11-06-03 Madl 0 - Uni Salzburg · 11-06-03 Madl 0 The Ghost in our ... •DNA has two chains, each made of nucleotides composed of a deoxy-ribose sugar, ... • xxx: Segments of the

0

11-06-03 Madl 0

The Ghost in our Genes - From the Past via the Present to the Future

Pierre MADL

Div. of Material Sciences

Dep. Physics & Biophysics

University of Salzburg

Hellbrunnerstr. 34

A-5020 Salzburg

[email protected]

http://biophysics.sbg.ac.at/home.htm

1

07-10-29 Madl 1

Menu (Structural Levels):

• Genetics – A definition,• Nucleus: Genetic code, Chromosomes,

• Cell: Replication, Transcription, Mitosis, Meiosis;

• Organism: Mendelian Genetics, Mutagenicity,

• Population: Epigenetics

Intro (1/4)

About myself:

• electronics engineer• MSc in ecology• PhD student • part time service technician

Nucleus Cell OrganismIntro Population

Dep. of Physics & Biophysics,Faculty of Natural Sciences

2

07-10-29 Madl 2

Genetics - A definition:

• .… the study of genes•…. the study of heredity •…. the variation in living organisms

William Bateson (1861-1926) coined the name “genetics” in 1909

Intro (2/4)


Whether geneticists study at the molecular, cellular, organismal, familial, population, or evolutionary level, genes are always central to their studies.

3

07-10-29 Madl 3

Genetics - a fragmented science:

• Genomics

• Transcriptomics

• Proteomics

• Metabolomics

Intro (3/4)


Genetics - a fragmented science:• Genetics: study of genes at the molecular, cellular, organismal, familial, population, or

evolutionary level.• Transcriptomics: • The need to look directly at the Proteins that are made. Fragments can be identified by reference

to the genome, if known, prediction. But needs powerful computers! BIOINFORMATICS• Metabolomics: x

4

07-10-29 Madl 4

The central Dogma:

• DNA↓ (transcription)

• RNA↓ (translation)

• Proteins

…. a photocopy

Tomos D.,2006

Intro (4/4)


The central Dogma: a photocopy of the “recipe book” (genetic code) – every cell of a body has a complete set of this code (holographic memory), only the environment determines which pages of this code are read for the appropriate function (liver cell has to express liver-associated function, proteins, etc, not muscle associated information).

• a specialized cell will only activate the appropriate information of this recipe book (i.e. chapter of the liver);

• a stem-cell can specialize into any cell – therefore is pluri-potential;

Hologram: Top: This is how a photographic image would appear if you look at it with

magnifying glasses of increasing strength. If you were to cut away the pieces of the picture that are outside the frame shown, the pixels containing the information would be lost and the image could not be reconstructed.

Below: This is the principle of information storage in the hologram. As mentioned before, the actual image would not be visible on the film, but the smaller sections of the film still contain the information about the complete object. If you cut it in half or even smaller pieces, you can still use each of the pieces to create a projection of the whole kitten (probably even with its ears intact - they have not been on the original photo used for the demonstration, so we will never know how they looked...).

5

07-10-29 Madl 5

Genetics on a “Nuclear” Level

Intro Cell Organism PopulationNucleus

6

07-10-29 Madl 6

The Eukaryotic Cell:

• Plant• Animal

Cell (1/6)


Generalized features of higher plant and animal cells are:a. A plasma membrane encloses the cytoplasm in both.b. Plant cells have a rigid cell wall.c. In both, the nucleus contains DNA complexed with proteins and organized into chromosomes.d. The nuclear envelope is two layers of semipermeable membrane with pores that allow movement of materials (e.g., ribosomes) between nucleoplasm and cytoplasm.e. The cytoplasm contains many materials and organelles. Important in genetics are:i. Centrioles (basal bodies) are in cytoplasm of nearly all animals, but not in most plants. In animals, a pair of centrioles is associated with the centrosome region of the cytoplasm where spindle fibers are organized in mitosis or meiosis.ii. The endoplasmic reticulum (ER) is a double membrane system that runs through the cell. ER with ribosomes attached collects proteins that will be secreted from the cell or localized to an organelle.iii. Ribosomes synthesize proteins, either free in the cytoplasm or attached to the cytoplasmic side of the ER.iv. Mitochondria are large organelles surrounded by double membrane that play a key role in energy processing for the cell. They contain their own DNA encoding some mitochondrialproteins, rRNAs and tRNAs.v. Chloroplasts are photosynthetic structures that occur in plants. The organelle has a triple membrane layer, and includes a genome encoding some of the genes needed for organelle functions.

7

07-10-29 Madl 7

The Genetic Code:

• DNA: double stranded macro-molecule arranged in chromosomes (network of granules = nuclear chromatin).

• RNA: single stranded macro-molecule, spherical, intranuclearstructure(s) - nucleolus / nucleoli.

Cell (2/6)


Nucleus:•Genetic material of both eukaryotes and prokaryotes is DNA (deoxy-ribo-nucleic acid). Many viruses also have DNA, but some have RNA (ribo-nucleic acid) genomes instead.

•DNA has two chains, each made of nucleotides composed of a deoxy-ribose sugar, a phosphate group and a base. The chains form a double helix.

8

07-10-29 Madl 8

The Genetic Code:

• Deoxyribose• Phosphate• 4 Bases:

Adenine (Purine)Guanine (Purine)Cytosine (Pyrimidine)Thymine (Pyrimidine)

Uracil (in RNA)

Cell (3/6)


Genetic Code:• Chromosome: ???? A series of messages contained in the chromosomes;• This code regulates cell functions by way of directing the synthesis of cell proteins;• The code corresponds to the structure of the DNA; • The code is transmitted to new cells during cell division;

The basic unit is the nucleotide: it consists of a • phosphate group• deoxy-ribose sugar

There are two classes of nitrogenous bases:a. Purines (double-ring, nine-membered structures) include adenine (A) and guanine (G).b. Pyrimidines (one-ring, six-membered structures) include cytosine (C), thymine (T) in DNA and uracil (U) in RNA.

The sequence of bases determines the genetic information. Genes are specific sequences of nucleotides that pass traits from parents to offspring.

9

07-10-29 Madl 9

The Genetic Code:

• Base pairing H-bonding

• Chargaff’s law equal numbers of bases

A & T;equal numbers of bases

G & C;

Cell (4/6)


The bases of the two strands are held together by hydrogen bonds between complementary bases (two for A-T pairs and three for G-C pairs). Individual H-bonds are relatively weak and so the strands can be separated (by heating, for example). Complementary base pairing means that the sequence of one strand dictates the sequence of the other strand.Chargaff’s Law:

•1st: In human DNA, for example, the four bases are present in these percentages: A=30.9% and T=29.4%; G=19.9% and C=19.8%. This strongly hinted towards the base pair makeup of the DNA, although Chargaff was not able to make this connection himself.

•2nd: is that the composition of DNA varies from one species to another, in particular in the relative amounts of A, G, T, and C bases. Such evidence of molecular diversity, which had been presumed absent from DNA, made DNA a more credible candidate for the genetic material than protein.

10

07-10-29 Madl 10

The Genetic Code:• Code: AGCT (U)• Backbone (Phosphate Deoxy-Ribose chain)

Cell (5/6)


Deosyribose• The base pairs are 0.34 nm apart, and one full turn of the DNA helix takes 3.4 nm, so there are 10 bp in a

complete turn. The diameter of a dsDNA helix is 2 nm.• Because of the way the bases H-bond with each other, the opposite sugar-phosphate backbones are not

equally spaced, resulting in a major and minor groove. This feature of DNA structure is important for protein binding.

Genetic Code (sequence of AT & GC):•Purines (double-ring, nine-membered structures) include adenine (A) and guanine (G).•The code corresponds to the structure of the DNA and regulates cell functions by way of directing the synthesis of cell proteins;

•The code is transmitted to new cells during cell division;•The coded messages are contained in the chromosomes;

11

07-10-29 Madl 11

What makes a Gene:

• Segments of the DNA• strings on chromosome• unique properties• identical in all cells (holographic properties)

• not all are expressed (biosemiotic principle)

• code for proteins and regulate other genes

Cell (6/6)


Gene is the basic unit of inheritance and make proteins that make up nearly all we are (muscles, hair, eyes, etc.). By selecting different pieces of a gene, your body can make many kinds of proteins. This process is called alternative splicing.If a gene is “expressed” that means it is turned on and it will make proteins.

• xxx: Segments of the DNA chain;• Xxx: beads on a (chromosome) string;• Ccc: determine cell properties, both structure and functions unique to the cell;

Genes are • Identical in all cells (holographic aspect);• not all genes are expressed in all cells;• not all genes are active all the time; • may code for enzymes or other functional proteins, structural proteins, regulators of other genes; almost everything that happens in our bodies happens because of proteins (walking, digestion, fighting disease).

•Locus: specific site of a gene on the chromosome. Since the chromosomes exist in pairs, genes are also paired.•Alleles: alternate forms of a gene can occupy the same locus (homo, hetero);•Recessive gene: expressed only when homozygous;•Dominant gene: homo or hetero or co-;•Sex-linked gene: X, recessive, hemi

Hologram: Top: This is how a photographic image would appear if you look at it with magnifying glasses of increasing strength. If you were to cut away the pieces of the picture that are outside the frame shown, the pixels containing the information would be lost and the image could not be reconstructed.Below: This is the principle of information storage in the hologram. As mentioned before, the actual

12

07-10-29 Madl 12

Scaffolding:• from DNA double helix to• packed chromatin fiber to• condensed chromosome

Chromosome (1/12)


DNAi ANIM

ATION

DNA-mole

cule/

packing

Eukaryotic chromosomes are linear dsDNA, and by weight contain about twice as much protein as DNA. The DNA-protein complex is called chromatin, and it is highly conserved in all eukaryotes.

1. Both histones and non-histones are involved in physical structure of the chromosome.2. Histones are abundant, small proteins with a net (+) charge. The five main types are H1, H2A,

H2B, H3 and H4. By weight, chromosomes have equal amounts of DNA and histones.3. Histones are highly conserved between species (H1 less than the others).4. Non-histone is a general name for other proteins associated with DNA. This is a big group, with

some structural proteins, and some that bind only transiently. Non-histone proteins vary widely, even in different cells from the same organism. Most have a net (-) charge, and bind by attaching to histones. HMG (high mobility group) proteins are a well-studied example of non-histone proteins.

5. Chromatin formation involves histones, and condenses the DNA so it will fit into the cell. Chromatin formation has two components:

a. Two molecules each of histones H2A, H2B, H3 and H4 associate to form a nucleosome core, and DNA wraps around it 1 3⁄4 times for a 7-fold condensation factor. Nucleosome cores are about 11 nm in diameter.

b. H1 serves as the linker histone, connecting nucleosomes to create chromatin with a diameter of 30 nm, for an additional 6-fold condensation. The exact mechanism used by H1 is unknown.

6. Chromatin is arranged in looped domains of DNA similar to those formed in prokaryotic chromosomes. Loops are anchored to the nuclear matrix at DNA sequences called MARs(matrix attachment regions). An average human chromosome has about 2,000 looped domains. Looped domains may be important in regulating transcription and replication.

13

07-10-29 Madl 13

Chromosome:• Chromatid• Telomere• Centromere• Histone

Gene:• strings• imprinting

Chromosome (2/12)


Eukaryotes have multiple linear chromosomes in a number characteristic of the species. Most have two versions of each chromosome, and so are diploid (2N).

a. Diploid cells are produced by haploid (N) gametes that fuse to form a zygote. The zygote then undergoes development, forming a new individual.

b. Examples of diploid organisms are humans (23 pairs) and Drosophila melanogaster (4 pairs). The yeast Saccharomyces cerevisiae is haploid (16 chromosomes).

Chromosome: Genetic material in cells is organized into chromosomes (literally “colored body”because it stains with biological dyes).

a. Prokaryotes generally have one circular chromosome.b. Eukaryotes generally have:

i. Linear chromosomes in their nuclei, with different species having different numbers of chromosomes.

ii. DNA in organelles (e.g., mitochondria and chloroplasts) that is usually a circular molecule.Chromatid: Paired chromosomes, before mitosis, the DNA chains duplicate to form new chromosome material. The duplicated chromosomes lie side by side = chromatid. During Mitosis = the process by which chromatids separate into chromosomes.Genes occur in pairs on homologous chromosomes, one from each parent;• Different effects of gene whether ♀ or ♂;• Genes modified during gametogenesis;• Gene imprinting: additional methyl groups added to DNA molecules;• Basic structure identical; in some diseases different expression (behavior) depending on parent of origin - hereditary disease as a result of imprinting;

14

07-10-29 Madl 14

From a multi-resolution view ….

Ch.No.1885·E6 bp

HGP @ UCSC, 2004

Chromosome (3/12)


First looked through a microscope. Later Fluorescence In Situ Hybridization produces chromosome bands. Genetic map grew to 5000 markers (places where distinctive variation occurs, like those used in DNA fingerprinting). The image shows Ch.No 18, with about 85 million bases. Order of the markers determined by studying family inheritance of variations. Studies also led to the identification of genes associated with some diseases:

• Huntington’s disease (HD), is a rare inherited neurological disorder affecting up to approximately 10 people per 100,000 people of Western European descent and 0.1 out of 100,000 in people of Asian and African descent. HD is caused by a trinucleotide repeat expansion in the Huntingtin (Htt) gene and is one of several polyglutamine (or PolyQ) diseases. This expansion produces an altered form of the Htt protein, mutant Huntingtin (mHtt), which results in neuronal cell death in select areas of the brain. Huntington's disease is a terminal illness. HD’s most obvious symptoms are abnormal body movements called chorea and a lack of coordination, but it also affects a number of mental abilities and some aspects of personality. These physical symptoms occur in a large range of ages,with a mean occurence a person's late forties/early fifties. If the age of onset is below 20 years then it is known as juvenile HD. As there is currently no proven cure, symptoms are managed with various medications and care methods.

• Duchenne muscular distrophy, • retinoblastoma, • Cystic Fibrosis and other genes in the 80’s.• Ochre is mouse Ch.No 5, yellow is mouse Ch.No 7

15

07-10-29 Madl 15

…. to a gene level cluster ….

HGP @ UCSC, 2004

Chromosome (4/12)


HD = Huntington’s disease gene. First success of RFLP (restriction fragment length polymorphism) mapping. Found linkage in 1983 before the first RFLP map was even constructed. Disease claimed Woody Guthrie. Nancy Wexler, whose mother had died of the disease, became director of the Huntington’s commission (congressional) and of NIH project. Collected family data in Venezuela. “Lucky Jim” Gusella found a link between HD and one of the first RFLP markers he tested. Took another 10 years to actually locate the gene. Takes seconds on the browser.

16

07-10-29 Madl 16

…. to the single gene level ….

HGP @ UCSC, 2004

Chromosome (5/12)


`

17

07-10-29 Madl 17

…. to the single exon level ….

HGP @ UCSC, 2004

Chromosome (6/12)


`

18

07-10-29 Madl 18

…. to the base-pair level ….

HGP @ UCSC, 2004

Chromosome (7/12)

caggcggactcagtggatctggccagctgtgacttgacaagcaggcggactcagtggatctagccagctgtgacttgacaag


19

07-10-29 Madl 19

Human Genome (HG):

Karyotype• 22 chromosomes• plus sex

X chromosomeY chromosome

Postlethwait & Hospon, 1995

Chromosome (8/12)


A karyotype shows the complete set of chromosomes in a cell (diploid). Metaphase chromosomes are used because they are easiest to see under the microscope after staining. The karyotype is species-specific.

a. The karyotype for a normal human male has 22 pairs of autosomes, and 1 each of X and Y; one sex has a matched pair (e.g., human females with XX) and the other has an unmatched pair (human male with XY). female (22+XX), male (22+XY), altogether 23 chromosome-pairs for a human being;

b. Human chromosomes are numbered from largest (1) to smallest (although 21 is actually smaller than 22).

c. Human chromosomes with similar morphologies are grouped (A through G).d. Staining produces bands on the chromosomes, allowing easier identification. G banding is an example.

i. Chromosomes are partially digested with proteolytic enzymes or treated with mild heat, and then stained with Giemsa stain. The dark bands produced are G bands.

ii. In humans, metaphase chromosomes show about 300 G bands, while about 2,000 can be distinguished in prophase.

iii. Drawings (ideograms) show the G banding pattern of human chromosomes.

20

07-10-29 Madl 20

Human Genome (HG):

• haploid (n)• diploid (2n)

Chromosome (9/12)


Chromosome pairs in diploid organisms are homologous chromosomes. One member of each pair (homolog) is inherited from each parent. Chromosomes that have different genes and do not pair are nonhomologous chromosomes.Eukaryotes have multiple linear chromosomes in a number characteristic of the species. Most have two versions of each chromosome, and so are diploid (2N).

a. Diploid cells are produced by haploid (N) gametes that fuse to form a zygote. The zygote then undergoes development, forming a new individual.

b. Examples of diploid organisms are humans (23 pairs) and Drosophila melanogaster (4 pairs). The yeast Saccharomyces cerevisiae is haploid (16 chromosomes).

c. Cells within multicellular organisms can be functionally divided into two major compartments (atembryogenesis): *Based on differentiation potencyGerm cells: totipotent (infinite proliferation potential) Ex. mammalian oocytes (40 years)Somatic cells: differentiated also include stem cells (multipotent);(stem cells can be activated by mitogenic signals to enter restricted number of cell divisions);

Animals and some plants have male and female cells with distinct chromosome sets, due to sex chromosomes. One sex has a matched pair (e.g., human females with XX) and the other has an unmatched pair (human male with XY). Autosomes are chromosomes other than sex chromosomes.

Chromosomes differ in size and morphology. Each has a constriction called a centromere that is used in segregation during mitosis and meiosis. The centromere location is useful for identifying chromosomes.

a. Metacentric means the centromere is approx. in the center, producing two equal arms.b. Submetacentric means one arm is somewhat longer than the other.c. Acrocentric have one long arm and a short stalk and often a bulb (satellite) as the other arm.d. Telocentric chromosomes have only one arm, because the centromere is at the end.

21

07-10-29 Madl 21

Human Genome (HG):

• Allele• Genotype• Phenotype• Epistasis

Chromosome (10/12)


In eukaryotes, chromosomes are enormously long, linear molecules. Each chromosome encompasses many genes, arranged linearly, and interspersed with stretches of DNA that do not code for anything.

• a locus (plural, loci) describes a precise location (site) on a chromosome. Since the chromosomes exist in pairs, genes are also paired;

• Allele: alternate forms of a gene can occupy the same locus (homo, hetero);• Recessive / dominant gene: recessive expressed only when homozygous; dominant can be homo-or hetero- or co-;

• Sex-linked gene: X, recessive, hemiGenes are arranged on linear chromosomes: Frequently, geneticists use the terms gene and loci interchangeably, because genes are small relative to chromosomes and seem to occupy pinpoint locations. We speak of loci having different alleles (polymorphic), or only one allele (monomorphic).

Phenotype vs. Genotype: An organism’s PHENOTYPE is its observable characteristics.An organism’s GENOTYPE is its genetic composition of alleles.An organism heterozygous for a recessive allele, such as albinism, would exhibit the dominant trait, yet would possess the heterozygous genotype.Do all loci have multiple alleles? No, only a small percentage of loci have multiple alleles, perhaps 1-5% or less, depending upon the species (again, this is a rough estimate, scientists don’t really know and gene-hunters frequently ignore variation).

Epistasis occurs when a gene at one locus alters the expression of a gene at another locus.

22

07-10-29 Madl 22

Human Genome (HG):

• 3·E9 base pairs;• 27·E3 genes (10% of HG);• 85% of them are known;• 15% are unknown (inactive);• of the 85% only 1/5 are

known what they accomplish

Chromosome (11/12)


The Human Genome is the sum total of all genes contained in a cell’s chromosomes: • 3·E9 pairs of DNA nucleotides• approx. 27,000 genes (humans and mice have about the same number of genes. But we are so

different from each other, how is this possible? One human gene can make many different proteins while a mouse gene can only make a few!

• Genes = 10% of human genome• Exons: parts of the DNA chain that code for specific proteins• Introns: the parts in-between the exons• Both exons and introns are transcribed but only the exons are translated (introns are removed

from mRNA before leaving nucleus)

There are a relatively small number of human genes, less than 30,000, but they have a complex architecture that we are only beginning to understand and appreciate.

• We know where 85% of genes are in the sequence.• We don’t know where the other 15% are because we haven’t seen them “on” (they may only be

expressed during fetal development).• We only know what about 20% of our genes do so far.

So it is relatively easy to locate genes in the genome, but it is hard to figure out what they do.

23

07-10-29 Madl 23

Chromosome (11/12)


Human Genome (HG):

…. but there are still some challenges: ….

• there are some 100·E3 proteins,hence: 1 gene ≠ 1 protein!

• how to pack this into the nucleus?• why are there only 27·E3 genes?

i) a mouse has about the same, i) DNA of apes & humans = 98%

A typical eukaryotic cell is about 25 µm in diameter, but this average hides a large range of sizes. The smallest cell is a type of green algae, Ostreococcus tauri, with a diameter of only 0.8 micrometers, about the size of a typical bacterium. The human sperm is about 4 µm wide, but 40 µmlong, while the egg is about 100 µm in diameter. Single neurons can be a meter or more in length. While schematic diagrams often picture cells as simple cubes or spheres, most cells have highly individual shapes. Human red blood cells are flattened disks indented on either side; muscle cells are highly elongated; neurons are long and thin with many branches on each end; and white blood cellsconstantly change their shapes as they crawl through the body.The nucleus is the largest organelle in the cell (approx. 10µm in diameter).

http://www.bookrags.com/research/cell-eukaryotic-gen-01/

But you know something, scientists.... scientists who are the ultimate reductionists are finding evidence of our incredible connections. When they begin to explore the world of DNA (the genetic material) and compare the DNA of human beings with the DNA of other life forms, they find that aboriginal people are right!. If we compare a human DNA with the DNA of the great apes, the gorillas, the orang-utans, and chimpanzees, 98% of our DNA is identical. They are our closest relatives. And if you compare our DNA with the DNA of a snake, of an insect, of a fish, or of a bird, or a tree, vast tracks of our DNA are still identical. We are all related, because we are all descendents from one original cell some 3 and a half billion years ago. And if you begin to recognize that other species are our relatives, our kin, than as Willson and Ehrlich point out, surely the goodness, we would treat them with greater respect and care than if we simply look at them as commodities or resources.

D. Suzuki - speaking at the Australian Museum Society in Sydney AUS - 1992 (wisdom of the elders)

24

07-10-29 Madl 24

Chromosome (12/12)


…. Hence ….• each gene give rise to several proteins by alternative splicing;• each protein is modified in multiple ways by phosphorylation, methylation, acetylation, glycosylation etc.

• these modified proteins can further take part in different protein complexes.

Yeast (clone & 5 - 6·E3 genes) Human: (~ 27·E3 genes for ~200 cell types)

Yeast: no differentiation - clonal, repetitive “immortal”5 - 6·E3 genes for metabolic and cell division processes

Human: ~27,000 genes for ~200 cell types

Non-protein RNA. “Junk genes” (Steve Jones)? 50% of human genome - “transposons”Internalised viruses (Villareal)

Further observations:1. Genome size vs. gene numbers2. Coding sequences vs. noncoding & repeatitive sequences

(yeast: almost no noncoding; human: 96% noncoding+repeats)3. Larger transcriptional units in higher eukaryotes

(30-200 kb for human)Factors contributing to different epigenetic regulatory pathways:1. Larger genomic size, more extensive epigenetic silencing

mechanisms2. Multicellularity: how to maintain multiple cell types (cellular

identity)

25

07-10-29 Madl 25

Genetics on a Cellular Level

Intro Nucleus Organism PopulationCell

26

07-10-29 Madl 26

DNA Replication during the 1st

meiotic division:

• DNA unwinding;• Strand separation;•Complementary

copy

Russel, Gene Control, 200?

Replication (1/6)


1. Replication starts at origin of replication, with denaturation to expose the bases and create a bi-directional replication bubble. E. coli has one origin, oriC, which has a minimal sequence of about 245 bp required for initiation.

2. Events in initiating DNA synthesis, derived from in vitro studies:a. Gyrase (a type of topoisomerase) relaxes supercoils in the region.b. Initiator proteins attach.c. DNA helicase (from dnaB) binds initiator proteins on the DNA, and denatures the region

using ATP as an energy source.d. DNA primase (from dnaG) binds helicase to form a primosome, which synthesizes a short (11

6 1 nt) RNA primer. Primers begin with two purines, typically AG.

27

07-10-29 Madl 27


meiotic division:

• leading strand;• lagging strand;


Replication (2/6)


1. When DNA denatures at the oriC, replication forks are formed. DNA replication is usually bi-directional, but will consider events at just one replication fork:

a. Single-strand DNA-binding proteins (SSBs) bind the ssDNA formed by helicase, preventing reannealing.

b. Primase synthesizes a primer on each template strand.c. DNA polymerase III adds nucleotides to the 3’ end of the primer, synthesizing a new strand

complementary to the template, and displacing the SSBs. DNA is made in opposite directions on the two template strands.

d. New strand made 5’ → 3’ in same direction as movement of the replication fork is leading strand, while new strand made in opposite direction is lagging strand. Leading strand needs only one primer, while lagging needs a series of primers.

2. Helicase denaturing DNA causes tighter winding in other parts of the circular chromosome. Gyrase relieves this tension.

3. Leading strand is synthesized continuously, while lagging strand is synthesized discontinuously, in the form of Okazaki fragments. DNA replication is therefore semidiscontinuous.

4. Each fragment requires a primer to begin, and is extended by DNA polymerase III.5. Okazaki data show that these fragments are gradually joined together to make a full-length

dsDNA chromosome. DNA polymerase I uses the 3’-OH of the adjacent DNA fragment as a primer, and simultaneously removes the RNA primer while resynthesizing the primer region in the form of DNA. The nick remaining between the two fragments is sealed with DNA ligase.

28

07-10-29 Madl 28


meiotic division:

• leading strand;• lagging strand;


Replication (3/6)


DNAi ANIM

ATION

DNA-mole

cule/

replic

ation

1. When DNA denatures at the oriC, replication forks are formed. DNA replication is usually bi-directional, but will consider events at just one replication fork:

a. Single-strand DNA-binding proteins (SSBs) bind the ssDNA formed by helicase, preventing reannealing.

b. Primase synthesizes a primer on each template strand.c. DNA polymerase III adds nucleotides to the 3’ end of the primer, synthesizing a new strand

complementary to the template, and displacing the SSBs. DNA is made in opposite directions on the two template strands.

d. New strand made 5’ → 3’ in same direction as movement of the replication fork is leading strand, while new strand made in opposite direction is lagging strand. Leading strand needs only one primer, while lagging needs a series of primers.

2. Helicase denaturing DNA causes tighter winding in other parts of the circular chromosome. Gyrase relieves this tension.

3. Leading strand is synthesized continuously, while lagging strand is synthesized discontinuously, in the form of Okazaki fragments. DNA replication is therefore semidiscontinuous.

4. Each fragment requires a primer to begin, and is extended by DNA polymerase III.5. Okazaki data show that these fragments are gradually joined together to make a full-length dsDNA

chromosome. DNA polymerase I uses the 3’-OH of the adjacent DNA fragment as a primer, and simultaneously removes the RNA primer while resynthesizing the primer region in the form of DNA. The nick remaining between the two fragments is sealed with DNA ligase.

29

07-10-29 Madl 29


meiotic division:

• replication forkof circular DNA;


Replication (4/6)


Replication fork and Rolling circle replication:1. Another model for replication is rolling circle, which is used by several bacteriophages, including

ΦX174 (after a complement is made for the genomic ssDNA) and λ (after circularization by base pairing between the “sticky” ssDNA cos ends)

2. Rolling circle replication begins with a nick (single-stranded break) at the origin of replication. The 5’ end is displaced from the strand, and the 3’ end acts as a primer for DNA polymerase III, which synthesizes a continuous strand using the intact DNA molecule as a template.

3. The 5’ end continues to be displaced as the circle “rolls”, and is protected by SSBs until discontinuous DNA synthesis makes it a dsDNA again.

4. A DNA molecule many genomes in length can be made by rolling circle replication. During viral assembly it is cut into individual viral chromosomes and packaged into phage head.

5. Bacteriophage λ, regardless of whether entering the lytic or lysogenic pathway, circularizes its chromosome immediately after infection.

a. In a lysogenic infection, the circular DNA integrated into a specific site in the E. colichromosome by a crossover event.

b. In a lytic infection, rolling circle replication produces a long concatamer of λ DNA, and the a viral endonuclease (product of the ter gene) recognize the cos sites and makes the staggered cuts that used to assemble new virus particles.

30

07-10-29 Madl 30


meiotic division:

• Telomere;


Replication (5/6)


1. When the ends of chromosomes are replicated and the primers are removed from the 5’ ends, there is no adjacent DNA strand to serve as a primer, and so a single-stranded region is left at the 5’end of the new strand. If the gap is not addressed, chromosomes would become shorter with each round of replication.

2. Most eukaryotic chromosomes have short, species-specific sequences tandemly repeated at their telomeres. Blackburn and Greider have shown that chromosome lengths are maintained by telomerase, which adds telomere repeats without using the cell’s regular replication machinery.

3. In the ciliate Tetrahymena, the telomere repeat sequence is 5’-TTGGGG-3’. Telomerase, an enzyme containing both protein and RNA, binds to the terminal telomere repeat when it is single-stranded, synthesizing a 3-nt sequence, TTG. The 3’ end of the telomerase RNA contains the sequence AAC, which binds the TTG positioning telomerase to complete its synthesis of the TTGGGG telomere repeat. Additional rounds of telomerase activity lengthen the chromosome by adding telomere repeats.

4. After telomerase adds telomere sequences, chromosomal replication proceeds in the usual way. Any shortening of the chromosome ends is compensated by the addition of the telomere repeats.

5. Telomere length may vary, but organisms and cell types have characteristic telomere lengths. Mutants affecting telomere length have been identified, and data indicate that telomere length is genetically controlled. Shortening of telomeres eventually leads to cell death, and this may be a factor in the regulation of normal cell death.

31

07-10-29 Madl 31


meiotic division:

• short: G-T or A-C mismatch

• long: several kb longi) detecting erroneous site;i) determining faulty strand;i) correcting the error;


Replication (6/6)


Mismatch repair is a system for recognizing and repairing the erroneous insertion, deletion and mis-incorporation of bases that can arise during DNA replication and recombination, as-well as repairing some forms of DNA damage [1]. The fact that the damage detection and repair systems are as complex as the replication machinery itself highlights the importance evolution has attached to DNA fidelity.Examples of mismatched bases include a G/T or A/C pairing. The damage is repaired by excising the wrongly incorporated base and replacing it with the correct nucleotide. Usually, this involves more than just the mismatched nucleotide itself, and can lead to the removal of significant tracts of DNA.There are two types of mismatch repair; long patch and short patch. Long patch can repair all types of mismatches (although it is primarily replication associated) and can excise tracts up-to a fewkilobases long. Short patch repair handles only specific mismatches caused by damage to the genome, and removes lengths of around 10 nucleotides. Successful mismatch repair requires the error-free execution of three events:

1. Detection of a single mismatch, of which there are eight kinds, in the newly synthesised DNA.2. Determining which of the two base pairs is incorrect.3. Correcting the error by excision repair.

Mismatch repair is strand-specific. During DNA synthesis only the newly synthesised (progeny) strand will include errors, and replacing a base in the parental strand would actually introduce an error. The mismatch repair machinery has a number of cues which distinguish the newly synthesisedstrand from the template (parental). In gram-negative bacteria transient hemimethylationdistinguishes the strands (the parental is methylated and daughter is not). In other prokaryotes and eukaryotes the exact mechanism is not clear.

Source: Iyer RR, Pluciennik A, Burdett V, Modrich PL. DNA mismatch repair: functions and mechanisms. Chemical Reviews, Vol. 106, No. 2, pages 302-23 (2006).

32

07-10-29 Madl 32

The Central Dogma:

• DNA↓ (transcription)

• RNA (mRNA, tRNA, rRNA)↓ (translation)

• Proteins↓ (polypeptide-AAA)

• Enzymes

Transcription (1/6)


A protein is specified by a gene• Transcribed into mRNA;• Translated through tRNA and cytoplasmic ribosomes into protein;

The Central Dogma in Protein Synthesis:• Amino acids:• Messenger RNA (mRNA): • Transfer RNA (tRNA):• Protein: • Enzymes:

33

07-10-29 Madl 33

From DNA to pre-mRNA:


Transcription (2/6)


Prokaryotes contain only one RNA polymerase, which transcribes all RNA for the cell. Eukaryotes have three different polymerases, each transcribing a different class of RNA. Processing of transcripts is also more complex in eukaryotes. Production of proteins requires two steps:Step 1: Transcription involves an enzyme (RNA polymerase) making an RNA copy of part of one DNA strand. There are four main classes of RNA:

i. Messenger RNAs (mRNA), which specify the amino acid sequence of a protein by using codons of the genetic code.

ii. Transfer RNAs (tRNA).iii. Ribosomal RNAs (rRNA).iv. Small nuclear RNAs (snRNA), found only in eukaryotes.

Step 2: Translation converts the information in mRNA into the amino acid sequence of a protein using ribosomes, large complexes of rRNAs and proteins.

1.Eukaryotes contain three different RNA polymerases:a. RNA polymerase I, located in the nucleolus, synthesizes three of the four rRNAs found in

ribosomes: three of the RNAs (the 28S, 18S, and 5.8S rRNA molecules).b. RNA polymerase II, located in the nucleoplasm, synthesizes messenger RNAs (mRNAs;

translated to produce polypeptides) and some small nuclear RNAs (snRNAs), some of which are involved in RNA processing events.

c. RNA polymerase III, also located in the nucleoplasm, synthesizes the transfer RNAs(tRNAs), which bring amino acids to the ribosome; 5S rRNA, the fourth rRNA molecule found in each ribosome; and the small nuclear RNAs (snRNAs) not made by RNApolymerase II.

2. Eukaryotic RNA polymerases are harder to study than the prokaryotic counterpart, because they are present at low concentrations. Inhibition by α-amanitin is a useful research tool, since RNA pol II is very sensitive, RNA pol III less so and RNA pol I is relatively insensitive.3. Basal transcription factors (TFs) are needed for initiation by all 3 RNA polymerases.

a. Each TF works with only one type of RNA polymerase.b. TFs are numbered to match their corresponding RNA polymerase, and assigned a letter in

the order of their discovery (e.g., TFIID was the fourth TF discovered that works with RNA polymerase II).

34

07-10-29 Madl 34


• rRNA (Ribosomal)• tRNA (Transcription)• snRNA (small nuclear)

Transcription (3/6)


Step 2: Translation converts the information in mRNA into the amino acid sequence of a protein using ribosomes, large complexes of rRNAs and proteins.

Ribosome: the organelle on which translation of mRNA (Protein synthesis) takes place; the large subunit is red, the small subunit is yellow; Ribosomes are the catalyst for protein synthesis, facilitating binding of charged tRNAs to the mRNA so that peptide bonds can form. A cell contains thousands of ribosomes.

• Ribosomes in both prokaryotes and eukaryotes consist of two subunits of unequal size (large and small), each with at least one rRNA and many ribosomal proteins.

• Eukaryotic ribosomes are larger and more complex than prokaryotic ones, and vary in size and composition among organisms. Mammalian ribosomes are an example; they are 80S, with 60S and 40S subunits.

• DNA regions that encode rRNA are called ribosomal DNA (rDNA) or rRNA transcription units. The rRNA genes of most species do not contain introns.

• Splicing occurs in the nucleus, mediated by spliceosomes consisting of small nuclearribonucleoprotein particles (snRNPs) bound to the pre-mRNA. The snRNPs consist ofsnRNAs associated with proteins.

1. When protein-coding genes are first transcribed by RNA pol II, the product is a precursor-mRNA (pre-mRNA). The pre-mRNA will be modified to produce a mature mRNA.

2. Results of promoter analysis reveal two types of elements:a. Basal promoter elements are located near the transcription start site. Examples include:

i. The TATA box (aka TATA element or Goldberg-Hogness box) at -25; its full sequence is TATAAAA. This element aids in local DNA denaturation, and sets the start point for transcription.

ii. The initiator element (Inr), a pyramiding-rich sequence near the transcription start site.b. Promoter proximal elements are further upstream from the start site, at positions between -50

and -200. These elements generally function in either orientation. Examples include:i. The CAAT box, located at about -75.ii. The GC box, consensus sequence GGGCGG, located at about -90.

35

07-10-29 Madl 35


• TATA box (can be de-/-activated by histones)

• Initiation • RNA elongation


Transcription (4/6)


Histones can also bind to the TATA box so that the promotor site on the DNA is hidden or exposed

1. When protein-coding genes are first transcribed by RNA pol II, the product is a precursor-mRNA (pre-mRNA). The pre-mRNA will be modified to produce a mature mRNA.

2. Results of promoter analysis reveal two types of elements:a. Basal promoter elements are located near the transcription start site. Examples include:

i. The TATA box (aka TATA element or Goldberg-Hogness box) at -25; its full sequence is TATAAAA. This element aids in local DNA denaturation, and sets the start point for transcription.

ii. The initiator element (Inr), a pyramiding-rich sequence near the transcription start site.b. Promoter proximal elements are further upstream from the start site, at positions between -50 and -200.

These elements generally function in either orientation. Examples include:i. The CAAT box, located at about -75.ii. The GC box, consensus sequence GGGCGG, located at about -90.

36

07-10-29 Madl 36


Transcription-Initiation Complex

•Transcription of the gene by RNA polymerase II.

•Addition of the 3’-5’cap.

•Addition of the poly(A) tail.

Transcription (5/6)


DNAi ANIM

ATION

DNA-mole

cule/

transcr

iption

Transcription-Initiation Complex:• The newly made 5’ end of the mRNA is modified by 5’ capping. A capping enzyme adds a

guanine, usually 7-methyl guanosine (m7G), to the 5’ end using a 5’-to-5’ linkage. Sugars of the 2 adjacent nt are also methylated. The cap is used for ribosome binding to the mRNA during translation initiation.

• The 3’ end of the pre-RNA has 50–250 adenines added enzymatically to form a poly(A) tail. The poly(A) tail is important in mRNA stability, and also plays a role in transcription termination, since RNA polymerase II does not rely directly on a signal in the DNA.

37

07-10-29 Madl 37

From DNA, pre-mRNA to mRNA:

Splicing to remove•Introns (non-coding)and to maintain• Exons (coding)


Transcription (6/6)


When protein-coding genes are first transcribed by RNA pol II, the product is a precursor-mRNA(pre-mRNA). The pre-mRNA will be modified to produce a mature mRNA.

Only some of the genes in a cell are active at any given time, and activity also varies by tissue type and developmental stage. Regulation of gene expression is not completely understood, but it has been shown to involve an array of controlling signals.

a. Jacob and Monod (1961) proposed the operon model to explain prokaryotic gene regulation, showing that a genetic switch is used to control production of the enzymes needed to metabolize lactose. Similar systems control many genes in bacteria and their viruses.

b. Genetic switches used in eukaryotes are different and more complex, with much remaining to be learned about their function (EPIGENETIC).

Introns vs. Exons:1. Removal of introns is necessary for mRNA maturation, as hnRNA (Heteronuclear RNA) becomes

functional mRNA.2. in Philip leder’s lab (1978) it was shown that the mouse β-globin pre-mRNA (part of the cell’s

hnRNA) is colinear with the gene that encodes it, while the mature β-globin mRNA is horter than the gene. The missing RNA was an intron that was removed during RNA processing.

3. Introns are found in most eukaryotic genes that encode proteins, and have also been found in bacteriophage genes.

38

07-10-29 Madl 38

From DNA to …. :

• rRNA (Ribosomal)• tRNA (Transcription)• snRNA (small nuclear)


Translation (1/13)


1. Promoter sequences for 5S rRNA and tRNA genes are typically within the sequences that will be transcribed, hence internal control region (ICR). Promoters for the snRNA genes transcribed by RNA pol III are typically upstream of the genes.

2. Transcription initiation for 5S rRNA and tRNAs requires binding of TFIIIs to the ICR, allowing RNA polymerase III to bind.

a. The 5S rDNA has two ICR domains, boxA and boxC.b. The tDNA has two ICR domains, boxA and boxB.

3. The ICRs interact with transcription factors TFIIIA, TFIIIB and TFIIIC. Formation of the transcription complex on 5S rDNA illustrates this interaction.

a. TFIIIA is bound to boxC, TFIIIC can bind to boxA.b. When TFIIIA is bound to boxC, TFIIIC can bind to boxA.c. TFIIIB then binds to TFIIIA and TFIIIC (not to the DNA directly).d. TFIIIB functions as a transcription initiation factor by positioning RNA polymerase III

correctly on the gene.e. RNA polymerase III then begins transcription 50 bp upstream from boxA, at the beginning of

the gene.f. Once the transcription factors are positioned on the 5S rDNA, they initiate successive rounds

of transcription without dissociating from the DNA.4. Transcription termination for the 5S rRNA and tRNA genes uses simple sequences at the 3’ end of

the genes.5. Transcription of 5S rDNA produces a mature 5S rRNA, and no sequences need to be removed.6. Transcription of tRNA genes produces a pre-tRNA with extra sequences at each end, and introns

in the tRNAs for certain amino acids. If present, introns are usually found just 3’ to the anticodon, and in many cases the anticodon pairs with the intron in the pre-tRNA. Introns are removed by a specific endonuclease, and splicing is completed by RNA ligase.

a. The tRNAs (75-90 nt), which occur in repeated copies in the eukaryotic genome.i. Each tRNA has a different sequence.ii. All tRNAs have CCA (added posttranscriptionally) at their 3’ ends.iii. Extensive chemical modifications are performed on all tRNAs after transcription.iv. All tRNAs can be shown in a cloverleaf structure, with complementary base pairing

between regions to form four stems and loops. Loop II contains the anticodon used to recognize mRNA codons during translation. Folded tRNAs resemble an upside-down “L”.

b. Some snRNAs (the others are transcribed by RNA polymerase II).

39

07-10-29 Madl 39

From mRNA to AA:

• Common to all AA• 20 Aminoacids (AA)

Translation (2/13)


4. There are 20 amino acids used in biological proteins. They are divided into subgroups according to the properties of their R groups (acidic, basic, neutral and polar, or neutral and nonpolar).

5. Polypeptides are chains of amino acids joined by covalent peptide bonds. A peptide bond forms between the carboxyl group of 1 amino acid, and the amino group of another.

40

07-10-29 Madl 40

From mRNA to AA:

• mRNA triplets assigning for Aminoacids (AA)


Translation (3/13)


Production of proteins requires two steps:Step 2: Translation converts the information in mRNA into the amino acid sequence of a protein using ribosomes, large complexes of rRNAs and proteins.

1. How many nucleotides are needed to specify one amino acid? A one-letter code could specify four amino acids; two-letters specify 16 (4 X 4). To accommodate 20, at least three letters are needed.2. Characteristics of the genetic code:

a. It is a triplet code. Each three-nucleotide codon in the mRNA specifies 1 amino in the polypeptide.

b. It is comma free. The mRNA is read continuously, three bases at a time, without skipping any bases.

c. It is non-overlapping. Each nucleotide is part of only one codon, and is read only once during translation.

d. It is almost universal. In nearly all organisms studied, most codons have the same amino acid meaning. Examples of minor code differences include the protozoan Tetrahymena and mitochondria of some organisms.

e. It is degenerate. Of 20 amino acids, 18 are encoded by more than one codon. Met (AUG) and Trp (UGG) are the exceptions; all other amino acids correspond to a set of two or more codons. Codon sets often show a pattern in their sequences; variation at the third position is most common.

f. The code has start and stop signals. AUG is the usual start signal for protein synthesis. Stop signals are codons with no corresponding tRNA, the nonsense or chain-terminating codons. There are generally three stop codons: UAG (amber), UAA (ochre) and UGA (opal).

g. Wobble occurs in the anticodon. The 3rd base in the codon is able to base-pair less specifically, because it is less constrained three-dimensionally. It wobbles, allowing a tRNA with base modification of its anticodon (e.g., the purine inosine) to recognize up to three different codons.

41

07-10-29 Madl 41

From AA-sequence to polypeptides:

• initiation (start) codon

• termination (stop) codonUAG (amber), UAA (ochre) and UGA (opal).


Translation (4/13)


1. Protein synthesis begins with fMet-tRNA in the P site of the ribosome. The next charged tRNAapproaches the ribosome bound to EF-Tu-GTP. When the charged tRNA hydrogen bonds with the codon in the ribosome’s A site, hydrolysis of GTP releases EF-Tu-GDP.

2. EF-Tu is recycled with assistance from EF-Ts, which removes the GDP and replaces it with GTP, preparing EF-Tu-GTP to escort another aminoacyl tRNA to the ribosome.

3. Next, the initiator tRNA binds the AUG to which the 30S subunit is bound. AUG universally encodes methionine. Newly made proteins begin with Met, which is often subsequently removed.

a. Initiator methionine in prokaryotes is formylmethionine (fMet). It is carried by a specific tRNA (with the anticodon 5’r-CAU-3’r).

b. The tRNA first binds a methionine, and then transformylase attaches a formyl group to the methionine, making fMet-tRNA.fMET (a charged initiator tRNA).

c. Methionines at sites other than the beginning of a polypeptide are inserted by tRNA.Met (a different tRNA), which is charged by the same aminoacyl-tRNA synthetase as tRNA.fMet.

4. When Met-tRNA.fMet binds the 30S-mRNA complex, IF3 is released and the 50S ribosomal subunit binds the complex. GTP is hydrolysed, and IF1 and IF2 are relased. The result is a 70S initiation complex consisting of (Figure 6.14):

a. mRNA.b. 70S ribosome (30S and 50S subunits) with a vacant A site.c. fMet-tRNA in the ribosome’s P site.

42

07-10-29 Madl 42


• merging (AA) – attachment site of tRNA (w/n Ribosome)


Translation (5/13)


6. Polypeptides are unbranched, and have a free amino group at one end (the N terminus) and a carboxyl group at the other (the C terminus). The N-terminal end defines the beginning of the polypeptide.

43

07-10-29 Madl 43


• stop codon


Translation (6/13)


DNAi ANIM

ATION

DNA-mole

cule/

transla

tion

44

07-10-29 Madl 44


• in-situ observation

Madigan, Martinko and Parker, 1999

Translation (7/13)


45

07-10-29 Madl 45

From gene to polypeptides:

• Prokaryote

• Eukaryote


Translation (8/12)


1. Eukaryotes and prokaryotes produce mRNAs somewhat differently.a. Prokaryotes use the RNA transcript as mRNA without modification. Transcription and

translation are coupled in the cytoplasm. Messages may be polycistronic.b. Eukaryotes modify pre-RNA into mRNA by RNA processing. The processed mRNA migrates

from nucleus to cytoplasm before translation. Messages are always monocistronic.2. Eukaryotic pre-RNAs often have introns (intervening sequences) between the exons (expressed

sequences) that are removed during RNA processing. Introns were discovered in 1977 by Richard Roberts, Philip Sharp and Susan Berger.

46

07-10-29 Madl 46

From gene to polypeptides:

• Prokaryote

• Eukaryote

….

Translation (9/13)


47

07-10-29 Madl 47

From polypeptides to protein:

• Primary structure

• Secondary structure

• Tertiary structure

• Quaternary structure


Translation (10/13)


• Proteins have up to four levels of organization:I. Primary structure is the amino acid sequence of the polypeptide. This is determined by the

nucleotide sequence of the corresponding gene. II. Secondary structure is folding and twisting of regions within a polypeptide, resulting from

electrostatic attractions and/or hydrogen bonding. Common examples are a-helix and b-pleated sheet.

III. Tertiary structure is the three-dimensional shape of a single polypeptide chain, often called its conformation. Tertiary structure arises from interactions between R groups on the amino acids of the polypeptide, and thus relates to primary structure.

IV. Quaternary structure occurs in multi-subunit proteins, as a result of the association of polypeptide chains. Hemoglobin is an example, with two 141-amino-acid a polypeptides, and two 146-amino-acid β polypeptides (each associated with a heme group).

• More than amino acid sequence alone determines the folding of a polypeptide into a functional protein. Cell biology experiments show that proteins in the molecular chaperone family assist other proteins in folding.

48

07-10-29 Madl 48

Protein release:

• Rough ER (site of synthesis)

• Golgi (packing & transport)

• Vesicles (release through plasma membrane)


Translation (11/13)


1. Localization of the new protein results from signal (leader) sequences in the polypeptide.2. In eukaryotes, proteins synthesized on the rough ER (endoplasmic reticulum) are glycosylated

and then transported in vesicles to the Golgi apparatus. The Golgi sorts proteins based on their signals, and sends them to their destinations.

a. The required signal sequence for a protein to enter the ER is 15–30 N-terminal amino acids. b. As the signal sequence is produced by translation, it is bound by a signal recognition

particle (SRP) composed of RNA and protein.c. The SRP suspends translation until the complex (containing nascent protein, ribosome,

mRNA and SRP) binds a docking protein on the ER membrane.d. When the complex binds the docking protein, the signal sequence is inserted into the

membrane, SRP is released, and translation resumes. The growing polypeptide is inserted through the membrane into the ER, an example of cotranslational transport.

e. In the ER cisternal space, the signal sequence is removed by signal peptidase and the protein is usually glycosylated.

f. Proteins destined for other organelles are translated completely, and then specific amino acid sequences direct their transport into the appropriate organelle.

49

07-10-29 Madl 49

Summary:


Translation (12/13)


Protein Synthesis in a nut shell: 1. DNA replication, transcription and translation proceed rapidly in a hair follicle.2. In DNA replication DNA polymerase copies DNA strands using nucleotides that diffuse in and form base pairs with the DNA.3. In transcription, RNA polymerase copies a single strand of DNA into messenger RNA (mRNA).4. Newly made mRNA moves through a nuclear pore into the cell’s cytoplasm.5. In translation, at ribosomes, bonds form between amino acids (AA) which are alligned by tRNAs according to the nucleotide sequence in mRNA. The joined AA-sequence form a polypeptide.6. The main polypeptide synthesized in a hair follicle cell forms the protein keratin which makes long fibers.7. The fibers of keratin are about all that is left when the hair follicle cells die and become the hair.

50

07-10-29 Madl 50

Reverse Transcriptase –breaking

The Central Dogma :

• RNA dependent DNA polymerase – trascribessingle stranded RNA into single stranded DNA;

• telomerase rTST• viral rTST (e.g. HIV)

Wikipedia, 2007

Translation (13/13)


In biochemistry, a reverse transcriptase, also known as RNA-dependent DNA polymerase, is a DNApolymerase enzyme that transcribes single-stranded RNA into single-stranded DNA. Normal transcription involves the synthesis of RNA from DNA, hence reverse transcription is the reverse of this.Reverse transcriptase was discovered by Howard Temin at the University of Wisconsin-Madison, and independently by David Baltimore in 1970. The two shared the 1975 Nobel Prize in Physiology or Medicine with Renato Dulbecco for their discovery.

Commonly used examples of reverse transcriptases include:• HIV-1 reverse transcriptase from the human immunodeficiency virus type 1 (PDB 1HMV).• M-MLV reverse transcriptase from the Moloney murine leukemia virus. • AMV reverse transcriptase from the avian myeloblastosis virus.• Telomerase reverse transcriptase that maintains the telomeres of eukaryotic chromosomes

Conversion of the HIV RNA genome into DNA by viral reverse transcriptase (RT) is a key step in the early stages of the HIV life cycle, making the enzyme an ideal target for antiretroviral therapy. In the animation above, RT inhibitors are colored in orange. Two classes of reverse transcriptaseinhibitors are commercially available: nucleos(t)ide reverse transcriptase inhibitors (NRTI's) and non-nucleoside reverse transcriptase inhibitors (NNRTI's). The NRTI's were the first antiretroviralsto be made available for the treatment of HIV. Based on their similarity to the natural nucleotide building blocks of DNA and RNA, NRTI's are incorporated into the growing DNA strand and terminate further strand elongation. On the other hand, NNRTI's are a chemically diverse class of drugs that bind to the same pocket near the active site of RT and as such inhibit the enzyme.

Source: http://en.wikipedia.org/wiki/Reverse_Transcriptasehttp://www.tibotec.com/bgdisplay.jhtml?itemname=HIV_discovery&product=none&s=2Jochmans D.,Deval J., Kesteleyn B., VanMarck H., Bettens E., DeBaere I, Dehertogh P.,

Ivens T., VanGinderen M., VanSchoubroeck B., Ehteshami M., Wigerinck P., Götte M., Hertogs K.; 2006; Indolopyridones Inhibit Human Immunodeficiency Virus Reverse Transcriptase with a

Novel Mechanism of Action; Journal of Virology, Vol. 80, No. 24, p.12283-12292,

0

07-10-29 Madl 0

Cell Cycle

• Mitosis (somatic cells)

• Meiosis (gametes)


Mitosis (1/3)


Cell Cycle: Both unicellular and multicellular eukaryotes show a continous cell cycle, with growth, mitosis and cell division.

a. The cycle of somatic cells consists of:i. Mitosis.ii. Interphase, composed of:

(1) Gap 1 (G1) when the cell prepares for chromosome replication.(2) Synthesis (S) when DNA replicates and new chromosomes are formed.(3) Gap 2 (G2) when the cell prepares for mitosis and cell division.

b. Relative time in each phase varies among cell types, with duration of G1 generally the deciding factor. Some cells exit G1 and enter a nondividing state called G0.

c. Interphase chromosomes are elongated and hard to see with light microscopy. Sister chromatidsare held together by replicated but unseparated centromeres. The chromatids become visible in prophase and metaphase of mitosis. When the centromeres separate, they become daughter chromosomes

• Mitosis: somatic cells (PMAT): daughter cells have the same number of chromosomes as the parent cell.

• Meiosis: gametogenesis (1st and 2nd div): number of chromosomes reduced by half. Occur in gonads (testes & ovaries). Precursor cells or germ cells; mature into

i. Gametes: sperm, ova; in gametogenesisi. Spermatogenesis, oogenesis;

1

07-10-29 Madl 1

Mitosis:

• Interphase: duplication of DNA; • Prophase: centriole migration;• Metaphase: chromosome line-up; • Anaphase: chromatids separation;• Telophase: cytoplasmic division;

Mitosis (2/3)


Mitosis: somatic cells (PMAT): Daughter cells have the same number of chromosomes as the parent cell.

• Interphase: DNA duplication to form chromatids just before mitosis;• Prophase: chromosomes condense, centriole replication & migration, mitotic spindle forms;

nuclear envelope breaks down; nucleoli in nucleus cease to be discrete areas; Kinetochores form on the centromeres and become attached to kinetochore microtubules;

• Metaphase: chromosomes line up in centre, chromatids still joined at centromere; nuclear envelope completely gone; kinetochore microtubules orient the chromosomes with their centromeres in a plane between the spindle poles, the metaphase plate; a protein scaffold causes the chromosomes to reach a highly condensed state;

• Anaphase: chromatids separate (disjunction) and progeny chromosomes move toward opposite poles by kinetochore microtubules; shape of the chromosomes moving toward the poles is defined by their centromere locations; cytokinesis usually begins near the end of anaphase.

• Telophase starts when migration of progeny chromosomes is completed; chromosomes begin to uncoil and form interphase chromosomes; cytoplasm divides (nuclear envelope forms around each chromosome group); spindle microtubules disappear; nucleoli reform; nuclear division is complete. Cytokinesis is division of the cytoplasm, compartmentalizing the new nuclei into separate daughter cells.

2

07-10-29 Madl 2

Mitosis:

• Cytokinesis during Telophase;

Mitosis (3/3)


Mitosis: somatic cells (PMAT): Daughter cells have the same number of chromosomes as the parent cell.

• Telophase starts when migration of progeny chromosomes is completed; chromosomes begin to uncoil and form interphase chromosomes; cytoplasm divides (nuclear envelope forms around each chromosome group); spindle microtubules disappear; nucleoli reform; nuclear division is complete. Cytokinesis is division of the cytoplasm, compartmentalizing the new nuclei into separate progeny cells.

Gene segregation in mitosis is highly ordered, so that each new cell receives a complete set of chromosomes (pairs in a diploid cell, and one of each type in a haploid cell).

3

07-10-29 Madl 3

Meiosis:1st meiotic division: duplication of chromosomes;

• Prophase of meiosis: synapse & crossover.

• Metaphase: paired arrangement of chromosomes;

•Anaphase: migration of homologous chromosomes;

•Telophase: new progeny cells; 2nd meiotic division: halving of chromosomes

Meiosis (1/7)


Meiosis is two successive divisions of a diploid nucleus (2n) after only one DNA replication cycle. The result is haploid (n) gametes (animals) or meiospores (plants). The two rounds of division in meiosis are meiosis I and meiosis II, each with a series of stages. Cytokinesis usually accompanies meiosis, producing four haploid cells from a single diploid cell.

First meiotic division: duplication of chromosomes to form chromatids• Prophase of meiosis: homologous chromosomes lie side by side over entire length = synapse.

Interchange of segments of homologous chromosomes = crossover.2 Xs side by side just like the autosomes. X and Y end to end – no crossover.

• Metaphase: paired chromosomes arrange in middle of cell;• Anaphase: homologous chromosomes migrate to opposite poles of the cell; each chromosome

is composed of two chromatids, the chromatids are not separated• Telophase: two new daughter cells form; each contains half the chromosome number =

reduction of chromosomes by half; interchange of genetic material occurred during synapse;Second meiotic division = mitotic division

• 2 chromatids separate, 2 new daughter cells are formed with half the normal number of chromosomes

4

07-10-29 Madl 4

Meiosis:• Segregation• Assortment• Potential gametes: 2N

• Linkage• Crossing-over (rare in mitosis)

Meiosis (2/7)


1. Segregation: Diploid organisms must form haploid gametes via the process of meiosis. They therefore start with two copies of every gene, but produce gametes with only one copy of each gene. Segregation is the process by which the different alleles of a diploid organism are packaged into separate gametes. Example: A heterozygote for the albino gene, for example, would produce two types of gametes, a and A. This process occurs at every locus, and is a result of the seperationof homologous chromosomes during meiosis. Segregation applies to ONE LOCUS. Segregation of alleles is 2:2. Rarely, 3:1 or 1:3 ratios are seen, due to gene conversion.

2. Independent Assortment describes the process of segregation occurring at multiple loci simultaneously: The segregation of alleles into gametes follows the laws of probability: therefore an Aa individual would produce 50% A gametes and 50% a gametes. If genes are on different chromosomes, alleles assort independently of each other. This is called independent assortment. The chance of an allele at one locus being in a particular gamete is independent for each locus.

3. Number of potential gametes: The number of potential, different, gametes a parent can produce is equal to 2n, where n is the number of loci assorting. Thus, a heterozygote for three loci: Aa Bb Cc could form EIGHT different gametes; e.g. ABC, ABc, AbC, aBC, Abc, aBc, abC, abc, …. By contrast, AA BB Cc can form only two different gametes, ABc and ABC, because only one locus is assorting. For n independently assorting loci, there are 2n different gametes that can be created. If they are truly assorting independently, they will be present in equal numbers.

4. Linkage: Departures from independent assortment are most often caused by LINKAGE, when two loci are close to each other on the same chromosome. Linkage causes certain combinations of alleles to be over-represented in the gametes.

i. During meiosis alleles of some genes assort together because they are near each other on the same chromosome.

ii. Recombination occurs when genes are exchanged between the X chromosomes of the F1 females.

e. Some relevant terminology:

i. A chiasma (plural chiasmata) is the site on the homologous chromosomes where crossover occurs.

ii. Crossing-over is the reciprocal exchange of homologous chromatid segments, involving the breaking and rejoining of DNA.

iii. Crossing-over is also the event leading to genetic recombination between linked genes in both prokaryotes and eukaryotes.

f. Crossing-over occurs at the four-chromatid stage of prophase I in meiosis. Each crossover event involves two of the four chromatids. All chromatids may be involved in crossing-over, as chiasmata form along the aligned chromosomes

5

07-10-29 Madl 5

Discoveries in the 1860s:

• Genes as particles of inheritance• Patterns of inheritance• Genes come from both parents• Forms of dominant genes (allele)

Sperm (homunculus) @ 1860

Meiosis (3/7)


• Discovered Genes as Particles of Inheritance

• Discovered Patterns of Inheritance

• Discovered Genes Come from both Parents

Egg + Sperm = Zygote

Nature vs Nurture

Sperm means Seed (Homunculus)

• Discovered One Form of Gene (Allele) Dominant to Another

• Discovered Recessive Allele Expressed in Absence of Dominant Allele

6

07-10-29 Madl 6

Gametogenesisformation of haploid cells (n):

• Oocytes formed before birth (arrested prophase - up to 4 decades!);

• Spermatocytes continous formation (fresh);

Meiosis (4/7)


Gametogenesis:Oocytes: formed before birth - prolonged prophase of first meiotic division until ovulation – more frequent congenital abnormalities in ova of older women (longer exposure to potentially harmful environmental influences until meiotic division resumes at ovulation);Spermatocytes: continously formed (‘fresh’ sperm)i. In males, spermatogenesis produces spermatozoa within the testes.

(1) Primordial germ cells (primary spermatogonia) undergo mitosis to produce secondary spermatogonia.

(2) Secondary spermatogonia transform into primary spermatocytes (meiocytes) which undergo meiosis I, giving rise to two secondary spermatocytes.

(3) Each secondary spermatocyte undergoes meiosis II, producing haploid spermatids that differentiate into spermatozoa.

ii. In females, oogenesis produces eggs (oocytes) in the ovary.(1) Primordial germ cells (primary oogonia) undergo mitosis to produce secondary oogonia.(2) Secondary oogonia transform into primary oocytes, which grow until the end of oogenesis.(3) Primary oocytes undergo meiosis I and unequal cytokinesis, producing a large secondary

oocyte, and a small cell called the first polar body.(4) The secondary oocyte produces two haploid cells in meiosis II. One is a very small cell, the

second polar body, and the other rapidly matures into an ovum.(5) The first polar body may or may not divide during meiosis I. Polar bodies have no function in

most species and degenerate, so that a round of meiosis produces only one viable gamete, the ovum. Human oocytes form in the fetus, completing meiosis only after fertilization.

7

07-10-29 Madl 7

Gametes:

• Haploid spermatocyte

• Halpoid oocyte

Meiosis (5/7)


8

07-10-29 Madl 8

Fertilization:

• Fusion of haploid gametes

• Diploid Zygote (2n)

Meiosis (6/7)


9

07-10-29 Madl 9

Fertilization:

• Fusion of haploid gametes

• Diploid Zygote (2n)

Meiosis (7/7)


10

07-10-29 Madl 10

Genetics on an Organismic Level

Intro Nucleus Cell PopulationOrganism

11

07-10-29 Madl 11

Father of Genetics:• Gregor MENDEL

(1822-1884)• worked with Pisum sativum (pea)

•work lost for over 50 yrs –rediscovered in 1900;

Mendelian Genetics (1/15)


Mendelian Genetics:• Gregor MENDEL (Augustinian Monk at Brno Monastery in Austria (now Czech Republic); well

trained in math, statistics, probability, physics, and interested in plants and heredity.• Mendel worked with peas (Pisum sativum) - good choice for environment of monastery:

Obligate self-pollination reproductive system

Permits side-by-side genetic barriers

Cross-pollinations require intentional process; crosses meticulously documented -numerically/statistically analyzed

Scientists of 1860s could not understand math

Mendel was among the first to think in quantitative, rather than strictly qualitative terms.

Work lost in journals for 50 years! But eventually rediscovered in 1900s independently by 3 scientists and recognized as landmark work!

12

07-10-29 Madl 12

Design of the Experiment:

• Pisum sativum (pea)




Mendel’s Experimental design1. Mendel began his work in 1854 with the garden pea Pisum sativum, by crossbreeding plants

with different characteristics. He reported his theory explaining transmission of traits to the next generation in 1865, but its significance was not realized until several decades later.

2. His success resulted from focusing on well-defined traits one at a time, quantifying the offspring and analyzing the results mathematically.

3. Garden peas are excellent for this type of research, because they grow easily, produce large numbers of seeds quickly and routinely self-fertilize. Experimental cross-fertilization is also readily accomplished in peas.

4. Mendel first grew strains of peas using self-fertilization to be certain that the traits of interest were unchanged in subsequent generations (true-breeding or pure-breeding strains).

5. Then he looked at inheritance of traits selected because they have only two distinct possibilities for phenotype. The traits he studied are listed, and the dominant phenotype is indicated by an asterisk:

a. Flower/seed coat color (one gene controls both): *grey/purple vs. white/white.b. Seed color: *yellow vs. green.c. Seed shape: *green vs. yellow.d. Pod color: *green vs. yellow.e. Pod shape: *inflated vs. pinched.f. Stem height: *tall vs. short.g. Flower position: *axial vs. terminal.

13

07-10-29 Madl 13

Observations made:

• Pisum sativum (pea)

Punett square:



Two lines of garden peas have been grown separately for a long time, they are called “true breeding” lines because the parents always resemble the offspring. One line has purple flowers and one line has white flowers. A parent is chosen from each line. These are called the P1. When they are artificially crossed (garden peas normally self-fertilize), the resulting offspring (called F1) are all purple. Two individuals from the F1 are crossed. The resulting offspring (the F2) are 75% purple-flowered and 25% white flowered.

Terminology used in breeding experiments:a. Parental generation is the P generation.b. Progeny of P generation is the first filial generation, designated F1.c. When F1 interbreed, the second filial generation, F2, is produced.d. Subsequent interbreeding produces F3, F4 and F5 generations.

14

07-10-29 Madl 14

Resume:

• dominant & recessive alleles• homo- & heterozygous traits




Genetic differences between organisms arise from mutations, recombination and selection. All three are necessary for the process of evolution.

a. Mutations (heritable changes in the genetic material) may be spontaneous or induced. Only those that escape the cell’s DNA repair mechanisms are fixed in the genome and passed to the next generation.

b. Recombination (exchange of genetic material) is produced by enzymes that cut and rejoin DNA molecules.

i. In eukaryotes, recombination via crossing-over is common in meiosis and occurs more rarely in mitosis.

ii. In prokaryotes, recombination may occur when two DNA molecules with similar sequences become aligned.

c. Selection (favoring particular combinations of genes in a given environment) was described by Darwin. Its main consequence is to change the frequency of genes affecting traits under selection. Different genotypes contribute alleles to the next generation in proportion to their selective advantage.

15

07-10-29 Madl 15

Mendel’s Law:

• Principle of segregation• Independent assortment

F2 genotype F2 phenotype1/16 & 2/16 & 2/16 & 4/16 (s-y)

1/16 & 2/16 (s-g)1/16 & 2/16 (w-y)

1/16 (w-g)




Mendel’s Law: Through experiments, Mendel deduced some of the basic facts of genetics. Inheritance is particulate: “particles” called genes carry the information that makes parents tend to resemble their offspring.

1. The 1st Mendelian law, the principle of segregation involved only one pairs of traits (monohybrid crosses). The 1st law states: “Recessive characters, which are masked in the F1from a cross between two true-breeding strains, reappear in a specific proportion in the F2.” This is because alleles segregate during anaphase I of meiosis, and progeny are then produced by random combination of the gametes.

2. After Mendel analyzed crosses involving two pairs of traits (dihybrid crosses) …. The 2nd

Mendelian law, the law of independent assortment, which says that the factors for different traits assort independently of one another. This allows for new combinations of the traits in the offspring. A dihybrid cross will produce four possible phenotypic classes, in a 9:3:3:1 ratio.

3. Trihybrid crosses (involving three independently assorting character pairs) result in 64 possible combinations of the eight different gamete types contributed by each parent, creating 27 different genotypes. There will be eight different phenotypes, in a predicted ratio of 27:9:9:9:3:3:3:1.

16

07-10-29 Madl 16

Inheritance:• Congenital (at birth)• Hereditary (genetic)

Causes• Gene, chromosome abnormalities

• Epigenetic (environment)



Inheritance:• Congenital: present at birth; • Hereditary (genetic): result of chromosome abnormality or defective gene;Causes of malformations:• Chromosomal abnormalities; Non-Disjunction is the failure of homologous chromosomes in

germ cells to separate from one another during 1st or 2nd meiotic division;Sex chromosomes or autosomes;Extra chromosome: trisomy (24 or 47);Absent chromosome: monosomy (22 or 45);Chromosome Deletion: Broken piece of chromosome is lost from cell;Translocation: Not lost, just misplaced and attached to another chromosome - reciprocal: between two nonhomologous chromosomes (no loss or gain of genetic material - no loss of cell function) - in germ cells: deficient or excess chromosome material – abnormal zygote;

• Gene abnormalities;• Intrauterine injury (e.g. drugs, radiation, infection, environmental, etc);

Drugs: thalidomide (phocomelia), DES (cervical cancer), street drugs (IUFD), smoking (IUGR), alcohol (FAS), etcRadiation: x-raysMaternal infections: - Rubella virus (CVS, CNS, chr. infection)- CMV (microcephaly, chronic infection)- Toxoplasma gondii (hydrocephalus, systemic infection)

• Epigenetic: environmental effects on genetically predisposed embryo;

17

07-10-29 Madl 17

Trisomy 21:

• Hereditary (genetic)• Translocation



Inheritance:• Hereditary (genetic): result of chromosome abnormality or defective gene;Causes of malformations:• Chromosomal abnormalities; Non-Disjunction is the failure of homologous chromosomes in

germ cells to separate from one another during 1st or 2nd meiotic division; sex chromosomes or autosomes; Extra chromosome: trisomy (24 or 47);

18

07-10-29 Madl 18

Trisomy 21:

• Hereditary (genetic)• Translocation



Inheritance:• Hereditary (genetic): result of chromosome abnormality or defective gene;Causes of malformations:• Chromosomal abnormalities; extra chromosome: trisomy (24 or 47);• Translocation: Not lost, just misplaced and attached to another chromosome - reciprocal:

between two nonhomologous chromosomes (no loss or gain of genetic material - no loss of cell function) - in germ cells: deficient or excess chromosome material – abnormal zygote;

19

07-10-29 Madl 19

Modes of Inheritance:• Autosomal dominant

(dominant gene)• Autosomal recessive

(both alleles altered)• Codominant (expression of both alleles)

• X-linked (affects males)



Modes of Inheritance• Autosomal dominant (a dominant gene expressed in the heterozygous state);• Autosomal recessive (expressed only in homozygous individual, disease only if both alleles are

abnormal); • Codominant (full expression of both alleles in heterozygous state); • X-linked (usually affects male offspring; the abnormal X-linked gene acts as dominant gene

when paired with the Y chromosome);

20

07-10-29 Madl 20

X-Chromosome:e.g. Hemophilia

• Female (XX)• Male (XY)



Sex chromosome:Women have two X-Chromosomes, but men have one X and one Y-chromosome. Sex chromosomes separate during the meiotic division that produces eggs and sperm. Progenies inherit one of the their X-chromosomes from their father, while sons inherit only the X-chromosome from their mother. Sons inherit their Y-chromosome from their father. • Genetic sex = composition of X and Y• Female: XX, male XYHaemophilia or hemophilia (from Greek haima "blood" and philia "to love") is the name of a family of hereditary genetic disorders that impair the body's ability to control blood clotting, or coagulation. In the most common form, haemophilia A, clotting factor VIII is absent. The effects of this sex-linked disorder are manifested almost entirely in males, though it is the mother's of affected sons who transmit the disorder to them genetically. Females are almost exclusively asymptomatic carriers of the disorder, and may have inherited it from their mother or father.Trait is found on the X-chromosome – heredity: recessivehttp://en.wikipedia.org/wiki/Hemophilia

21

07-10-29 Madl 21

Pedigree:

• Nomenclature



1. Recessive traits are well documented in humans, and are usually the result of a mutation causing loss or modification of a gene product.

2. Deleterious recessive alleles persist in the population because heterozygous individuals carry the allele without developing the phenotype, and so are not at a selective disadvantage.

3. Characteristics of recessive inheritance of a relatively rare trait:a. Parents of most affected individuals have normal phenotypes but are heterozygous. If the

allele is rare the trait will “skip” generations.b. Mating of heterozygotes will produce 3⁄4 normal progeny and 1⁄4 with the recessive

phenotype.c. If both parents have the recessive trait, all their progeny will usually also have the trait.

4. Dominant traits are also well documented in humans. A mutation may produce a dominant phenotype by causing a function to be gained due to an altered gene product capable of a new activity. Examples:

a. Woolly hair.b. Achondroplasia.c. Brachydactyly.d. Marfan syndrome.

5. Dominant alleles produce a distinct phenotype when in a heterozygote whose other allele is wild-type. Due to the rarity of dominant mutant alleles causing recognizable traits, homozygous dominant individuals are very unusual. Most pairings are between a heterozygote and a homozygous recessive (wild-type) individual.

6. Characteristics of dominant inheritance of a relatively rare trait:a. Affected individuals have at least one affected parent.b. The trait is present in every generation.c. Offspring of an affected heterozygote will be 1⁄2 affected and 1⁄2 wild-type.

22

07-10-29 Madl 22

Pedigree:

• Ooculo-cutaneous) Albinism



Albinism (from Latin albus; extended etymology), more technically hypomelanism or hypomelanosis, is a form of hypopigmentary congenital disorder, characterized by a lack of melanin pigment in the eyes, skin and hair (or more rarely the eyes alone). Albinism results from inheritance of recessive genes. The condition is known to affect mammals, fish, birds, reptiles, and amphibians. There are two main categories of albinism in humans:* In oculocutaneous albinism (despite its Latin-derived name meaning "eye-and-skin" albinism), pigment is lacking in the eyes, skin and hair. (The equivalent mutation in non-humans also results in lack of melanin in the fur, scales or feathers.)* In ocular albinism, only the eyes lack pigment. People with oculocutaneous albinism can have anywhere from no pigment at all to almost-normal levels. People who have ocular albinism have generally normal skin and hair color, and many even have a normal eye appearance.

• Expressed in both sexes at appriximately equal frequencies, thus autosomal;• Not expressed in every generation, thus recessive; recessive traits in (grand-) parent generation

(mutation causing loss or modification of a parental gene;thus Girl is the carrier of an autosomal recessive trait.

23

07-10-29 Madl 23

Abnormal Fetal development:

• Malformation• Deformation• Dysplasia• Disruption• Disorders• Syndromes



Minor Anomalies relate to disturbance of phenogenesis in fetal life:• Phenogenesis: the process of attaining final quantitative anthropometric traits of the race and family

(variant familial developmental pattern) and can be intrinsic (chromosome imbalance) or extrinsic (teratogens);

Abnormal Fetal development• Malformation: Intrinsic abnormalities of blastogenesis and organogenesis affecting the

morphogenetically reactive fields of the embryo = developmental field defects; Occur alone or in combination (syndromes or associations) and can bei severe (spina bifida aperta) or mild (spina bifida occulta). Causally heterogeneous: Intrinsic causes: mendelian mutations, chromosome abnormalities, environmental interactions (multifactorial), mitochondrial mutations EPIGENETICS;

• Deformation: secondary changes in form or shape of previously normally formed organs or body parts caused by extrinsic forces (e.g. Potter syndrome) or intrinsic defects (e.g. fetal akinesiasyndrome with congenital arthrogryposis);

• Dysplasia: Disturbances of histogenesis, occurring later and somewhat independently of morphogenesis; morphogenesis is prenatal, histogenesis continues postnatally in all tissues that have not undergone end differentiation; Dysplasias may predispose to cancer;

• Disruption: Environmental (exogenous) causes producing abnormalities of morphogenetic field dynamics; e.g. rubella, thalidomide, isotretinoin, alcohol, etc;

• Disorders: most are inherited as autosomal rezessive (AR), some are X-linked, a few are AD. Great variability in presentation; some present with dysmorphic features; storage material in RES and other tissues; e.e Albinism;

• SYNDROMES are patterns of anomalies proven or presumed causally related and are caused: i) chromosome mutations i) imprinting defectsi) Aneuploidyi) multifactorial disordersi) teratogenic sequences

24

07-10-29 Madl 24

Mutations in Erytrhocytes:

• Sickle Cell Anemia (SCA)




DNAi ANIM

ATION

DNA-mole

cule/

mutation

/SCA

Screening of hemoglobin for altered electrophoretic mobility has identified over 200 hemoglobin mutants, showing a variety of amino acid substitutions in both the α and the β chains. Each appears to derive from a single amino acid change. However, Most effects are not as severe as those seen in sickle-cell anemia. Hemoglobin is formed by four polypeptide chains, two molecules of the αpolypeptide and 2 of the β polypeptide, each associated with a heme group. Sickle Cell Anemia•J. Herrick (1910) first described sickle-cell anemia, finding that red blood cells (RBCs) change shape (form a sickle) under low O2 tension.

a. Sickled RBCs are fragile, hence the anemia.b. They are less flexible than normal RBCs, and form blocks in capillaries, resulting in tissue

damage downstream.c. Effects are pleiotropic, including damage to extremities, heart, lungs, brain, kidneys, GI tract,

muscles and joints. Results include heart failure, pneumonia, paralysis, kidney failure, abdominal pain and rheumatism.

d. Heterozygous individuals have sickle-cell trait, a much milder form of the disease.•E.A. Beet and J.V. Neel independently proposed (1949) that sickle-cell trait and disease were the result of a single mutant allele.•Linus Pauling and coworkers (1949) used electrophoresis and showed:

a. Hemoglobin from individuals with sickle-cell anemia (Hb-S) has altered mobility compared with normal hemoglobin (Hb-A).

b. Hemoglobin from individuals with the sickle-cell trait shows equal amounts of Hb-A and Hb-S, indicating that heterozygotes make both forms of hemoglobin.

c. Therefore, the sickle-cell mutation changes the form of its corresponding protein, and protein structure is controlled by genes.

•Hemoglobin is formed by four polypeptide chains, two molecules of the α polypeptide and 2 of the βpolypeptide, each associated with a heme group.•V.M. Ingram (1956) found that the 6th amino acid of the β chain in sickle-cell hemoglobin is valine(no electrical charge) rather than the negatively charged glutamic acid in the β chain of normal hemoglobin.•Outline of the genetics and gene products involved in sickle-cell anemia and trait:

a. Wild-type β chain allele is βA, which is codominant with βS.b. Hemoglobin of βA/βA individuals has normal β subunits, while hemoglobin of those with the

genotype βS/βS has β subunits that sickle at low O2 tension.c. Hemoglobin of βA/βS individuals is 1⁄2 normal, and 1⁄2 sickling form. (The two β chains of an

25

07-10-29 Madl 25

Influence on the physical manifestation:

• Genotype

• Phenotype



Gregor Mendel (1822–1884) laid the foundation for our current understanding of heredity. He did not know about chromosomes or genes, which were discovered after his lifetime.

Genotype versus Phenotype 1. Hereditary traits are under control of genes (Mendel called them particulate factors).2. Genotype is the genetic makeup of an organism, a description of the genes it contains.3. Phenotype is the characteristics that can be observed in an organism.4. Phenotype is determined by interaction of genes and environment. Genes provide potential, but

environment determines whether that potential is realized

26

07-10-29 Madl 26

Immune:

• Immunity• Tolerance• Tumour immunology• Evasion of immunity

Immune response


Immunity:•Adaptive immunity: Antigen-specific host defence following exposure to antigen (Ag); Involves T and B lymphocytes and their products; T-cell receptor (TCR) interacts with Ag peptide + major histocompatibility complex (MHC) on Ag-presenting cell (APC); B-cell receptor (BCR) – membrane bound Ig/antibody; Activated B-cells differentiate into plasma cells that secrete soluble antibodies; Activated T-cells are responsible for cell mediated immunity.•Innate immunity: Results from cells and factors that constitute the early host defence system; Tolerance: •Self-tolerance = self/nonself-discrimination: Ability to respond to foreign Ag but not to host self-Ag;•Central tolerance: Learned during lymphocyte development in thymus; Clonal deletion of self-reactive thymocytes;•Peripheral tolerance: Self-reactive B- and T-cells can escape tolerance mechanisms; Proteins that are not present in thymus during development or at too low a level to induce clonal deletion; Induce unresponsiveness in mature T-cells to self-Ag; Via clonal deletion or induction of anergy (inactive cells); Immunoregulation by T-suppressor cells; Inhibit function of other immune cells.Tumor immunology: •Innate anti-tumour response: Defence against initiation of tumour growth; Effector cells: granulocytes, mast cells, natural killer (NK) cells, NKT cells, and dendritic cells and macrophages (APCs); NK cells – detect changes in expression level of MHC molecules on cell surface; If tumour cells downregulate MHC class I NK-mediated cell lysis; NKT cells have role in anti-tumour immunity but can also suppress anti-tumour response; Depends on balance of positive and negative signals from various cytokine receptors. •Immunosurveillance: Natural immunological resistance to cancer; Tumour cells express tumour-associated Ags (TAA); T-cells mount immune response; Cytokine IFNg acts as surveillance molecule; Protects against chemically-induced or spontaneous tumours (reduced in k/o mice); Involves NK and NKT cells; Involves RAG2 = recombination activating gene 2; Catalyzes rearrangement of TCR and Ig genes; Involves STAT1 = signal transducer/activator of transcription; Transcription factor mediating IFN receptor signals.•Tumour antigens: Most TAA are derived from self-molecules; Encoded by mutant cellular genes (involved in genetic transformation of tumour progression); Overexpression of normal proteins; Ectopic expression of normal proteins; Normally expressed at undetectable levels; Normally

d l t ifi d l t l t

27

07-10-29 Madl 27

Genetics on a Population level

Intro Nucleus Cell Organism Population

28

07-10-29 Madl 28

Epigenetics (epi = on or over the genetic information).

Reversible changes in DNA function, without changing the DNA sequence.

Hence, at least 2 forms of info: • Genetic information • Epigenetic information

i.e. the effect of a gene depends both upon the environment, and upon other genes.

Epigenetics – part I (1/6)


The effect of every gene depends both upon the environment, and upon other genes. A gene does not act alone, it gives instructions for the manufacture of a protein. Proteins act with other proteins, with substrates, etc... All genes interact with the environment to some extent. Sometimes the contribution of the environment is small, sometimes it is very significant.

• Genetic information provides the building block for the manufacture of all Proteins needed for the cell functional activity;

• Epigenetic information provides additional instruction on how, when and where these information should be used.

29

07-10-29 Madl 29

A phenotypic variation:

• same parents• same age • no mutation in pigmentation

Image: Jirtle R.



…. but they are epigenetically different !

…. all mice are genetically IDENTICAL ….

Gene expression is conditioned by environmentDevelopmental interactions occur from conception til deathDepends on what environments and what sequence the organism encounters them

30

07-10-29 Madl 30

Another phenotypic variation ….

…. obviously we are more than the sum of our genes!



Genetics vs. Epigenetics“We are more than the sum of our genes” (Klar 1998)“You can inherit something beyond the DNA sequence” (Watson 2003)

31

07-10-29 Madl 31

Epigenetics - Nutrition & phenotypic variation:

Image: Hirschhorn J.N.



32

07-10-29 Madl 32

Affects:• Signal transduction• Cell cycle• Angiogenesis• Apoptosis• DNA repair

Waddington; 1957;Epigenetic Landscape



Genes are only puppets.Assorted proteins and RNAs pull the strings, telling the genes when and where to turn on or off – like switches (Science 293:1064)

Chromosomal infrastructure is essential for gene control, determining both active and repressed states. It is important not only to turn the right genes on but also to turn the right genes off. Histonesand chromatin components have key roles in this decision making process. If as few as three inappropriate genes are turned off, a normal cell can be converted into a cancer cell. This epigenetic silencing of genes underlies a new approach to cancer therapy. Mistargeting of these enzymes leads to tumorigenesis, but inhibition of their activity presents a novel approach to therapy. The list of genes that are found to be inactivated by DNA methylation events is growing rapidly and includes genes involved in the following:

• Signal transduction cascade pathways.• Cell cycle regulation.• Angiogenesis.• Apoptosis.• DNA repair

Recent Cancer methylation studies predict that hundred (100) of CPG islands could be methylated in a tumor cell. However, it is clear that both the genome-wide methylation studies and candidate gene approaches that each tumor type may have its own set of cancer cell type specific genes that are more susceptible to methylation. Thus each cancer type may have the potential to be typed or classified according to methylation profile. Epigenetics: reversible heritable changes in gene function occur without a change in the sequence of nuclear DNA. Differentiating tissues/organs are inherently organized; such organization emergesfrom within the “epigenetic landscape” rather than from without. Complex networks of biological signalling pathways can arise from the interactions between simple pathways under local control. These networks exhibit emergent properties: there is integration of signals across multiple time scales; the generation of distinct outputs depend on input strength and duration; there are self-sustaining feedback loops. Fig-A: "The path followed by the ball, corresponds to the developmental history of a particular organ. Fig-B: Interacting network of signal transduction pathways. "The pegs in the ground represent genes; the strings leading from them represent the pathways initiated by gene expression. The slope of the epigenetic landscape is controlled by the pull of these numerous pathways which are ultimately anchored to the genes."

33

07-10-29 Madl 33

Epigenetics regard:• Development of multicellular organisms• Environment-Organism interaction• Pathogenesis of diseases

Image: Jirtle R.



Gene expression is conditioned by environment;Developmental interactions occur from conception till death.Depends on what environments and what sequence the organism encounters them (psychosomatic axis).

34

07-10-29 Madl 34

The dynamic balance between Health & Disease

• Robustness(phases of stress) Eustress vsDistress

Chronic Disease (1/10)


Whenever organisms thrive and interact with a/biotic stressors (solar, hyperhaline, acidic, bacterial, macrofanua-flora, etc), they are subject to a variety of stresses. If these factors exceed the buffing capacity of the affected organism (dynamic range of tolerance) they tend to restrict their chances of survival.

Stress: stress is in most definitions considered to be a significant deviation from the conditions optimal for life and eliciting changes and responses at all functional levels of the organism which, although at first reversible, may also become permanent. According to the dynamic concept of stress, the organism under such conditions passes through a succession of characteristic phases. Stress can be describe as a state in which increasing demands made upon an organism lead to an initial destabilization of function, followed by normalization and improved resistance or chronic damage and eventually even premature death.

(2) ad hoc - Massnahmen lassen die tieferen Ursachen des Problems unberührt bzw. sie tendenziell sogar noch verstärken und verdichten. In der Medizin ist es dann und nur dann angezeigt, die Symptome zu behandeln, ohne die Krankheit selbst zu heilen, wenn die Krankheit entweder mit Sicherheit das Ende bedeutet oder sich von selbst heilen wird.

Source: Larcher, 1995 Plant Physiology, Bateson G.; 1972; Steps into an Ecology of Mind; p. 627-633

35

07-10-29 Madl 35


• Paracelsus; (1493-1541) There is no such thing as good or bad, only the DOSE makes

the poison.



36

07-10-29 Madl 36


• Chaotic pattern; i.e. non-linear dynamics

Bifurcation Pattern



Health & Disease: In case of brief disturbances, homeostasis is restored sooner or later as the disturbance passes. On the other hand, if the disturbance or is significantly long, a series of irreversible events bring the organism to a new ‘steady state’. Chronic disturbances favour development or differentiation of “new” tissues (cancer as a result of prolonged and repetitive events of distress?). However, the tumour cell as such does not exist: the bad cell, the bad virus = HN15N, the bad bacteria = Mycobacterium tuberculosis, the bad plant = Caulerpa taxifolia, the bad animal = Canis lupus, the bad individual = Homos sapiens sapiens, the bad group of people = Iran, the evil state = Bush’s USA, etc.). It just depends on the interaction with its surroundings (the relation is much more important then the entities themselves). Here the disease itself becomes a messenger, the vehicle that tries to communicate to the outside world / brain (i.e. to the westener that sees the body as something separate from the mind). Hence, disease is a just a mere tool of non-verbal communication.

Source: Ho M.W.; 2003; The Rainbow and the Worm: The Physics of Organisms; 2nd ed.; p.28;Dürr H.P., Popp F.A., Schommers W., 2000; Elemente des Lebens; p.107-108, 132, 194;Friedman N., 1997; Bridgning Science and Spirit; p.266; Popp F.A..; 2002; Die Botschaft der Nahrung; p.XXII;Resch G., Gutmann V.; 1994; Wissenschaftliche Grundlagen der Homoeopathie, 3rd ed.; p.413-435;http://en.wikipedia.org/wiki/Epigeneticshttp://www.usc.edu/hsc/dental/odg/jaskoll01.htm

37

07-10-29 Madl 37


Stress - stimuli may include:• chemical agents• physical agents• psychic

Germ and stem cells are • mostly “resting” or dormant, • not responsive to external stimuli



DNAi ANIM

ATION

DNA-mole

cule/

mutation

/DNA-dam

age

Stress - stimuli may include:• chemical agents: toxic & cancerogenic chemicals, radicals (ROS), • physical agents: ionizing radiation, non-ionizing radiation (resonance)• psychic: personal psychological setting: family, relaitonship, work …. Cancer cluster (ABC-

Catalyst))

38

07-10-29 Madl 38

Cancer - Selection, outgrowth

•more autonomous growth

•ignore death and senescence signals

•escape immune surveillance

• trigger angiogenesis• invasion, metastasis

Risk @ age 40: x10Risk @ age 65: x100



Under the influence of epigenetics!

Cancer is usually a disease of old age. It is not due to a single gene. Cancer is also not a static disease; some tumors (eg colon, breast, melanoma, cervical, pancreatic, bladder, lung etc) display a progression from benign to pre-malignant to invasive to metastatic stages. Increasing numbers/kinds of genetic abnormalities correspond to progression.

• Liquid tumours (leukemias, lymphomas): Precursors already mobile and invasive. Only one or two mutations may be required.

• Solid tumours – epithelial or mesenchymal. Most human cancers arise from epithelium. Precursors are immobile. At least three to five mutations, in different pathways, appear to be required to develop solid tumours in adults. Rb, p53, RAS and telomerase (TERT) pathways.

39

07-10-29 Madl 39

Cancer - Selection, outgrowth

•more growth autonomous

•ignore death and senescence signals

•escape immune surveillance

• trigger angiogenesis• invasion, metastasis



Tumor progression: Selection, outgrowth- more growth autonomous- ignore death and senescence signals- escape immune surveillance- trigger angiogenesis- invasion, metastasis

40

07-10-29 Madl 40

Breast cancer:

Nature Rev Cancer 5:676, 2005J Mamm Gland Biol Neo 6:235, 2001



Catalys

t

Cancer

-Cluste

r-video

(00:2

2-01:3

0)

Breast cancer: BRCA gene is a breast cancer susceptibility gene, that is tumor suppressor gene responsible for both normal development and carcinogenesis in breast. BRCA1, reveals multi functional protein involved in DNA repair. Cell cycle regulation, transcription and apoptosis. BRCA1 mutations may play a significant role in the tumor-genesis of familial breast cancer. Breast cancer model: COX2 = prostaglandin-endoperoxide synthase 2; often overexpressed in DCIS; •Increases HMEC growth, •estrogen synthesis, •mutagen production, •angiogenesis, •invasion potential, •decreases immune surveillance and apoptosis

Normal epithelial cells:Proliferate and form spheroids (acini) with hollow lumens and polarized surrounding cells.Resembles in vivo structures eg lumenal secretory cells surrounding lumen; surrounded by myoepithelial cells that are in contact with basement membrane.

Breast tumour cell lines:Proliferate but do not form acini; form nonpolarized, disordered clusters with limited differentiation.Similar to IDBC where tumour cells form nests, poorly formed tubules, cords and sheets with cell-cell junctions.Reversed by eg down-regulation/blocking function of b1-integrin and EGFR; or inhibition of MAPK or PI3K pathways; or restoration of dystroglyan (DG1; polarization) or CEACAM1(adhesion molecule) expression.

41

07-10-29 Madl 41

Stromal interaction:

• fibroblast

Curr Opin Gen Dev 11:54, 2001



A fibroblast is a type of cell that synthesizes and maintains the extracellular matrix of many animal tissues. Fibroblasts provide a structural framework (stroma) for many tissues, and play a critical role in wound healing. They are the most common cells of connective tissue in animals. The main function of fibroblasts is to maintain the structural integrity of connective tissue by continuously secreting precursors of the extracellular matrix. Fibroblasts secrete the precursors of all the components of the extracellular matrix, primarily the ground substance and a variety of fibres. The composition of the extracellular matrix determines the physical properties of connective tissues.Stromal microenvironment further influences growth of tumour cells; Co-culture/transplantation with stromal fibroblasts leads to branching structures of mammary ducts;Stromal cells (mainly fibroblasts) provide:

• Supportive functions eg angiogenesis (since normally involved in wound healing and inflammation);

• Responsive functions eg remodeling extracellular matrix (ECM) during invasion (via matrix metalloproteinases);

• Oncogenic functions eg stimulation of proliferation (via GFs or cytokines), suppression of cell death, and transformation of adjacent cells; Difference between normal fibroblasts vsfibroblasts from tumours or after carcinogen treatment or viral (eg HSV, HIV) infection;

42

07-10-29 Madl 42

Angiogenesis

&

Metastasis

Nat Rev Cancer. 2002;2:563-72



DNAi ANIM

ATION

DNA-mole

cule/

mutation

/tumor

grow

th

Angiogenesis:• Secrete substances that cause blood vessels to grow toward tumor for nourishment (for growth

>1mm): e.g. VEGF = vascular endothelial growth factor; PDGF = platelet derived GF; basic FGF = fibroblast GF

• All Oncs and TSGs promote angiogenesis, either directly or indirectly (via HIF1 [hypoxia-inducible transcription factor]

• Angiogenesis inhibitors hinder tumour growth

Metastasis:• Seeding and growth of satellite lesions elsewhere; e.g. spread via blood vasculature (to distant

organs) and/or lymphatic vessels (to nearby lymph nodes);• Involves increased cell mobility, secretion of ECM degrading proteases, targeting membrane

proteins;• Likely arise from a small subset of cells within the primary tumor;• Genetic alterations not clearly identified yet;

43

07-10-29 Madl 43

Metastasis:

• Haemodynamic

• Soil & Seed Hyp.




Metastasis:• Seeding and growth of satellite lesions elsewhere; e.g. spread via blood vasculature (to distant

organs) and/or lymphatic vessels (to nearby lymph nodes);• Involves increased cell mobility, secretion of ECM degrading proteases, targeting membrane

proteins;• Likely arise from a small subset of cells within the primary tumor;• Genetic alterations not clearly identified yet;

Organ preferences (lungs, liver, bone, brain, bowel, lymph nodes)• Hemodynamic mechanisms: depends on the number of tumour cells delivered to organ and

caught in capillaries;• “Soil and seed” hypothesis: due to differences in tumour cell/host organ interactions; i.e. cells

need suitable environment; Chemokines and growth factors may play a role e.g. receptors on tumour cells with ligands on/secreted from target organ cells;

44

07-10-29 Madl 44

Metastasis:

• Intravasion

• Extravasion




Catalys

t

Epigeneti

cs-vid

eo (0

4:00-0

4:40)

Steps in metastasis:• Detachment from primary tumour (intravasion): due to invasion into vessels or abnormal vessels;

may involve decreased levels adhesion molecules (e.g. cadherins), increased expression of proteases (e.g. metaloproteinases) and motility factors (e.g. Scatter Factor);

• Tumour cell arrest: cells are large compared to capillaries, so lodge in first capillary bed encountered (lung, liver);

• Extravasion of tumour cells: attachment to and invasion through endothelium and basement membrane/matrix; involves adhesion molecules and proteases;

However, • a tumor cell as such does not exist!• Tumor cell lost contact with surrounding;• Uncontrolled growth; divides continuously (mitosis), not knowing when to stop;

45

07-10-29 Madl 45

Epigenetics – part II (1/7)


Biochemistry involved in Epigenetics:• DNA de-/methylation (-CH3) • Histone de-/acetylation (HAT/HDAC)• Histone de-/methylation (-CH3)• Hostone de-Phosphorylation and non-histone proteins

Pennisi, Science 293:1067, 2001

Biochemical reactions which are involved in Epigenetics:• DNA Methylation: (addition of a methyl-group, CH3)It is the covalent addition of methyl group to

5th Position of cystosine with in CPG di-nucleotides which are frequently located in the promoter region of genes. It is a complex process catalyzed by DNA methyl transferase. The addition of the methyl group from the universal methyl Donor s-adenosyl L -methionine.

• Histone Acetylation: Chromatin remodeling by histone modification by acetylation. The acetylation of histones (H) mainly H3 and H4 is done at A.A lysine 9 & 14 and lysine 5, 8, 12, 16 respectively by enzyme systems histone acetyltransferases. The latter transfer the acetyl co-enzyme A to the lysine residue which leads to neutralizing the positive charge. Histone acetylationloosens chromatin packaging and correlates with transcriptional activation. Whereas, histone deacetylases remove the acetyl groups re-establishing the positive charge in the histones which are associated with repression of transcription.HAT - ↑histone acetylation (hyperacetylation) ↑ transcriptional activity.

HDAC - ↓histone acetylation (hypoacetylation) ↓transcriptional activity.• Histone Methylation: The process is carried out by an enzyme histone methyl transferase which

directs site-specific methylation of amino-acid residues such as lys. 4&9 in the tail of the histoneH3. Methylation of lysine 9 in histone H3 directs the binding of non-coding RNA, histone deacetylase to control chromatin structure and gene expression.

1. Cytosine DNA methylation- methyl group is transferred from S-adenosylmethionine to the C-5 position of cytosine by a family of cytosine (DNA-5)-methyltransferases (DNMT’s).

2. Genomic imprinting is parent-of-origin-specific allele silencing. It is maintained, in part, by differentially methylated regions and it is normally reprogrammed in the germline.

3. Histone modifications — including acetylation, methylation and phosphorylation — are important in transcriptional regulation and many are stably maintained during cell division, although the mechanism for this epigenetic inheritance is not yet well understood.

46

07-10-29 Madl 46



Chain of events:• inherited

predisposition• Epigenetic

exposure• Trigger

(threshold)

Wong, et al. Hum Mol Genet 14:R11, 2005

Twin studies:Minnesota Study of Twins Reared Apart:

Compared MZ twins reared together (MZT) vs MZ twins reared apart (MZA)Degree of dissimilarity between MZT vs MZA assumed to be due to environmentCorrelations within MZT and MZA twin pairs were almost identical for most traits

Personality test, fingerprint ridges, ECG patterns, systolic BP, heart rate, IQ, social attitudesBouchard et al. Science 250:223, 1990

Swedish Twin Registry:Similar results with respect to migraines (in females), smoking (in males), peptic ulcers

Headache 43:235, 2003; Arch Gen Psych 57:886, 2000; Arch Intern Med 160:105, 2000

47

07-10-29 Madl 47

Epigenetics regards:• Development of multicellular

orgamisms• Environment-Organism

interaction• Pathogenesis of diseases

Image: Jirtle R. Wong, et al. Hum Mol Genet 14:R11, 2005



Example: mouse agouti locusIsogenic Avy/a mice range in colour from yellow to black (pseudoagouti)Darkness proportional to amount of DNA methylation in agouti gene (complete methylationblack).Transplants’ colour influenced by genetic mother (dam) not surrogate

Epigentic signals can be transmitted to the next generation ie display meiotic stability.Not all epigenetic signals are erased and reprogrammed during gametogenesis.

May partly explain incomplete penetrance and variable expressivity.

Sources: Pennisi, Science 293:1064, 2001Wong, et al. Hum Mol Genet 14:R11, 2005Bouchard et al. Science 250:223, 1990Headache 43:235, 2003 Arch Gen Psych 57:886, 2000Arch Intern Med 160:105, 2000Gartner, Lab Anim 24:71, 1990

48

07-10-29 Madl 48



Epigenetics & Imprinting:•Parental methylation to gametal genes.•DNA-Methylation of DNA interfere with regulatory proteins.

Catalys

t

Epigeneti

cs-vid

eo (0

4:40-0

7:30)

Epigenetics & Imprinting:•Parents have enzymes which add methyl groups to gamete’s genes.•Methylation of DNA messes up the grooves to which the regulatory proteins bind. Regulatory proteins usually have domains (zinc fingers, leucine zippers, or helix-turn-helix) which will fit into the smooth double-helix grooves. But adding methyl (CH3) puts bumps in the grooves.

Histones can also bind to the TATA box so that the promotor site on the DNA is hidden or exposed.

Science 293:1074Genomic DNA is the ultimate template of our heredity …. It is unclear, for example, why the number of protein-coding genes in humans, now estimated at ~35,000, only doubles that of the fruit fly Drosophila melanogaster. Is DNA alone then responsible for generating the full range of information that ultimately results in a complex eukaryotic organism, such as ourselves? We favor the view that epigenetics, imposed at the level of DNA-packaging proteins (histones), is a critical feature of a genome-wide mechanism of information storage and retrieval that is only beginning to be understood. We propose that a "histone code" exists that may considerably extend the information potential of the genetic (DNA) code. We review emerging evidence that histoneproteins and their associated covalent modifications contribute to a mechanism that can alter chromatin structure, thereby leading to inherited differences in transcriptional "on-off" states or to the stable propagation of chromosomes by defining a specialized higher order structure at centromeres …. we have chosen epigenetic phenomena and underlying mechanisms in two general categories: chromatin-based events leading to either gene activation or gene silencing. In particular, we center our discussion on examples where differences in "on-off" transcriptional states are reflected by differences in histone modifications that are either "euchromatic" (on) or "heterochromatic" (off).

Science 293:1080 In diverse organisms, small RNAs derived from cleavage of double-stranded RNA can trigger epigenetic gene silencing in the cytoplasm and at the genome level. Small RNAs can guide posttranscriptional degradation of complementary mRNA and (at least in plants) induce methylationof homologous DNA sequences. RNA silencing can counteract foreign sequences (like retroviruses and transposons) and is probably involved in development.

49

07-10-29 Madl 49

Epigenetics & Imprinting:

•Any gene-regulating activity that doesn’t involve changes to the DNA code and that can persist through one or more generations.



Any gene-regulating activity that doesn’t involve changes to the DNA code and that can persist through one or more generations.

Genetics vs. Epigenetics“We are more than the sum of our genes” (Klar 1998)“You can’t inherit something beyond the DNA sequence” (Watson 2003)

The conventional wisdom on genes goes something like this: DNA is transcribed onto RNA, which form proteins, which are responsible for just about every process in the body, from eye color to ability to fight off illness. But even as the finishing touches were being applied to the sequencing of the human genome (completed in April 2003), unaccountable anomalies kept creeping in, strangely reminiscent of the quarks and dark matter and sundry weird forces that keep muddying the waters of theoretical physics.Enter the science of epigenetics, which attempts to explain the mysterious inner layers of the genetic onion that may account for why identical twins aren’t exactly identical and other conundrums, including why some people are predisposed to mental illness while others are not. Scientific American devotes a two-part article to the topic in its November and December 2003 issues. To summarize:Only 2% of our DNA - via RNA - codes for proteins. Until very recently, the rest was considered "junk," the byproduct of millions of years of evolution. Now scientists are discovering that some of this junk DNA switches on RNA that may do the work of proteins and interact with other genetic material. "Malfunctions in RNA-only genes," explains Scientific American, "can inflict serious damage."Epigenetics delves deeper into the onion, involving "information stored in the proteins and chemicals that surround and stick to DNA." Methylation is a chemical process that, among other things, aids in the transcription of DNA to RNA and is believed to defend the genome against parasitic genetic elements called transpons. An 2003 MIT study created mice with an inborn deficiency of a methylating enzyme. Eighty percent of these mice died of cancer within nine months. A five-year Human Epigenome Project to map all the DNA methyl sites was launched in October 2003 in the UK.

50

07-10-29 Madl 50

Indexing via Chromatin: genome-organizing platform:

Chromatin is not uniform in structure but has different designs



To retrieve info., we need an indexing system:1. Highly condensed chromatin fibers (heterochromatin) vs. less compacted regions (euchromatin)2. Unusual histone proteins: histone variants3. Addition of chemical flags to histones: covalent modifications4. Altered chromatin structure: chromatin remodeling5. Addition of a methyl group to a cytosine (C) base in DNA: DNA methylation6. Noncoding RNAs: interrelated pathways the create variation in the chromatin polymer

51

07-10-29 Madl 51

Euchromatin vs. Heterochromatin:

1. Nature of DNA sequence2. mRNA or dsRNA expression3. Spatial organization within the

nucleus (nucleoplasm vs. nuclear matrix, or distinct nuclear domains).



The distinction between euchromatin and heterochromatin

Euchromatin: * active” chromatin * largely coding sequences* less than 4% of the mammalian genome* ”open” (decompacted), nuclease-sensitive

state* complexed with transcripton/chromatin

machineriesHeterochromatin:

* historically less well studied * important in the organization and proper functioning

of eukaryotic genomes* “closed”, or “locked-down” state* centromeres & telomeres: constitutive

heterochromatin* defense mechanism* heterochromatin serves important genome

maintenance functions

52

07-10-29 Madl 52

Epigenetics and Disease: genomic modifications can be passed on – “Epigenetic marks

•Prader-Willi Syndrome•Angelman Syndrome

PW-AM-Syndrome (1/2)


Video

Das Ged

aech

tnis derGen

e (12

:00-13

:30)

Prader-Willi and Angelman syndromes: Independent of primary gene sequence, there are genomic modifications that can be passed on from the parental environment – “Epigenetic marks. Both of these genetic disorders are caused by deletion of a region of chromosome 15. Up to 4Mb deleted, primary genes affected are: SNRPN (small nuclear ribonucleoprotein polypeptide N) , NDN(necdin), MKRN3 (makorin), IPWS (imprinted in Prader-Willi syndrome)

Prader-Willi Syndrome del-15q11.2-13Angelman Syndrome del-15q11.2-13but: Deletions account for ~70%, and always of the paternal chromosome28% are uniparental disomy*, always maternal, with NO genomic deletion.2% are small mutations on the paternal side, affecting the whole region*usually follows trisomic rescue – 47 chromosomes in fertilised ovum, one lost on cell division. (correction by two mistakes)

•However, the syndromes differ:Prader-Willi Syndrome (PWS): obesity, muscular hypotonia, mental retardation, short stature, hypogonadism, small limbsAngelman Syndrome (AS): uncontrollable laughter, jerky movements, and other motor and mental symptoms.

Developing syndrome depends upon the parent that provided the mutant chromosometwo closely located genes – one for AS, one for PWSPWS – abnormal father copy, AS – abnormal mother copy

SYNDROMES are patterns of anomalies proven or presumed causally related and are caused: • chromosome mutations • imprinting defects• Aneuploidy• multifactorial disorders • teratogenic sequences

53

07-10-29 Madl 53

Implications:

• in vitro fertilisation by intracytoplasmic sperm injection: girls maintained paternal imprint

• 9% of all IVF compared to •4.2% natuarlly conceived

PW-AM-Syndrome (2/2)


Gene de-/activation by exposure to light and artificial environment (petri dish)

Video

Das Ged

aech

tnis derGen

e (19

:40-21

:40)

Hansen M, Kurinczuk JJ, Bower C, Webb S., 2002;New England Journal of Medicine 346: 725-730;

The risk of major birth defects after intracytoplasmic sperm injection and in vitro fertilizationFollowing

ICS, 26/301 (8.6%) ICS = intracytoplasmic sperm injectionandIVF, 75/837 (9.0%) have major birth defects

compared with 168/4000 naturally-conceived infants (4.2%)Assisted reproductive technology (ART) often required for sperm malfunction, but Angelman (for example) which has increased incidence following IVF/ICS is a result of loss of maternal methylation? Increased risk more a reflection of in vitro culture effects?

54

07-10-29 Madl 54

So J.B.Lamarck (1744-1829) was not so wrong at all:

•Transient or heritable changes in gene expression through modulation of chromatin, which is not brought about by changes in DNA sequence

• These regulatory mechanisms for chromatin indexing are known as “epigenetics”

• Evolution of the genetic code, translation, and cellular organization itself follows a dynamic whose mode is …. Lamarckian.

Vetsigian K. Woese C. Goldenfeld N., 2006; Collective evolution and the genetic code PNAS Vol. 103 no. 28

Epigenetics – part III (1/8)


Transient vs. permanent (heritable) chromatin changes*transient (or reversible) marks on chromatin:

responsive to intrinsic and external stimuliregulate the “reading” of underlying DNA template

*some modifications or structures are stable thru several cell divisionsthis establishes “epigenetic states” or cellular memory

These chromatin “signatures”: highly organized system for indexing distinct regions of the genomeenvironmental signals --> gene expression

Lamarckism or Lamarckian evolution refers to the once widely accepted idea that an organism can pass on characteristics that it acquired during its lifetime to its offspring (also known as based on heritability of acquired characteristics or "soft inheritance"). It is named for the French biologist Jean-Baptiste Lamarck, who incorporated the action of soft inheritance into his evolutionary theories and is often incorrectly cited as the founder of soft inheritance. It proposed that individual efforts during the lifetime of the organisms were the main mechanism driving species to adaptation, as they supposedly would acquire adaptive changes and pass them on to offspring. After publication of Charles Darwin's theory of natural selection, the importance of individual efforts in the generation of adaptation was considerably diminished. Later, Mendeliangenetics supplanted the notion of inheritance of acquired traits, eventually leading to the development of the modern evolutionary synthesis, and the general abandonment of the Lamarckian theory of evolution in biology. In a wider context, soft inheritance is of use when examining the evolution of cultures and ideas, and is related to the theory of Memetics. While enormously popular during the early 19th century as an explanation for the complexity observed in living systems, the relevance of soft inheritance within the scientific community dwindled following the theories of August Weismann and the formation of the modern evolutionary synthesis.

55

07-10-29 Madl 55

The riddle w/n nature

….Its all about Resonance

Importance ofRelationships

(each single entity becomes meaningless when viewed in isolation).



A coherent state maximises both global cohesion as well as local freedom. Nature presents us a deep riddle that compels us to accommodate seemingly polar opposites (determinism and probabilities at the same time). What nature is telling us is that coherence does not mean uniformity. You can begin to understand it by thinking of an orchestra …. Where everyone is doing his or her own thing, as yet keeping perfectly in tune or in step with the whole. Imagine a huge super-orchestra playing with instruments spanning an incredible spectrum of sizes from a piccolo of 1nm up to a bassoon or bas viol of 1m or more, and a musical range of 72 octaves. The amazing thing is that this super-orchestra never ceases to play out our individual songlines, with a certain recurring rhythm and beat, but in endless variations that never repeat exactly. Each and every player, however small, can enjoy maximum freedom of expression, improvising from moment to moment, while maintaining in step and in tune with the whole. However, imagine if some members of the orchestra play the wrong tune (are incoherent), it disturbs the entire harmony of the explicate order

Central to Bohm 's schema are correlations between observables of entities which seem separated by great distances in the Explicate Order, manifestations of the Implicate Order. Within quantum theory there is entanglement of such objects (living beings are quantum beings). This view of order necessarily departs from any notion which entails signalling, and therefore causality. The correlation of observables does not imply a causal influence, and in Bohm 's schema the latter represents 'relatively' independent events in space-time; and therefore Explicate Order. He also used the term unfoldment to characterise processes in which the Explicate Order becomes relevant (or "relevated"). Bohm likens unfoldment also to the decoding of a television signal to produce a sensible image on a screen. The signal, screen, and television electronics in this analogy represent the Implicate Order whilst the image produced represents the Explicate Order.

56

07-10-29 Madl 56

Resonance - From cell to societies:Biomolecules: DNA, RNAOrganelles: ribosomes,

mitochondria, centrioles, etc.Cells: of all biota (Archaea, Eubacteria, Protista, Eukaryota)

Organs & Organism: Multicellular living beings;

Society: group of single species (population) that can also share common cultural rules (Homo sapiens);



Legast

henie

Epigeneti

k-video

(02:5

0-04:2

5)

i) Abscissa: “1” represents the balance of operation (Homeostasis) - from left to right: Functional Complexity – from atoms, to molecules, organelles, cells, organs, organisms, societies and beyond.

ii) Holographic organism: Although biophotonic processes are predominantly associated to the DNA, they propagate via the microtubular network of the cytoskeleton to the extracellular matrix, thereby involving the entire organism. It is even assumed that any organism (incl. Humans act as a holographic biocomputer). A common hypothesis claims that information in the brain is not stored in localized areas of the brain but rather smeared like a hologram over the entire brain. Thereby, information is retrieved via a built-in Fourier transformation and converted to distinct action potentials.

iii) Living systems are neither mere subjects, nor objects, but subjects and objects at the same time. In contrast to the Neo-Darwinistic point of view the capacity of evolutionary development does not originally depend on the rivalry and power in the fight for existence, rather, it depends mainly on the capacity of communication; they can be looked upon at as expanding antennae systems.

iv) Not only tissues and organs are tied together to form an organism, also members of a group, of a culture, a society. Symbolically, the immune system and a society perform similar tasks – it protects the group from potentially dangerous influences. Pandemics or even epidemics are challenges to the entire social ‘immune system’. If the feeling of being ‘crippled’ is evident within a society, its members to a large extent reflect this attitude (see F.D.Roosevelt’s election, 1933: a handicaped president for a crippled nation trying to escape the great depression). Most members are victims of the tribal culture.

Source: Popp F.A., et al.; 1992; Recent Advances in Biophoton Research; Bischof M.; 1995; Biophotonen, das Licht in unseren Zellen; p.276;Myss C.; 2000; Anatomy of Spirit; (DE ed.); p.144-149; Popp F.A..; 2002; Die Botschaft der Nahrung; p.XXII;Friedman N., 1997; Bridging Science and Spirit; p.274;

57

07-10-29 Madl 57

Concepts of the implicate Order in Nature:

The information-matter-energy triad:IEM-Triad: Nature must be interpreted as matter, energy and information

EQM = h⋅n0, ERT= m 0⋅c2

Energy: the potential for causing change;Information: the quality of a message;Matter: the physical world (frozen wave-function);



Information-Energy-Matter Triad: With the quantum potential, its effect on a particle depends on its form rather than its magnitude. The effect is the same regardless of the strength of the wave. The wave may have larger effects even at long distances, for the wave does not carry energy; it is an information wave (see ship travelling on auto-pilot controlled by satellite: the information contained within the radio waves actually guides the enormous energy possessed by the ship).

• Energy: "the potential for causing changes", is a concept used to understand dynamics of most physical processes

• Information: materialized information becomes matter; • Matter: is the substance of which physical objects are composed. It constitutes the observable

universe. According to the theory of relativity there is no distinction between matter and energy, because matter can be converted to energy, and vice versa. …. Matter is the frozen wavefunction in space-time!

Information is the bridge between soma and significance: The wave function is the mental (or significance aspect) of the electron. The field (wave function) and particle are never separate and are actually aspects of the same reality. The field acts on the particle, not by intensity, but by its form (information). It gives rise to an activity that is identified with meaning (proto-intelligence) guides the electron as radio waves guide the ship.

Source: Dürr H.P., Popp F.A., Schommers W., 2000; Elemente des Lebens; p.259-273;Friedman N., 1997; Bridging Science and Spirit; p.48-50, 53, 79-80;Bischof M. 1995; Biofotonen – Das Licht in unseren Zellen; p.217;Bohm D., 2000; Wholeness and the Implicate Order, p. 147-148 (wikipedia)http://en.wikipedia.org/wiki/Implicate_and_Explicate_Order

58

07-10-29 Madl 58

Resonance - From cell to societies:

Coherence from the cosmic to the atomic level.



Fragmented Science - Our technical capabilities far exceed our current mental capacities. Our theories are not descriptions of reality but rather ever-changing forms of insight – as repeatedly demonstrated by Galileo, Kepler, Newton, Maxwell Einstein, Planck, Feynman, Bohm etc. Our understanding of the world around us has soared, but does this make us any more conscious about what we are really doing, or are we still as ignorant as before?Knowledge: Our Research and scientific investigation should not be completely condemned, but placed into the proper context. By investigating certain natural phenomena, technical challenges, their social implications of new discoveries, we tend to exceed our competence by releasing it to the world not knowing about the long-term consequences – be it the military or on-the edge scientific research. The intellectuals who come up with new discoveries in the first place overestimate the capacity of those who later apply and make use of these innovations. Indeed, what makes science unique and special, the great strength of science, is also its tragic flaw or weakness. Current scientific approaches are still reductionistic. In order to render a scientific problem comprehensible, experts must focus on a tiny fraction of nature. From a western scientific perspective there exists an external world, whose properties are independent of any individual human being and indeed of humanity as a whole. These properties are encoded in ”eternal” physical laws in which experts can obtain reliable (albeit imperfect and tentative) knowledge of these laws by hewing them to “objective” procedures and epistemological structures prescribed by the (so-called) scientific method; i.e. scientists bring it into the laboratory and isolate it from everything else. But in the process from separating it from the context that made it of interest in the first place, we loose all sense of where it fits and why it matters. Science must remain distant from it, must look at it through a microscope, and give it numbers so experts can feed it into a computer. Scientists are not allowed to feel emotional or passionate about it because that may color the way we interpret the data.

• In our western society, science, technology, and human work in general, are split up into specialities, each considered to be separate in essence from the other. Thus, from a human perspective the process of division is a way of thinking about things that are convenient and useful mainly in a practical, technical and fictional sense.

• Today, science and technology are the driving forces in western societies and aim to objectify human’s insight bringing about fragmentation and general confusion. But from the general theory of relativity we know that dimensions such as length, mass, and velocity are illusory, and attain a totally different aspect when different frames of reference are chosen. Apparently, the illusion that the self is separated from the whole has its origins within our way of thinking

59

07-10-29 Madl 59

Expanding Horizons:



H.P.D: Unser körper ist nicht eine superzelle, sondern hat diese zellulare form, weil einfach der informationsfluss muss genügend schnell erfolgen damit man auch schäden sofort ausmerzen kann. Und wenn das zu gross ist dann gehen diese organismen einfach zu grunde ....

The cellular structure can be found throughout the 3D-reality – be it on a galactic scale or all the way down to the atomic scale. However, it is all about interdependence of the involved entities and their relations on tha approriate scale. This are the driving forces that generate and determine “form and shape“ at any given level.

Dürr worked as a particle physisist with W.Heisenberg. During his 50-year investigation into the structure of the atom, he realized that the matter as such does not exist – there is just shape and gestalt (form und gestalt). The particle is an artifact – it is the result of the information and the corresponding energy involved.

Source: modified after Elmqvist et al., 2003;Dürr H.P. Jungk R.; 199 Ökologische Revolution;Dürr H.P.; 2005; 60th congress of the LMHI;

60

07-10-29 Madl 60

Science pretends to be objective, but since Heisenberg, Schrödingerand Planck, we know that there is no such thing as objectivity.

Everything can be explained scientifically – but it would no longer make any sense (Einstein).



i) Die moderne betrachtung der wissenschaft ist so, dass es eigentlich keine exaktheit mehr gibt (Heisenberg’s uncertainty principle). D.h. ich kann nicht die wirklichkeit einfangen in dem ich mit beliebiger genaugigkeit die gegenwart ansehe und die gesetze prüfe, sondern da ist immer eine prinzipielle unschärfe darin, und um zu wissen was passiert muss man ein bisschen das umfeld der fakten auch kennen .... weil exaktheit immer bedeutet dass ich etwas aus dem kontext reisse, dass ich es isoliere .... wenn wir auf exaktheit verzichten, dann kommen die beziehung um so klarer in unser gesichtsfeld .... d.h. unschärfe bedeutet dass wir sensibel werden für die wahrnehmung der gestalt.

ii) D.S.: The great strength of science, is also its tragic flaw or weakness. The very essence of science is that experts must focus on a part of nature. We try to bring it into the laboratory and isolate it from everything else. But in the process from separating it from the context that made it of interest in the first place, we loose all sense of where it fits and why it matters. And the essence of the scientific ideal is that we must objectify that what we are observing. We must remain distant from it, we must look at it through a microscope, we give it numbers so we can fed it into a computer, we don't feel emotional or passionate about it because that may color the way that we interpret our data. The very act of distancing ourselves from that object of nature means that we no longer care.

iii) D.S.: "Do you believe that absolutely everything can be expressed scientifically?" So whenEinstein was asked, can everything be explained scientifically, his answer was Yes, it would be possible, but it would make no sense, it would be description without meaning, as if you would describe Beethoven's symphony as a variation of wave pressure. And of course he is absolutely right. You see, a physicist could describe a Beethoven symphony very very precisely as the sequence of wave pressure striking your ear, but he would absolutely miss the spiritual sense that makes that symphony of any meaning to you.

Source: http://www.photomosaic.com/p/stamps.htmDuerr H.P. Jungk R.; 199 Ökologische Revolution; Suzuki D.; 1992; Wisdom of the Elders; Australian Museum Society, Sydney AUS.

61

07-10-29 Madl 61

Epigenetics – Environment & Consciousness

“The Biology of Belief: Unleashing the Power of Consciousness, Matter and Miracles” is a recent book in the market on epigenetics!

Disclaimer: I haven’t read the book yet.



Important ideas to keep in mind:1. Basic concepts of chromatin and epigenetics.2. Epigenetic (non-DNA) control that may underlie development, cancer, aging, etc. 3. Wide range of biological phenomena in a diverse range of experimental/animal models.4. Epigenetic research in the “post-genomic” era.

62

07-10-29 Madl 62

DNA from the Beginning

Documents

11-06-03 Madl 0 - Uni Salzburg · 11-06-03 Madl 0 The Ghost in our ... •DNA has two chains, each made of nucleotides composed of a deoxy-ribose sugar, ... • xxx: Segments of the