Supplemental Material

The poly(A) binding protein Nab2 functions in RNA polymerase III transcription

L. Maximilian Reuter, Dominik M. Meinel, Katja Sträßer

Supplemental Figure S1. Nab2 occupies all RNAPIII transcribed genes. (A-F) Individual

traces of Rpb3 (RNAPII), Rpc160 (RNAPIII), and Nab2 at tRNA genes as well as at the

SCR1, RDN5, SNR6, SNR52, and RPR1 gene loci show that Nab2 is recruited to single genes

transcribed by RNAPIII.

Supplemental Figure S2. Growth properties of NAB2 mutants. (A) Comparison of the growth

properties of different NAB2 mutants. Strains expressing wild-type NAB2, the new nab2-34

allele, the previously generated temperature sensitive nab2-1-GFP and nab2-1 alleles or the

nab2-C437S allele, which is impaired in RNA binding, were spotted in 10-fold serial dilutions

on YPD plates and grown for 2 or 4 days at the indicated temperatures. (B) Growth curves of

NAB2 and nab2-34 cells at 30°C and 37°C in liquid YPD culture. The mean values and

standard deviation (SD) of three replicates are shown.

Supplemental Figure S3. Nab2 is required for full RNAPIII transcriptional activity in vivo.

(A,B) Northern blots of total RNA extracted from NAB2 and nab2-34 (A) as well as RPC25

and rpc25-S100P cells (B), which were used for the quantifications shown in Figures 5A-C.

Since the tRNAIle probe hybridizes to the intronic region, only transcripts still containing the

intron are detected. SNR14 (U4 snRNA) is synthesized by RNAPII and served as control.

tRNAIle precursors (two highest bands), the RPR1 precursor and the SNR6 levels were used for

quantification. (C) Amount of RNA used in Northern Blots. 1 µg of total RNA was loaded on

2% Formaldehyde agarose gels. Total RNA was visualized by Ethidiumbromide staining. 25S

rRNA and 18S rRNA levels were quantified. Data represent the mean ± SD of at least 4

independent biological replicates.

Supplemental Figure S4. Nab2 is required for RNAPIII transcription in vitro. (A,B) Gels of

the vitro transcription assays using transcription active extracts and a tRNAAla(UGC)E (A) or

an SNR6 (B) template, which were used for the quantifications shown in Figures 5D and 5E.

All bands were used for quantification. (C) In vitro transcription assays on the SNR6 template

with add back of recombinant Nab2, which were used for the quantifications shown in Figure

5F. All bands were used for quantification. (D) Fully reconstituted in vitro transcription assay

with add back of recombinant Nab2 on the SNR6 template, which were used for the

quantifications shown in Figure 5G.

Supplemental Figure S5. ChIP profiles on SCR1. (A) Scheme of the longest RNAPIII

transcribed gene SCR1 including amplicon sizes and locations. (B-E) Occupancy profiles of

RNAPIII (B), TFIIIC (C), TFIIIB (D) and Nab2 (E) are shown. Data represent the mean ± SD

of at least three independent replicates.

Supplemental Figure S6. Nab2 is needed for full occupancy of RNAPIII and TFIIIB but not

of TFIIIC on SCR1. ChIP occupancies of Rpc160 (RNAPIII) (A), Bdp1 (TFIIIB) (B), and

Tfc1 (TFIIIC) (C) on SCR1 in NAB2 and nab2-34 cells grown at 30°C and 37°C were

determined by ChIP-qPCR as for Supplemental Figure S5. SCR1-1 to SCR1-7 according to

Supplemental Figure S5. Data represent the mean ± SD of at least three independent

replicates, *: p < 0.05 and **: p < 0.01.

Supplemental Figure S7. DNA binding of Nab2 to dsDNA probes. Increasing amounts of

Nab2-His6 (0, 0.5, and 1 µg) were incubated with the specific RNAPIII promoter dsDNA

(TA-30-B6) and four scrambled probes with (dsDNA1(+) and dsDNA2(+)) and without

(dsDNA1(-) and dsDNA2(-)) two 2-nucleotide mismatches, each as detailed in Materials and

Methods. DNA sequences for the different dsDNA probes are given in Supplemental Table

S3.

Supplemental Table S1. Yeast strains used in this study.

Strain Description Source

RS453MATa; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL+ Euroscarf

W303MATa; ura3-1; trp1-1; his3-11,15; leu2-3,112; ade2-1; can1-100; GAL+ Euroscarf

BDP1-TAP MATa; BDP1-TAP::TRP1; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL+ this study

BRF1-HA MATa; BRF1-HA::HIS3mx6; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL+ this study

NAB2 shuffle MATa ;nab2::HIS3mx6; ura3-1; trp1-1; his3-11,15; leu2-3,112; ade2-1; can1-100; GAL+; pRS316-NAB2 this study

NAB2 shuffle BDP1-TAP

MATa ;nab2::HIS3mx6; BDP1-TAP::TRP1; ura3-1; trp1-1; his3-11,15; leu2-3,112; ade2-1; can1-100; GAL+; pRS316-NAB2

this study

NAB2 shuffle RPC160-TAP

MATa; nab2::HIS3mx6; RPC160-TAP::TRP1; ura3-1; trp1-1; his3-11,15; leu2-3,112; ade2-1; can1-100; GAL+; pRS316-NAB2

this study

NAB2 shuffle TFC1-TAP

MATa ;nab2::HIS3mx6; TFC1-TAP::TRP1; ura3-1; trp1-1; his3-11,15; leu2-3,112; ade2-1; can1-100; GAL+; pRS316-NAB2

this study

NAB2-TAP MATa; NAB2-TAP::TRP1; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL+ this study

NAB2-TAP MATa; NAB2-TAP::URA3; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0 (Meinel et al. 2013)

NAB2-TAP BRF1-HA

MATa; NAB2-TAP::TRP1; BRF1-HA::HIS3mx6; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL+ this study

NAB2-TAP TFC8-HA

MATa; NAB2-TAP::TRP1; TFC8-HA::HIS3mx6; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL+ this study

NAB2-TAPRPC160-HA

MATa; NAB2-TAP::TRP1; RPC160-HA::HIS3mx6; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL+

this study

RPA190-TAP MATa; RPA190-TAP::TRP1; his3-11,15; ura3-52; leu2-3,112; trp1-1;can1-100; GAL+ this study

RPB3-TAP MATa; RPB3-TAP::HIS3mx6; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0 (Meinel et al. 2013)

RPC25

(YPH500)MATα; ura3-52; lys2-801_amber; ade2-101_ochre; trp1-Δ63; his1-Δ200; leu2-Δ1

(Zaros and Thuriaux 2005)

RPC25NAB2-TAP

MATα; NAB2-TAP::TRP1; ura3-52; lys2-801_amber; ade2-101_ochre; trp1-Δ63; his1-Δ200; leu2-Δ1 this study

RPC25RPC160-TAP

MATα; RPC160-TAP::TRP1; ura3-52; lys2-801_amber; ade2-101_ochre; trp1-Δ63; his1-Δ200; leu2-Δ1 this study

rpc25-S100P(DS3-6b) MATa; ura3-52; trp1-Δ63; his3-Δ200; leu2; rpc25-S100P (Zaros and Thuriaux

2005)

rpc25-S100PNAB2-TAP

MATa; NAB2-TAP::TRP1; ura3-52; trp1-Δ63; his3-Δ200; leu2; rpc25-S100P this study

rpc25-S100P RPC160-TAP

MATa; RPC160-TAP::TRP1; ura3-52; trp1-Δ63; his3-Δ200; leu2; rpc25-S100P this study

RPC160-HA MATa; RPC160-HA::HIS3mx6; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL+ this study

RPC160-TAP MATa; RPC160-TAP::TRP1; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL+ this study

RPC160-TAP MATa; RPC160-TAP::HIS; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0 this study

TAP-NPL3 MATa; TAP-NPL3; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0 (Meinel et al. 2013)

TAP-THO2 MATa; TAP-THO2; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0 (Meinel et al. 2013)

TFC1-TAP MATa; TFC1-TAP::TRP1; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL++ this study

TFC8-HA MATa; TFC8-HA::HIS3mx6; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL+ this study

Supplemental Table S2. Plasmids used in this study.

Plasmid Description Source

pAC1038 ∆N-NAB2-GFP, CEN, LEU2 (Green et al. 2002)

pAC1152 ∆N-NAB2 (nab2-1), CEN, LEU2 (Marfatia et al. 2003)

pAC2307 nab2-C437S, CEN, LEU2 (Kelly et al. 2007)

pGex-6P-1-NAB2 the coding region of NAB2 was amplified by PCR creating BamHI and NotI sites and cloned into the same sites of pGex-6P-1

this study

pBluescriptIIKS-SNR6 the genomic SNR6 locus including 117 upstream and 253 downstream was amplified by PCR creating EcoRI and XbaI sites and cloned into the same site of pBluescriptIIKS

(Brow and Guthrie 1990)

pBluescriptIIKS-tA the coding region of tRNAAla(UGC)E was amplified this study

by PCR creating NotI and XbaI sites and cloned into the same sites of pBluescriptII KS

pBS1479 plasmid for genomic TAP-tagging with the TRP1-KL marker

Euroscarf

pET21a-BDP1 the coding region of BDP1 was amplified by PCR creating EcoRI and NotI sites and cloned into the same sites of pET21a

this study

pET21a-BRF1 the coding region of BRF1 was amplified by PCR creating SacI and NotI sites and cloned into the same sites of pET21a

this study

pET21a-NAB2 the coding region of NAB2 was amplified by PCR creating SacI and NotI sites and cloned into the same sites of pET21a

this study

pET21a-TBP the coding region of TBP was amplified by PCR creating EcoRI and NotI sites and cloned into the same sites of pET21a

this study

pRS315-NAB2 the ORF of NAB2 including 532 bp 5’ and 311 bp 3’ was amplified by PCR creating Not1 and Xho1 sites and cloned into the same sites of pRS315

this study

pRS315-nab2-34 nab2-34 inserted by homologous recombination after mutagenic PCR of the NAB2 ORF

this study

pRS316-NAB2 the ORF of NAB2 including 532 bp 5’ and 311 bp 3’ was amplified by PCR creating Not1 and Xho1 sites and cloned into the same sites of pRS316

this study

pYM15 plasmid for genomic HA tagging with the HIS3mx6 marker

Euroscarf

Supplemental Table S3. dsDNA probe sequences used in this study.

Oligo DNA sequence

TA-30-B6_1 GCTGAAATCTCTTTTTCAATTGCTCCGGTGTATAAAGCCGCGGTCCCTTACTCTTTCTTCAACAATTAAATACTC

TA-30-B6_2 GAGTATTTAATTGTTGAAGAAAGAGTAAGGGACCGCCCCTTTATTGACCGGAGCAATTGAAAAAGAGATTTCAGC

dsDNA1(+)_1 ATCGTAGATACTGAGTACTCACATCGTCAAGATCACAAGACTATGCACTAGTCACGTCACGTCATAGACTAGATA

dsDNA1(+)_2 TATCTAGTCTATGACGTGACGTGACTAGTGCATAGTCAAGTGATCAAGACGATGTGAGTACTCAGTATCTACGAT

dsDNA1(-)_2 TATCTAGTCTATGACGTGACGTGACTAGTGCATAGTCTTGTGATCTTGACGATGTGAGTACTCAGTATCTACGAT

dsDNA2(+)_1 GACTATCTAGACTGCGATCTCAATCTTCGAAGCTTACAAGTATCACCTATGCATTCAAGTTGCAACGTACTGCAT

dsDNA2(+)_2 ATGCAGTACGTTGCAACTTGAATGCATAGGTGATACAAGTAAGC

AACGAAGATTGAGATCGCAGTCTAGATAGTC

dsDNA2(-)_2 ATGCAGTACGTTGCAACTTGAATGCATAGGTGATACTTGTAAGCTTCGAAGATTGAGATCGCAGTCTAGATAGTC

Supplemental Materials and methods

Quantification of ChIP experiments

For quantification of the purified DNA, the Step One Plus cycler (Applied Biosystems) was

used with the Applied Biosystems Power Sybr Green PCR Master Mix. For calculation of the

enrichments, a non-transcribed region (NTR) on Chromosome V (174131-174200) was

applied. To determine the primer efficiencies, standard curves were used. Occupancies were

calculated as enrichments of the tested gene over the NTR with the following formula:

(E^(CTIP-CT

INP))NTR/(E^(CTIP-CT

INP)YFG). Regions amplified by the respective primer pairs are:

SNR6 (chromosome XII, 366249-366328), tDNALys (amplification of 21 genes encoding

tRNALys(CUU), .e.g. chromosome III, 151295-151354), RPR1 (chromosome V, 117975-

118091) and SCR1 (chromosome V, 441987-442508, primers as shown in Supplemental

Figure S5A and described in (Ghavi-Helm et al. 2008)).

Oligo design for EMSAs

Used oligos were annealed in 10 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM EDTA, heated

to 95°C for 5 min and slowly cooled to room temperature (45 min). dsDNA code: (+): 4-

nucleotide mismatches; (-): no mismatches; 1: no double nucleotides; 2: double nucleotides

allowed. Combinations of oligo sequences were as follows:

dsDNA1(+): dsDNA1(+)_1 and dsDNA1(+)_2;

dsDNA1(-): dsDNA1(+)_1 and dsDNA1(-)_2;

dsDNA2(+): dsDNA2(+)_1 and dsDNA2(+)_2;

dsDNA2(-): dsDNA2(+)_1 and dsDNA2(-)_2

Supplemental References

Brow DA, Guthrie C. 1990. Transcription of a yeast U6 snRNA gene requires a polymerase III promoter element in a novel position. Genes & Development 4: 1345-1356.

Ghavi-Helm Y, Michaut M, Acker J, Aude JC, Thuriaux P, Werner M, Soutourina J. 2008. Genome-wide location analysis reveals a role of TFIIS in RNA polymerase III transcription. Genes & development 22: 1934-1947.

Green DM, Marfatia KA, Crafton EB, Zhang X, Cheng X, Corbett AH. 2002. Nab2p is required for poly(A) RNA export in Saccharomyces cerevisiae and is regulated by arginine methylation via Hmt1p. The Journal of biological chemistry 277: 7752-7760.

Kelly SM, Pabit SA, Kitchen CM, Guo P, Marfatia KA, Murphy TJ, Corbett AH, Berland KM. 2007. Recognition of polyadenosine RNA by zinc finger proteins. Proceedings of the National Academy of Sciences of the United States of America 104: 12306-12311.

Marfatia KA, Crafton EB, Green DM, Corbett AH. 2003. Domain analysis of the Saccharomyces cerevisiae heterogeneous nuclear ribonucleoprotein, Nab2p. Dissecting the requirements for Nab2p-facilitated poly(A) RNA export. The Journal of biological chemistry 278: 6731-6740.

Meinel DM, Burkert-Kautzsch C, Kieser A, O'Duibhir E, Siebert M, Mayer A, Cramer P, Soding J, Holstege FC, Strasser K. 2013. Recruitment of TREX to the transcription machinery by its direct binding to the phospho-CTD of RNA polymerase II. PLoS Genet 9: e1003914.

Zaros C, Thuriaux P. 2005. Rpc25, a conserved RNA polymerase III subunit, is critical for transcription initiation. Molecular microbiology 55: 104-114.