27
1 http://www.youtube.com/watch?v=x5yPkxCLads5/18/11

12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

  • Upload
    others

  • View
    14

  • Download
    0

Embed Size (px)

Citation preview

Page 1: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

1

http://www.youtube.com/watch?v=x5yPkxCLads5/18/11

Page 2: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

2

Direct Detection of Genotype

about gene testing: http://www.ornl.gov/sci/techresources/Human_Genome/medicine/genetest.shtml about sickle cell: http://ghr.nlm.nih.gov/condition=sicklecellanemia http://www.ygyh.org/ http://www.nlm.nih.gov/medlineplus/sicklecellanemia.html

Page 3: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

3

direct detection of genotype: http://www.labtestsonline.org/understanding/features/genetics-3.html

A glu à val missense mutation in the β hemoglobin gene causes sickle cell anemia Loss-of-function mutations cause β thalassemias (form of anemia)

Page 4: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

4

You are a clinical geneticist and you want to • determine the genotype of an individual at a particular locus -- such as

the β globin gene • or study a the β globin gene in a group of individuals

You have a tube of genomic DNA prepared from spit or blood or whatever. It is a complex heterogeneous mixture of sequences How are you going to examine your gene of interest?

Total Genomic DNA

Page 5: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

5

PROBLEM: • β hemoglobin gene 3 kb/3 million kb: 1 part in 1 million of the

genome • Small quantity of your gene and it’s contaminated with all of

these other sequences WANT A TUBE LABELED:

PURE β hemoglobin sequences

Page 6: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

6

How to purify the gene sequences that you want to study? If you were trying to purify a protein what would you do?

Page 7: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

7

Can take advantage of natural systems to amplify specific DNA sequences in vivo (see pg 27 of this lecture) or in vitro amplification

Two methods of isolating and amplifying a gene are: (a) in vivo, using the replication machinery of a bacterium to amplify recombinant DNA containing the gene (typically in the form of plasmids) (b) in vitro, in the test tube using the polymerase chain reaction technique.

Page 8: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

8

Amplify the gene or sequence using PCR -- an in vitro process PCR = polymerase chain reaction • Very sophisticated molecular technologies have developed based

on our understanding of the enzymology of DNA replication, transcription and translation

• PCR is an in vitro DNA replication technology that has revolutionized basic research in molecular biology and genetics

• PCR involves exponential amplification* of a specific gene or region of DNA from a complex mixture of DNA

* an old principle in a new context: see end of lecture

The Secret of the Persian

Chessboard by Carl Sagan

Page 9: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

9

How do we target amplification to our specific sequences of interest?

How come only the red sequence is amplified from the starting template:

Page 10: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

10

Specificity of amplification is controlled

by the primers added to the reaction –WHY?

What are the other components of a PCR Reaction?

Page 11: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

11

Page 12: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

12

PCR animations http://www.dnalc.org/ddnalc/resources/animations.html

Melt = denature DNA with heat Anneal = allow primer to hydrogen bond with complementary sequences on the template DNA Replicate = allow DNA polymerase to extend primer and synthesize complementary copy of template

What is temperature scale in oC?

See pg 23 for more detailed schematic

Page 13: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

13

The complete sequence of human beta globin gene is shown below Conventions for displaying gene sequences: • Sequence reads 5’ to 3’ • Only the mRNA like strand is displayed (complementary strand not shown)

>ref|NG_000007.3|:70000-73000 Homo sapiens beta globin (HBB) on chromosome 11 CACACATATATATATATATTTTTTCTTTTCTTACCAGAAGGTTTTAATCCAAATAAGGAGAAGATATGCT TAGAACCGAGGTAGAGTTTTCATCCATTCTGTCCTGTAAGTATTTTGCATATTCTGGAGACGCAGGAAGA GATCCATCTACATATCCCAAAGCTGAATTATGGTAGACAAAACTCTTCCACTTTTAGTGCATCAACTTCT TATTTGTGTAATAAGAAAATTGGGAAAACGATCTTCAATATGCTTACCAAGCTGTGATTCCAAATATTAC GTAAATACACTTGCAAAGGAGGATGTTTTTAGTAGCAATTTGTACTGATGGTATGGGGCCAAGAGATATA TCTTAGAGGGAGGGCTGAGGGTTTGAAGTCCAACTCCTAAGCCAGTGCCAGAAGAGCCAAGGACAGGTAC GGCTGTCATCACTTAGACCTCACCCTGTGGAGCCACACCCTAGGGTTGGCCAATCTACTCCCAGGAGCAG GGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGAC ACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGT TACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGG TTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTG ATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGA CCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAA GGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACC TTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTAT GGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGATAAGTAA CAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGT TTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCC

Sickle cell mutation CCT-GAG-GAG à CCT-GTG-GAG.

In blue: transcription start site Highlighted ATG: start of translation

TATA box – part of the promoter: mutations here cause loss-of-function phenotype (thalassemia)

Page 14: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

14

Design primers to amplify a region spanning the sickle cell mutation -- between the //’s but not extending beyond the symbols in either direction: • Both primer sequences must read in the 5’ to 3’ direction. • Primers are typically 20-30 bases long >ref|NG_000007.3|:70000-73000 Homo sapiens beta globin (HBB); and hemoglobin on chromosome 11 CACACATATATATATATATTTTTTCTTTTCTTACCAGAAGGTTTTAATCCAAATAAGGAGAAGATATGCTTAGAACCGAGGTAGAGTTTTCATCCATTCTGTCCTGTAAGTATTTTGCATATTCTGGAGACGCAGGAAGAGATCCATCTACATATCCCAAAGCTGAATTATGGTAGACAAAACTCTTCCACTTTTAGTGCATCAACTTCTTATTTGTGTAATAAGAAAATTGGGAAAACGATCTTCAATATGCTTACCAAGCTGTGATTCCAAATATTACGTAAATACACTTGCAAAGGAGGATGTTTTTAGTAGCAATTTGTACTGATGGTATGGGGCCAAGAGATATATCTTAGAGGGAGGGCTGAGGGTTTGAAGTCCAACTCCTAAGCCAGTGCCAGAAGAGCCAAGGACAGGTACGGCTGTCATCACTTAGACCTCACCCTGTG//GAGCCACACCCTAGGGTTGGCCAATCTACTCCCAGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTG//AGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTG

Page 15: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

15

Left primer: 5’ GAGCCACACCCTAGGGTT etc. Right primer: 5’ CAAAGAACCTCTGGGT etc.

What do you do with your PCR product once you make it?

Page 16: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

16

+ pole DNA size standards (or ladder) in first and last lanes BUT, how can you determine genotype using your PCR product? How do we know if the globin sequence is

CCT-GAG-GAG OR CCT-GTG-GAG

Gel Electrophoresis Agarose Slab Gel stained with ethidium bromine and photographed on UV transilluminator

Wells where DNA is loaded

- pole

Page 17: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

17

Restriction enzyme = restriction endonuclease

• nuclease = enzyme that hydrolyzes phosphodiester bond • endo = cuts internally in the DNA polymer (vs. exo that

cleaves from the end • restriction = nuclease activity restricted to a site with a

specific DNA sequence

Page 18: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

18

The AàT transversion mutation in the sickle-cell allele removes an Mst II restriction site Mst II recognizes CCTNAGG where N = A, C, G or T Note that at this level of examination the two alleles are codominant

Page 19: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

19

The SCN9a gene codes for a subunit of a neuronal sodium ion channel involved in the transmission of pain signals On left: dideoxy sequence display of PCR Product* On right: restriction digest of product of PCR targeting the SCN9A gene

Figure 3 Mutations in SCN9A in patients with primary erythermalgia** (A) Affected members in the family are heterozygous for a T2573A mutation. (B) Restriction endonuclease Hph I digestion for the identification of the T2573A mutation in the family. Mutation T2573A abolishes a recognition site for restriction endonuclease Hph I. Three fragments of 470 bp, 303 bp, and 167 bp are found in patients, and two fragments of 303 bp and 167 bp fragments are found in unaffected members. * Read about Sanger dideoxy sequencing in your textbook **characterized by red, warm and burning extremities

Hph I recognition site: 5’ TCACC 3’ T2573A = T to A transversion at nucleotide number 2573 removes HphI restriction site

Page 20: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

20

Nature Genetics 38: 1304 2006: R-spondin1 is essential in sex determination, skin differentiation and malignancy Here is the abstract of the paper: R-spondins are a recently characterized small family of growth factors. Here we show that human R-spondin1 (RSPO1) is the gene disrupted in a syndrome characterized by XX sex reversal, palmoplantar hyperkeratosis and predisposition to squamous cell carcinoma of the skin. Our data show, for the first time, that disruption of a single gene can lead to complete female-to-male sex reversal in the absence of the testis-determining gene, SRY. Here is an exerpt from the introduction to the paper: We have previously described a large consanguineous Italian family that includes four 46,XX (SRY-negative) brothers. In the same family, palmoplantar hyperkeratosis (PPK) and predisposition to squamous cell carcinoma of the skin (SCC) segregate as recessive traits. All members of the family with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK (Fig. 1a). We proposed that homozygosity for a single mutational event causes both PPK and SCC in XYand XX individuals and sex reversal in XX individuals. PEDIGREES on the next page.

Page 21: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

21

R-spondin1 is essential in sex determination, skin differentiation and malignancy

VOLUME 38 [ NUMBER 11 [ NOVEMBER 2006 NATURE GENETICS

Page 22: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

22

Page 23: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

23

a. Mutation analysis in family F. The guanine insertion at nucleotide 896 of exon 5 is shown by an arrow. ‘WT’ refers to an individual lacking the insertion. ‘WT/–’ refers to a heterozygote ‘–/–’ refers to an individual homozygous for the insertion

Page 24: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

24

(b) Mutation analysis in individual AN. The locations of primers for five separate PCRs are indicated by arrows (3, 4a, 4b, 5 and del). The 4a and 4b amplifications are included in the AN deletion. The primers for the ‘del’ reaction could not amplify the genomic region in control DNA, as the expected size is too large for the applied PCR conditions. Exon (‘Ex’) and intron sizes, as well as primer localization, are not to scale.

Page 25: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

25

Taking advantage of natural systems to amplify specific DNA sequences

Use recombinant DNA techniques to generate a molecular clone of the DNA: use a cell such as E. coli to make lots of copies of your gene -- put it in a DNA molecule that is easy to recover in a pure form from the cell

Page 26: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

26

The Secret of the Persian Chessboard

by Carl Sagan Parade Magazine Februrary 1989

The basic idea behind population growth, AIDS, nuclear weapons and much else (PCR)

“The way I first heard this story, it happened in ancient Persia. But it might have been India or even China. Anyway, it happened a long time ago. The Grand Vizier, the principal advisor to the King, had invented a new game. It was played with moving pieces on a board of 64 squares. The most important piece was the King. The next most important was the Grand Vizier. The object of the game was to capture the enemy King, and so the game was called in Persian shahmat -- shah for king and mat for dead, Death to the King. In Russian it is still called shakhmaty, which perhaps conveys a lingering revolutionary ardor. Even in English there is an echo of this name --- the final move is called “checkmate”. The game, of course, is chess.

Page 27: 12.02fire.biol.wwu.edu/trent/trent/12.02.22lecture.pdffamily with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK

27

As time passed, the pieces, their moves and the rules evolved. There is, for example, no longer a piece called the Grand Vizier -- it has become transmorgrifeed into a queen, which much more formidable powers. Why a king should delight in the creation of a game called “death to the king” is a mystery. But as the story goes, he was so pleased that he asked the Grand Vizier to name his own reward for such a splendid invention. The Grand Vizier had his answer ready. He was a humble man, he told the king. He wished only for a humble reward. Gesturing to the 8 columns and 8 rows of squares on the board he had devised, he asked that he be given a single grain of wheat on the first square, twice that on the second square, twice that on the third square and so on, until each square had its complement of wheat. No, the king remonstrated. This is too modest a prize for so important an invention. He offered jewels, dancing girls, palaces. But the grand vizier, his eyes becomingly lowered refused them all. …. Eventually the king consented. When the Master of the Royal Granary began to count out the grains, however, the King was in for rude surprise a: 1, 2, 4, 8, 16, 32, 64, 128, 256, 512, 1024……263 263 = 9 X 1018 = 9 million trillion grains of wheat on the last square….. An account of what happened next has not come down to us. But, how much would all of this wheat weigh? If each grain were 2 millimeters in size, then all of the grains together would weigh about 75 billion metric tons – the equivalent of about 150 years of the world’s present wheat production. A sequence of numbers like this - where each is a fixed multiple of the previous one -- is called a geometric progression and the process is called exponential increase. Exponentials show up in all sorts of places – compound interest and, of course, the Polymerase Chain Reaction.