Ballroom

12:00pm - 1:00pm Poster Judging: Barcino

1:00pm - 1:30pm Student Lunch: Aventine Ballroom

1:30pm - 2:30pm Session S-3: Vicino Ballroom

2:30pm - 2:45pm Presentation of Poster Winners: Vicino Ballroom

Students will present their posters and SCASM will continue the tradi-tion of supporting the winning students to present their posters at the next ASM General Meeting. Please come by and support the students in their microbiology research efforts and professional presentations. Encourage them to share their project information with you – they’ll be glad to discuss their research.

2:45pm - 3:00pm Remove Posters: Barcino

Sponsored by: bioMérieux, Inc.

Friday, oCtober 28 (Cont’d)

SCheDule

SATuRDAY SCIENTIFIC SESSIONS: Urine represents the largest sample type received in most clinical microbiology laboratories and we will learn about the latest recommendations for processing urine for routine cul-ture. Next, we will listen to an infectious disease pharmacist describe the types of laboratory errors that have the greatest impact on patient outcomes…and what we as experts can do to avoid these errors. ASM Distinguished Lecturer, Dr. Steve Ricke, has investigated microbial con-tamination of food for decades and will describe steps he believes must be taken to protect our food supply. Finally, there will be Case Studies…and more Case Studies…all representing scenarios that we may have encountered in our laboratory in the recent past or may encounter in the near future! This last session will be geared to inform us how best to deal with today’s most noteworthy infectious diseases from a laboratory diagnostic perspective.

9:00am - 12:00pm SESSION S-2 COuRSE 16-075-09 2 Contact Hrs. Location: Vicino Ballroom Moderator: Diane Citron, M(ASCP), F(AAM)

9:00am Maximizing the Value of urine Exam for Microbial Pathogens [Jeannette Harris]

10:00am - 11:00am ExHIBITS OPEN – KNOWLEDGE QuEST COuRSE 16-075-10 1 Add’l Contact Hr. Location: Aventine Ballroom Coffee Break Sponsored by: DiaSorin Molecular, LLC

11:00am Clinical Impact Associated with Laboratory Error [Joan-Miquel Balada-Llasat, PharmD, PhD, D(ABMM)]

12:00pm - 1:30pm Exhibits Open & Lunch Location: Aventine Ballroom

1:30pm - 5:00pm SESSION S-3 COuRSE 16-075-11 3 Contact Hrs. Location: Vicino Ballroom Moderator: Margie Morgan, PhD, D(ABMM)

1:30pm Keeping Organic and Non-Organic Foods Safe from Foodborne Salmonella [Steven Ricke, PhD]

2:30pm Presentation of Poster Winners [Ann Grasmick, MT(ASCP)] Location: Vicino Ballroom

2:45pm T.D. Beckwith & Certificate of Appreciation Awards [Mark Dubar, BS] Location: Vicino Ballroom

3:00pm Break Location: Vicino Courtyard

3:15pm Clinical Mysteries That YOu Can Help Solve Now [Yvette McCarter, PhD, D(ABMM) & Susan Butler Wu, PhD, D(ABMM)]

4:45pm Closing Remarks [President, Mark Dubar, BS]

Saturday, oCtober 29 (Cont’d)

9:30am - 12:45pm Location: Portofino A/B Moderator: Kelly Burke, MS

9:30am Creating a Bridge from General Microbiology to the Clinical Microbiology Coursework [Hencelyn Chu, PhD, MLS (ASCP)]

Bridging the curricula between the general microbiol-ogy courses and the clinical microbiology courses is critical to enhance students’ success in the clinical laboratory science training programs and in their careers. This workshop will present an inventory of current general microbiology course contents and laboratory topics as well as the required clinical microbiology body of knowledge and skill sets in the training programs and in the healthcare industry. Various case studies that highlight examples of the healthcare industry’s need for enhanced curriculum in topics such as infection control, antimicrobial use, and emerging infectious diseases will be presented.

10:30am - 10:45am Coffee Break & Exhibits Open

10:45am Microbrew Session [Barbara Juncosa, PhD]

11:45am Research Engagement: The Key to Transforming Laboratory Education in the Life Sciences [Erin Sanders, PhD]

Course-based undergraduate research experiences (CUREs) and apprentice-based research experiences (AREs) represent inclusive, student-centered instruc-tional strategies that engage students in authentic research, and inspire their interest in biology. Come and learn about a laboratory curriculum that was created as a framework for immersing students into an assortment of CUREs and AREs, wide-ranging enough to accommodate the diverse research inter-ests of over 250 undergraduates per year, yet tailored to the unique motivations and competencies of indi-vidual students.

12:45pm - 1:30pm Lunch Location: Aventine Ballroom

FRIDAY, OCTOBER 28

1O:OOam - 11:OOam 12:OOpm - 1:3Opm 3:30pm - 4:00pm

SCientiFiC exhibit hourS

SATuRDAY, OCTOBER 29

1O:OOam - 11:OOam 12:OOpm - 1:3Opm

eduCator SeSSion-mini aSmCueCourSe 16-075-07 3 ContaCt hrS.

Ann Beall, BAJoan-Miquel Balada-Llasat, PharmD, PhD, D(ABMM)

Mark Roger Couturier, PhD, D(ABMM)

Hencelyn Chu, PhD, MLS (ASCP)Susan Butler-Wu, PhD, D(ABMM)

Stefano Bertuzzi, PhD

Yvette McCarter, PhD, D(ABMM)

Barbara Juncosa, PhDJeannette HarrisJennifer Dien-Bard, PhD, D(ABMM), FCCM

Tom Thomson, PhD, D(ABMM), F(AAM)

Susan Sharp, PhD, D(ABMM), F(AAM)

Erin Sanders, PhDSteven Ricke, PhD

Featured SPeakerS

2016

geneRAl inFORMAtiOn | RegiStRAtiOn OPtiOnS

EducationEducation is the major component in the purpose of the Southern California Branch of the American Society for Microbiology (SCASM). Through its educational activities, SCASM contributes to the profes-sion and helps to increase, refine, and perpetuate the microbiologist’s body of knowledge. With an exceptional faculty presenting relevant, diverse and stimulating workshops and sessions, this is a meeting you cannot afford to miss! SCASM is recognized by the State of California as an Accrediting Agency for Continuing Education for Clinical Laboratory Sciences.

Scientific ExhibitsIn addition to quality education, you will have an opportunity to visit with the companies that provide products and services to your lab. The SCASM Annual Meeting Committee has arranged for an effec-tive exhibit schedule. Take advantage of this valuable opportunity to review new products and ask questions about ones you currently use.

CEu DocumentationCEU documentation is available and included in your registration fees. If you require CEU’s, you should arrive early to your sessions to allow time to sign-in. You must attend the entire session and you must sign in for each session. There will be no exceptions. CEU credit will also be available for the Corporate Sponsored ses-sions on Friday and Saturday mornings. A total of 14 units may be earned if you attend all sessions offered.

Hotel InformationThe SCASM 80th Annual Meeting will be held again at the Hyatt Regency La Jolla at Aventine, 3777 La Jolla Village Dr., San Diego, CA 92122. Discover this AAA Four Diamond Hyatt and enjoy a seaside destination with the charm of a European village and the panache of Southern California. The hotel is offering a special group rate of $185.00 single or double occupancy. Book your reservation at www.scasm.org, or https://resweb.passkey.com/go/SCASM2016. You can also call Hyatt reservations at 888-421-1442. To receive a room at this special rate, you must state that you are with the Southern California Branch of the American Society for Microbiology and you must make your reservations by October 5. Reservations received after this date will be taken on a space & rate availability basis. Self-parking is $5.00 per day for overnight guests or $5.00 for day use.

SCASM Membership DiscountsCurrent members of SCASM for the 2016 membership year (by October 1, 2016) are eligible for the members’ discount rate on registration fees. If you are a current member, and want to renew your membership, or if you are not a member and want to become a member, go to www.scasm.org to join or renew.

Attention Young TechsThe New Technologist Scholarship Program will be held again this year. Details will be forthcoming by email and on the website, www.scasm.org. Watch for it!

Annual Meeting ManagementQuestions related to registration for the Annual Meeting can be directed to 858-487-7759 or info@scasm.org.

Registration OptionsRegister on line now at www.scasm.org or complete the reg-istration form in this brochure and return as indicated with your check made payable to SCASM.

Full RegistrationYour full registration includes all of the Sessions, Scientific Exhibits, breakfast and lunch on Friday and Saturday, as well as the President’s Reception on Friday evening.

One Day RegistrationOne day registration includes Sessions, Scientific Exhibits, and breakfast and lunch for the day, but does not include Friday Reception.

Student RegistrationStudent registration includes all of the Sessions, Scientific Exhibits, breakfast and lunch on Friday and Saturday, as well as the President’s Reception on Friday evening. Student registrants must be able to provide a student ID at the registration desk on site.

Guest RegistrationGuest registration includes Scientific Exhibits, breakfast and lunch for one or two days (depending on registration choice). This registration option is for non-scientific guests only. If a guest plans to attend the Sessions, the regular Full Registration fee must be paid.

Corporate Sponsored Sessions We’re offering the Corporate Sponsored Sessions again this year. The 7:45am sessions on Friday and Saturday mornings will be a selection of scientific sessions, with nationally known speakers presenting topical information about new methods and instrumentation. DUE TO LIMITED SPACE, IT WILL BE FIRST COME - FIRST SERVE TO THE FIRST 50 PEOPLE IN THE ROOM. ADVANCE TICKETS WILL NOT BE ISSUED THIS YEAR. No charge to program registrants – FIRST COME – FIRST SERVE.

Food & Beverage FunctionsIf you purchase a full registration, it includes admission to the breakfast and lunches each day, as well as the President’s Reception on Friday evening.

If you purchase a one day or guest registration, it includes admission to the breakfast and lunches on the day you attend, but it DOES NOT include the President’s Reception on Friday evening. You must purchase a separate ticket for that evening if you’d like to attend.

Friday Evening President’s ReceptionWe invite you to join us for the President’s Reception on Friday night, poolside at the Hyatt. This is a night you won’t want to miss.

If you are not a “full meeting registrant”, you can still attend this reception for a fee of $75.00, which includes cocktails, heavy hors d’oeuvres and entertainment for the evening. All exhibitors are entitled to two passes per paid booth to this reception, included in their exhibit fee.

Cancellation/Refund PolicyA full refund, less a $50.00 processing fee, will be granted for cancel-lation requests received in writing by September 1, 2016. No refunds will be granted after this date.

Visit the SCASM website for updates on meetings, activities, microbiology links, and much more! www.scasm.org

SCASM 80th AnnuAl Meeting | OCt. 27-29, 2016 | RegiStRAtiOn FORM

Please type or print clearly:

First Name_____________________________________________Last/Surname_________________________________________________ Guest First Name______________________________________Last/Surname______________________________________________ Organization_________________________________________________________________________________________________ Address_____________________________________________________________________________________________________ City___________________________________________________State/Province__________Zip/Post Code____________________ E-Mail Address (required for registration confirmation)__________________________________________________________________________

Phone_____________________________SCASM Membership #_____________________________Expires______________________

The support of our exhibitors makes this meeting possible. May we share your contact information with them? qYes qNo

1. Full General Registration Fees (includes sessions, meals, President’s Reception & exhibits) (PleaseCheckOneCategory) SCASM Member Non-Member EarlyBird(postmarkedby8/15) q $185 q $215 RegularRate(postmarkedby10/1) q $205 q $235 On-SiteRate(postmarkafter10/1) q $225 q $255 StudentRate(anytime) q $70 q $100 EmeritusRate(anytime) q $80

2. One Day Registration Fees (includes sessions, meals & exhibits)

MUST Choose Day to Attend: q Friday q Saturday SCASM Member Non-Member 1Day(postmarkedby8/15) q $110 q $140 1Day(postmarkedby10/1) q $130 q $160 1DayOn-SiteRate(after10/1) q $150 q $180 Student(anytime) q $45 q $75 EmeritusOneDay(anytime) q $50

NOTE: StudentRegistrantsmustprovidestudentIDatregistrationdeskonsite.

3. Guest Registration Fees Guest registration is for nonscientific guests only and includes all meal functions, but not the President’s Reception or any sessions. MUSTChooseDay(s)toAttend:q Friday q Saturday One Day q $90 Two Days q $175

4. President’s Reception Registration a. Full Meeting Registrant - No Fee. Will you attend? q yes q no

b. I need to purchase additional tickets for the President’s Reception for additional exhibitors (above the 2 included w/exhibit fee, guests, or one day registrants – includes cocktails & hors d’oeuvres) q $75 per person # of tickets required at $75 ea:________

5. Exhibits Only Registration(Thisregistrationincludes admissiontoexhibitsonly,nomealfunctions.) q $25 per day

Mail this registration form to: SCASM 10889 La Alberca Avenue, San Diego, CA 92127 Phone: 858-487-7759 | E-mail: info@scasm.org

6. Registration Fees Total $_______________Registration Fee

$_______________Add’lPresident’sReceptionTicket(s)$_______________My total registration fee for Annual Meeting. q Iprefertopaybycheck.PleasemakethecheckpayabletoSCASM& mail with this registration form to: SCASM, 10889 La Alberca Avenue, San Diego, CA 92127

If you would like to pay by credit card (AMEx, VISA, MC or Discover), please go to the website www.scasm.org to register.

7. PLEASE INDICATE ANY SPECIAL NEEDS Dietary: q Diabetic q Vegetarian q Low Salt q Low Fat q Vegan q Shellfish Allergies qOther(pleaseexplain)____________________

Physical: The Hyatt Regency La Jolla is ADA compliant. q Pleasecheckhere ifyourequirespecialaccommodations inorder toparticipate in the Annual Meeting AND send written description of your needs to info@scasm.org.

8. Cancellation/Refund PolicyA full refund, less a $50.00 processing fee, will be granted for cancellation requests received in writing by September 1, 2016. No refunds will be granted after this date.

9. Membership – Current Members & New MembersTo be eligible for the member rate, you must be a 2016 SCASM member by October 1, 2016.Ifyouareacurrentmemberandwanttorenewyourmembership, or if you are not a member and want to become a member, go to www.scasm.org to join or renew.

*Registrations must be postmarked by dates indicated, without exception, to receive discounted rates. Pre-registration can not be accepted by phone, fax or mail after October 1, 2016. You may register until October 29, 2016 on line at www.scasm.org at the on-site rates.

** PHONE REGISTRATIONS CANNOT BE ACCEPTED You will receive a confirmation letter by e-mail within two weeks of your registration.

SCASM 10889 La Alberca Avenue San Diego, CA 92127 ADDRESS SERVICE REQUESTED

PRSRT 1st Class U.S. Postage

PAID Permit #751

San Diego, CA

2016 SCASM Annual MeetingHyatt Regency La Jolla at Aventine, San Diego, CA14 Hours of Continuing Education Credits Available Obtain up to 7 Hours/Day 0.1 CEU = 1 Contact Hr. (California) SCASM is recognized by the State of California as an Accrediting Agency for Continuing Education for Clinical Laboratory Sciences.

Celebrating

years of sCasM80

oPen noW!

registration materials enclosed