28
1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching in Science, University at Buffalo, State University of New York. by Norris Armstrong, Terry Platt, and Peggy Brickman

1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

  • View
    234

  • Download
    0

Embed Size (px)

Citation preview

Page 1: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

1

The Case of the Druid Dracula: Clicker Case Version

Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching in Science, University at Buffalo, State University of New York.

by Norris Armstrong, Terry Platt, and Peggy Brickman

Page 2: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

2

The Crime

In a quiet corner of Wales in the village of Llanfairpwll, 90-year-old Mabel Leyshorn was murdered. Her murder had been not only brutal (her heart had been hacked out), but also creepy. It appeared as if the Mabel’s blood had been collected in a small kitchen saucepan and tasted. The murder showed other signs of the occult: a candlestick and a pair of crossed pokers had been arranged near the body.

- from BBC’s Crimewatch December 2001

Page 3: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

3

The Crime SceneFurther investigation indicated that this was no supernatural villain at work: the murderer had worn tennis shoes which had left distinctive footprints under the glass door that had been shattered by a piece of broken garden slate. Moreover, the windowsill had bloodstains on it; with any luck, the evidence recovery unit hoped to use it to help determine who had committed the crime.

Page 4: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

4

CQ1: What is your blood type?

A: AB: BC: ABD: OE: Don’t know

Page 5: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

5

Evidence in the Courtroom

• Primarily rape cases• Paternity testing• Historical/missing persons investigations• Military “dog tag”• Convicted felon databases

Sources of DNA?

• Blood was previously used for blood typing• Now used as source of DNA

Uses for DNA fingerprinting

Page 6: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

6

DNA in the CellDNA in the Cell

Target GeneTarget Gene

chromosome

double stranded DNA molecule

individual nucleotides

Page 7: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

7

Example: Amelogenin Gene • Tooth enamel development • Copies on X and Y chromosome• X copy is different from Y copy

Y:

X:

--- indicates missing basesX copy is shorter than Y copy

5’CCCTAGGGTCTA---------GTGTGTTGATTC 5’3’GGGATCCCAGAT---------CACACAACTAAG 3’

GTGTGTTGATTC 3’CACACAACTAAG 5’

5’CCCTAGGGTCTATAACGCCTAGTGTGTTGATTC 5’3’GGGATCCCAGATATTGCGGATCACACAACTAAG 3’

Page 8: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

8

Gel Electrophoresis: Sizing DNA Fragments

(-) Negative electrode

(+) Positive electrode

bp?

bp?

Page 9: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

9

CQ2: The DNA fragment indicated is approximately ____ base pairs in size.

bp?

A: 300B: 350C: 580D: 600E: 700

Page 10: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

10

Why do the two DNA fragments indicated differ in how bright they appear?

Page 11: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

11

•Antiparallel

•Complementary

DNA Structure

Two DNA chains

5′ end

3′ end 5′ end

3′ end

Page 12: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

12

CQ3: Below is one strand from part of the amelogenin gene. What is the nucleotide sequence of the other strand?

A: 3′ -ACTGTTAGATT-5′ B: 3′ -GGGACCCGAGA-5′ C: 5′ -GGGACCCGAGA-3′ D: 3′ -CCCTGGGCTCT-5′ E: 5′ -CCCTGGGCTCT-3′

5’-CCCTGGGCTCT-3’

Page 13: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

13

Copying DNA (Replication)

ATCGGACT

TAGCCTGA

--------

DNA strands are separated

Each single strand is used as a template to make a complementary strand

Two identical DNA molecules are produced

ATCGGACT

TAGCCTGA

- GA-T-

T -C -A -

ATCGGACT

--------

TAGCCTGA

--------

Page 14: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

14

Enzymes Perform Replication

• Helicases unwind DNA double helix.

• Single Stranded Binding Proteins hold separated DNA strands apart.

• Primase makes a starting point (primer).

• DNA polymerase connects new complementary bases.

• Ligase attaches pieces together.

Page 15: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

15

Enzymes Perform Replication

Replication fork

Page 16: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

16

CQ4: How would DNA replication be affected if ligase were not available?

A: The template strands would not be able to separate.

B: Replication would result in many small segments of DNA instead of a complete molecule.

C: Complementary RNA would be produced but not complementary DNA.

D: The DNA strands would separate but replication would not be able to start.

E: The DNA strands produced by replication would not be complementary to the template strands.

Page 17: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

17In 32 cycles at 100% efficiency, 1.07 billion copies of targeted DNA region are created

In 32 cycles at 100% efficiency, 1.07 billion copies of targeted DNA region are created

Amplifying DNA with PCR (Polymerase Chain Reaction)Amplifying DNA with PCR (Polymerase Chain Reaction)

Target region

Thermal cycleThermal cycleThermal cycle

Page 18: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

18

CQ5: You need many copies of the amelogenin gene, which you will make using Polymerase Chain Reaction (PCR). You will need to follow the steps of replication. Which of the following would allow you to begin?

A: Add short stretches of single stranded DNA complementary to the sequence at either end of the gene.

B: Add DNA polymerase enzyme.

C: Break the covalent bonds that hold the double helix together.

D: Break the hydrogen bonds that hold the double helix together.

Page 19: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

19

CQ6: Which of the strands of DNA could act as a primer for the DNA sequence shown below?

5’-CCCTGGGCTCTGTAAATGTTTCTAAGTG-3’3’-GGGACCCGAGACATTTACAAAGATTCAC-5’

A: 3′ -ACTGTTAGA-5′

B: 3′ -AAATTTGGC-5′

C: 3′ -ATGCTTTGA-5′

D: 5′ -GGGACCCGA-3′

E: 5′ -CCCTGGGCT-3′

Page 20: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

20

Automated gels

MW Amelog.

101 bp110 bp

Page 21: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

21

CQ7: The blood left at the crime scene was from a male. Which of the following DNA profiles could have come from the suspect?

A:

B:

Page 22: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

22

CQ8: Is this enough to convict a suspect?

A: Yes

B: No

Page 23: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

23

Additional Markers

---TCAT------TCAT---

Short Tandem Repeats (STRs)Short Tandem Repeats (STRs)

•Same pair in suspect 2:

•Different people have different numbers of repeats on their chromosomes

•Chromosomes 11 of suspect 1:

Page 24: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

24

Positions of other STR

regions

CSF1PO

TH01

TPOX

AMEL

Each person is unique

Page 25: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

25

Druid Dracula: DNA testing

• With kits just add DNA sample with primers for amelogenin (XY) different STR regions.

• Amplify and electrophores.

• Allele ladder shows all varieties in population.

Page 26: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

26

Page 27: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

27

CQ9: What is the chance that someone might have 5 and 7 repeats for the STR THO1 just by accident?

STR THO1 allele frequencies

5 6789

9.310

1/2001/41/61/71/61/3

1/100

A: 1/200B: 1/206C: 1/600D: 1/1200E: 1/2600

Page 28: 1 The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching

28

Hardman’s Arrest• Standard police work identified Matthew Hardman

as a suspect. Preliminary DNA testing provided enough evidence to arrest Hardman on suspicion of murder.

• During the arrest, a knife was found in his coat pocket. Subsequent DNA testing revealed two sources of DNA on the knife, one from Hardman and one matching the victim. The possibility of a random match was one in 73 million.

• A search of Hardman’s dwelling produced magazines and evidence of accessing internet sites featuring how to become a vampire. 

• Matthew Hardman was found guilty of murder on August 2, 2002, and sentenced to life imprisonment.