Upload
others
View
0
Download
0
Embed Size (px)
Citation preview
1
Running head: The role of ethylene in virus-vector interactions 1
2
To whom correspondence should be addressed: 3
Clare L. Casteel 4
Department of Plant Pathology 5
University of California 6
1 Shields Avenue 7
Davis, CA 95616 8
Phone: (530)-752-6897 9
Email: [email protected] 10
11
12
13
14
15
16
Plant Physiology research area: Signaling and Response 17
18
Plant Physiology Preview. Published on July 6, 2015, as DOI:10.1104/pp.15.00332
Copyright 2015 by the American Society of Plant Biologists
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
2
Title: Disruption of ethylene responses by Turnip mosaic virus mediates suppression of 19
plant defense against the aphid vector, Myzus persicae 20
21
Authors: Clare L. Casteel1, Manori De Alwis2, Aurelie Bak1, Haili Dong3, Steven A. 22
Whitham3 and Georg Jander2 23
24 1Department of Plant Pathology, University of California, Davis, CA, 95616, USA 25 2Boyce Thompson Institute for Plant Research, Ithaca, NY, 14853, USA 26 3Department of Plant Pathology and Microbiology, Iowa State University, Ames, IA 27
50011, USA 28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
Summary: A plant virus suppresses plant defense against insect vectors by modulating 47
ethylene responses. 48
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
3
49
Footnotes: 50
This publication was supported by the United States Department of Agriculture award 51
2013-2013-03265 to CLC, University of California start-up funds to CLC, and a grant 52
from the US National Science Foundation, IOS-1121788 to GJ and SAW.53
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
4
Abstract 54
Plants employ diverse responses mediated by phytohormones to defend themselves 55
against pathogens and herbivores. Adapted pathogens and herbivores often manipulate 56
these responses to their benefit. Previously we demonstrated that Turnip mosaic virus 57
(TuMV) infection suppresses callose deposition, an important plant defense induced in 58
response to feeding by its aphid vector (Myzus persicae), and increases aphid fecundity 59
compared to uninfected control plants. Further, we determined that production of a single 60
TuMV protein, NIa-Pro (Nuclear Inclusion a - Protease domain), was responsible for 61
changes in host plant physiology and increased M. persicae reproduction. To characterize 62
the underlying molecular mechanisms of this phenomenon, we examined the role of three 63
phytohormone signaling pathways, jasmonic acid, salicylic acid, and ethylene, in TuMV-64
infected Arabidopsis thaliana (Arabidopsis), with and without aphid herbivory. 65
Experiments with Arabidopsis mutants, ethylene insensitive2 (ein2) and ethylene 66
response1 (etr1), as well as chemical inhibitors of ethylene synthesis and perception 67
(aminoethoxyvinylglycine and 1-methylcyclopropene, respectively), show that the 68
ethylene signaling pathway is required for TuMV-mediated suppression of Arabidopsis 69
resistance to M. persicae. Additionally, transgenic expression of NIa-Pro in Arabidopsis 70
alters ethylene responses and suppresses aphid-induced callose formation in an ethylene-71
dependent manner. Thus, disruption of ethylene responses in plants is an additional 72
function of NIa-Pro, a highly conserved Potyvirus protein. Virus-induced changes in 73
ethylene responses may mediate vector-plant interactions more broadly and thus 74
represent a conserved mechanism for increasing transmission by insect vectors across 75
generations. 76
77
78
79
80
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
5
Introduction 81
Plants suffer from numerous pathogen and herbivore challenges in both natural and 82
agricultural environments, often facing multiple simultaneous threats (Casteel and 83
Hansen, 2014). For example, many plant pathogens depend of insect vectors for 84
transmission, including over 75% of all described plant viruses (Nault, 1997). Thus, 85
plants must recognize, prioritize, and mount the most appropriate response to both the 86
insect that is feeding and the pathogen being transmitted. Despite constant attack, plants 87
persist, largely due to a sophisticated surveillance system that is orchestrates an arsenal of 88
defenses that may be morphological, biochemical, or molecular in nature (Jones and 89
Dangl, 2006; Jander and Howe, 2008). Nevertheless, pathogens and insects successfully 90
colonize plants by actively compromising plant perception and/or defense responses. 91
Recent studies show that synergisms exist between challengers, where both 92
parties benefit during dual attack. For example, some virus infections can decrease plant 93
defenses against insects, increasing plant palatability and vector fitness. Consequently, 94
improved insect performance will increase the number of viruliferous vectors, promoting 95
virus transmission to new hosts (Mauck et al., 2010; Casteel and Jander, 2013; Casteel et 96
al., 2014; Li et al., 2014). Thus, vector-plant interactions represent a critical and 97
synergistic relationship, ultimately determining survival and host range. Although 98
numerous studies have examined virus-plant interactions, few have examined the 99
molecular and genetic mechanisms mediating plant-virus-vector interactions and 100
alterations in plant defenses (Li et al., 2014; Mauck et al., 2014). 101
While defenses vary wildly across plant species, the phytohormones that regulate 102
their production are somewhat conserved (Mauck et al., 2014). Modulation of hormone 103
composition, timing, and concentration specifies plant responses to an attack (Mur et al., 104
2006; Verhage et al., 2010) and represents an excellent target for compromising defenses. 105
Numerous studies have demonstrated that at least three phytohormones, jasmonic acid 106
(JA), salicylic acid (SA) and ethylene (ET), have major roles in orchestrating plant 107
defense responses (Bari and Jones, 2009; Erb et al., 2012; Pieterse et al., 2012). In 108
general, SA signaling is critical for defense responses against a wide range of pathogens, 109
including viruses (Glazebrook, 2005; Carr et al., 2010). Production of JA and ET, 110
meanwhile, are involved in regulation of plant response to herbivores, necrotrophic 111
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
6
pathogens, and non-pathogenic microbes (Glazebrook, 2005; Howe and Jander, 2008; 112
Van der Ent et al., 2009). Virus infection can also alter JA and ET signaling (Carr et al., 113
2010; Lewsey et al., 2010; Wei et al., 2010; Mauck et al., 2014). 114
Together, Arabidopsis thaliana (Arabidopsis), Myzus persicae (green peach 115
aphid), and Turnip mosaic virus (TuMV) constitute an excellent model system for 116
investigating the molecular and biochemical mechanisms that underlie plant-aphid-virus 117
interactions. As a well-studied model plant, Arabidopsis provides numerous genetic 118
resources that can be used to investigate responses to aphid feeding and virus infection. 119
M. persicae is a broad host range aphid and the world’s most prolific plant virus vector, 120
transmitting more than 100 different viral species (Kennedy et al., 1962). M. persicae is 121
the most common aphid pest on Arabidopsis in greenhouses and growth chambers (Bush 122
et al., 2006), and we also have observed it feeding from Arabidopsis growing in nature. 123
Due to the agricultural relevance of M. persicae, there is a large body of literature about 124
the biology of this insect and its interactions with host plants, going back more than 100 125
years. More recently, several research groups have initiated projects to study plant 126
defense against aphids using Arabidopsis and M. persicae as a model system (De Vos et 127
al., 2007; Louis and Shah, 2013). TuMV is a positive-strand RNA virus that infects not 128
only Arabidopsis but also hundreds of other species in more than forty plant families 129
(Walsh and Jenner, 2002). It is considered to be one of the most damaging viruses for 130
vegetable crops worldwide (Tomlinson, 1987; Nguyen et al., 2013; Yasaka et al., 2015) 131
and is transmitted by M. persicae and many other aphid species in both natural and 132
agricultural settings (Shattuck, 1992). Largely due to its ability to systemically infect 133
Arabidopsis (Sanchez et al., 1998; Martin Martin et al., 1999), TuMV has become a 134
model for potyvirus-host interactions (Walsh and Jenner, 2002). 135
In this study, we investigate the role of phytohormone signals in TuMV’s ability 136
to suppress plant defense and enhance aphid fecundity during infection of host plants. 137
First we show that TuMV infection induces SA and ET accumulation in Arabidopsis. 138
Next, using genetic and pharmacological analyses, we demonstrate that ET signaling is 139
necessary for TuMV-initiated suppression of plant defense responses and enhanced aphid 140
reproduction in plants. Further, we show that expression of the viral protein, NIa-Pro, 141
alters ET responses and that ET is also required for NIa-Pro’s role in suppressing aphid-142
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
7
induced defense in virus-infected plants. This molecular, biochemical, and genetic 143
evidence reveals that TuMV may modulate ET responses not only to increase plant 144
susceptibility to infection but also to increase vector performance. 145
146
Results 147
SA, JA, and ET were quantified in Arabidopsis plants challenged with TuMV, aphids, 148
and the combination of the two (Fig. 1). TuMV-GFP infection more than doubled SA and 149
ET production in host plants relative to controls. Aphid feeding had no significant impact 150
on SA or ET accumulation (Fig. 1A, C), but induced JA accumulation more than four-151
fold relative to control plants (Fig. 1B). There were no significant impacts of TuMV in 152
combination with aphids on SA, JA, and ET. 153
To determine the biological relevance of these phytohormone changes, we 154
surveyed Arabidopsis mutants that were compromised in individual signaling pathways 155
for enhanced aphid fecundity on TuMV-infected plants. Aphids produced significantly 156
more progeny on TuMV-infected wildtype Arabidopsis and mutants compromised in SA 157
signaling controls (salicylic acid induction deficient2, sid2-1; non-expresser of pr1, npr1-158
2; Fig. 2). This suggests that a functioning SA signaling pathway is not required for 159
TuMV’s ability to enhance aphid fecundity. In contrast to SA signaling mutants, aphid 160
reproduction was not enhanced by TuMV-GFP infection of mutants insensitive to ET 161
(ethylene insensitive2, ein2-1; ethylene receptor1, etr1-3; Fig. 2). Although aphid 162
performance was not enhanced on the JA-insensitive mutant coronatine insensitive1 163
(coi1) infected with TuMV-GFP compared to the mock-inoculated mutant, aphids 164
generally performed better on coi1 plants compared to wild type controls without TuMV-165
GFP. This was not observed in another JA insensitive mutant (jasmonate insensitive 1, 166
jin1; Fig. 2). As reported previously, M. persicae produced more progeny on plants with 167
defects in JA signaling (Mewis et al., 2005). Together, these results indicate that 168
induction of ET and components of jasmonic signaling may be critical to TuMV’s ability 169
to enhance aphid fecundity during infection of host plants, whereas the induction of 170
salicylic acid is not. 171
To further investigate the role of ET signaling in virus-vector interactions, we 172
used a pharmacological approach to inhibit ET signaling. TuMV-infected Arabidopsis 173
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
8
plants were treated with aminoethoxyvinylglycine (AVG), which inhibits ET biosynthesis 174
(Amrhein and Wenker, 1979) or with 1-methylcyclopropene (MCP), which blocks ET 175
perception by binding to ET receptors (Sisler, 2006). Two chemical inhibitors were used 176
in experiments because, although AVG is easier to work with, it is known to also impact 177
auxin signaling in host plants (Soeno et al., 2010). Aphids were then caged on these 178
plants and allowed to develop and reproduce over time. TuMV-GFP infection did not 179
enhance aphid fecundity when ET perception (Fig. 3A, C; MCP) or biosynthesis (Fig. 180
3B,D; AVG) was inhibited in Arabidopsis and Nicotiana benthamiana, further 181
confirming the genetic approaches described above (Fig. 2). 182
Previously, we demonstrated that TuMV infection inhibits aphid-induced callose 183
production in host plants (Casteel et al., 2014). Since ET plays a major role in bacteria-184
triggered callose deposition (Clay et al., 2009), it may be required for inhibition of aphid-185
induced callose deposition by TuMV. Consistent with this hypothesis, aphid-induced 186
callose was inhibited in wildtype plants infected with TuMV, while aphids induced 187
callose deposition significantly in ET signaling mutants infected with TuMV-GFP (Fig. 188
4A). Next, we treated plants challenged with TuMV-GFP using the ET inhibitors MCP 189
and AVG, as described above, and quantified aphid-induced callose accumulation. While 190
TuMV-GFP infection inhibited aphid-induced callose deposition in wild type plants, 191
aphid feeding induced significant callose deposition in infected plants treated with ET 192
biosynthesis or perception inhibitors (Fig. 4B, C). Additionally, callose induction in 193
TuMV-infected plants was generally higher in plants with compromised ET signaling as 194
compared to corresponding controls (Fig. 4), suggesting that induction of ET during virus 195
infection (Fig. 1C) may play a major role in inhibition of virus-induced callose formation. 196
To determine the role of ET induction in enhanced aphid fecundity, we treated mock- and 197
TuMV-infected plants with 20 ppm of ET. Aphids were then added as previously 198
described and fecundity quantified. Treatment of plants with ET did not enhance aphid 199
fecundity in either treatment significantly (Fig. 5), suggesting that the amount of ET 200
added is beyond the threshold required to increase aphid performance and aphids will not 201
benefit further. 202
NIa-Pro is the major protease needed to process the TuMV polyprotein into 203
individual functioning proteins (Urcuqui-Inchima et al., 2001). Recently, we 204
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
9
demonstrated the additional ability of NIa-Pro to inhibit plant defenses and increase aphid 205
performance (Casteel et al., 2014). Further experiments were designed to determine 206
whether ET signaling is required for NIa-Pro’s ability to enhance aphid performance and 207
inhibit plant defenses (Fig. 6). Consistent with previous results, aphid-induced callose 208
was inhibited and aphids were significantly more fecund on plants expressing NIa-Pro 209
compared to empty vector controls (Fig. 6A, B, C). However, when ET signaling was 210
inhibited in plants expressing NIa-Pro, aphid fecundity was not increased (Fig. 6A, B). 211
While inhibition of aphid-induced callose was prevented in transgenic plants expressing 212
NIa-Pro treated with AVG, the same pattern was not observed with MCP (Fig. 6B, C). 213
Surprisingly, all plants treated with MCP had greater amounts of callose (Fig. 6B). 214
However, this is consistent with a lack of significant difference in aphid fecundity 215
observed on these plants (Fig. 6A). These results suggest that ET signaling is required for 216
NIa-Pro’s ability to enhance aphid performance. 217
To test the hypothesis that NIa-Pro expression alters ET production in plants, we 218
conducted experiments with transgenic Arabidopsis expressing NIa-Pro. While there was 219
no significant difference in ET production between wild type plants and plants expressing 220
the empty vector, plants expressing NIa-Pro produced greater amounts of constitutive ET 221
compared to both controls (Fig. 7). Next we examined ethylene-dependent and ethylene-222
independent changes in transcript abundance to determine the generality of the response. 223
We measured accumulation of EIN2, a positive regulator of the ET signaling pathway 224
(Qiao et al., 2009), EIN3, a key transcription factor mediating ethylene-regulated gene 225
expression (Guo and Ecker, 2003), ERF1, a transcription factor induced by ET 226
production and targeted by EIN3 (Solano et al., 1998), acting down-stream of EIN2 227
(Stepanova and Alonso, 2005), and an ethylene inducible plant defensin (PDF1.2) 228
(Penninckx et al., 1998). We did not observe a major modification of EIN2 or EIN3 229
transcript abundance in TuMV or aphid treatments (Fig 8A, B). However, EIN2 transcript 230
accumulation was increased in the plants expressing EV and NIa-Pro with aphid feeding 231
(Fig. 8A). EIN2 and EIN3 accumulation are not regulated by ethylene production as 232
evident in previous studies (Alonso et al., 1999; Guo and Ecker, 2003). In contrast to 233
EIN2 and EIN3, ERF1 and PDF1.2 are induced by ethylene production (Brown et al., 234
2003; Lorenzo et al., 2003). ERF1 transcript abundance is increased in plants by aphid 235
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
10
feeding, TuMV infection, and NIa-Pro expression (Fig. 8C). Additionally, aphid feeding 236
on plants expressing NIa-Pro increased ERF1 transcript abundance the most compared to 237
all other treatments (Fig. 7C). Surprisingly, PDF1.2 was not induced by TuMV infection, 238
but was significantly increased in plants expressing NIa-Pro (Fig. 8D) compared to 239
controls. However, PDF1.2 was not induced in plants expressing NIa-Pro with aphid 240
feeding compared to controls (Fig. 8D). Next we measured the accumulation of OSR1 241
and AZI1, two transcripts not related to ethylene signaling or ethylene-induced defense 242
responses, but robustly induced in response to ethylene treatment (Hall et al., 2012). 243
TuMV infection increased OSR1 accumulation, while aphid feeding induced AZI1 244
accumulation compared to controls (Fig. 9). However, in contrast to the ethylene-induced 245
transcripts related to plant defenses (ERF1 and PDF1.2), NIa-Pro expression did not alter 246
accumulation of OSR1 and AZI1 (Fig. 9). These results show that NIa-Pro expression 247
interferes with a specific set of ET-induced defense responses. 248
Induction of ET by TuMV may indirectly benefit the virus by increasing vector 249
performance and thus the number of inoculated vectors available for transmission. ET 250
induction also may benefit the virus directly by increasing infection efficiency or 251
performance. To determine whether ET induction is directly beneficial to TuMV, we 252
challenged three-week-old Arabidopsis mutants that were insensitive to ET (ein2-1; etr1-253
3) and mutants that constitutively induce ET (eto1-2; Fig. 10) with TuMV. Next, the 254
number of infected plants was quantified after 5 days. Significantly greater numbers of 255
ET-insensitive mutants were infected compared to wild type controls (Fig. 10). However, 256
in mutants that constitutively produce ET, there was no difference in infection rate (Fig. 257
10). These findings indicate that induction of ET signaling is important for successful 258
TuMV infection of Arabidopsis. 259
260
Discussion 261
Our results demonstrate that ET responses are critical for TuMV-vector 262
synergisms. TuMV induces ET production (Fig. 1), and ET biosynthesis and perception 263
are required for NIa-Pro to suppress plant defenses and increase insect performance on 264
infected host plants (Fig. 2, 3, 4, 6). Further, expression of NIa-Pro directly increases ET 265
production (Fig. 7) and alters a specific set of ethylene-induced defense transcripts (Fig. 8 266
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
11
and 9). Additionally, plants with compromised ET signaling are more resistant to TuMV 267
(Fig. 8). Taken together, these results suggest that TuMV may be inducing ET production 268
in order to increase plant susceptibility. Alterations in ET also benefit aphids, increasing 269
insect fecundity on infected plants, and therefore the number of viruliferous aphids. Virus 270
infection and aphid feeding have been shown to influence the production of ET (Love et 271
al., 2005; Love et al., 2007; Kim et al., 2008; Mantelin et al., 2009; Chen et al., 2013; 272
Haikonen et al., 2013; Mandadi et al., 2014; Mauck et al., 2014), though ET’s role in 273
vector-virus-plant interactions has not yet been demonstrated. Virus-induced changes in 274
ET responses may mediate vector-plant interactions more broadly and thus represent a 275
conserved mechanism for increasing transmission by insect vectors across generations. 276
ET regulates plant responses to biotic and abiotic stress and mediates plant 277
development and senescence (van Loon et al., 2006; Koyama, 2014). No generalized role 278
of ET in plant-virus interactions has been established. Also, only a few systems have 279
been investigated with significant variation across interactions (van Loon et al., 2006; 280
Love et al., 2007; Kim et al., 2008; Endres et al., 2010; Haikonen et al., 2013; Mauck et 281
al., 2014). However, ET may play an important role in antiviral defense. Recent studies 282
found that Arabidopsis ein2 and etr1 mutations increased resistance to Tobacco mosaic 283
virus and Cauliflower mosaic virus (Love et al., 2005; Love et al., 2007; Chen et al., 284
2013), consistent with our results. Further, overexpression of ERF5, an ET response 285
transcription factor, from Nicotiana tabacum conferred reduced susceptibility to Tobacco 286
mosaic virus, indicating an important role of ET in plant-virus interactions. Increases in 287
ET production following aphid feeding also have been reported in various plant–aphid 288
interactions. However, ET production has been associated with both increased 289
susceptibility and resistance to aphids (Miller et al., 1994; Argandoña et al., 2001; 290
Mantelin et al., 2009; Lu et al., 2014; Wu et al., 2015). The role of ET in both plant-virus 291
and plant-aphid interactions may be mediated by the compatibility of the interactions, 292
although additional studies are needed to confirm this. 293
NIa-Pro is the main protease for TuMV, cleaving the TuMV polyprotein into 294
individual proteins (Urcuqui-Inchima et al., 2001). NIa-Pro possesses relatively strict 295
substrate specificity, cleaving after Gln at Val-Xaa-His-Gln (Kang et al., 2001). A 296
previous study demonstrated that the same consensus sequence site, Val-Xaa-His-Gln, 297
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
12
exists in an amyloid-β peptide from animals and NIa-Pro has activity against this site 298
(Han et al., 2010). It is possible that NIa-Pro also cleaves a plant protein that possesses 299
the NIa-Pro cleavage substrate. Yet NIa-Pro also has other functions, including non-300
specific DNAse activity (Anindya and Savithri, 2004; Rajamäki and Valkonen, 2009), 301
and may possess additional unknown functions that are critical to aphid-virus-plant 302
interactions. 303
Relatively few studies have identified the host plant genes that mediate virus-304
plant-vector interactions. However, two host proteins have been identified that may 305
mediate plant interactions with Tomato yellow leaf curl China virus (TYLCCNV) and its 306
whitefly vector (Bemisia tabaci). TYLCCNV-infected plants have reduced defense 307
responses and impaired JA signaling, benefiting whitefly vectors and increasing 308
attraction. TYLCCNV is transmitted with a betasatellite pathogenicity factor, βC1, which 309
mediates suppression of plant signaling and defense responses (Yang et al., 2008; Zhang 310
et al., 2012). Recently, host proteins were identified that interact with βC1 and mediate 311
suppression of plant signaling and defense responses. βC1 interacts with the 312
ASYMMETRIC LEAVES1 (ASI), which suppress JA signaling, and with the 313
transcription factor MYC2, compromising activation of plant defense responses (Yang et 314
al., 2008; Li et al., 2014). Future identification of host proteins that interact with NIa-Pro 315
will shed light on this novel function. 316
While ET signaling is required for TuMV’s ability to increase aphid fecundity, it 317
does not appear that NIa-Pro is targeting a key regulator of ethylene signaling, as NIa-Pro 318
alters a specific set of ethylene-induced defense transcripts (Fig. 8 and 9). Signaling by 319
other hormones could also be involved. Virus infection alters the accumulation of many 320
plant hormones, which can be viewed as either a disruption to a susceptible host, or a 321
coordination of responses by a resistant host (Alazem and Lin, 2014). Consistent with 322
previous findings (Ellis et al., 2002), aphids produced more progeny on a coi1 mutant, 323
which lacks a receptor for JA-isoleucine conjugates, than on wildtype Arabidopsis. 324
Additionally, TuMV-enhanced aphid fecundity was not observed on the coi1 mutant, 325
suggesting the involvement of JA signaling in virus-vector-plant interactions (Fig. 2). In 326
contrast to coi1, TuMV-GFP infection in jin1, another JA signaling mutant, still 327
enhanced aphid fecundity (Fig. 2). These results suggest that NIa-Pro may target 328
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
13
components of this pathway in addition to ET. Significant cross talk exists between the 329
ET and JA pathways. However changes may not be directly related to JA. For example, 330
ethylene-dependent inhibition of root growth (Adams and Turner, 2010) and 331
susceptibility to Verticillium longisporum (Ralhan et al., 2012) are altered in the coi1 332
mutant independently of JA biosynthesis and related signaling. Thus, alterations in as yet 333
unknown components of COI1 signaling may explain our observed results. 334
Although genetic resistance in the host plants is currently the best approach for 335
TuMV management, such resistance is not available for all crop species or it may fail 336
because it is not effective against all strains of the virus (Shattuck, 1992). Therefore, 337
research on the interactions between TuMV, its aphid vectors, and host plants is 338
necessary for the development of new strategies to combat viral infections in agricultural 339
crops. Although further research on the interactions between M. persicae, TuMV, and 340
their host plants will be needed, the results presented here suggest that manipulation of 341
ethylene signaling in response to virus infection may provide a means to limit the spread 342
and transmission of TuMV in plants. 343
344
Materials and Methods 345
Plants and growth conditions - Wild type Arabidopsis thaliana (Arabidopsis) 346
Columbia-0 (Col-0) and Arabidopsis mutants in the Col-0 background (sid2-1, npr1-2, 347
jin1-1, coi1-1, ein2-1, eto1-2, and etr1-3) were obtained from the Arabidopsis Biological 348
Resource Center (www.arabidopsis.org). Nicotiana benthamiana seeds were obtained 349
from Peter Moffett (Université de Sherbrooke, Quebec, Canada). Plants were grown in 350
Conviron growth chambers in 20 × 40-cm nursery flats using Cornell Mix (by weight 351
56% peat moss, 35% vermiculite, 4% lime, 4% Osmocoat slow-release fertilizer [Scotts, 352
Marysville, OH], and 1% Unimix [Scotts, Marysville, OH]) at 23°C and a 16:8-h 353
light:dark photoperiod, as previously described (Casteel et al., 2014). Seeds from 354
COI1/coi1-1 Arabidopsis were planted and grown as previously described (Rasmann et 355
al., 2012). Plants were grown for 3 weeks and were used in experiments before flowering, 356
unless otherwise noted. All experiments were conducted at least 2 times, with varying 357
numbers of biological replicates per treatment per experiment. 358
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
14
TuMV infection - TuMV-GFP was propagated from infectious clone p35TuMVGFP 359
(Lellis et al., 2002). To prepare inoculum, fully infected N. benthamiana leaves were 360
collected three weeks after inoculation and weighed. Leaves were then ground in 2 361
volumes 20 mM sodium phosphate buffer (pH 7.2), filtered through organza mesh cloth, 362
and frozen in aliquots at –80ºC. For inoculations, one leaf from each plant was dusted 363
with carborundum (Sigma, St. Louis, MO) and rub-inoculated with TuMV-GFP sap using 364
a cotton-stick applicator. A corresponding set of control plants was dusted with 365
carborundum and mock-inoculated with a cotton-stick applicator that was soaked in 366
uninfected N. benthamiana sap in 20 mM phosphate buffer, prepared in the same manner 367
as the virus-infected sap (mock inoculation treatment throughout the manuscript). Ten 368
days after inoculation, a UV lamp (UV Products, Upland, CA, Blak Ray model B 100AP) 369
was used to identify fully infected leaves. For infection rate bioassays, a UV light was 370
used after 5 day post inoculation to identify infected plants. 371
Insects - All experiments were conducted with a tobacco-adapted red strain of Myzus 372
persicae (green peach aphid) that was obtained from Stewart Gray (USDA Plant Soil and 373
Nutrition Laboratory, Ithaca, NY, USA). Aphids were reared on tobacco (N. tabacum) 374
with a 16:8-h light:dark photoperiod at 24 °C (150 mmol m-2 s -1). 375
Aphid bioassays - To assess the effect of TuMV infection on aphid fecundity, one 376
apterous adult aphid was placed in a plastic clip cage on the underside of a fully infected 377
or mock-inoculated N. benthamiana or the full leaf of Arabidopsis. After 24 hours, all 378
aphids except one nymph were removed. The single nymph was allowed to develop and 379
progeny were counted after 7 to 9 days to determine fecundity. 380
Jasmonic acid and salicylic acid analysis – Wildtype Arabidopsis were planted as 381
described above and, after three weeks of growth, half of the plants were infected with 382
TuMV-GFP as described above. After one week, infected plants were identified by 383
fluorescence under UV light. For aphid induction, 15 adult apterous aphids were caged 384
on one leaf per plant on six plants with TuMV-GFP infection and six mock-inoculated 385
plants. Corresponding sets of individual leaves received cages with no aphids as a control 386
(six plants with TuMV-GFP infection and six mock-inoculated plants). Caged leaves 387
were developmentally matched and infected leaves were verified for full infection before 388
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
15
caging based on GFP visualization. Twenty-four hours after aphid placement, each caged 389
leaf was harvested individually. Harvested leaves were weighed and placed in tubes 390
containing two steel balls, before being flash-frozen in liquid nitrogen and stored at -391
80°C until further use. One mL extraction buffer (iso-propanol:H2O:HCl , 2:1:0.005, v/v) 392
was added to each sample. d4-SA and d5-JA (CDN isotopes, Point-Claire, Canada) were 393
added as internal standards and samples were homogenized in a paint shaker for 45 s. 394
Samples were dissolved in 200 µL methanol after extraction with dichloromethane and 395
solvent evaporation, and 15 µL were analyzed using a triple-quadrupole LC-MS/MS 396
system (Quantum Access; Thermo Scientific, Waltham, MA, USA). Samples were 397
separated on a C18 reversed phase HPLC column (Gemini-NX, 3µ, 150 x 2.00 mm; 398
Phenomenex, Torrance, CA, USA) using a gradient of 0.1% formic acid in water and 399
0.1% formic acid in acetonitrile at a flow rate of 300 µL min-1, as previously described 400
(Rasmann et al., 2012). 401
Ethylene analysis - Four leaves were cut from each of twelve mock-inoculated plants 402
and from twelve TuMV-GFP-infected plants and weighed. Only fully infected leaves 403
were used and all leaves were developmentally matched, as previously described. The 404
four leaves from each individual plant were then placed in a gas-tight 10 ml glass jar with 405
1 ml of water. To allow wound-induced ethylene to dissipate, jars were left open for two 406
hours. After this period, 15 adult apterous aphids each were added half of the jars for 407
each treatment and all jars were sealed. Twenty-four hours after jars were sealed, a 1 ml 408
sample of head space was injected using a loop injector and in analyzed using a gas 409
chromatograph equipped with a flame ionization detector (Agilent, Santa Clara, CA; 410
column: GS-GAS PRO, Custom Column 5" Cage, Length 30, Diameter 0.32 mm, Limits 411
from –80 to 260 (isothermal) program 300). Samples were compared to a standard of 412
known concentration and values (nl/h g fresh weight) representing averages from several 413
independent plants of treatment (n = 6 per line). Ethylene production in Arabidopsis 414
mutants and in the inhibition experiment below was verified by this method as well. 415
Ethylene inhibition experiments - To examine the role of ethylene in virus-vector 416
interactions ethylene signaling was inhibited using 1-methylcyclopropene (MCP), which 417
blocks ethylene perception by binding to ethylene receptors and 418
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
16
aminoethoxyvinylglycine (AVG), which inhibits ethylene biosynthesis. For MCP 419
treatment 1 mg of MCP (0.14%) was dissolved in 100 mL of distilled water. Next, each 420
flat of plants was enclosed in an airtight container and twenty ml of the MCP solution 421
was immediately placed in each glass jar in the container with the plants. As a control, a 422
similar experiment was set up with water. Plants were removed after 24 hours. MCP 423
treatment was done thrice: once the day after infecting, once the day before aphids were 424
put on the plants, and once four days after aphids were added. For AVG treatment, 1 425
gram of AVG was dissolved in 1 liter of water with 0.05% Silwet (Momentive 426
Performance Materials, Waterford, New York). Plants were treated on the day after 427
infecting, and every four days until experiments were finished. 428
Ethylene induction experiments - We challenged plants with TuMV, as previously 429
described (Casteel et al., 2014). The plants were divided equally into two airtight 430
chambers and ethylene was injected to a concentration of 20 ppm. Four days later, aphids 431
were added as described above and plants were treated again with ethylene. A final 432
ethylene treatment was applied four days after aphids were added. At the end of the 433
experiment, aphid progeny were counted. 434
Callose staining - Arabidopsis leaves were collected 24 hours after infestation with 25 435
aphids, depending on the experiment. Callose accumulation was visualized as previously 436
described (Casteel et al., 2014). Briefly, leaves were cleared in 95% ethanol overnight 437
and stained with 150 mM K2P04 (pH 9.5), 0.01% aniline blue for 2 h. The leaves were 438
examined for UV fluorescence using a Leica fluorescence compound microscope (365 439
nm excitation, 396 nm chromatic beam splitter, 420 nm barrier filter), and callose spots 440
were quantified manually. 441
Arabidopsis transgenic plants - The transformation vectors harboring pMDC32 NIa-442
Pro or the pMDC32 empty vector were introduced into Agrobacterium tumefaciens and 443
transferred into wildtype Arabidopsis plants by floral dip transformation (Clough and 444
Bent, 1998). Positive transgenic lines were screened on kanamycin Murashige and Skoog 445
(MS) agar plates and then confirmed by reverse-transcription PCR. Single leaves of four–446
week-old Arabidopsis transformed with the pMDC32 empty vector, or constitutively 447
expressing NIa-Pro, were used in experiments as described above. 448
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
17
Transcript abundance analysis - Total RNA was extracted from frozen tissue samples 449
using the SV Total RNA Isolation system with on-column DNAse treatment (Promega, 450
Madison, WI). RNA integrity was verified using a 1.2% agarose gel. After RNA 451
extraction and DNAse treatment, 1µg of total RNA was reverse transcribed with SMART 452
MMLV reverse transcriptase (Clonetech, Mountain View, CA) using an oligo-dT12-18 453
primer. Transcript abundance was analyzed with quantitative real-time RT-PCR (qRT-454
PCR), with UBQ10 (ubiquitin 10, At4g05320; 455
AAGAGATAACAGGAACGGAAACATA; 456
GGCCTTGTATAATCCCTGATGAATAA) as the reference gene. Primers were 457
synthesized following the recommendation of Primer-Blast 458
(http://www.ncbi.nlm.nih.gov/tools/primer-blast/; EIN2; At5g03280; 459
GCTCTGTTAGGGCTTCCTCCA; AGCCACTCTAACGCTTACTTGTT; ERF1; 460
At3g23240; AAAGCAGCTTGATCGTAGGC; 461
ATTCGACTAGAAACGGTATTAGGG; EIN3; At3g20770; 462
TTGATCGTAATGGTCCTGCG; TCCTCTTTCCCATTAGGCCA; OSR1; At2g41230; 463
GAACCTCTCGACCCCTGAT; TGACATGATCTTACTTGCACGA; PDF1.2; 464
At5g44420; TTTCGACGCACCGGCAATG; TGCTGGGAAGACATAGTTGCATGA; 465
AZI1; At4g12470; GTCTATGCACTGCTCTGAGG; ACGATATTGTGCACTGGCAT). 466
Quantitative RT-PCR was performed using the QuantStudio™ 6 Flex Real-Time PCR 467
System in a 10 μL mixture containing SYBR® Green PCR master mix (Applied Bio-468
systems, http://www.lifetechnologies.com). The cycling conditions comprised 10 min 469
polymerase activation at 95°C followed by 40 cycles at 95°C for 15 sec, 55°C for 1 min 470
and 72°C for 40 sec. Following cycling, the melting curve was determined. Each assay 471
was conducted in triplicate and included a no-template control. Ct values were 472
automatically determined for all plates and genes using the QuantStudio™ 6 Flex Real-473
Time PCR System Software. In order to ensure comparability between data obtained 474
from different genes, all samples were in a same plate. Analysis of qRT-PCR 475
fluorescence data was then performed using the standard curve method. 476
Statistical analysis - Aphid fecundity on phytohormone signaling mutants was analyzed 477
with t-tests comparing mock- and TuMV-infected treatments for each mutant. All 478
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
18
remaining aphid fecundity and callose induction data were analyzed by ANOVA, with 479
infection /NIa-Pro expression status, and aphid feeding as main factors. Virus infection 480
rate was analyzed with chi-squared tests. Phytohormone induction data were analyzed by 481
ANOVA. Transcript abundance data were analyzed byANOVA, followed by a Tukey’s 482
HSD post-hoc test. All analyses were performed in JMP 8 software (SAS Institute, Cary, 483
NC, USA). Phytohormone experiments included 4-6 experimental units per treatment. 484
All fecundity experiments were repeated at least twice and consisted of 12-30 485
experimental units per treatment. All callose experiments included 4-6 experimental units 486
per treatment. TuMV-GFP infection experiments were repeated 3 times and consisted of 487
30-40 experimental units per treatment. For qRT-PCR three biological replicates were 488
analyzed per treatment for two separate experiments. 489
Acknowledgments 490
We thank Julia Vrebalov, Jim Giovannoni, and Lee Ann Richmond for valuable advice 491
on ethylene measurements, induction experiments, and for use of a gas chromatograph, 492
M.R. Sudarshana for use of the qPCR machine, and William Miller for a donation of 1-493
methylcyclopropene. 494
495
496
497
498
499
500
501
502
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
19
Literature Cited 503
Adams E, Turner J (2010) COI1, a jasmonate receptor, is involved in ethylene-induced 504 inhibition of Arabidopsis root growth in the light. J Exp Bot 61: 4373-4386 505
Alazem M, Lin NS (2014) Roles of plant hormones in the regulation of host-virus 506 interactions. Mol Plant Pathol 507
Alonso JM, Hirayama T, Roman G, Nourizadeh S, Ecker JR (1999) EIN2, a 508 bifunctional transducer of ethylene and stress responses in arabidopsis. Science 509 284: 2148-2152 510
Amrhein N, Wenker D (1979) Novel inhibitors of ethylene production in higher plants. 511 Plant Cell Physiol 20: 1635-1642 512
Anindya R, Savithri HS (2004) Potyviral NIa proteinase, a proteinase with novel 513 deoxyribonuclease activity. J Biol Chem 279: 32159-32169 514
Argandoña VH, Chaman M, Cardemil L, Muñoz O, Zúñiga GE, Corcuera LJ 515 (2001) Ethylene production and peroxidase activity in aphid-infested barley. J 516 Chem Ecol 27: 53-68 517
Bari R, Jones JD (2009) Role of plant hormones in plant defence responses. Plant Mol 518 Biol 69: 473-488 519
Brown RL, Kazan K, McGrath KC, Maclean DJ, Manners JM (2003) A role for the 520 GCC-box in jasmonate-mediated activation of the PDF1.2 gene of Arabidopsis. 521 Plant Physiol 132: 1020-1032 522
Bush J, Jander G, Ausubel FM (2006) Prevention and control of pests and diseases. In 523 J Salinas, JJ Sanchez-Serrano, eds, Arabidopsis protocols, second edition. 524 Humana Press, Totowa, pp 13-25 525
Carr JP, Lewsey MG, Palukaitis P (2010) Signaling in induced resistance. Adv Virus 526 Res 76: 57-121 527
Casteel C, Hansen A (2014) Evaluating insect-microbiomes at the plant-insect interface. 528 J Chem Ecol 40: 836-847 529
Casteel CL, Jander G (2013) New synthesis: Investigating mutualisms in virus-vector 530 interactions. J Chem Ecol 39: 809 531
Casteel CL, Yang C, Nanduri AC, De Jong HN, Whitham SA, Jander G (2014) The 532 NIa-Pro protein of Turnip mosaic virus improves growth and reproduction of the 533 aphid vector, Myzus persicae (green peach aphid). Plant J 77: 653-663 534
Chen L, Zhang L, Li D, Wang F, Yu D (2013) WRKY8 transcription factor functions 535 in the TMV-CG defense response by mediating both abscisic acid and ethylene 536 signaling in Arabidopsis. Proc Natl Acad Sci U S A 110: E1963-1971 537
Clay NK, Adio AM, Denoux C, Jander G, Ausubel FM (2009) Glucosinolate 538 metabolites required for an Arabidopsis innate immune response. Science 323: 539 95-101 540
Clough SJ, Bent AF (1998) Floral dip: A simplified method for Agrobacterium-541 mediated transformation of Arabidopsis thaliana. Plant J 16: 735-743 542
De Vos M, Kim JH, Jander G (2007) Biochemistry and molecular biology of 543 Arabidopsis-aphid interactions. BioEssays 29: 871-883 544
Ellis C, Karafyllidis L, Turner JG (2002) Constitutive activation of jasmonate 545 signaling in an Arabidopsis mutant correlates with enhanced resistance to 546 Erysiphe cichoracearum, Pseudomonas syringae, and Myzus persicae. Mol Plant 547 Microbe Interact 15: 1025-1030 548
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
20
Endres MW, Gregory BD, Gao Z, Foreman AW, Mlotshwa S, Ge X, Pruss GJ, 549 Ecker JR, Bowman LH, Vance V (2010) Two plant viral suppressors of 550 silencing require the ethylene-inducible host transcription factor RAV2 to block 551 RNA silencing. PLoS Pathog 6: e1000729 552
Erb M, Meldau S, Howe GA (2012) Role of phytohormones in insect-specific plant 553 reactions. Trends Plant Sci 17: 250-259 554
Glazebrook J (2005) Contrasting mechanisms of defense against biotrophic and 555 necrotrophic pathogens. In Annu Rev Phytopath, Vol 43, pp 205-227 556
Guo H, Ecker JR (2003) Plant responses to ethylene gas are mediated by 557 SCF(EBF1/EBF2)-dependent proteolysis of EI3 transcription factor. Cell 115: 558 667-677 559
Haikonen T, Rajamaki ML, Tian YP, Valkonen JP (2013) Mutation of a short 560 variable region in HCPro protein of Potato virus A affects interactions with a 561 microtubule-associated protein and induces necrotic responses in tobacco. Mol 562 Plant Microbe Interact 26: 721-733 563
Hall BP, Shakeel SN, Amir M, Ul Haq N, Qu X, Schaller GE (2012) Histidine kinase 564 activity of the ethylene receptor ETR1 facilitates the ethylene response in 565 Arabidopsis. Plant Physiol 159: 682-695 566
Han HE, Sellamuthu S, Shin BH, Lee YJ, Song S, Seo JS, Baek IS, Bae J, Kim H, 567 Yoo YJ, Jung YK, Song WK, Han PL, Park WJ (2010) The Nuclear Inclusion 568 A (NIa) protease of Turnip mosaic virus (TuMV) cleaves amyloid-beta. PloS one 569 5: e15645 570
Howe GA, Jander G (2008) Plant immunity to insect herbivores. Annu Rev Plant Biol 571 59: 41-66 572
Jander G, Howe G (2008) Plant interactions with arthropod herbivores: State of the 573 field. Plant Physiol 146: 801-803 574
Jones JD, Dangl JL (2006) The plant immune system. Nature 444: 323-329 575 Kang H, Lee YJ, Goo JH, Park WJ (2001) Determination of the substrate specificity of 576
Turnip mosaic virus NIa protease using a genetic method. J Gen Virol 82: 3115-577 3117 578
Kennedy JS, Day MF, Eastop VF (1962) A conspectus of aphids as vectors of plant 579 viruses. Commonwealth Institute of Entomology, London 580
Kim B, Masuta C, Matsuura H, Takahashi H, Inukai T (2008) Veinal necrosis 581 induced by Turnip mosaic virus infection in Arabidopsis is a form of defense 582 response accompanying HR-like cell death. Mol Plant Microbe Interact 21: 260-583 268 584
Koyama T (2014) The roles of ethylene and transcription factors in the regulation of 585 onset of leaf senescence. Front Plant Sci 5: 650 586
Lellis AD, Kasschau KD, Whitham SA, Carrington JC (2002) Loss-of-susceptibility 587 mutants of Arabidopsis thaliana reveal an essential role for eIF(iso)4E during 588 potyvirus infection. Curr Biol 12: 1046-1051 589
Lewsey MG, Murphy AM, Maclean D, Dalchau N, Westwood JH, Macaulay K, 590 Bennett MH, Moulin M, Hanke DE, Powell G, Smith AG, Carr JP (2010) 591 Disruption of two defensive signaling pathways by a viral RNA silencing 592 suppressor. Mol Plant Microbe Interact 23: 835-845 593
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
21
Li R, Weldegergis BT, Li J, Jung C, Qu J, Sun Y, Qian H, Tee C, van Loon JJ, 594 Dicke M, Chua NH, Liu SS, Ye J (2014) Virulence factors of geminivirus 595 interact with MYC2 to subvert plant resistance and promote vector performance. 596 Plant Cell 26: 4991-5008 597
Louis J, Shah J (2013) Arabidopsis thaliana-Myzus persicae interaction: Shaping the 598 understanding of plant defense against phloem-feeding aphids. Front Plant Sci 4: 599 213 600
Lorenzo O, Piqueras R, Sánchez-Serrano JJ, Solano R (2003) Ethylene response 601 factor1 integrates signals from ethylene and jasmonate pathways in plant defense. 602 The Plant Cell 15: 165-178 603
Love AJ, Laval V, Geri C, Laird J, Tomos AD, Hooks MA, Milner JJ (2007) 604 Components of Arabidopsis defense- and ethylene-signaling pathways regulate 605 susceptibility to Cauliflower mosaic virus by restricting long-distance movement. 606 Mol Plant Microbe Interact 20: 659-670 607
Love AJ, Yun BW, Laval V, Loake GJ, Milner JJ (2005) Cauliflower mosaic virus, a 608 compatible pathogen of Arabidopsis, engages three distinct defense-signaling 609 pathways and activates rapid systemic generation of reactive oxygen species. 610 Plant Physiol 139: 935-948 611
Lu J, Li J, Ju H, Liu X, Erb M, Wang X, Lou Y (2014) Contrasting effects of ethylene 612 biosynthesis on induced plant resistance against a chewing and a piercing-sucking 613 herbivore in rice. Mol Plant 7: 1670-1682 614
Mandadi KK, Pyle JD, Scholthof KB (2014) Comparative analysis of antiviral 615 responses in Brachypodium distachyon and Setaria viridis reveals conserved and 616 unique outcomes among C3 and C4 plant defenses. Mol Plant Microbe Interact 617 27: 1277-1290 618
Mantelin S, Bhattarai KK, Kaloshian I (2009) Ethylene contributes to potato aphid 619 susceptibility in a compatible tomato host. New Phytol 183: 444-456 620
Martin A, Cabrera y Poch HL, Martinez Herrera D, Ponz F (1999) Resistances to 621 Turnip mosaic potyvirus in Arabidopsis thaliana. Mol Plant Microbe Interact 12: 622 1016-1021 623
Mauck KE, De Moraes CM, Mescher MC (2010) Deceptive chemical signals induced 624 by a plant virus attract insect vectors to inferior hosts. Proc Natl Acad Sci USA 625 107: 3600-3605 626
Mauck KE, De Moraes CM, Mescher MC (2014) Biochemical and physiological 627 mechanisms underlying effects of Cucumber mosaic virus on host-plant traits that 628 mediate transmission by aphid vectors. Plant Cell Environ 37: 1427-1439 629
Mewis I, Appel HM, Hom A, Raina R, Schultz JC (2005) Major signaling pathways 630 modulate Arabidopsis glucosinolate accumulation and response to both phloem-631 feeding and chewing insects. Plant Physiol 138: 1149-1162 632
Miller HL, Neese PA, Ketring DL, Dillwith JW (1994) Involvement of ethylene in 633 aphid infestation of barley. J Plant Growth Regul 13: 167-171 634
Mur LAJ, Kenton P, Atzorn R, Miersch O, Wasternack C (2006) The outcomes of 635 concentration-specific interactions between salicylate and jasmonate signaling 636 include synergy, antagonism, and oxidative stress leading to cell death. Plant 637 Physiol 140: 249-262 638
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
22
Nault LR (1997) Arthropod transmission of plant viruses: A new synthesis. Ann 639 Entomol Soc Am 90: 521-541 640
Nguyen HD, Tomitaka Y, Ho SY, Duchene S, Vetten HJ, Lesemann D, Walsh JA, 641 Gibbs AJ, Ohshima K (2013) Turnip mosaic potyvirus probably first spread to 642 Eurasian Brassica crops from wild orchids about 1000 years ago. PloS one 8: 643 e55336 644
Penninckx IA, Thomma BP, Buchala A, Metraux JP, Broekaert WF (1998) 645 Concomitant activation of jasmonate and ethylene response pathways is required 646 for induction of a plant defensin gene in Arabidopsis. Plant Cell 10: 2103-2113 647
Pieterse CM, Van der Does D, Zamioudis C, Leon-Reyes A, Van Wees SC (2012) 648 Hormonal modulation of plant immunity. Annual Review of Cell and 649 Developmental Biology 28: 489-521 650
Qiao H, Chang KN, Yazaki J, Ecker JR (2009) Interplay between ethylene, 651 ETP1/ETP2 F-box proteins, and degradation of EIN2 triggers ethylene responses 652 in Arabidopsis. Genes & Dev 23: 512-521 653
Rajamäki M-L, Valkonen JPT (2009) Control of nuclear and nucleolar localization of 654 nuclear inclusion protein a of picorna-like Potato virus A in Nicotiana species. 655 Plant Cell 21: 2485-2502 656
Ralhan A, Schottle S, Thurow C, Iven T, Feussner I, Polle A, Gatz C (2012) The 657 vascular pathogen Verticillium longisporum requires a jasmonic acid-independent 658 coi1 function in roots to elicit disease symptoms in Arabidopsis shoots. Plant 659 Physiol 159: 1192-1203 660
Rasmann S, De Vos M, Casteel CL, Tian D, Halitschke R, Sun JY, Agrawal AA, 661 Felton GW, Jander G (2012) Herbivory in the previous generation primes plants 662 for enhanced insect resistance. Plant Physiol 158: 854-863 663
Sanchez F, Martinez-Herrera D, Aguilar I, Ponz F (1998) Infectivity of Turnip mosaic 664 potyvirus cDNA clones and transcripts on the systemic host Arabidopsis thaliana 665 and local lesion hosts. Virus Res 55: 207-219 666
Shattuck VI (1992) The biology, epidemiology, and control of Turnip mosaic virus. 667 Horticult Rev 14: 199-238 668
Sisler EC (2006) The discovery and development of compounds counteracting ethylene 669 at the receptor level. Biotech Adv 24: 357-367 670
Soeno K, Goda H, Ishii T, Ogura T, Tachikawa T, Sasaki E, Yoshida S, Fujioka S, 671 Asami T, Shimada Y (2010) Auxin biosynthesis inhibitors, identified by a 672 genomics-based approach, provide insights into auxin biosynthesis. Plant Cell 673 Physiol 51: 524-536 674
Solano R, Stepanova A, Chao Q, Ecker JR (1998) Nuclear events in ethylene 675 signaling: A transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 676 and ETHYLENE-RESPONSE-FACTOR1. Genes & development 12: 3703-3714 677
Stepanova AN, Alonso JM (2005) Arabidopsis ethylene signaling pathway. Science's 678 STKE : Signal Transduction Knowledge Environment 2005: cm4 679
Tomlinson JA (1987) Epidemiology and control of viral diseases of vegetables. Ann 680 Appl Biol 110: 661-681 681
Urcuqui-Inchima S, Haenni AL, Bernardi F (2001) Potyvirus proteins: A wealth of 682 functions. Virus Res 74: 157-175 683
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
23
Van der Ent S, Van Wees SC, Pieterse CM (2009) Jasmonate signaling in plant 684 interactions with resistance-inducing beneficial microbes. Phytochem 70: 1581-685 1588 686
van Loon LC, Geraats BPJ, Linthorst HJM (2006) Ethylene as a modulator of disease 687 resistance in plants. Trends Plant Sci 11: 184-191 688
Verhage A, van Wees SCM, Pieterse CMJ (2010) Plant immunity: It’s the hormones 689 talking, but what do they say? Plant Physiol 154: 536-540 690
Walsh JA, Jenner CE (2002) Turnip mosaic virus and the quest for durable resistance. 691 Mol Plant Pathol 3: 289-300 692
Wei T, Zhang C, Hong J, Xiong R, Kasschau KD, Zhou X, Carrington JC, Wang A 693 (2010) Formation of complexes at plasmodesmata for potyvirus intercellular 694 movement is mediated by the viral protein P3N-PIPO. PLoS Patho 6 695
Wu C, Avila CA, Goggin FL (2015) The ethylene response factor PTI5 contributes to 696 potato aphid resistance in tomato independent of ethylene signalling. J Exp Bot 697 66: 559-570 698
Yang JY, Iwasaki M, Machida C, Machida Y, Zhou X, Chua NH (2008) βC1, the 699 pathogenicity factor of TYLCCNV, interacts with AS1 to alter leaf development 700 and suppress selective jasmonic acid responses. Genes & Dev 22: 2564-2577 701
Yasaka R, Ohba K, Schwinghamer MW, Fletcher J, Ochoa-Corona FM, Thomas 702 JE, Ho SY, Gibbs AJ, Ohshima K (2015) Phylodynamic evidence of the 703 migration of Turnip mosaic potyvirus from Europe to Australia and New Zealand. 704 J Gen Virol 96: 701-713 705
Zhang T, Luan JB, Qi JF, Huang CJ, Li M, Zhou XP, Liu SS (2012) Begomovirus-706 whitefly mutualism is achieved through repression of plant defences by a virus 707 pathogenicity factor. Mol Ecol 21: 1294-1304 708
709
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
24
Figure Legends 710
Figure 1. Concentrations of phytohormones in Arabidopsis plants, with or without 711
TuMV infection and aphid herbivory. Shown are (A) salicylic acid, (B) jasmonic acid, 712
and (C) ethylene accumulation in mock-inoculated or TuMV-GFP-infected Arabidopsis 713
plants, with or without 24 hours of the feeding by the green peach aphid (Myzus persicae) 714
(mean +/- s.e. of N =4-6, letters represent significant differences, ANOVA and Tukey’s 715
HSD post hoc test). 716
717
Figure 2. Involvement of plant defense signaling in TuMV-aphid-plant interactions. 718
Number of progeny produced by a single aphid after 9 days on TuMV-GFP-infected or 719
mock-inoculated Arabidopsis wildtype controls (wt) or hormone signaling mutants (mean 720
+/- s.e., N =15-30,*P < 0.05, two-tailed Student’s t-test comparing infected and 721
uninfected plants of the same genotype). 722
723
Figure 3. Ethylene perception and biosynthesis is required for TuMV infection to 724
increase M. persicae fecundity on host plants. Number of progeny produced by a single 725
aphid after 9 days on TuMV-GFP-infected or mock-inoculated (A,C) Arabidopsis and 726
(D,B) N. benthamiana treated with 1-methylcyclopropene (MCP), which blocks ethylene 727
perception or aminoethoxyvinylglycine (AVG), which inhibits ethylene biosynthesis 728
(mean +/- s.e., N =15-18, letters represent significant differences, ANOVA and Tukey’s 729
HSD post hoc). 730
731
Figure 4. Ethylene signaling is required for TuMV infection to reduce callose 732
accumulation. (A) Callose deposition in Arabidopsis wildtype controls (wt) or ethylene 733
insensitive mutants that were mock-inoculated or TuMV-GFP-infected, with and without 734
M. persicae infestation. Callose deposition in Arabidopsis leaves that were mock-735
inoculated or TuMV-GFP-infected, with and without M. persicae infestation and treated 736
with (B) 1-methylcyclopropene (MCP), which blocks ethylene perception or (C) 737
aminoethoxyvinylglycine (AVG), which inhibits ethylene biosynthesis (mean +/- s.e. of 738
N = 4-6, different letters indicate significant differences by ANOVA and Tukey’s HSD 739
post hoc). 740
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
25
741
Figure 5. Ethylene treatment does not enhance M. persicae fecundity on host plants. 742
Number of progeny produced by a single aphid after 7 days on TuMV-GFP-infected or 743
mock-inoculated (A) Arabidopsis and (B) N. benthamiana treated with 20 ppm of 744
ethylene (mean +/- s.e. N =15-28, letters represent significant differences, ANOVA and 745
Tukey’s HSD post hoc test). 746
747
Figure 6. Expression of the TuMV protein NIa-Pro requires ethylene signaling to 748
increase aphid growth and reduce callose accumulation. (A) Number of progeny 749
produced by aphids on Arabidopsis expressing NIa-Pro or the EV control treated with 750
(A) 1-methylcyclopropene (MCP), which blocks ethylene perception or (B) 751
aminoethoxyvinylglycine (AVG), which inhibits ethylene biosynthesis (mean +/- s.e., N 752
= 12-18, letters represent significant differences, ANOVA and Tukey HSD post hoc). (C) 753
Callose accumulation on Arabidopsis expressing NIa-Pro or the EV control treated with 754
MCP or AVG (mean +/- s.e., N = 4-6, letters represent significant differences, ANOVA 755
and Tukey HSD post hoc test). 756
757
Figure 7. Expression of the TuMV protein NIa-Pro increases ethylene production. 758
Concentrations of ethylene in wildtype Arabidopsis and transgenic plants expressing the 759
empty vector (EV) control or NIa-Pro. (mean +/- s.e., N = 6, letters represent significant 760
differences, ANOVA and Tukey’s HSD post hoc test). 761
762
Figure 8. Expression of the TuMV protein NIa-Pro alters ethylene signaling. Relative 763
(A) EIN2, (B) EIN3, (C) ERF1, and (D) PDF1.2 transcript abundance was measured by 764
quantitative RT-PCR in mock-inoculated and TuMV-GFP-inoculated plants, with or 765
without aphid feeding for 24 hrs and in leaves of plants expressing the empty vector or 766
NIa-Pro, with and without aphids feeding for 24 hrs. (mean +/- s.e., N = 3, letters indicate 767
significant differences by analysis of variance (ANOVA) and Tukey’s post-hoc test, with 768
transcript abundance in mock-inoculated and EV plants set to 1. 769
770
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
26
Figure 9. Expression of the TuMV protein NIa-Pro does not alter ethylene-induced 771
transcripts. Relative (A) OSR1 and (B) AZI1 transcript abundance was measured by 772
quantitative RT-PCR in mock-inoculated and TuMV-GFP-inoculated plants, with or 773
without aphid feeding for 24 hrs and in leaves of plants expressing the empty vector or 774
NIa-Pro with and without aphids feeding for 24 hrs. (mean +/- s.e., N = 3, letters indicate 775
significant differences by analysis of variance (ANOVA) and Tukey’s post-hoc test, with 776
transcript abundance in mock-inoculated and EV plants set to 1. 777
778
Figure 10. Ethylene signaling is required for plant susceptibility to TuMV. Percent 779
TuMV-GFP infection for Arabidopsis (A) ethylene insensitive mutants (ein2-1, etr1-3), 780
(B) mutants that constitutively produce ethylene (eto1-2). (N = 30-48, *P<0.05, chi-781
squared test relative to wildtype control). 782
783
784
785
786
787
788
789
790
791
792
793
794
795
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
Parsed CitationsAdams E, Turner J (2010) COI1, a jasmonate receptor, is involved in ethylene-induced inhibition of Arabidopsis root growth in thelight. J Exp Bot 61: 4373-4386
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Alazem M, Lin NS (2014) Roles of plant hormones in the regulation of host-virus interactions. Mol Plant PatholPubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Alonso JM, Hirayama T, Roman G, Nourizadeh S, Ecker JR (1999) EIN2, a bifunctional transducer of ethylene and stress responsesin arabidopsis. Science 284: 2148-2152
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Amrhein N, Wenker D (1979) Novel inhibitors of ethylene production in higher plants. Plant Cell Physiol 20: 1635-1642Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Anindya R, Savithri HS (2004) Potyviral NIa proteinase, a proteinase with novel deoxyribonuclease activity. J Biol Chem 279: 32159-32169
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Argandoña VH, Chaman M, Cardemil L, Muñoz O, Zúñiga GE, Corcuera LJ (2001) Ethylene production and peroxidase activity inaphid-infested barley. J Chem Ecol 27: 53-68
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Bari R, Jones JD (2009) Role of plant hormones in plant defence responses. Plant Mol Biol 69: 473-488Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Brown RL, Kazan K, McGrath KC, Maclean DJ, Manners JM (2003) A role for the GCC-box in jasmonate-mediated activation of thePDF1.2 gene of Arabidopsis. Plant Physiol 132: 1020-1032
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Bush J, Jander G, Ausubel FM (2006) Prevention and control of pests and diseases. In J Salinas, JJ Sanchez-Serrano, eds,Arabidopsis protocols, second edition. Humana Press, Totowa, pp 13-25
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Carr JP, Lewsey MG, Palukaitis P (2010) Signaling in induced resistance. Adv Virus Res 76: 57-121Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Casteel C, Hansen A (2014) Evaluating insect-microbiomes at the plant-insect interface. J Chem Ecol 40: 836-847Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Casteel CL, Jander G (2013) New synthesis: Investigating mutualisms in virus-vector interactions. J Chem Ecol 39: 809Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Casteel CL, Yang C, Nanduri AC, De Jong HN, Whitham SA, Jander G (2014) The NIa-Pro protein of Turnip mosaic virus improvesgrowth and reproduction of the aphid vector, Myzus persicae (green peach aphid). Plant J 77: 653-663
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Chen L, Zhang L, Li D, Wang F, Yu D (2013) WRKY8 transcription factor functions in the TMV-CG defense response by mediatingboth abscisic acid and ethylene signaling in Arabidopsis. Proc Natl Acad Sci U S A 110: E1963-1971
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
Clay NK, Adio AM, Denoux C, Jander G, Ausubel FM (2009) Glucosinolate metabolites required for an Arabidopsis innate immuneresponse. Science 323: 95-101
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Clough SJ, Bent AF (1998) Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. PlantJ 16: 735-743
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
De Vos M, Kim JH, Jander G (2007) Biochemistry and molecular biology of Arabidopsis-aphid interactions. BioEssays 29: 871-883Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ellis C, Karafyllidis L, Turner JG (2002) Constitutive activation of jasmonate signaling in an Arabidopsis mutant correlates withenhanced resistance to Erysiphe cichoracearum, Pseudomonas syringae, and Myzus persicae. Mol Plant Microbe Interact 15:1025-1030
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Endres MW, Gregory BD, Gao Z, Foreman AW, Mlotshwa S, Ge X, Pruss GJ, Ecker JR, Bowman LH, Vance V (2010) Two plant viralsuppressors of silencing require the ethylene-inducible host transcription factor RAV2 to block RNA silencing. PLoS Pathog 6:e1000729
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Erb M, Meldau S, Howe GA (2012) Role of phytohormones in insect-specific plant reactions. Trends Plant Sci 17: 250-259Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Glazebrook J (2005) Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. In Annu Rev Phytopath,Vol 43, pp 205-227
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Guo H, Ecker JR (2003) Plant responses to ethylene gas are mediated by SCF(EBF1/EBF2)-dependent proteolysis of EI3transcription factor. Cell 115: 667-677
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Haikonen T, Rajamaki ML, Tian YP, Valkonen JP (2013) Mutation of a short variable region in HCPro protein of Potato virus Aaffects interactions with a microtubule-associated protein and induces necrotic responses in tobacco. Mol Plant Microbe Interact26: 721-733
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hall BP, Shakeel SN, Amir M, Ul Haq N, Qu X, Schaller GE (2012) Histidine kinase activity of the ethylene receptor ETR1 facilitatesthe ethylene response in Arabidopsis. Plant Physiol 159: 682-695
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Han HE, Sellamuthu S, Shin BH, Lee YJ, Song S, Seo JS, Baek IS, Bae J, Kim H, Yoo YJ, Jung YK, Song WK, Han PL, Park WJ(2010) The Nuclear Inclusion A (NIa) protease of Turnip mosaic virus (TuMV) cleaves amyloid-beta. PloS one 5: e15645
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Howe GA, Jander G (2008) Plant immunity to insect herbivores. Annu Rev Plant Biol 59: 41-66Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Jander G, Howe G (2008) Plant interactions with arthropod herbivores: State of the field. Plant Physiol 146: 801-803Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Jones JD, Dangl JL (2006) The plant immune system. Nature 444: 323-329Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from
Copyright © 2015 American Society of Plant Biologists. All rights reserved.
Kang H, Lee YJ, Goo JH, Park WJ (2001) Determination of the substrate specificity of Turnip mosaic virus NIa protease using agenetic method. J Gen Virol 82: 3115-3117
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kennedy JS, Day MF, Eastop VF (1962) A conspectus of aphids as vectors of plant viruses. Commonwealth Institute of Entomology,London
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kim B, Masuta C, Matsuura H, Takahashi H, Inukai T (2008) Veinal necrosis induced by Turnip mosaic virus infection in Arabidopsisis a form of defense response accompanying HR-like cell death. Mol Plant Microbe Interact 21: 260-268
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Koyama T (2014) The roles of ethylene and transcription factors in the regulation of onset of leaf senescence. Front Plant Sci 5:650
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lellis AD, Kasschau KD, Whitham SA, Carrington JC (2002) Loss-of-susceptibility mutants of Arabidopsis thaliana reveal anessential role for eIF(iso)4E during potyvirus infection. Curr Biol 12: 1046-1051
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lewsey MG, Murphy AM, Maclean D, Dalchau N, Westwood JH, Macaulay K, Bennett MH, Moulin M, Hanke DE, Powell G, Smith AG,Carr JP (2010) Disruption of two defensive signaling pathways by a viral RNA silencing suppressor. Mol Plant Microbe Interact 23:835-845
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Li R, Weldegergis BT, Li J, Jung C, Qu J, Sun Y, Qian H, Tee C, van Loon JJ, Dicke M, Chua NH, Liu SS, Ye J (2014) Virulencefactors of geminivirus interact with MYC2 to subvert plant resistance and promote vector performance. Plant Cell 26: 4991-5008
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Louis J, Shah J (2013) Arabidopsis thaliana-Myzus persicae interaction: Shaping the understanding of plant defense againstphloem-feeding aphids. Front Plant Sci 4: 213
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lorenzo O, Piqueras R, Sánchez-Serrano JJ, Solano R (2003) Ethylene response factor1 integrates signals from ethylene andjasmonate pathways in plant defense. The Plant Cell 15: 165-178
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Love AJ, Laval V, Geri C, Laird J, Tomos AD, Hooks MA, Milner JJ (2007) Components of Arabidopsis defense- and ethylene-signaling pathways regulate susceptibility to Cauliflower mosaic virus by restricting long-distance movement. Mol Plant MicrobeInteract 20: 659-670
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Love AJ, Yun BW, Laval V, Loake GJ, Milner JJ (2005) Cauliflower mosaic virus, a compatible pathogen of Arabidopsis, engagesthree distinct defense-signaling pathways and activates rapid systemic generation of reactive oxygen species. Plant Physiol 139:935-948
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lu J, Li J, Ju H, Liu X, Erb M, Wang X, Lou Y (2014) Contrasting effects of ethylene biosynthesis on induced plant resistanceagainst a chewing and a piercing-sucking herbivore in rice. Mol Plant 7: 1670-1682
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Mandadi KK, Pyle JD, Scholthof KB (2014) Comparative analysis of antiviral responses in Brachypodium distachyon and Setariaviridis reveals conserved and unique outcomes among C3 and C4 plant defenses. Mol Plant Microbe Interact 27: 1277-1290
Pubmed: Author and TitleCrossRef: Author and Title
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
Google Scholar: Author Only Title Only Author and Title
Mantelin S, Bhattarai KK, Kaloshian I (2009) Ethylene contributes to potato aphid susceptibility in a compatible tomato host. NewPhytol 183: 444-456
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Martin A, Cabrera y Poch HL, Martinez Herrera D, Ponz F (1999) Resistances to Turnip mosaic potyvirus in Arabidopsis thaliana.Mol Plant Microbe Interact 12: 1016-1021
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Mauck KE, De Moraes CM, Mescher MC (2010) Deceptive chemical signals induced by a plant virus attract insect vectors toinferior hosts. Proc Natl Acad Sci USA 107: 3600-3605
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Mauck KE, De Moraes CM, Mescher MC (2014) Biochemical and physiological mechanisms underlying effects of Cucumber mosaicvirus on host-plant traits that mediate transmission by aphid vectors. Plant Cell Environ 37: 1427-1439
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Mewis I, Appel HM, Hom A, Raina R, Schultz JC (2005) Major signaling pathways modulate Arabidopsis glucosinolate accumulationand response to both phloem-feeding and chewing insects. Plant Physiol 138: 1149-1162
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Miller HL, Neese PA, Ketring DL, Dillwith JW (1994) Involvement of ethylene in aphid infestation of barley. J Plant Growth Regul 13:167-171
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Mur LAJ, Kenton P, Atzorn R, Miersch O, Wasternack C (2006) The outcomes of concentration-specific interactions betweensalicylate and jasmonate signaling include synergy, antagonism, and oxidative stress leading to cell death. Plant Physiol 140: 249-262
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Nault LR (1997) Arthropod transmission of plant viruses: A new synthesis. Ann Entomol Soc Am 90: 521-541Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Nguyen HD, Tomitaka Y, Ho SY, Duchene S, Vetten HJ, Lesemann D, Walsh JA, Gibbs AJ, Ohshima K (2013) Turnip mosaicpotyvirus probably first spread to Eurasian Brassica crops from wild orchids about 1000 years ago. PloS one 8: e55336
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Penninckx IA, Thomma BP, Buchala A, Metraux JP, Broekaert WF (1998) Concomitant activation of jasmonate and ethyleneresponse pathways is required for induction of a plant defensin gene in Arabidopsis. Plant Cell 10: 2103-2113
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Pieterse CM, Van der Does D, Zamioudis C, Leon-Reyes A, Van Wees SC (2012) Hormonal modulation of plant immunity. AnnualReview of Cell and Developmental Biology 28: 489-521
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Qiao H, Chang KN, Yazaki J, Ecker JR (2009) Interplay between ethylene, ETP1/ETP2 F-box proteins, and degradation of EIN2triggers ethylene responses in Arabidopsis. Genes & Dev 23: 512-521
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Rajamäki M-L, Valkonen JPT (2009) Control of nuclear and nucleolar localization of nuclear inclusion protein a of picorna-likePotato virus A in Nicotiana species. Plant Cell 21: 2485-2502
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ralhan A, Schottle S, Thurow C, Iven T, Feussner I, Polle A, Gatz C (2012) The vascular pathogen Verticillium longisporum www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
requires a jasmonic acid-independent coi1 function in roots to elicit disease symptoms in Arabidopsis shoots. Plant Physiol 159:1192-1203
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Rasmann S, De Vos M, Casteel CL, Tian D, Halitschke R, Sun JY, Agrawal AA, Felton GW, Jander G (2012) Herbivory in theprevious generation primes plants for enhanced insect resistance. Plant Physiol 158: 854-863
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Sanchez F, Martinez-Herrera D, Aguilar I, Ponz F (1998) Infectivity of Turnip mosaic potyvirus cDNA clones and transcripts on thesystemic host Arabidopsis thaliana and local lesion hosts. Virus Res 55: 207-219
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Shattuck VI (1992) The biology, epidemiology, and control of Turnip mosaic virus. Horticult Rev 14: 199-238Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Sisler EC (2006) The discovery and development of compounds counteracting ethylene at the receptor level. Biotech Adv 24: 357-367
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Soeno K, Goda H, Ishii T, Ogura T, Tachikawa T, Sasaki E, Yoshida S, Fujioka S, Asami T, Shimada Y (2010) Auxin biosynthesisinhibitors, identified by a genomics-based approach, provide insights into auxin biosynthesis. Plant Cell Physiol 51: 524-536
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Solano R, Stepanova A, Chao Q, Ecker JR (1998) Nuclear events in ethylene signaling: A transcriptional cascade mediated byETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1. Genes & development 12: 3703-3714
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Stepanova AN, Alonso JM (2005) Arabidopsis ethylene signaling pathway. Science's STKE : Signal Transduction KnowledgeEnvironment 2005: cm4
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Tomlinson JA (1987) Epidemiology and control of viral diseases of vegetables. Ann Appl Biol 110: 661-681Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Urcuqui-Inchima S, Haenni AL, Bernardi F (2001) Potyvirus proteins: A wealth of functions. Virus Res 74: 157-175Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Van der Ent S, Van Wees SC, Pieterse CM (2009) Jasmonate signaling in plant interactions with resistance-inducing beneficialmicrobes. Phytochem 70: 1581-1588
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
van Loon LC, Geraats BPJ, Linthorst HJM (2006) Ethylene as a modulator of disease resistance in plants. Trends Plant Sci 11: 184-191
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Verhage A, van Wees SCM, Pieterse CMJ (2010) Plant immunity: It's the hormones talking, but what do they say? Plant Physiol 154:536-540
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Walsh JA, Jenner CE (2002) Turnip mosaic virus and the quest for durable resistance. Mol Plant Pathol 3: 289-300Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wei T, Zhang C, Hong J, Xiong R, Kasschau KD, Zhou X, Carrington JC, Wang A (2010) Formation of complexes at plasmodesmata www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.
for potyvirus intercellular movement is mediated by the viral protein P3N-PIPO. PLoS Patho 6Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wu C, Avila CA, Goggin FL (2015) The ethylene response factor PTI5 contributes to potato aphid resistance in tomato independentof ethylene signalling. J Exp Bot 66: 559-570
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Yang JY, Iwasaki M, Machida C, Machida Y, Zhou X, Chua NH (2008) ßC1, the pathogenicity factor of TYLCCNV, interacts with AS1to alter leaf development and suppress selective jasmonic acid responses. Genes & Dev 22: 2564-2577
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Yasaka R, Ohba K, Schwinghamer MW, Fletcher J, Ochoa-Corona FM, Thomas JE, Ho SY, Gibbs AJ, Ohshima K (2015)Phylodynamic evidence of the migration of Turnip mosaic potyvirus from Europe to Australia and New Zealand. J Gen Virol 96: 701-713
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhang T, Luan JB, Qi JF, Huang CJ, Li M, Zhou XP, Liu SS (2012) Begomovirus-whitefly mutualism is achieved through repressionof plant defences by a virus pathogenicity factor. Mol Ecol 21: 1294-1304
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
www.plantphysiol.orgon October 1, 2020 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.