Embed Size (px)
Citation preview
1
PDX1 PROTEIN THERAPY: A NOVEL APPROACH FOR TREATMENT OF DIABETES
By
VIJAY KOYA
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2009
2
© 2009 Vijay Koya
3
To my brother and parents, for their support and appreciation for higher education, and to my wife for her support all through my graduate school.
4
ACKNOWLEDGMENTS
I have spent last 4 years at the University of Florida working towards my doctoral degree.
In the process I had opportunity to learn, explore, and teach. I have had unique experiences that
helped me to develop as an individual and helped me plan my career for the future. There have
many people who have influenced my thought process, my behavior and my interaction. During
this 4 year long journey, I have been helped by many people to successfully reach my research
goals.
Firstly, I would like to thank my mentor, Dr. Lijun Yang for giving me an opportunity to
conduct research in her lab. She has been exceptionally helpful in achieving my research goals.
She has supported me in every possible way to have an enjoyable experience in her lab. Her
unwavering support has helped me to achieve my goal to obtain admission into residency
program. Her enthusiasm and perseverance has motivated me to work extra hard.
Next, I would like to thank my supervisory committee Dr. Daniell Purich, Dr. Lung-ji
Chang, Dr. Chen Liu, and Dr. Sally litherland. Their insight has helped me to accelerate my
research progress and made sure I am progressing in right direction. I should thank Dr. Purich for
his personal advice. Conversation with him has been inspiring and motivates me to achieve
greater heights in science. I should thank Dr. Lung-ji Chang for providing with reagents
necessary for my experiments.
Next, I would like to thank Dr. Shiwu Li (expert in Molecular biology) for his constant
support technically and intellectually. Working with him has been a memorable experience. He
has been a constant backbone for my research achievements. He has optimized to generate high
quality Pdx1 protein, the most valuable reagent that shaped my research projects. He is very
approachable person, has a great knowledge in various fields of biomedical sciences, technically
sound, and has a great sense of humor. He has been a constant source to clarify my doubts.
5
I would like to thank Dr. Shun Lu for his help with the Balb/C mice project. I would like to thank
Dr. Chang Qing and Dr. Dongqi Tang for teaching me techniques related to animal surgery and
dissection. I would like to thank my lab colleagues Cathy and Hong Fong for their technical
assistance with the experiments. I would like to thank William Donlean for his assistance with
lab ordering, lab maintenance and equipment handling. He is a great person to work and having
him around is always fun.
I should thank Michael lagoe and Adam Kenney, undergraduates in the lab who have
been a helping hand in conducting some of my experiments. Mike is a fun guy to work with. He
has shown extreme level of dedication towards the experiments that I have assigned to him. I
would like to thank Fred Hutchinson for his help in the mouse colony. He has been exceptionally
helpful in maintaining my mouse colonies. I would like to thank Sushama (my wife), Dr. Satish
Medisetty, Suntiha, Karthik, Rushi and Will for proof-reading my dissertation. I would like to
thank all my friends and colleagues in the PhD program for their support and encouragement
through all these years. I would like to thank my family for their constant support and
encouragement all these years. I would like to thank my wife for her exceptional support with
both academic and no-academic affairs. I would like to thank the IDP and MCB program
directors for making it an enjoyable learning experience.
.
6
TABLE OF CONTENTS page
ACKNOWLEDGMENTS ...............................................................................................................4
LIST OF TABLES .........................................................................................................................10
LIST OF FIGURES .......................................................................................................................11
LIST OF ABBREVIATIONS ........................................................................................................14
ABSTRACT ...................................................................................................................................16
CHAPTER
1 INTRODUCTION ..................................................................................................................18
Diabetes ..................................................................................................................................18 Type 1 Diabetes ...............................................................................................................18 Type 2 Diabetes ...............................................................................................................19 Current Treatment Options ..............................................................................................20 Novel Approaches for Treatment of Diabetes .................................................................21
Pancreatic Duodenal Homeobox 1 (Pdx1) .............................................................................21 Function of Pdx1 in Pancreatic Beta Cells ......................................................................22 Protein Transduction Domain (PTD) ..............................................................................23 Beta Cell Regeneration ....................................................................................................24 Liver Cell Transdifferentiation into insulin-producing cells (IPCs) ...............................24
Significance ............................................................................................................................26
2 GENERAL METHODS .........................................................................................................27
Recombinant DNA Technology .............................................................................................27 Plasmid Isolation .............................................................................................................27 Preparation of LB Broth ..................................................................................................27 Agar Gel Electrophoresis ................................................................................................27 Polymerase Chain Reaction .............................................................................................27 Restriction Digestion .......................................................................................................28 DNA Ligation ..................................................................................................................28 Transformation of Competent E.coli Cells ......................................................................28
Protein Expression, Purification and Analysis .......................................................................29 Protein Expression in Bacteria ........................................................................................29 Protein Purification ..........................................................................................................29 Dialysis of the Purified Protein .......................................................................................30 Sodium Dodecylsulphate - Polyacrylamide Gel Electrophoresis (SDS-PAGE) .............31 Western Blotting ..............................................................................................................31
Mammalian Cell Culture Protocols ........................................................................................32
7
Cell Culture .....................................................................................................................32 Transfection of Plasmid in Mammalian Cells .................................................................32 RNA Isolation from Cells/Tissue ....................................................................................33 cDNA Synthesis ..............................................................................................................33 Measurement of Luciferase Activity ...............................................................................34
Extraction and Measurement of Insulin ..................................................................................34 Serum Sample Collection for Measurement of Insulin by ELISA ..................................34 Tissue Sample Collection for Measurement of Insulin by ELISA ..................................34 ELISA for Measurement of Insulin .................................................................................35
Procedures for Imaging ...........................................................................................................35 Haematoxylin and Eosin (H &E) Staining ......................................................................35 Immunofluroscence .........................................................................................................36
General Animal Procedures ....................................................................................................36 Animal Housing ...............................................................................................................36 Collection of Blood .........................................................................................................37 Tissue Sample Collection for Histology ..........................................................................37 Measurement of Blood Glucose ......................................................................................37 Tissue Sample Collection for RNA Isolation ..................................................................37 Anesthesia ........................................................................................................................38 Pancreatectomy ................................................................................................................38 Splenectomy ....................................................................................................................38
3 REVERSAL OF STREPTOZOTOCIN-INDUCED DIABETES IN MICE BY CELLULAR TRANSDUCTION WITH RECOMBINANT PANCREATIC TRANSCRIPTION FACTOR PANCREATIC DUODENAL HOMEOBOX-1 ...................40
Introduction .............................................................................................................................40 Materials and Methods ...........................................................................................................41
Construction and Production of rPdx1, PTD–Green Fluorescent Protein, and Mutant Pdx1 Fusion Proteins .......................................................................................41
Cell Entry and Immunoblotting .......................................................................................42 rPdx1 Functional Analyses Using NeuroD-Luciferase Reporter Construct ....................43 Animal Studies ................................................................................................................43 Low-Dose Streptozotocin-Induced Diabetes ...................................................................43 Intraperitoneal Glucose Tolerance Test ...........................................................................44 Pdx1 Protein in vivo Kinetics and Tissue Distribution ....................................................44 RT-PCR ...........................................................................................................................44 Quantitative Real-Time RT-PCR Analysis .....................................................................45 Immunohistochemistry and Immunofluorescence ..........................................................46 Tissue and Serum Insulin Measurements by Enzyme-Linked Immunosorbent Assay ...47 Statistical Analysis ..........................................................................................................47
Results .....................................................................................................................................47 Generation of Recombinant Fusion Proteins ...................................................................47 Characterization of Recombinant Fusion Proteins ..........................................................48 In vivo Kinetics and Tissue Distribution .........................................................................49 In vivo Effects of rPdx1 on Blood Glucose Levels in Diabetic Mice .............................50
8
Pdx1 Treatment Promoting Endogenous beta cell Regeneration ....................................51 Pdx1 Treatment Promoting Liver Cell Transdifferentiation into IPCs ...........................52 Relationship between Pancreas and Liver at Tissue Insulin Levels ................................53
Discussion ...............................................................................................................................54
4 PDX1 PROTEIN THERAPY PREVENTS THE ONSET OF TYPE 1 DIABETES IN NOD MICE .............................................................................................................................79
Introduction .............................................................................................................................79 Materials and Methods ...........................................................................................................80
Animal Studies ................................................................................................................80 Intraperitoneal Glucose Tolerance Test (IPGTT) ............................................................80 Serum Insulin Measurements ..........................................................................................81 Construction of Truncated Pdx1 Proteins ........................................................................81 Extraction of Splenocytes from the Spleen .....................................................................82 Lymphocyte Proliferation Assay .....................................................................................82 BDC 2.5 Mice Splenocyte Transfer ................................................................................83
Results .....................................................................................................................................83 Administration of rPdx1 to NOD Mice Prevents the Onset of Diabetes .........................83 Beta cell Functional Analysis and Determination of Tissue Insulin Levels ...................84 Pdx1 Treatment Preserves Islet Mass Possibly by Beta cell regeneration and
Promotes Liver Cell Transdifferentiation into Insulin-Producing Cells. .....................84 Detection of Pdx1 Antibodies in Serum Samples of rPdx1/Saline-treated Mice ............85 Determination of Antigenic Epitope of Pdx1 Protein .....................................................85 PAA emerge before the onset of diabetes. ......................................................................86 Demonstration of Autoreactive Lymphocytes Against Pdx1 Protein in NOD Mice ......87 Decreased Proliferation of Donor Derived BDC2.5 CD4+ Lymphocytes in
Pancreatic Lymph Node ...............................................................................................87 Effect of Mutant-rPdx1 On the Onset of Diabetes in NOD mice ....................................88
Discussion ...............................................................................................................................88
5 MOLECULAR MECHANISM OF THE ROLE OF PDX1 IN BETA CELL PROLIFERATION ...............................................................................................................112
Introduction ...........................................................................................................................112 Materials and Methods .........................................................................................................113
Cell Culture ...................................................................................................................113 Design of siRNA for the Pdx1 Transcript .....................................................................113 siRNA Mediated Knockdown of Pdx1 Transcript in INS-1 Cells ................................113 Western Blotting with Anti-Pdx1 and Anti-tubulin Antibody ......................................114 BrdU Proliferation Assay ..............................................................................................114 Real Time PCR ..............................................................................................................115 Construction of pGL4.10-Cyclin B1 Promoter-Luciferase Vector ...............................116 Analysis of Promoter Constructs for Activation by Pdx1 or Nkx6.1 using
Luciferase Reporter Assays .......................................................................................116 Results ...................................................................................................................................117
9
Phenotype of INS-1 Cells Treated with Pdx1 siRNA ...................................................117 siRNA-mediated Knockdown of Pdx1 Transcripts in INS-1 Cells ...............................117 Decrease in Cell Proliferation of Pdx1 Knockdown Cells ............................................117 Analysis of the Gene Expression of Beta Cell Specific transcription factors and
Cell Cycle Genes........................................................................................................118 Analysis of Cyclin B1 Promoter using CMV-Pdx1 .......................................................118 Nkx6.1 Activation of Cyclin B1 Promoter ....................................................................118 Pdx1 Activation of Nkx6.1 Promoter ............................................................................119
Discussion .............................................................................................................................119
6 FUTURE STUDIES .............................................................................................................132
Reversal of Streptozotocin-induced Diabetes in Mice by Cellular Transduction with Recombinant Pancreatic Transcription Factor, Pancreatic Duodenal Homeobox-1 .........132
Future Studies ................................................................................................................132 Pdx1 Protein Therapy for the Treatment of Type 1 Diabetes in NOD Mice ........................134
Future Studies ................................................................................................................134 Molecular Mechanism of the Role of Pdx1 in Beta Cell Proliferation .................................135
Future Studies ................................................................................................................135
APPENDIX
A NOD MICE TRIAL 1 ...........................................................................................................136
B NOD MICE TRIAL 2 ...........................................................................................................137
REFERENCES ............................................................................................................................138
BIOGRAPHICAL SKETCH .......................................................................................................152
10
LIST OF TABLES
Table page Table 3-1. Primer name, sequences, size, GenBank #, and PCR condition ...................................59
Table 3-2. Real time PCR Primer name, sequences, size, GenBank #, and PCR condition ..........60
Table 5-1. Real time PCR Primer name, sequences, size, GenBank #, and PCR condition ........122
Table A-1. Mice database of trial 1 .............................................................................................136
Table B-1. Mice database of trial 2 ..............................................................................................137
11
LIST OF FIGURES
Figure page 3-1 Cloning, expression, purification, and characterization of rat Pdx1, PTD-GFP, and
rPdx1-mut fusion proteins. ...............................................................................................61
3-2 Time course of cell entry of rPdx1 and rPdx1-mut proteins. .............................................62
3-3 Functional analysis of rPdx1 protein. ................................................................................63
3-4 In vivo kinetics and tissue distribution of rPdx1 following intra-peritoneal injection. .....64
3-5 In vivo tissue distribution of rPdx1 following intraperitoneal injection. ...........................65
3-6 Experimental timeline for rPdx1 treatment........................................................................66
3-7 In vivo effects of rPdx1 protein on blood glucose levels. ..................................................67
3-8 Intraperitoneal glucose tolerance test. ................................................................................68
3-9 Comparison of average blood glucose and Insulin levels between rPdx1 treated and untreated control mice. .......................................................................................................69
3-10 Histology of pancreatic islets. ............................................................................................70
3-11 Immunostaining with anti-KI67 antibody and anti-insulin antibody. ................................71
3-12 Quantitative Realtime-PCR analyses of pancreatic tissue between rPdx1 treated and control mice. ......................................................................................................................72
3-13 Insulin immunohistochemical staining of liver tissue. ......................................................73
3-14 RT-PCR analysis of the expression of pancreatic genes in the liver.. ...............................74
3-15 Quantitative Real Time-PCR analyses of pancreatic gene expression in liver.. ................75
3-16 Expression of pancreatic genes in other organs.. ...............................................................76
3-17 Pancreatic tissue insulin measurements as determined by ELISA. ...................................77
3-18 Liver tissue insulin measurements as determined by ELISA. ...........................................78
4-1 Time line for the experimental plan for treatment of NOD mice. .....................................92
4-2 Effect of rPdx1 (12-weeks) on the onset of diabetes in NOD mice. ..................................93
4-3 Blood glucose levels of rPdx1 (12-weeks) treated NOD mice. .........................................94
12
4-4 Body weights of rPdx1 (12-weeks) treated NOD mice. ....................................................95
4-5 Effect of short term rPdx1treatment (4-weeks) on the onset of diabetes in NOD mice. ...96
4-6 Blood glucose levels of rPdx1 (4-weeks) treated NOD mice. ...........................................97
4-7 Effect of short term rPdx1treatment (8-weeks) on the onset of diabetes in NOD mice. ...98
4-8 Blood glucose levels of rPdx1 (8-weeks) treated NOD mice. ...........................................99
4-9 Intraperitoneal glucose tolerance test. IPGTT (n=4/group). ...........................................100
4-10 Serum insulin measurements as determined by ELISA. ................................................101
4-11 Haematoxylin & Eosin staining and immunohistochemistry of pancreatic tissue sections. ............................................................................................................................102
4-12 Pancreas and liver tissue insulin levels as determined by ELISA. ................................103
4-13 Detection of Pdx1 antibodies by ELISA in the NOD mice. ............................................104
4-14 Confirmation of anti-Pdx1 antibody in the NOD mice by western blotting. ...................105
4-15 Determination of antigenic epitope by western blot. .......................................................106
4-16 Relationship between Pdx1 autoantibody levels and onset of diabetes. ..........................107
4-17 Antigen-stimulated lymphocyte proliferation. .................................................................108
4-18 Transfer of splenocytes from donor BDC2.5 mice to the recipient NOD mice. .............109
4-19 Illustration of Pdx1 and mutant Pdx1proteins. ..............................................................110
4-20 Effects of mutant-Pdx1 on the onset of diabetes. . .........................................................111
5-1 Location of 21 mer siRNAs on Pdx1 mRNA transcript. .................................................123
5-2 Phenotype of INS1 cells treated with Pdx1 siRNA.. .......................................................124
5-3 Confirmation of Pdx1 knockdown using western blotting. .............................................125
5-4 Measurement of INS-1 cell proliferation using BrdU incorporation. ..............................126
5-5 Analysis of relative change in the gene expression. ........................................................127
5-6 Analysis of cyclin B1 promoter using CMV-Pdx1. .........................................................128
5-7 Nkx6.1 activation of Cyclin B1promoter .........................................................................129
5-8 Pdx1 activation of Nkx6.1 promoter. ...............................................................................130
13
5-9 The chain of events triggered by Pdx1 towards β-cell cycle progression.. .....................131
14
LIST OF ABBREVIATIONS
BrdU Bromo-deoxy-uridine
CFSE Carboxyfluorescein diacetate, succinimidyl ester
CMV Cauliflower mosaic virus
ELISA Enzyme-linked immunosorbance assay
GAD Glutamic acid decarboxylase
GFP Green fluorescent protein
GLP-1 Glucagon-like peptide-1
GST Glutathione transferase
H&E Hematoxylin & eosin
HRP Horse radish peroxidase
Hsp Heat shock protein
IAA Insulin autoantibody
IACUC Institutional animal care & use committee
IAPP Islet amyloid polypeptide
ICA Islet cell autoantibody
IDDM Insulin dependent diabetes mellitus
IgG Immunoglobulin G
INGAP Islet neogenesis associated protein
INS-1 Insulinoma cell line
IP Intra peritoneal
IPCs Insulin-producing cells
IPGTT Intraperitoneal glucose tolerance test
NOD Non-obese diabetic
15
NIDDM Non-insulin dependent diabetes mellitus
PAGE Poly acrylamide gel electrophoresis
PBS Phosphate-buffered saline
Pdx1 Pancreatic duodenal homeobox-1
PTD Protein transduction domain
rPdx1 Recombinant Pancreatic duodenal homeobox-1
RT-PCR Reverse transcriptase polymerase chain reaction
SDS Sodium dodecyl-sulphate
STZ Streptozotocin
16
Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
PDX1 PROTEIN THERAPY: A NOVEL APPROACH FOR TREATMENT OF DIABETES
By
Vijay Koya
August 2009
Chair: Lijun Yang Major: Medical Sciences—Molecular Cell Biology
Diabetes is a metabolic disorder characterized by hyperglycemic condition that occurs due
to insulin deficiency (autoimmune type 1 diabetes) or insulin resistance (type 2 diabetes).
Pdx1 is widely regarded as a master transcriptional regulator of the pancreas and is critical for
development, regeneration, and maintenance of beta-cell function. Pdx1 protein possesses a
protein transduction domain (PTD) sequence that facilitates its entry into cells. This study,
therefore, sought to evaluate the capacity of in vivo administered recombinant Pdx1 (rPdx1) in an
effort to ameliorate hyperglycemia in mice with streptozotocin (STZ)-induced diabetes.
Administration of rPdx1 into STZ-induced diabetic mice led to restoration of euglycemia.
Insulin, glucagon, and Ki67 immunostaining revealed increased islet cell number and
proliferation in islets of pancreata of rPdx1-treated mice. Analysis of liver tissue by RT-PCR and
insulin immunostaining demonstrated that the rPdx1 treatment promoted liver cell
reprogramming into insulin-producing cells. This novel PTD-based protein therapy offers a
promising way to treat patients with diabetes while circumventing the potential side effects
associated with the use of viral vectors.
We further investigated the therapeutic effects of rPdx1 in NOD mice (type 1 diabetic
mouse model). Administration of rPdx1 to pre-diabetic NOD mice prevented the onset of
17
diabetes. The characterization of NOD mice revealed the presence of anti-Pdx1 autoantibodies in
pre-diabetic mice indicating the possible role of Pdx1 as an autoantigen. The role of Pdx1 as an
autoantigen was confirmed by demonstration of Pdx1 dependent activation of lymphocytes and
mapping of the epitope region responsible for autoantibody production. Decreased proliferation
of CD4+ T lymphocytes in the pancreatic lymph nodes of rPdx1-treated mice, confirmed the role
of rPdx1 in immunomodulation. In conclusion, Pdx1 is a novel autoantigen and rPdx1 antigen-
based immunotherapy could serve as an effective strategy for prevention of the onset of diabetes.
In order to understand the role of Pdx1 in beta cell regeneration, we explored to study the
siRNA mediated knockdown of Pdx1 in rat insulinoma cells (INS-1cells). The BrdU
proliferation assay demonstrated a decrease in the proliferation of cells treated with Pdx1 siRNA.
The knockdown studies suggested that beta cell specific transcription factors and cell cycle
regulators may be involved in regulation of beta cell proliferation. Molecular studies indicated
that Pdx1 promotes beta cell cycle progression by activation of cyclin B1 expression via Nkx6.1.
In conclusion, these studies investigated the role of Pdx1 in promoting beta cell
regeneration, liver cell transdifferentiation, and immunomodulation towards the treatment of
diabetes.
18
CHAPTER 1 INTRODUCTION
Diabetes
Diabetes is a metabolic disorder characterized by hyperglycemic condition. The symptoms
include frequent urination (polyuria), excessive thirst (polydipsia), extreme hunger (polyphagia),
increased fatigue and unusual weight loss. According to the estimates by the American Diabetic
Association, there are 20.8 million children and adults in the United States, or 7% of the
population suffering with diabetes. The exact cause of diabetes continues to be a mystery, it has
been demonstrated that both genetic and environmental factors play a role in causing the
disease(1-5). Diabetes is classified into two types, type 1 (insulin dependent diabetes mellitus or
IDDM) and type 2 (non-insulin dependent diabetes mellitus or NIDDM).
Type 1 Diabetes
IDDM occurs due to an absolute deficiency of the insulin hormone. It occurs mostly in
children and young adults, hence, termed as juvenile diabetes. The disease is characterized by the
autoimmune destruction of pancreatic beta cells(6). Predisposition to a given autoimmune
response requires the requisite allele(s) that controls antigen presentation by antigen-presenting
cells for T-cell recognition. The main susceptibility genes code for polymorphic HLA molecules
and in particular alleles of class II MHC genes (DR, DQ and DP). Polymorphisms of individual
genes outside the MHC also contribute to diabetes risk but recent evidence suggests that there
are additional non-HLA genes determining susceptibility linked to the MHC (7). Some
autoimmune responses emerge following infection by a pathogen, whose protein(s) possess
structural similarities in some of its epitopes to regions on proteins of the host(2). Thus,
antibodies evoked against a pathogen might cross-react with a self-protein and act as
autoantibodies, and the involved autoantigen then provides a source for persistent stimulation.
19
Proteins to which the immune system is ordinarily self-tolerant might, if altered, elicit auto-
immune responses. Environmental factors appear to play an important role in the pathogenesis of
childhood-onset type 1 diabetes(2). The most important factors are thought to be infectious,
dietary, perinatal, and psychosocial. Enteroviruses (especially Coxsackie B virus), breastfeeding,
the early presence or lack of certain foods, birth weight, childhood over-nutrition, maternal islet
autoimmunity, and negative stress events have been shown to be related to the prevalence of type
1 diabetes. However, clear conclusions to date are limited (8).
It has been reported that approximately 50% of the genetic risk for type 1 diabetes can be
attributed to the HLA region. The highest risk HLA-DR3/4 DQ8 genotype has been shown to be
highly associated with beta-cell autoimmunity. The first antibodies described in association with
the development of type 1 diabetes were islet cell autoantibodies (ICA) (9). Subsequently,
antibodies to insulin (IAA)(10), glutamic acid decarboxylase (GAD)(11) and protein tyrosine
phosphatase (IA2 or ICA512) have all been characterized(12). Several studies have been
conducted in non-obese diabetic (NOD) mice to understand the antigen based
immunotherapeutic strategies to suppress beta cell auto immunity. Much success has been
achieved in NOD mice using administration of autoantigens such as insulin(13;14),
GAD65(11;15-19), and Hsp60(20;21). Few of the antigen molecules have been tested in human
patients with limited success. The Insulin antigen based clinical trials were conducted in the pre-
diabetic human patients in Diabetes Prevention Trail-1 (DPT-1), however the treatment had
limited or no significant effects(22;23). Similarly inconclusive results were obtained with
clinical trials using Hsp, P27-peptide in human subjects(24).
Type 2 Diabetes
Type 2 or non-insulin dependent diabetes mellitus (NIDDM), accounts for 90% of cases
and is characterized by a triad of (1) resistance to insulin action on glucose uptake in peripheral
20
tissues, especially skeletal muscle and adipocytes, (2) impaired insulin action to inhibit hepatic
glucose production, and (3) dysregulated insulin secretion (25). In most cases, Type 2 diabetes is
a polygenic disease with complex inheritance patterns (4;25). Environmental factors, especially
diet, physical activity, and age, interact with genetic predisposition to affect disease prevalence.
(26). Type 2 diabetes is often accompanied by other conditions, including hypertension, high
serum low-density-lipoprotein (LDL) cholesterol concentrations, and low serum high-density-
lipoprotein (HDL) cholesterol concentrations. Hyperinsulinemia occurring in response to insulin
resistance may play an important role in the genesis of these abnormalities. Increased free fatty
acid levels, inflammatory cytokines from fat, and oxidative factors, have all been implicated in
the pathogenesis of type 2 diabetes. Insulin insensitivity is an early phenomenon partly related to
obesity and pancreas beta-cell function declines gradually over time already before the onset of
clinical hyperglycemia. Several mechanisms have been proposed, including increased non-
esterified fatty acids, inflammatory cytokines, adipokines, and mitochondrial dysfunction for
insulin resistance, glucotoxicity, lipotoxicity, and amyloid formation for beta-cell dysfunction
(27).
Current Treatment Options
The most common method of treatment of both type 1 and type 2 diabetes is Insulin
replacement therapy. Insulin replacement therapy was first initiated during 1920’s and continues
to be the most common approach to overcome adverse effects of the diabetic condition.
However, insulin replacement therapy remains to be a management drug that can ameliorate the
symptoms but is not considered a true remedy (28). Although it is the most common approach
for the management of diabetes, it has several complications. Acute complications include
dosage issue where in patients may be at a risk of overdose leading to hypoglycemia. Chronic
21
complications are associated with aberrant glucose metabolism that include retinopathy,
nephropathy and cardiovascular problems (29).
With the development of Edmonton protocol for islet transplantation, it gained importance
as an alternative long term therapy for type1 diabetes patients. The treatment regimen also
included long term use of immunosuppressive drugs sirolimus and tacrolimus. Patients did
achieve insulin independence only for a short period of time (1 year) (30). The long term usage
of immunosuppressive drugs and insufficient number of donor cadavers for transplantation
procedures has put the brakes on this approach.
Novel Approaches for Treatment of Diabetes
With the advancements in stem cell technologies, the cell based therapy has become a
promising avenue for treatment of diabetes. Transdifferentiation of bone marrow derived cells
into beta-like cells has been achieved with limited success in mice models(31). Autologous
hematopoietic stem cell transplantation approach is currently under clinical trial in Brazil. The
newly onset diabetic patients (15 patients) were identified and administered with immune-
modulatory drugs and GM-CSF to mobilize bone marrow cells(32). The patients could achieve
insulin independence for over a period of 3 years. Efforts have been made to engineer cord blood
stem cells into insulin producing beta like cells, however the complexity of this approach has
significantly slowed down the progress in this area(33). A major mile stone has been achieved
recently in cell based therapy with the engineering of glucose responsive insulin secreting cell
from embryonic cells(34)
Pancreatic Duodenal Homeobox 1 (Pdx1)
Pdx1 is a transcriptional factor, plays crucial role in pancreas development and beta cell
differentiation during embryogenesis(35;36). Its role in post natal stage is maintaining mature
beta cell function and regulating gene expression of several important genes in the
22
pancreas(35;37;38). During embryogenesis, Pdx1 expression domain appears in the duodenum
early in development along with Hlxb9 and demarcates a population of cells that represent the
earliest pancreatic precursors. Later it is expressed in all cells differentiating toward the exocrine
and endocrine components of the pancreas where it triggers the genetic cascade, necessary for
differentiation of precursor cells into different cell types in the pancreas. In the adult pancreas,
Pdx1 expression is predominantly restricted to the insulin-producing islet beta cells and a subset
of somatostatin producing delta cells(39-41). Pdx1 null mutant resulted in agenesis of pancreas
with hyperglycemia and did not survive after birth(35). Pdx1 has been found to play key role in
beta cell neogenesis and insulin production (38).
Function of Pdx1 in Pancreatic Beta Cells
In mature beta cells, Pdx1 transactivates the insulin gene and islet amyloid polypeptide
(IAPP) and other genes involved in glucose sensing and metabolism, such as GLUT2(35;42) and
glucokinase(35;43). Pdx1 regulates the pancreas-specific expression of other transcriptional
factors such as Pax4, Nkx6.1 and Pdx1 itself. Pdx1 co-operates with Hnf-3b to auto-activate its
own transcription (44). During regeneration of the islets, either from duct cells or by replication,
Pdx1 is plays a major role by triggering the genetic cascade of differentiation(45). Pdx1 protein
possesses N-terminal region transactivation domain, in the middle region, an antennapedia-like
homeodomain consisting of 3 helices. The homeodomain of the Pdx1 protein plays a critical role
in DNA binding and protein-protein interactions as a transcriptional activation mechanism.
Furthermore, it contains a protein transduction domain within the helix 3 region consisting of 7
amino acids (RRMKWKK) that is conserved in mice, rats, and humans(46). This sequence plays
a major role in nuclear entry of the Pdx1 protein to perform its major transcriptional events
occurring in the pancreas.
23
Protein Transduction Domain (PTD)
The protein transduction domains are short peptides with rich basic amino acids such as
arginine and lysine, help facilitate binding to negatively charged heparin sulphate proteoglycans
on the lipids membrane followed by internalization via receptor-independent macropinocytosis
into the cytoplasmic and nuclear compartments(47-49). This phenomemon was first reported in
HIV Tat transactivator (50;51). Later such transduction domains were discovered in
homeodomain region of the antennapedia, a transcriptional factor of the Drosophila
melanogaster(47;52). The protein transduction domain has been proved to successfully carry
protein into the cells and be functional. The artificial engineered protein transduction domains
were covalently linked the macromolecules to transduce the macromolecule into the cell. Site-
specific recombination in human embryonic stem cells was demonstrated using the PTD
mediated Cre recombinase(53). The protein transduction domain has been exploited successfully
to deliver wide variety of molecules such as antigenic epitopes(54) and large protein
molecules(55;56). Most recently recombinant proteins with protein transduction domains were
used for generation of induced pluripotent stem cells(57). The first in vivo studies of PTDs were
demonstrated by engineering beta-gal molecule to the PTD(58). Protein transduction domains
were engineered with therapeutic molecules demonstrated their biological activity in disease
models of asthma (59), Inflammation(60), cancer(61), Stroke(61;62). Pdx1 protein has its own
inbuilt antennapedia like protein transduction domain(63;64) that will help the protein to enter
the cells in a receptor independent manner by lipid raft dependent macropinocytosis(65;66) . The
Pdx1 protein has been used to transduce into pancreatic duct cells and differentiate them into
insulin-producing cells in vitro(63). Despite several studies in vitro showing functional
significance of PTD in Pdx1, in vivo functional studies are yet to be explored.
24
Beta Cell Regeneration
Pdx1 is regarded as a master transcriptional regulator of pancreas development and is
critically needed for the development, regeneration, and function of islet β-cells. Beta cell
regeneration has been known to occur during pregnancy, initial stages of insulin resistance to
meet the insulin demands, early stages of beta cell destruction, partial pancreatectomy. During
post natal condition, the primary mechanism by which new beta cells are formed is by self
duplication or replication of the existing cells(67;68) and/or differentiation of beta cell from duct
cell progenitors (neogenesis). Pancreatic duodenal homeobox (Pdx1) is the key transcriptional
factor controlling the beta cell regeneration(37;39;68). However, the molecular mechanism
associated with the role of Pdx1 in beta cell regeneration is yet to be investigated. In vivo
regeneration of residual islet β-cells appear to be linked to increased biosynthesis of the
pancreatic duodenal homeobox-1 (Pdx1) transcription factor(45). However, Pdx1 mediated
regeneration mechanism is severely hindered during diabetic condition due to the oxidative
stress(45;69-71). Previous studies in HIT-T15 cells and zucker diabetic rats have shown that
oxidative stress causes post transcriptional defect in Pdx1 mRNA processing(69;72) . One
possible approach to overcome the diabetic condition could be restoring and/or expediting the
beta cell replication mechanism by augmenting the Pdx1 expression. The mechanism of beta cell
replication in hyperglycemic state could be enhanced by hyper-expression of key transcription
factors such as factor pancreatic duodenal homeobox (Pdx1) necessary for beta cell regeneration.
Liver Cell Transdifferentiation into insulin-producing cells (IPCs)
Liver and pancreas are closely related both developmentally and phylogenetically. Liver
and pancreas are derived from appendages of the upper primitive foregut endoderm. It has been
suggested that the late separation of liver and pancreas during organogenesis in primitive ventral
25
endoderm might have left both tissues with pluripotent cells that are capable of giving rise to
both hepatic and pancreatic lineages. In lower organisms, such as worms and fish, the two organs
never gets separated during organogenesis and the ‘hepato–pancreas’ functions as both liver and
pancreas (73-76). Tissues of both the organs have some metabolical similarities such as
responsiveness to glucose, and both express a large group of specific transcription factors such
as hepatic nuclear factor 1α and 3β that are known to control the Pdx1 expression in pancreatic
cells and could cooperate other wise silent Pdx1 expression during transdifferentiation
(39;44;74). Under the experimental and pathological conditions such as cancer, transconversion
of pancreatic acinar cells and hepatocytes in both rodents and humans has been reported(77).
Mounting evidence indicates that liver stem cells(78;79) and adult hepatocytes(80) can be
reprogrammed into IPCs by ectopic overexpression of Pdx1 that restore euglycemia in diabetic
mice(81). Pdx1 induces developmental redirection from hepatic to pancreatic lineage by
repressing the expression of key hepatic transcription factor CCAAT/enhancer -binding protein β
(C/EBPβ)(82). Liver cell transdifferentiation into IPCs was achieved in both in vitro and in vivo
conditions by hyper expressing Pdx1 via gene transfer approach using lentivirus or
adenovirus(78;83-85). Transient over expression of Pdx1 using adenovirus gene therapy in the
liver in vivo has led to transdifferentiaton of liver cells into insulin-producing cells. This
remarkable approach has several advantages such as IPCs derived from liver cell do have
resistance against the autoimmune attack unlike the beta cells in islets(86). However, studies
from other groups using gene therapy resulted in hepatitis(86;87) and development of tumors
which limited the feasibility to apply for human subjects. The alternative approach using protein
therapy using protein transduction domain could be a safe and efficient approach for the
production of insulin-producing cells. A safe and efficient method of delivering Pdx1 to
26
reprogram the target cells would eventually make this approach more feasible for the clinical
setup. Investigations are underway to characterize the cell types within liver that are susceptible
to transdifferentiation. It was demonstrated that hepatocyte proliferation induced by partial
hepatectomy and enforced ectopic Pdx1 expression using gene therapy accelerate
transdifferentiation process in liver(88). Recent studies have used DDC mouse model for
demonstrating the transdifferentiation of oval cells into IPCs(89).
Significance
Given its key role in pancreatic development, islet β-cell regeneration, liver-to-endocrine
pancreas transdifferentiation as well as its ability to autoregulate itself, Pdx1 protein is an ideal
candidate for protein therapy, especially because of its antennapedia-like PTD, permitting its
rapid entry into cells. We therefore aim to test the hypothesis that effective in vivo delivery of
recombinant Pdx1 protein (rPdx1) will allow its entry into pancreatic or liver progenitor/adult
cells, where it can exert transcriptional control on its target genes, leading to restoration of
normoglycemia in Streptozotocin-induced diabetic mouse model and delay in the onset of
diabetes in Non-obese diabetic mouse model. We believe that the proposed study will serve as a
model system to design a rational protocol for pre-clinical investigation using protein based
approach for the treatment of diabetes. This approach will eliminate the need for gene therapy
that is facing severe challenges in clinical trials.
27
CHAPTER 2 GENERAL METHODS
This chapter discusses general methodologies and materials that are common used in the
laboratory. However, specific experimental procedures in relation to the specific aims are
described in detail in respective chapters.
Recombinant DNA Technology
Plasmid Isolation
The DNA plasmid was isolated and purified using Qiagen plasmid miniprep kit or
Qiagen plasmid midi kit.
Preparation of LB Broth
Ten LB medium capsules (Lennox) in 500 mL dd water were used in 2 L flask to make
500 mL of media. The flask was autoclaved and cooled to room temperature before use.
Agar Gel Electrophoresis
For 1% agarose gel, 1 gram of electrophoresis grade agarose (Biorad) was mixed in 1X
TAE buffer (Tris-acetic acid-EDTA). The mix was boiled for 1 min 30 sec in a microwave. The
solution was allowed to cool at room temperature. 5 µL of ethidium bromide (10,000X) was
added to the solution and mixed well. The mix was poured onto the gel casting apparatus and it
was allowed it to solidify. The gel was placed in an electrophoresis tank with 1X TAE buffer.
After loading the samples, the gel was run at 100 V.
Polymerase Chain Reaction
All reactions were performed using a standard procedure with variation in annealing
temperature. 95°C denaturing temperature 5 min, followed by 30 cycles of 94°C denaturing
temperature for 30 sec, 55-58°C of annealing temperature for 30 sec and 72°C extension
temperature for 30 sec. The reaction ended with final extension temperature of 72°C for 7 min.
28
Taq polymerase (Eppendorf) was used for all the PCR reactions.
Restriction Digestion
Approximately 0.5-1 µg of DNA was used for digestion in a 20 µL reaction. For each 20
µL reaction, 2 μL of 10X buffer (New England Biolabs, NEB), 1 μL of restriction enzyme
(NEB) and sterile dH2O to make up the volume to 20 μL was used in the reaction. The reaction
was incubated for 3 hours at 37°C. 0.2 μL 100X BSA was used for certain enzyme digestions
recommended by NEB catalog. For double digestions, compatible buffer was used based on
NEB catalog recommendations.
DNA Ligation
Approximately 100 ng of digested DNA was used for a 20 µL ligation reaction. For each
20 µL reaction, 2 µL of T4 DNA ligase buffer, 10X (Invitrogen) and 1 μL of ligase enzyme and
sterile dH2O to make up the volume to 20 μL was used in the reaction. The reaction was
incubated at 16°C overnight.
Transformation of Competent E.coli Cells
One Shot MAX Efficiency DH5α-T1 chemically competent cells (Invitrogen, CA) were
used for the transformation of bacteria. The competent cells were stored at -80°C. The cells were
thawed on ice (50 µL total). 1-50 ng DNA was added to the tube containing cells, gently swirled
and incubated on ice for 30 min. The cells were treated with heat shock by placing the tube in
water bath at 42°C for 1 min. The cells were then immediately placed on ice for 2 min. 250-450
µL S.O.C. medium (Invitrogen, CA) was added to the tube and incubated at 37°C for 1 hour on a
shaker at 225-250 rpm. Finally, 20 µL and 100 µL of tube mix were plated on separate LB agar
plates containing ampicillin. The plates were incubated overnight at 37°C. The plates were stored
at 4°C in plastic wrap to prevent dehydration.
29
Protein Expression, Purification and Analysis
Protein Expression in Bacteria
A single isolated clone was obtained and grown in 20 mL LB broth with 20 µL of 0.1%
kanamycin (100 µg/mL) (Sigma). The culture was allowed to grow overnight on a shaker at 220
rpm and 37°C. The entire culture was transferred to a large flask containing 500 mL of LB broth.
After growth at 37°C to an optical density (OD600) of 0.8, culture was incubated at room
temperature for another 18 hours in the presence of 0.5 mmol/L (final concentration) isopropyl-
D-1-thiogalactopyranoside (Fisher Scientific Stock: IPTG 1 g/ 4.2 mL ddH2O). The bacteria
culture was pelleted by centrifugation at 6000 rpm for 30 min. The supernatant was discarded
and pellet was stored at -80°C.
Protein Purification
The purification protocol was optimized for 3 L bacterial culture. The bacterial pellet was
stored at -80°C. After thawing at room temperature, 50 mL of 5 mM imidazole (Sigma) buffer
with 1 tablet of protease inhibitor cocktail (Roche, CA) and 0.2 g lysozyme (Sigma) was added.
The lysozyme was first dissolved in water before the imidazole was added. This allowed the
lysozyme to dissolve completely. 500 mL of Buffer A (10 mL of 1 M Tri/HCL pH.8, 50 mL of
5 M NaCl, 0.5 mL of Triton X-114, 800 µL of 3 M Imidazole , added ddH2O to bring the
volume to 500 mL) solution was prepared and stored at 4°C. 100 mL of Buffer A was added to
the bacterial pellet and left on ice for 30 min, this was followed by vigorous vortexing for 30
min. At this point the highly viscous sticky mix was formed. Later, the mix was transferred to
two centrifuge tubes and the solution was sonicated for 15 sec X 4 times each on ice. After
sonication, the solution became less sticky. The tubes were balanced and centrifuged at 12000
rpm for 30 min 4°C. The supernatant was saved. (If the supernatant wasn't clear, the
centrifugation step was repeated). While centrifugation, Ni-NTA agarose bead (Invitrogen) was
30
washed with ddH2O first and then equilibrated with 5 mM imidazole solution. The clear
supernatant obtained by centrifugation in the earlier step was mixed with ready to use Ni-NTA
before leaving it on the spinner at 4°C for 30 min. The column with NI-NTA and supernatant
mix was placed on the stand and allowed to drip down. 150 mL of 40 mM imidazole washing
solution (1.74 mL of 3 M imidazole into 150 mL of buffer A) was added to the column for
washing unwanted proteins. This was followed by another wash step with 150 mL of 40 mM
imidazole solution (1.74 mL of 3 M imidazole into 150 mL of 5 mM imidazole buffer). This step
was incorporated to get rid of the triton X-114 used in an earlier step. At the last wash, the
protein content was checked by mixing 25 µL sample with 500 µL Bradford solution (Bio-Rad
Protein Assay (5X) 10 mL + 40 mL ddH2O). If the color was brown, the washing step was
discontinued. The target His tagged protein was eluted by adding 60 mL of 300 mM imidazole
elution buffer (Elution buffer: 3 mL of 3 M imidazole + 27 mL of 5 mM imidazole. The samples
were collected in eppendorf tubes and checked the target protein by mixing 25 µL sample with
500 µL Bradford solution. In order to check the purity, SDS (Sodium Dodecylsulphate) gel was
run with 25 µL sample + 25 µL 2X sample buffer (Bio-Rad Laemmli Sample Buffer). Each lane
was loaded with 30 µL and the gel was run at 80 V until the dye front migrated through the gel.
The gel was later separated from the cast and washed with water on a shaker for 1 hour. The gel
was finally stained with Coomassie blue (Bio-Rad Bio-safe Coomassie).
Dialysis of the Purified Protein
In order to eliminate the imidazole from the purified protein, the elute was dialyzed against
the PBS. First, the dialysis tubing was boiled at 95°C in ddH2O for 5 min to make it flexible. 2 L
of PBS was prepared using ddH2O and chilled by placing it in the refrigerator. The sample was
placed into the dialysis tubing and dialyzed against 1 L of 1X PBS while stirring overnight. The
31
next morning, PBS was changed and dialyzed for 3-4 hours. Finally, the protein concentration
was measured and stored at -80°C by adding 10% (v/v) of glycerol.
Sodium Dodecylsulphate - Polyacrylamide Gel Electrophoresis (SDS-PAGE)
The SDS-PAGE was performed using a mini gel electrophoresis apparatus (Bio- Rad). The
pre-cast polyacrylamide gels (Bio-Rad) were used to run the samples. The samples were diluted
in 2X sample loading buffer (Laemmli loading dye, Bio-Rad). Composition: 62.5 mM Tris-HCl,
pH6.8, 2% SDS, 25% Glycerol, 0.01% Bromophenol Blue. 50 µL of β-mercaptothanol was
added to 950 µL of 2X sample loding buffer. The gel was run using 1x TGS buffer, 25 mM Tris,
192 mM Glycine, 0.1 % SDS, pH 8.3, (Bio-Rad). Equal volumes of the sample and 2x sample
loading buffer were mixed and boiled at 95°C for 5 min. The electrodes of the apparatus were
connected to the power pack (Bio-Rad) and run at 80 V for 1-2 hours.
Western Blotting
Transfer buffer with 15% methanol (100 mL 1x TGS buffer, 150 mL methanol, and 750
mL ddH2O was used to transfer the proteins onto the nitrocellulose membrane.
A transfer sandwich was prepared by encasing the gel and nitrocellulose membrane
between the filter paper and sponge (sponge - filter paper - gel - PVDF membrane - filter paper -
sponge). Then the transfer sandwich was placed in the electrophoresis tank. The apparatus was
run at 80 volts for 1.5 hours. The membrane was washed in 1x TBST by combining 100 mL 10x
TBS, 1 mL Tween 20, and 899 mL ddH2O. The membrane was then blocked with blocking
buffer using TBST with 5% non-fat dry milk (50 mL TBST + 2.5g dry milk) for 1 hour at room
temperature or at 4°C overnight with gentle rotation. The primary antibody was diluted (as per
company’s recommendation) in 10 mL of blocking buffer with 1% non-fat dry milk and
incubated at room temperature for 1 hour or at 4°C overnight with gentle rotation. The
membrane was washed with approximately 30 mL 1x TBST buffer for 15 min followed by 2
32
washes for 10 min each. The membrane was then incubated with the secondary antibody with
HRP conjugation (diluted as per company’s recommendation) in blocking buffer with 1% non-
fat dry milk and incubated at room temperature for 0.5-1 hour with gentle rotation. The
membrane was finally washed with 30 mL 1x TBST buffer for 15 min, followed by 2 washes for
10 min each. The membrane was dried by blotting the corner on a paper towel for 5 seconds.
One mL each of western blotting detection ECL reagents 1 and 2 (Amersham Biosciences) was
mixed. The membrane was placed on parafilm or polyvinyl wrap and covered evenly with
western blotting reagent mixture and incubated at room temperature for 1-2 min. The x-ray film
was developed in the dark room by exposing it for appropriate amount of time depending on the
signal.
Mammalian Cell Culture Protocols
Cell Culture
The INS-1 cells were grown in RPMI 1640 (Sigma) (430 mL) with 10% fetal bovine
serum supplemented with 5 mL of HEPES (1M), 5 mL of L-glutamine (200mM), 5 mL of
Sodium pyruvate (100 mM), 5 mL of Pen/Strep, 454 µL of 2-Mercaptoethanol (1000x) and 2 mL
Kanamycin (Stock: 50 mg/mL) per bottle of media. 3T3 cells were grown in Dulbecco's
Modified Eagle Medium (Sigma) 500 mL bottle supplemented with 10% FBS (55 mL) and 2 mL
Kanamycin (50 mg/mL).
Transfection of Plasmid in Mammalian Cells
Approximately 2 μg of DNA was added to 100 μL of serum free medium (Gibco) in a
microfuge tube for each well. In a separate tube, 4 μl of lipofectamine (Invitrogen) was added to
100 μL of serum free medium for each well. The tubes were vortexed and incubated for 5 min at
room temperature. The lipofectamine and plasmid preparations were mixed together, vortexed,
and incubated for 20 min at room temperature. The cell medium was changed immediately
33
before adding transfection medium. One preparation transfection medium (200 μL) was added
directly to the normal medium (1 mL) for each well and incubated for 4-6 hours at 37°C. The
transfection medium was aspirated and 1 mL of normal medium was added to each well. The
cells were incubated for 24 hours hours at 37°C.
RNA Isolation from Cells/Tissue
The cells or tissue were homogenized and mixed with trizol reagent (Invitrogen, CA). For
1 mL of trizol mix, 0.2 mL of chloroform (Fisher Scientific) was added and mixed vigorously
and allowed to incubate at room temperature for 15 min. The mix was then centrifuged at 12,000
rpm for 15 min at 4°C. The supernatant aqueous phase was transferred to a clean tube and RNA
was precipitated by adding 0.5 mL of isoproponal (Sigma) and mixing well. The solution was
allowed to incubate for 10 min at room temperature. This was followed by centrifugation at
12,000 rpm for 8 min at 4°C. The supernatant was discarded and the pellet was washed with 1
mL of 75% ethanol and centrifuged at 7,500 rpm for 15 min. The supernatant was discarded and
the pellet was allowed to dry for 10 min under the fume hood. The pellet was resuspended in 50
μL of RNAse free DEPC water (Invitrogen), the concentration was measured and stored at -
80°C.
cDNA Synthesis
Total of 2 μg of RNA was used to synthesize the cDNA. Random hexamers (2 μl)
(Invitrogen) was used and the volume was brought up to 11 μL with RNAse free DEPC water.
The mix was incubated at 70°C for 5 min followed by 5 min on ice. A cocktail mix was prepared
with 5x-first strand buffer (4 μl/sample), DTT (2 μl/sample), dNTP (2 μL/sample) and 1 unit of
superscript II reverse transcriptase (Invitrogen). 9 μl of mix per sample was added to the RNA
mix previously incubated on ice. The final mix was placed in PCR machine and run at 25°C for
34
10 min followed by 42°C for 50 min. The enzyme was finally inactivated by heating at 65°C for
10 min.
Measurement of Luciferase Activity
Dual-Luciferase Reporter Assay System (Promega) was used for the assay. Luciferase
assays were performed, using a luminometer tube for each sample and 100 µL of the Luciferase
Assay Reagent was loaded into each tube. The luminometer was programmed with a 2 second
measurement delay followed by a 10 second measurement read for luciferase activity. Next, 20
µL of cell lysate was added to the luminometer tube containing the Luciferase Assay Reagent
and it was mixed by pipetting three times. The tube was placed in the luminometer and the
reading was initiated and designated as M1. Next the tube was reloaded with 100 µL of Stop and
Glo buffer and placed in the luminometer and the reading was initiated and designated as M2.
The ratio of M1/M2 determined the ratio of luciferase activity (promoter) vs renilla activity
(internal control).
Extraction and Measurement of Insulin
Serum Sample Collection for Measurement of Insulin by ELISA
The mice were starved for 6 hours before blood collection. The mice were weighed and 2
mg/g body weight glucose was injected intraperitoneally. After 15 min of delivering the glucose
bolus, blood was collected from the retro-orbital sinus using a pasture pipette. The blood was
stored on ice for 30 min. The serum was extracted by centrifuging at 10,000 rpm for 10 min. The
supernatant was collected and stored at -80°C.
Tissue Sample Collection for Measurement of Insulin by ELISA
All the organs with major focus on the pancreas and liver were collected and weighed.
The organs were collected in ice cold Acid-ethanol solution (180 mM HCL in 70% ethanol (500
mL) 350 mL ethanol + 7.76 mL HCL + 142.24 mL H2O). The mechanical tissue homogenizer
35
was used to mince the tissue into tiny particles. The suspension was allowed to rotate on a
mechanical rotor overnight for the release of tissue extract into the solution. The suspension was
centrifuged at 6000 rpm for 15 min. The supernatant was collected and stored at -80°C.
ELISA for Measurement of Insulin
ELISA was performed to measure the insulin levels using Mouse ultra sensitive enzyme
immunoassay (Alpco Diagnostics) according to the manufacturer's protocol. The protocol was
modified slightly to suit our experimental objectives. 5 μL of tissue extracts were used for the
assay. High-concentration samples such as pancreas extract were diluted 50~500 times with
Calibrator '0'. 25 µL of Calibrator 0 was added to each well of the coated plate, then 5 µL of
Calibrators 3-7 or unknown samples were added to each well (duplicate for each calibrator or
sample). Then 50 µL of enzyme conjugate solution was added to each well. The plate was sealed
with plastic film and incubated on shaker at 800 rpm for 2 hours. Microplate washer was used to
wash the plate 6 times using an inbuilt program. After washing, 200 μl of substrate solution was
added to each well and incubated for 30 min. The plate was covered with aluminum foil to avoid
light. The reaction was stopped using 50 μl stop solution. The plate was then read on microplate
reader (Bio-rad) at 450 nm wavelength. The standard curve and unknown samples concentrations
were analyzed using software (Microplate manager).
Procedures for Imaging
Haematoxylin and Eosin (H &E) Staining
For the H & E staining, the following steps were followed. 3 x 5 min Xylene, 2 x 2 min
100% ethanol, 1 x 2 min 95% ethanol, 1 x 2 min deionized H2O, Hematoxalin staining, 1 x 2.25
min Hematoxalin (Vector Laboratories, CA), 1 x 15 sec deionized water, 1 x 1 min deionized
water, 1 x 1 min Blueing, 1 x 1 min Deionized water , 1x 1.5 min Eosin (Fisher Scientific) , 95%
36
ethanol 2 dips, 1 x 30s 95% ethanol , 1 x 1 min 100% ethanol, 3 x 1 min Xylene. Finally the
slides were covered with coverslip slides using permount medium (Fisher Scientific).
Immunofluroscence
The paraffin sections were first de-paraffinized and rehydrated using the following steps.
(Xylene: 5 min, Xylene: 5 min, 100% alcohol: 3 min, 100% alcohol: 3 min, 95% alcohol: 3 min,
70% alcohol: 15 dips. These steps were followed by rinsing for 5 min in tap water. For staining
for nuclear antigens, the slides were incubated in 95°C Preheated Trilogy (fresh) solution for 30
min. Later the slides were washed with distilled water for 5 min. Chilled 0.5% Triton-X100
(triton-X100 250 µL+50 mL TBS-0.5% Triton) in TBS was added on the slides and incubated
for 5 min and rinsed for 5 minutes in tap water, followed by wash step with TBS for 5 minutes.
This was followed by Block step for 20 min with serum (15 μL serum in 1 mL TBS). Serum
must be from the same species as the one in secondary antibody. This was followed by
incubation with primary antibody (diluted appropriately according to manufacturer's
recommendations) for 1 hour at room temperature or 4°C overnight. This was followed by wash
step with TBS for 5 min. Next, the tissue sections were incubated with secondary antibody
(diluted appropriately according to manufacturer's recommendations) for 45 min. A final wash
with TBS was continued for 5 min. The slides were mounted with Vectashield with Dapi (Vector
Laboratories, Burlingame, CA) and the coverslips were applied.
General Animal Procedures
Animal Housing
Balb/c mice were bred in pathology mouse colony, University of Florida), and housed in
SPF conditions. NOD female mice, 8 weeks old age were ordered from Jackson labs (Bar Harbor,
ME, USA) and housed in SPF conditions in pathology mouse colony. All procedures were carried
out as described in approved Institutional Animal Care & Use Committee (IACUC) protocols.
37
Collection of Blood
Blood was collected from the mice through retro orbital bleeding. The mice were
anesthetized using isoflurane. The mice was held with the left hand and a glass capillary tube
was placed on the medial aspect of the right eye and gently rolled until the blood started flowing
through the tube. A maximum of 100 µL blood was collected for mice under experimentation,
while a maximum of 400 µL was collected from mice designated for terminal bleeding.
Tissue Sample Collection for Histology
The mice were sacrificed according to the University of Florida, IACUC guidelines. The
mice were sprayed with 70% ethanol. A mid-ventral incision was made using scissors, followed
by collection of organ samples such as pancreas, liver, small intestine, kidneys, spleen, heart,
lung, and brain. The organ samples were preserved in 10% formalin for 24 hours and later
transferred to PBS. The organs were cut into small pieces and placed in cassettes for paraffin
embedding at the pathology core facility. The paraffin blocks were cut into 5 µm sections.
Measurement of Blood Glucose
The mice were either fasted or non-fasted before measuring the blood glucose. Before
measuring IPGTT, the mice were fasted for 6 hours. For measurement of fasting blood glucose
levels, the BALB/C mice were fasted for 8-10 hours. The mice were pricked with a 22 guage
needle on the tip of the tail. A drop of blood was squeezed from the tip of the tail. The
glucometer (Accu-Chek) was used to measure the blood glucose. The glucose strip was inserted
into the glucometer and a drop of blood was collected in a slot on the strip. The glucometer
displayed readings with units of mg/dL.
Tissue Sample Collection for RNA Isolation
The mice were sacrificed according to the University of Florida, IACUC guidelines. For
the large organs such as liver, the tissue samples were cut into small pieces. Several pieces were
38
collected from various liver lobes. For smaller organs such as kidney, spleen, the organs were cut
into 2-3 pieces. The tissue samples were wrapped in aluminum foil and snap frozen by dropping
them in liquid nitrogen. The samples were later stored at -80°C.
Anesthesia
The mice were given general anesthesia using isoflurane placed under isoflurane assembly
unit with nose cone apparatus as per IACUC guidelines.
Pancreatectomy
The mice were anaesthetized using an isoflurane assembly unit with nose cone apparatus. Toe
pinch method was used to verify if the mice was under anesthetic condition. The anesthesia was
maintained until the end of procedure. The anesthetized mouse was laid on its right lateral side. The
abdominal area of the left lateral side was wiped with 70% ethanol. An incision was made on left
lateral abdominal area where pancreas is located. Following incision, the peritoneal cavity was
exposed, pancreas was located and pulled out using forceps. The head of the pancreas is attached to
the duodenum and the tail is attached to the spleen. A nylon suture material was used to tie a knot on
the blood vessel running between spleen and tail of pancreas. Another knot was tied at the head of
the pancreas. Knot was tied deep in order to gain access to as much pancreas as possible. The tail of
the pancreas was then cut. The knot tied at the head of the pancreas is pulled gently in order to gain
access closer to the head. Another deep knot was tied closer to the head of the pancreas. A cut was
made between two knots that are tied close to the head of pancreas. A major chunk of pancreas was
isolated. The mouse incision was closed using staples. The mouse was monitored until it recovered
its consciousness. The staples were removed after 7 days.
Splenectomy
The mice were anaesthetized using an isoflurane assembly unit with nose cone apparatus. Toe
pinch method was used to verify if the mice was under anesthetic condition. The anesthetized mouse
39
was laid on their right lateral side. An incision was made on left lateral abdominal area where spleen
is located. Following incision, the peritoneal cavity was exposed, spleen was located and pulled out
using forceps. A knot was tied at both the ends of the spleen in order to prevent internal bleeding.
The spleen was slowly separated by cutting at both the ends of spleen and the mesenteric
connections. The associated organs such as pancreas are pushed back gently into the abdominal
cavity. The mouse incision was closed using staples. The mouse was monitored until it recovered its
consciousness. The staples were removed after 7 days.
40
CHAPTER 3 REVERSAL OF STREPTOZOTOCIN-INDUCED DIABETES IN MICE BY CELLULAR TRANSDUCTION WITH RECOMBINANT PANCREATIC TRANSCRIPTION FACTOR
PANCREATIC DUODENAL HOMEOBOX-1
Introduction
Type 1 diabetes is a metabolic disorder resulting from the autoimmune destruction of
pancreatic beta-cells. An intense research effort has been directed at identifying a means for
restoring beta-cell mass as well as glucose-regulated insulin production through islet cell
transplantation (90).Though progress has been made, the scarcity of donor islets and the potential
need for lifelong immunosuppression will, in theory, greatly limit its potential for widespread
application (91). Many alternate strategies have been pursued including vector-mediated delivery
of pancreatic transcription factors that allow for conversion of adult cells into insulin-producing
cells (IPCs) and for use of cocktails of beta-cell growth factors to promote differentiation of
embryonic stem cells into tissues capable of producing insulin(92). In vivo, regeneration of
residual islet beta-cells (90) has been noted to occur with a variety of beta-cell growth factors
including glucagon-like peptide-1 (93;94), exendin-4 (95;96), and the islet neogenesis–
associated protein (INGAP)(97). These outcomes appear linked to an increased biosynthesis of
the pancreatic duodenal homeobox-1 (Pdx1) transcription factor (45;93;94;96;98). Pdx1 is
widely regarded as a master transcriptional regulator of the pancreas and is critical for
development (35;99;100), regeneration (37;45), and maintenance of beta-cell function(37).
Liver stem cells (101) and adult hepatocytes (84;86) reportedly have been reprogrammed by
ectopic overexpression of Pdx1 into insulin-producing cells (IPCs) that are also capable of
restoring euglycemia in diabetic mice. However, the strategies involving the use of viruses as a
means for gene delivery in these studies raise safety concerns. An alternative delivery strategy
has recently been identified wherein short, highly basic peptide sequences called protein
41
transduction domains (PTD) act as molecular passports for facile penetration of cellular
membranes by proteins (49). Indeed, studies seeking to understand the cell internalization of
antennapedia-like homeodomain peptides, a form of PTD, support the view that transcription
factors can be transferred from cell to cell, possibly with direct paracrine activity (47;102). The
likely mechanism of cell entry by PTD-containing proteins relies on strong electrostatic
interactions of the cationic PTD with phospholipid elements residing in the plasma membrane,
followed by macropinocytosis and eventual release into the cytoplasm (49;103). Once
internalized, the protein is then free to exert its biological activity on susceptible targets. Given
its key role in pancreatic development, islet beta-cell regeneration, and liver-to-endocrine
pancreas transdifferentiation, Pdx1 represents an ideal candidate for protein therapy, especially
since its antennapedia-like domain is a PTD, mediating its rapid entry into cells (63;65;66).
Previous in vitro studies involving pancreatic duct and islet cells (63), as well as embryonic stem
cells (104), have demonstrated that Pdx1 protein cell entry induces insulin gene expression and
positive autoregulation of Pdx1 gene expression (63;104). Therefore, the ability of Pdx1 to
stimulate insulin gene transcription in vivo renders it a highly attractive approach as a potential
treatment for diabetes. This study investigated the therapeutic effects of rPdx1 in the Stz-induced
diabetic mouse model.
Materials and Methods
Construction and Production of rPdx1, PTD–Green Fluorescent Protein, and Mutant Pdx1 Fusion Proteins
To express recombinant rat Pdx1-His6 (hereafter designated rPdx1), full-length rat Pdx1
cDNA was amplified by PCR and subcloned using NdeI and XhoI sites in pET28b (Novagen,
Madison, WI). To express PTD–green fluorescent protein (PTD-GFP)-His6 (hereafter designated
PTD-GFP), the PTD-GFP plasmid containing the coding sequence for the 11-residue
42
(YGRKKRRQRRR) PTD of HIV-1 TAT positioned at the NH2-terminus of green fluorescent
protein was constructed by PCR and cloned into a pT7/CT-TOPO expression plasmid
(Invitrogen, Carlsbad, CA). To prepare the 16-residue PTD-deletion mutant of rPdx1-His6
(rPdx1-mut), a mutant rat Pdx1 expression plasmid missing PTD residues 188–203
(RHIKIWFQNRRMKWKK) within the rPdx1 homeodomain was constructed using PCR
amplification with appropriate primers containing sequences before and after the PTD of Pdx1
cDNA. The two PCR products were subsequently ligated to generate the PTD-deletion mutant.
After confirmation of the cDNA sequence, the resulting mutant Pdx1 cDNA subcloned into the
NdeI and XhoI sites of pET28b (Novagen). After growth at 37°C to an optical density (OD600) of
0.8, plasmid-containing BL21 (DE3) cells were incubated at room temperature for another 18
hours in the presence of 0.5 mmol/l (final concentration) isopropyl-D-1-thiogalactopyranoside.
Bacteria were lysed by pulse sonication in buffer A (20 mmol/l Tris/HCI pH 8.0, 500 mmol/l
NaCl, and 0.1% Triton X-100) containing 5 mmol/l imidazole and proteinase inhibitors (Roche
Diagnostics, Basel, Switzerland). After centrifugation, the cell-free supernatant was applied to a
column of Ni-nitrilotriacetate agarose (Invitrogen) and washed with several volumes of buffer A
containing 25 mmol/l imidazole. The protein was eluted by buffer A containing 250 mmol/l
imidazole. The purity of the eluted rPdx1, PTD-GFP, and rPdx1-mut fusion proteins were
characterized by SDS-PAGE/Coomassie Blue staining following dialysis against PBS.
Cell Entry and Immunoblotting
Rat liver epithelial stem cells (WB cells) (105;106) at 70% confluence were treated with
purified rPdx1 or rPdx1-mut at a 1 µm concentration for various time points, and the cells were
washed three times with PBS, harvested in lysis buffer (150 mmol/l NaCl, 50 mmol/l Tris-HCl,
pH 7.5, 500 µmol/l EDTA, 1.0% Triton X-100, and 1% sodium deoxycholate) containing a
protease inhibitor cocktail (Roche Diagnostics). For Western blotting (27,31), antibodies against
43
rPdx1 (rabbit serum, 1:1,000 dilution), his-tag (1:2000; Invitrogen), or actin (1:2000; DAKO,
Carpinteria, CA) were used to detect rPdx1, rPdx1-mut, actin, or PTD-GFP fusion protein in cell
lysates (50 μg total protein/lane) after SDS/PAGE separation.
rPdx1 Functional Analyses Using NeuroD-Luciferase Reporter Construct
3T3 cells were co-transfected with NeuroD-luciferase reporter construct (1µg) and Tk-
renilla reporter construct (0.5 µg), followed by either transfection with Pdx1 cDNA (0.5 µg) or
transduction with rPDx1 protein (10 µm). 50 μm Choloroquine, lysosomotropic agent was added
to the all the wells for the release of protein from the lysosomes. The luminescence was
measured using luminometer after 24 hours incubation.
Animal Studies
BALB/c mice (8–10 weeks-old, University of Florida, pathology mouse colony) were
injected with 50 mg/kg body wt streptozotocin (Sigma-Aldrich, St. Louis, MO) for 5 consecutive
days to induce diabetes (27,31). Animals with fasting blood glucose levels for two consecutive
readings of above 250-300 mg/dL received protein treatment. The diabetic mice were
intraperitoneally injected with either rPdx1 or PTD-GFP protein (0.1 mg /day/ mouse) for 10
consecutive days. Fasting blood glucose levels were measured regularly using a glucometer after
the mice were fasted for 6 hours. The sequential experimental events of the animal studies are
summarized in Fig. 3-6.
Low-Dose Streptozotocin-Induced Diabetes
1.47 grams of sodium citrate (Fisher Scientific) was dissolved in 50 mL of distilled water.
The pH was adjusted to 4.5 and stored at room temperature. Appropriate amount of
streptozotocin (STZ), depending on the number of animals, was weighed and dissolved in right
amount of sodium citrate solution so that final concentration is 7.5 mg/mL.
44
Appropriate amount of STZ- Na citrate was intra-peritoneally injected so that the final
concentration is 50 mg/kg.bdwt of mouse. The mice were injected daily with STZ and blood
glucose was measured before the injection. The dosage was continued until the blood glucose
levels reach more than 250 mg/dL. The maximum number of doses was limited to five. Once the
hyperglycemia was confirmed, the treatment with rPdx1 was begun immediately.
Intraperitoneal Glucose Tolerance Test
The normal, rPdx1, or PTD-GFP treated mice (n > 4 for each group) were fasted for 6
hours following intraperitoneal injection with glucose (1 mg/g body weight), and blood glucose
levels were measured at 5, 15, 30, 60, and 120 min postinjection. Subtotal pancreatectomy (~80-
90%) (n >4) was performed at day 30 post-treatment under general anesthesia. The mice were
killed at two time points (days 14 or 40 post-treatment), and organs and blood were collected for
evaluation of histology, gene expression, serum, and tissue insulin levels.
Pdx1 Protein in vivo Kinetics and Tissue Distribution
Mice were injected intraperitoneally with rPdx1 (0.1 or 1 mg). Blood samples were drawn
at 0.25, 0.5, 1, 2, 6, and 24 hours. Tissues from normal and rPdx1-treated mice were harvested at
1 or 24 hours, fixed in 10% formalin, and embedded in paraffin for Pdx1 immunohistochemistry
using rabbit anti-Pdx1 antibody (1:3,000; a gift of Dr. Christopher V. Wright, Vanderbilt
University).
RT-PCR
Total RNA was prepared from mouse tissues of the pancreas and liver using TRIZOL
reagent and cDNA synthesized using Superscript II reverse transcriptase (Invitrogen) with
random hexamer primers. Liver gene expression was determined by RT-PCR as previously
described (31). The forward and reverse PCR primers were designed to be intron spanning, and
their sequences and conditions are listed in Table 3-1. To eliminate false positives, no reverse
45
transcriptase, positive, or blank controls were included. All data represent at least three
measurements from at least four mice.
Quantitative Real-Time RT-PCR Analysis
cDNA from pancreatic and liver tissues was subjected to three independent PCR
reactions. Each reaction was performed in duplicate or triplicate in a Thermocycler Sequence
detection system (DNA engine opticon 2; MJ Research, Springfield, MO) using SYBR green
(Qiagen, Valencia, CA). Total pancreatic and liver RNA was used as templates for preparing
cDNA. Tissues were snap-frozen in liquid nitrogen and RNA was extracted in RNase free tubes
using Trizol reagent (Invitrogen). The integrity and stability of the RNAs from both pancreas and
liver were confirmed by demonstrating the intact 28s and 18s bands on gel electrophoresis.
cDNA was synthesized from 5 µg total RNA using Superscript reverse transcriptase enzyme
(Invitrogen) with random hexamer primers according to the manufacturer’s protocol.
Amplication of the correct product was confirmed by gel electrophoresis. Conditions for real-
time PCR were as follows: after initial denaturation at 95°C for 15 min to activate the enzyme,
38 cycles of PCR (denaturation 0.5 min at 94°C, annealing 0.5 min at 61°C [for liver] or 56°C
[for pancreas], and elongation 0.5 min at 72°C with a final extension 5 min at 72°C) were carried
out. Each gene was tested three times (3–4 mice/group). Relative gene expression in mouse
pancreas treated by rPdx-1 and PTD-GFP on day 14 was calculated by 2ΔΔCt method. We used
mouse β-actin as internal control and PTD-GFP treated day-14 pancreas cDNA as calibrator.
First, both threshold cycle (CT) values of target gene from rPdx1-treated day-14 pancreas cDNA
(n =3) and PTD-GFP–treated day-14 pancreas cDNA (n =4) were normalized by CT value of the
internal control. Then, the former was subtracted by the latter, namely ΔΔCT rPdx1/GFP _ (CT,Target
_ CT,Actin)rPdx1 _ (CT,Target _ CT, Actin)GFP. Similarly, ΔΔCT between rPdx1-treated day-14 liver
cDNA (n =3) and rPDX1-treated day-40 liver cDNA (n =4,) was also calculated by ΔΔCT day
46
14/day 40 _ (CT, Target _ CT,Actin) day 14 _ (CT,Target _ CT, Actin) day 40. The value of 2ΔΔCT, the
fold change of gene expression, was plotted into the figure. The primers were designed in
accordance to the real-time PCR conditions, and the sequences are listed in Table 3-2.
Immunohistochemistry and Immunofluorescence
Paraffin blocks containing the pancreas and liver were obtained from at least 5
mice/group. Antigen retrieval from paraffin sections was done in trilogy solution (Cell Marque,
Rocklin, CA) at 95°C for 30 min for unmasking nuclear antigens such as Pdx1 and Ki-67.
Paraffin sections (5 µm) were incubated with anti-swine insulin (1:1,000), rabbit anti-Pdx1
(1:5,000), rabbit anti-human Ki67 (1:100; Novus Biologicals, Littleton, CO), and goat anti-
glucagon (1:200) antibodies, followed by incubation with anti-mouse or rabbit IgG (1:5,000)
conjugated with HRP and detection with DAB substrate kit (Vector Laboratories, Burlingame,
CA) as previously described (31). For double immunofluorescence, tissue sections were
incubated with anti-swine insulin (1:200; Dako, CA) and goat anti-glucagon (1:150; Santa Cruz
Biotechnology, Santa Cruz, CA) primary antibody overnight at 4°C, followed by donkey anti–
guinea pig IgG conjugated with fluorescein isothiocyanate (1:1,000; RDI Research Diagnostics,
Concord, MA) and donkey anti-goat IgG with Alexa flour 594 flourochrome (1:500; Invitrogen).
For Ki67/insulin sequential immunostaining, the paraffin sections from pancreas were first
immunostained for Ki67 nuclear antigen and developed in brown color using the HRP/DAB
system. After being counterstained with hematoxylin to highlight cell nuclei (blue), the slides
were immunostained for insulin using guinea pig anti-porcine insulin (cross-react with mouse
insulin) antibody (Dako) at a dilution of 1:200 for 16 min. Presence of insulin in pancreatic islet
beta cells was visualized in red color with the Ventana Ultra View red detection kit (Ventana
Medical System, Tucson, AR).
47
Tissue and Serum Insulin Measurements by Enzyme-Linked Immunosorbent Assay
Whole pancreas and liver organs were obtained from at least five mice/group. They were
harvested, weighed, and immediately placed in acidethanol solution (180 mmol/l HCl in 70%
ethanol) on ice with a corresponding tissue volume (1 mL buffer/0.1 g liver or 0.05 g pancreas)
in accordance with a previously published procedure, with minor modifications (32). Tissue
insulin levels were measured using an ultrasensitive mouse insulin enzyme linked
immunosorbent assay (ELISA) kit (ALPCO, Diagnostics, Salem NH). Absorbance was
measured using a BIO-RAD 3550-UV microplate reader, with final results converted to
nanograms insulin/milligrams pancreas tissue or nanograms insulin/grams liver. For
measurement of serum insulin, both normal and treated mice were first fasted for 6 hours, and
blood samples were collected at 15-min intervals following intraperitoneal glucose (1 mg/g body
wt) stimulation. Serum insulin levels were determined by ELISA.
Statistical Analysis
Statistical significance was analyzed using an independent sample t test, requiring a P
value <0.05 for the data to be considered statistically significant.
Results
Generation of Recombinant Fusion Proteins
The expression plasmids containing rat Pdx1, rat Pdx1-mut, or PTD-GFP cDNA were
constructed, each containing an additional nucleotide sequence coding for a His6 tag for rapid
purification using Ni2+-nitrilotriacetate columns. To obtain nearly homogeneous proteins in
sufficient amounts for the in vitro and in vivo animal studies, bacterial expression conditions
were optimised to yield 10 mg highly pure rPdx1 per liter of growth medium. Figure 3-1A shows
the structural organization of rPdx1 (a), PTD-GFP (b), and rPdx1-mut (c) and a Coomassie blue-
stained SDS gel for rPdx1, PTD-GFP, and rPdx1-mut fusion proteins. These proteins consistently
48
had purity >90–95%, based on densitometry. The rPdx1, rPdx1-mut, and PTD-GFP proteins was
confirmed by Western blotting with anti-Pdx1 or anti–histidine-tag antibody.
Characterization of Recombinant Fusion Proteins
To confirm that rPdx1 protein possessed the ability to penetrate cells due to antennapedia-
like PTD within the homeodomain of Pdx1, WB cells were incubated with rPdx1 or rPdx1-mut
protein (1 µmol/l) for specified times, after which the cells were washed three times with PBS.
Cell lysates were separated by SDS-PAGE and blotted with anti-Pdx1 and anti-actin antibodies.
The relative amount of rPdx1 in the cell blots was quantified by densitometry and normalized
relative to actin. As shown in Fig. 3-2a, rPdx1 protein entry commenced within 5 min. As rPdx1
incorporation proceeded, cellular rPdx1 protein level reached peak values at 1–2 hours and began
to fall by 6 hours. In contrast, rPdx1-mut with deletion of the 16aa antennapedia-like PTD failed
to enter the cells, even though the cell culture medium still contained high levels of rPdx1-mut
protein (Fig. 3-2b). Since this assay cannot distinguish genuine rPdx1 protein entry versus
nonspecific binding to cell membrane surface, it was determined whether internalized rPdx1
protein was biologically active. To test the transcriptional function of the rPdx1 protein, 3T3 cells
were transfected with pNeuroD-luciferase reporter plasmid with or without rPdx1. NeuroD is
direct downstream target gene of Pdx1 protein. The cells were incubated in the presence or
absence of rPdx1 (10 µm). 3T3 cells co-transfection with CMV-Pdx1 plasmid for 24hours served
as a positive control. A comparable transcription efficacy for CMV-Pdx1–treated cells and rPdx1
protein–treated cells after 24 hrs was observed (Fig. 3-3). Both treatments showed statistically
significant differences when compared with control cells containing pNeuroD-luciferase plasmid
alone. These results clearly demonstrated that rPdx1 rapidly entered cells and efficiently
activated its downstream Neuro-D target gene.
49
In vivo Kinetics and Tissue Distribution
While the antennapedia-like PTD allows in vitro–administered rPdx1 to enter into the cells,
the in vivo tissue distribution and kinetics of rPdx1 were unknown. To examine rPdx1
distribution and kinetics, BALB/c mice were intraperitoneally injected with 0.1 or 1 mg rPdx1
protein, blood samples were collected at various times, and rPdx1 was detected in sera by anti-
Pdx1 immunoblotting. The rPdx1 became evident in sera as early as 1 hour postinjection,
reaching peak values at 2 h and then markedly falling by 6 hours. No rPdx1 protein was
detectable in the 24-hour serum samples (Fig. 3-4). Major organs were harvested at 1 or 24 hour
after intraperitoneal injection and probed with anti-Pdx1 antibody. As shown in the representative
images of liver, pancreas, and kidney tissues (Fig. 3-5), the rPdx1 was concentrated mainly in the
nuclei of hepatocytes, and the greatest intensity of Pdx1-positive cells was found nearest the
hepatic terminal veins. This distribution pattern is consistent with the predicted pathway for
rapidly internalized rPdx1 via the portal vein system. The rPdx1 was also detected in peripheral
acinar cells of the pancreas, possibly as a result of direct uptake or through local circulation along
pancreatic terminal capillaries. In kidneys, rPdx1 was mostly concentrated in brush borders of
proximal tubular cells. Little protein was seen in the cytoplasm and none in the nuclei. At 24
hours postinjection, only faint rPdx1 protein was focally detected in liver, pancreas, and kidney
tissue sections. A low level of rPdx1 was also detected in the tissues of the spleen, heart, lung,
and brain at 1 hour postinjection, but it became undetectable at 24 hours postinjection (data not
shown). Similar findings were also noted in mice treated with 1 mg rPdx1 protein. Control mice
showed no detectable rPdx1 protein in any tissue section except for pancreatic islet beta cells. On
the basis of these findings, the 0.1-mg rPdx1 at 24 hours intervals was chosen for in vivo
condition for assessing in vivo effects of rPdx1 on mice with streptozotocin-induced diabetes.
50
In vivo Effects of rPdx1 on Blood Glucose Levels in Diabetic Mice
With this, an experimental timeline was designed for rPdx1 protein administration (Fig. 3-
6) in mice with streptozotocin-induced diabetes. Diabetic BALB/c mice (body weights 20 g)
were intraperitoneally administered with 0.1 mg rPdx1 or nontherapeutic PTD-GFP protein
(negative control) over 10 consecutive days. Fasting blood glucose levels were monitored as
indicated. Mice receiving rPdx1 injections achieved near normoglycemia within 2 weeks of first
injection (Fig.3-7); however, no amelioration of hyperglycemia was observed in control mice
receiving the PTD-GFP.
At days 14 and 40 postinjection, intraperitoneal glucose tolerance test (IPGTT) (Fig. 3-8)
showed that the mice receiving rPdx1 injection, in contrast to those diabetic mice receiving PTD-
GFP, exhibited a much improved, nearly normal IPGTT curve. To further assess the ability of
glucose-stimulated insulin release in the rPdx1-treated diabetic mice, healthy normal and treated
mice were challenged at days 14 and 40 post-rPdx1 or–PTD-GFP injection with intraperitoneal
bolus of glucose. Sera collected from normal, rPdx1-treated, or PTD-GFP–treated mice at 15 min
postglucose injection were assayed for insulin and glucose (Fig. 3-9). Serum insulin levels in
rPdx1-treated mice were 6.9 times higher at day 14 and 11.3 times higher at day 40 than those in
the PTD-GFP–treated group (Fig. 3-9), indicating a significant improvement in the ability of the
rPdx1-treated mice to handle glucose challenge. Overall, the serum insulin levels were inversely
related to the blood glucose levels on days 14 and 40 postinjection in mice treated with rPdx1 or
PTD-GFP protein. Although near euglycemia was achieved at day 40 in rPdx1-treated mice, the
released insulin (2.6 µg/l) following 15 min of glucose stimulation was still much lower than that
in normal nondiabetic mice (5.7 µg/l), suggesting either functional immaturity of newly formed
islet beta cells or suboptimal beta cell mass in the pancreas or IPCs in nonpancreatic tissues for
glucose homeostasis.
51
Pdx1 Treatment Promoting Endogenous beta cell Regeneration
To explore whether rPdx1-mediated normoglycemia resulted from islet beta cell
regeneration, rPdx1-treated mice were subjected to subtotal (>90%) pancreatectomy at day 30 (n
= 4) postinjection. Blood glucose levels rose sharply following subtotal pancreatectomy (Fig. 3-
7), indicating that pancreatic cells (presumably the islet beta cells) played a dominant role in
restoring normoglycemia at 30 days post–rPdx1 injection. To further determine the role of the
pancreas at earlier stages of blood glucose normalization, subtotal pancreatectomy was
performed at day 12 postinjection in rPdx1-treated mice (n = 4) and resulted in elevated blood
glucose levels: from an average of 170 to 350 mg/dL within 48 hours postoperation. These results
raise the distinct possibility that in vivo delivery of rPdx1 promoted endogenous beta cell
regeneration.
Immunohistochemical examination confirmed vigorous islet beta cell regeneration, with
larger and more abundant islets evident in rPdx1-treated mouse pancreata, in contrast to rare and
scattered small islets in PTD-GFP–treated mice (Fig. 3-10A). Such findings indicate that when
administered in vivo in multiple doses, rPdx1 appears to promote endogenous beta cell
regeneration via an as yet undefined molecular/cellular mechanism. To further characterize the
regenerated islets, double immunofluorescence studies were conducted with anti-glucagon and
anti-insulin antibodies. Significantly, a change in the alpha cell–to–beta cell ratio and distribution
patterns was noted (Fig. 3-10B) consistent with a dynamic process of islet cell regeneration and
maturation. To determine the proliferation rate in the newly regenerated islets following rPdx1
treatment, Ki67 staining was sequentially performed, followed by insulin immunostaining, on
pancreas sections from various groups of animals. As shown in Fig. 3-11, representative
micrographs indicate that Ki67-positive pancreatic islet cells from normal mice were rarely seen
(0–1 Ki67 positive cell/islet (Fig. 3-11). Although few proliferating pancreatic islet cells were
52
observed in the PTD-GFP–treated mice, it was difficult to identify normal-sized islets except for
scant scattered small islets (Fig. 3-11). However, Ki67-positive islet cells were markedly
increased in the newly regenerated islets in the pancreata of the rPdx1-treated mice compared
with those of control mice. (Fig. 3-11). Sequential double Ki67/insulin immunostaining (Fig. 3-
11) showed that both insulin-positive islet beta-cells and non–beta-cells were proliferating in
islets from tissues obtained at days 14 and 40 post–rPdx1 treatment.
To determine the molecular events underlying rPdx1-mediated islet beta cell regeneration,
real-time RT-PCR was used to examine the expression of key genes relevant to pancreas
regeneration. rPdx1 treatment of diabetic mice (Fig. 3-12) at day 14 resulted in markedly
upregulated levels of INS-I (21.3 times), Pdx1 (3.8 times), INGAPrP (14.5 times), Reg3 (6.8
times), and PAP (34.3 times) relative to their corresponding control values (PTD-GFP–treated
pancreas). A similar pattern of upregulation of the aforementioned genes was observed at day 40
post-treatment. Interestingly, expression of PAP, although upregulated at day 14 when compared
with that in PTD-GFP–treated mice, was noticeably reduced at day 40 posttreatment. These
results indicate that rPdx1 protein can promote islet beta cell regeneration, possibly by
upregulating genes involved in pancreatic cell regeneration.
Pdx1 Treatment Promoting Liver Cell Transdifferentiation into IPCs
To access, whether in vivo intraperiteonal rPdx1 delivery affects the liver, presence of IPCs
were detected in treated mice at days 14 and 40 postinjection. Representative liver images from
mice treated with PTD-GFP or rPdx1 at day 14 posttreatment (Fig. 3-13) indicate that most of the
scattered insulin-staining–positive liver cells were distributed along the edges of hepatic terminal
veins (H.T.V.), a pattern consistent with rPdx1 tissue distribution in the liver (Fig. 3-13). There
were scattered individual insulin-positive hepatocytes (arrows) having small bilobed nuclei and
53
dark condensed chromatin, hinting at a more mature cell pattern. No IPCs were observed in the
control GFP-treated mouse liver.
The expression profiles of pancreatic genes were investigated for rPdx1 and PTD-GFP–
treated livers (Fig. 3-14). As expected, the rPdx1-treated livers at day 14 posttreatment (lane 6)
expressed many Pdx1-target pancreatic genes, including Pdx1, INS-I, GLUC, ELAS, and IAPP.
Upregulation of other pancreatic endocrine genes (INS-II, SOM, NeuroD, and ISL-I) and
pancreatic exocrine genes (p48 and AMY), was noted in the livers of the rPdx1-treated mice
compared with that in the PTD-GFP–treated mice. However, Ngn3 gene expression was not
detectable at either time point. Interestingly, by day 40, INS-I, GLUC, ELAS, and IAPP gene
expression became undetectable, whereas expression of the aforementioned pancreatic genes
continued, albeit at reduced levels. To quantitatively compare the changes of the pancreatic genes
in the livers between days 14 and 40, real-time RT-PCR was performed for selected mRNAs
including Ins-i, Gluc, Pdx1, p48, Amy, and Elas. As indicated in Fig. 3-15, a several-fold increase
was noted at day 14 vs. day 40 mice post–rPdx1 treatment.
Given the intrinsic ability of rPdx1 protein to penetrate cells indiscriminately, the tissue
specificity of rPdx1's effect on expression of pancreatic Pdx1, Ins-I, Gluc, and Amy genes was
examined by RT-PCR. Little or no pancreatic gene activation was detected at day 14 post–rPdx1
treatment in kidney, brain, heart, lung, small bowel, or spleen (Fig. 3-16). These results suggest
that rPdx1 selectively promotes liver expression of pancreatic genes and pancreatic beta cell
regeneration without detectable evidence of undesired expression in other tissues.
Relationship Between Pancreas and Liver at Tissue Insulin Levels
To determine the relative contribution of pancreas and liver tissue–derived insulin to
ameliorating blood glucose levels following rPdx1 treatment, pancreas and liver tissue insulin
content of both normal and treated mice was measured at day 14 or 40 by ELISA. Pancreatic
54
insulin content in rPdx1-treated diabetic mice at days 14 and 40 postinjection was 44 and 68%,
respectively, of the normal pancreatic levels (Fig. 3-17). These levels were also 6.7 times higher
at day 14 (P < 0.01, Student's t-test) and 15.8 times higher at day 40 (P < 0.001) post-treatment
compared with those in the PTD-GFP–treated diabetic mice.
There is a marked increase ( 16 times) in the liver tissue insulin content at day 14 post-
treatment in the rPdx1-treated mice over that of the PTD-GFP–treated mice (P < 0.001) and
nearly a nine fold increase over that of normal liver (Fig. 3-18). Interestingly, there was sharply
reduced liver insulin content at day 40 post–rPdx1 treatment, although it was still 7.3 times
higher than that in PTD-GFP–treated mice (P < 0.01) and 2 times higher than that in normal
liver. These findings confirmed that in vivo rPdx1 treatment promoted pancreatic islet beta cell
regeneration and transient liver cell transdifferentiation into IPCs, suggesting that liver and
pancreas both contributed to achieving glucose homeostasis in a compensatory fashion.
Discussion
Given that absolute and relative insulin deficiencies, respectively, form the basis of type 1
and 2 diabetes, the identification of a means for restoring functional beta cell mass would hold
immense promise as a means for curing these disorders. In this study, several novel findings
were observed: 1) in vivo administration of rPdx1 ameliorates hyperglycemia in diabetic mice, 2)
amelioration of hyperglycemia is attended by both pancreatic beta cell regeneration and liver cell
transdifferentiation, and 3) the observed therapeutic effect is likely to require Pdx1 to have an
intact protein transduction domain. These experiments therefore constitute a proof-of-principle
demonstration that protein therapy in the form of in vivo Pdx1 delivery to animals can be a
highly effective therapeutic strategy, one that exploits intrinsic properties of a naturally occurring
pancreatic transcription factor and that avoids undesirable effects typically associated with viral
vector-mediated gene therapies.
55
Specifically, these results indicate that in vivo delivery of rPdx1 can promote both beta cell
regeneration as well as liver cell transdifferentiation into IPCs. Pdx1-mediated pancreatic islet
beta cell regeneration appears to be the dominant effect on glucose homeostasis, since marked
hyperglycemia was observed in mice receiving nearly total pancreatectomy. Although the exact
cellular and molecular events responsible for rPdx1-mediated beta cell regeneration and liver cell
transdifferentiation remain to be defined, based on the findings, rPdx1 protein enters the
circulation via terminal veins and capillaries and penetrates cellular membranes to gain nucleus
entry into target cells in the liver and pancreas (Fig. 3-5), resulting in activation of rPdx1-
dependent transcription factor cascade. The notion that rPdx1 promotes pancreatic beta cell
regeneration is supported by the presence of numerous pancreatic large islets (Fig. 3-10), an
increasing number of proliferating islet cells (Fig. 3-11), an ensuing increase in the level of
pancreatic tissue insulin (Fig. 3-17), and the significant upregulation of several key genes related
to pancreatic cell regeneration in rPdx1-treated mice (Fig. 3-12). The fact that rPdx1 vigorously
promoted pancreatic islet cell proliferation and regeneration raises intriguing questions about the
type of pancreatic cells that are the targets of rPdx1 (e.g., what is the cell origin for the newly
regenerated islets?). Possible mechanisms include residual islet cell proliferation, exocrine acinar
cell transdifferentiation, and pancreatic ductal/stem cell neogenesis. Presently, this approach
limits the tracking of the cells of origin into/within the target tissue, resulting in the newly
formed islets.
Several genes (INGAPrP, Reg-3 , and PAP) upregulated by rPdx1 treatment are members
of the pancreatic regenerating (Reg) gene family originally identified in animal models of beta
cell regeneration (107). Their gene products play important roles in the maintenance of
progenitors in the process of pancreas regeneration. Despite variation between individual
56
samples, expression levels of the Reg genes determined by RT-PCR correlated well with an
earlier study involving conditional expression of Pdx1 in a transgenic mouse model (37).
The observed functional effects of rPdx1 on the liver are consistent with the published
results of ectopic expression of Pdx1 gene via adenovirus vectors resulting in liver cell
transdifferentiation (83;84). In the current experimental model, liver and pancreas appear to work
in a sequential, compensatory manner to ameliorate hyperglycemia and ultimately to restore
euglycemia in rPdx1-treated mice. The kinship between the liver and pancreas in controlling
glucose homeostasis is also supported by a recent study using liver and pancreas double-injury
animal models (89). The early phase of rPdx1-induced hepatic insulin production is supported by
an intense expression of the insulin I gene (Fig. 3-14) and a nearly 18-fold increase in liver tissue
insulin in comparison with that of control liver (Fig. 3-15). While the precise mechanism
underlying the rPdx1-mediated surge in hepatic insulin during early-stage glucose homeostasis
remains to be elucidated, possible explanations include the following: 1) action of hepatic insulin
on pancreatic progenitor cells via the insulin signaling pathway to promote beta cell regeneration
via IRS2-Akt-Pdx1–mediated signal transduction (108); 2) insulin-mediated facilitation of beta
cell neogenesis, involving amelioration of hyperglycemic toxic effects on residual beta cell
regeneration (109); and 3) rPdx1-mediated hepatic insulin production, resulting in an increased
rate of glucose clearance by the liver, perhaps by promoting glucokinase expression and/or by
insulin's stimulatory action on glycogen synthase, thereby lowering blood glucose levels (110).
Pdx1 gene expression has also been reported to be associated with beta cell neogenesis in
rodent pancreas injury models (37;45;108;111). Although this study showed roughly a 2 to 4x
increase of Pdx1 gene expression in the pancreas of rPdx1- over PTD-GFP–treated mice,
pancreatic beta cell function appears to be exquisitely sensitive to small changes in Pdx1 gene
57
expression levels in both humans and mice (111;112). The rPdx1 protein can positively regulate
Pdx1 gene expression, as evidenced by upregulation of endogenous Pdx1 gene expression in the
livers of rPdx1-treated mice. These observations are consistent with the findings of others
indicating that Pdx1 protein binds to its own promoter and positively regulates its own gene
expression (44). These results suggest that rPdx1-based protein therapy may not require a large-
dose or long-term treatment and, thus, may reduce or eliminate potential dosage-related systemic
toxicity.
Although in this study it was shown that rPdx1 effectively reverses hyperglycemia in
diabetic mice, there are potential obstacles to clinical translation. One concern is that rPdx1 could
be partially degraded by serum proteases. To assess this possibility, further studies on rPdx1
stability in whole blood and plasma would be helpful. Moreover, detailed pharmacokinetic
studies are needed to optimize dosages, routes of delivery, and the interval between treatments.
The polyclonal anti-Pdx1 antiserum used in this study precludes distinguishing between intact
and any partially degraded rPdx1 protein. Significantly, the ability of rPdx1 to ameliorate
hyperglycemia in diabetic mice, along with its nuclear localization in liver and pancreatic acinar
cells (Fig. 3-5), indicates in vivo availability of a sufficient amount of intact rPdx1 protein or
biologically active degradation products capable of translocation into cells. Another concern is
the potential toxicity of rPdx1 to off-target organs via its PTD, since the rPdx1 protein has the
potential to enter almost any tissue or cell type. We can, however, exclude the activation of rPdx1
target genes in tissues other than liver and pancreas at day 14 posttreatment. Moreover, the
animals appeared normal, without evidence of weight loss or abnormal organ morphology. In
fact, the diabetic mice treated with rPdx1 gained body weight, showed an improved IPGTT, and
exhibited markedly reduced blood glucose levels. Nonetheless, a full toxicity profile of rPdx1,
58
especially at earlier time points, is required to address this question. These studies are beyond the
scope of the present manuscript and will be pursued in the future.
Interestingly, the distribution of rPdx1 in the kidney is quite different from that in the liver
and pancreas at the early 1-hour time point (Fig. 3-5). Instead of being present in the cell nuclei,
rPdx1 was localized near the brush border of the proximal tubular cells. Such a distribution was
not observed at 24 hours. As the rPdx1 protein rapidly enters the bloodstream (Fig. 3-4) after
intraperitoneal injection, it may be filtered through glomerular capillaries into the urinary spaces
via the fenestrated capillary endothelial cells and glomerular basement membrane. Alternatively,
rPdx1 may gain entry via cells by virtue of its on-board PTD. Once in the urinary spaces, it
would not be surprising if the cationic rPdx1 protein interacts electrostatically with polyanions
(e.g., sialic acid and phopholipids) present on the apical surface of proximal tubular epithelial
cells.
In conclusion, this demonstration that in vivo rPdx1 delivery into diabetic mice rapidly
restores euglycemia exploits the intrinsic properties of this key pancreatic transcription factor
(e.g., its built-in antennapedia-like PTD, its positive autoregulation,(113), its vital role in
pancreatic cell development and regeneration (37;45), and its role in maintaining pancreatic beta
cell function) (37;114;115). Indeed, it is possible that that Pdx1-based protein therapy should
allow for a redirection (or reactivation) of pancreatic stem/precursor cell differentiation and
transdifferentiation (or reprogramming) from non-pancreatic cells along pancreatic beta cell
developmental pathways, a feature that could prove beneficial in treating patients with diabetes.
59
Table 3-1. Primer name, sequences, size, GenBank #, and PCR condition Genes Forward primer Reverse primer PCR
size GenBank Tm Cycle
(bp) Acc. No. (°C) No. HPRT CTCGAAGTGTTGGATACAGG TGGCCTATAGGCTCATAGTG 350 NM_01355
6 56 40
INS-I TAGTGACCAGCTATAATCAGAG CAGTAGTTCTCCAGCTGGTA 372 NM_008386
56 40
INS-II GCTCTTCCTCTGGGAGTCCCAC CAGTAGTTCTCCAGCTGGTA 288 NM_008387
56 40
GLUC TGAAGACCATTTACTTTGTGGCT TGGTGGCAAGATTGTCCAGAAT 492 NM_008100
57 40
SOM CTCTGCATCGTCCTGGCTTTG GGCTCCAGGGCATCATTCTCT 173 NM_009215
56 40
IAPP TGAACCACTTGAGAGCTACAC TCACCAGAGCATTTACACATA 282 NM_010491
55 40
Glut-2 CGGTGGGACTTGTGCTGCTGG GAAGACGCCAGGAATTCCAT 412 NM_031197
56 40
P48 CCCAGAAGGTTATCATCTGCC CGTACAATATGCACAAAGACG 245 NM_018809
57 40
ELAS AATGACGGCACCGAGCAGTATGT CCATCTCCACCAGCGCACAC 344 NM_033612
57 40
AMY TGGGTGGTGAGGCAATTAAAG TGGTCCAATCCAGTCATTCTG 371 NM_009669
56 40
PDX1 ACCGCGTCCAGCTCCCTTTC CCGAGGTCACCGCACAATCT 357 NM_008814
57 40
NeuroD1
CATCAATGGCAACTTCTCTTT TGAAACTGACGTGCCTCTAAT 257 NM_010894
56 40
ISL-I AGACCACGATGTGGTGGAGAG GAAACCACACTCGGATGACTC 296 NM_021459
56 40
NGN3 TGGCACTCAGCAAACAGCGA AGATGCTTGAGAGCCTCCAC 516 NM_009719
56 40
INS-I = Insulin I, INS-II = insulin-II, GLUC = glucagon, SOM = somatostatin, ELAS = elastase, AMY = amylase. NGN3 = neurogenin 3, IAPP = islet amyloid polypeptide, Glut-2 = glucose transporter-2, ISL-I = islet-1.
60
Table 3-2. Real time PCR Primer name, sequences, size, GenBank #, and PCR condition Genes Forward primer Reverse primer PCR
size GenBank Acc. No
Tm (°C)
Cycle No.
Actin ACCACACCTTCTACAATGAGC GGTACGACCAGAGGCATACA 185 NM_007393 56 38 INS-I GCCCTTAGTGACCAGCTAT GGA CCA CAA AGA TGC TGT TT 167 NM_008386.2 56 38 PDX1 ATGAAATCCACCAAAGCTCAC AGTTCAACATCACTGCCAGCT 190 NM_008814.2 56 38 INGAPrP GCTCTTATCTCAGGTTCAAGG AGATACGAGGTGTCCTCCAGG 178 NM_013893.1 56 38 Reg3γ CATGACCCGACACTGGGCTATG GCAGACATAGGGTAACTCTAAG 190 NM_011260.1 56 38 PAP AATACACTTGGATTGGGCTCC CCTCACATGTCATATCTCTCC 195 NM_011036.1 56 38
INS-I+ insulin, INGAPrP= Islet neogenesis associated protein-related protein, Reg3γ = regenerating islet-derived 3 gamma, PAP = pancreatitis-associated protein.
61
Figure 3-1. Cloning, expression, purification, and characterization of rat Pdx1, PTD-GFP, and
rPdx1-mut fusion proteins. The Pannel (A-C) represents the schematic structures of fusion proteins of rPdx1, PTD-GFP, and rPdx1-mut. The cDNAs coding rPdx1, mutant Pdx1, or PTD-GFP were cloned into the expression plasmid. Proteins were expressed and purified by an Ni-column. The purified proteins were run in a 10% SDS-PAGE gel stained with Coomassie Blue and confirmed by Western blotting using anti-Pdx1 antibody and anti–his-tag antibody.
62
Figure 3-2. Time course of cell entry of rPdx1 and rPdx1-mut proteins. WB cells were incubated
with rPdx1 or rPdx1-mut at a final concentration of 1 µmol/l for indicated times. Proteins were detected by Western blotting with rabbit anti-Pdx1 (1:1,000) or anti-actin (1:5,000) antibodies. The relative amount of cellular rPdx1 protein was quantified by densitometry and the values normalized to actin. The cells treated with rPdx1-mut shows the protein levels in the culture medium by the end of the treatment.
63
Figure 3-3. Functional analysis of rPdx1 protein. 3T3 cells were co-transfected with NeuroD- promoter with luciferase and Tk-renilla plasmid constructs. The cells were either treated with CMV-Pdx1 or transduced with 10 µm of rPdx1. A comparable transcription efficacy for CMV-Pdx1–treated cells and rPdx1 protein–treated cells was observed after 24 hours compared to the untreated cells.
64
Figure 3-4. In vivo kinetics and tissue distribution of rPdx1 following intra-peritoneal injection. Normal BALB/c mice were injected intraperitoneally with rPdx1 protein (0.1 mg/mouse). Blood samples were collected at indicated times, and 20 µL serum/lane was loaded in SDS-PAGE gels. The rPdx1 was detected by Western blotting with anti-Pdx1 antibody.
65
Figure 3-5. In vivo tissue distribution of rPdx1 following intraperitoneal injection. Liver,
pancreas, and kidney tissues were harvested at 1 or 24 h after rpdx1 intraperitoneal injection and fixed in 10% formalin. Paraffin sections were immunostained with anti-Pdx1 antibody (1:1,000). Typical distribution patterns of rpdx1 protein in liver (1, 4, and 7), pancreas (2, 5, and 8), and kidney (3, 6, and 9) were visualized by light microscopy at 1 h and 24 h posttreatment. Pdx1 immunostaining of the liver, pancreas, and kidney tissue sections from normal mice is indicated in the bottom row (10–12). The arrow in panel 2 indicates a small islet in the pancreas with strong nuclear Pdx1 immunostaining.
66
Figure 3-6. Experimental timeline for rPdx1 treatment. Timing of streptozotocin (Stz) treatment followed by treatment with rPdx1 or PTD-GFP proteins and selective pancreatectomy are indicated. The timing of blood glucose determinations and the measurement of blood insulin levels, IPGTT, measurement of tissue insulin, and the determination of gene expression by RT-PCR were shown.
67
Figure 3-7. In vivo effects of rPdx1 protein on blood glucose levels. Diabetic BALB/c mice were
treated with daily intraperitoneal injections of 0.1 mg rPdx1 or PTD-GFP for 10 consecutive days (long arrow), and blood glucose levels were determined by glucometer. The blood glucose levels of rPdx1 treated mice demonstrated amelioration in hyperglycemic condition compared to the PTD-GFP treated that remained hyperglycemic. Nearly total pancreatectomy was performed in selected control and rPdx1-treated mice at day 30 (short arrow).
68
Figure 3-8. Intraperitoneal glucose tolerance test. The IPGTT was performed by i.p. injected
with 1mg/g bd.wt of glucose, and blood glucose was measured at 0, 15, 30, 60, and 120 min in normal, rPdx1-, or PTD-GFP–treated mice. The mice treated with rPdx1 had better glucose handling ability than PTD-GFP treated mice. rPdx1 treated mice had better glucose handling ability at day 40 compared to day 14.
69
Figure 3-9. Comparison of average blood glucose and Insulin levels between rPdx1 treated and
untreated control mice. Glucose and insulin levels were measured in rPdx1- and PTD-GFP–treated mice 15 min after IPGTT on days 14 and 40 post-treatment (n = 5 mice per group). **P < 0.05; ***P < 0.001 (Student's t test).
70
Figure 3-10. Histology of pancreatic islets. A. Insulin immunohistochemistry of pancreatic
tissue. Representative picture of immunohistochemsitry of Paraffin-embedded pancreas tissues from mice treated with either PTD-GFP or rPdx1 were sectioned and immunostained with anti-insulin antibody (1:1,000). The Islets in rPdx1 treated mice are relatively larger in size with more insulin-producing beta cells compared to the islets in PTD-GFP treated mice. B. Paraffin sections from PTD-GFP–and rPdx1-treated mouse pancreas tissues were immunostained with both rabbit anti-glucagon/phycoethrin (red) and Guinea pig anti-insulin/FITC (green) and visualized under fluorescence microscopy. There is change in the ratio of alpha-cell–to–beta-cell ratio and distribution patterns.
71
Figure 3-11. Immunostaining with anti-KI67 antibody and anti-insulin antibody. The islets were stained with Ki-67(brown colour) from tissues of normal mice (1), PTD-GFP treated (2), rPdx1 treated (5, 6). The islets of rPdx1 treated mice were also stained for insulin (Red colour) (7) and double stained for Ki-67 and Insulin (7a)
72
Figure 3-12. Quantitative Realtime-PCR analyses of pancreatic tissue between rPdx1 treated and
control mice. Total RNA from diabetic mouse pancreas (days 14 and 40 post –rPdx1 or –PTD-GFP treatment) was used for real-time PCR analysis of INS-I, Pdx1, INGArP, Reg3 , and Pap gene expression. Expression levels are normalized to actin gene expression. Data are from 3 mice/group. INGAPrP, islet neogenesis-associated protein related protein; PAP, pancreatitis-associated protein; Reg3 , regenerating islet-derived 3 .
73
Figure 3-13. Insulin immunohistochemical staining of liver tissue. Paraffin sections from liver
were stained with anti-insulin antibody (1:250). Representative images were taken at 40x or 100x magnification. Insulin-positive cells are seen in the rPdx1-treated mouse liver section at day 14 post-treatment. Arrow, condensed nuclear chromatin of a bilobed-nucleated insulin-expressing liver cell. HTV, hepatic terminal vein.
74
Figure 3-14. RT-PCR analysis of the expression of pancreatic genes in the liver. Expression of
pancreatic genes in the liver. RT-PCR amplification of RNA extracted from livers of normal, PTD-GFP, or rPdx1-treated mice were analyzed by agarose gel electrophoresis. RNA from mouse pancreas was used as a positive control. For Ngn3 RT-PCR analysis, Ngn3 cDNA plasmid (*) was used as positive control because adult pancreas does not express this gene. No RT, no reverse transcription.
75
Figure 3-15. Quantitative Real Time-PCR analyses of pancreatic gene expression in liver. Total RNA from diabetic mouse liver (days 14 and 40 post–rPdx1 treatment) was analyzed by real-time PCR for the expression of five Pdx1 target genes (INS-I, Gluc, Pdx1, p48, Amy, Elas). Expression levels are normalized to actin gene expression. Fold changes (D14 over D40) are representative of data from 3 mice/group.
76
Figure 3-16. Expression of pancreatic genes in other organs. Total RNA from other organs of rPdx1-treated diabetic mice at day 14 post-treatment and expression of four key pancreatic genes (Ins-I, Gluc, Amy, and Pdx1) were examined by RT-PCR. Pancreatic gene expression was observed only in Liver and not in other organs. Data are from 3 mice/group and are representative of three independent experiments.
77
Figure 3-17. Pancreatic tissue insulin measurements as determined by ELISA. Pancreatic insulin content in rPdx1-treated diabetic mice at days 14 postinjection was 6.7 times higher at day 14 and 15.8 times higher at day 40 post-treatment compared with those in the PTD-GFP–treated diabetic mice. ** = p<0.05. *** = p<0.001.
78
Figure 3-18. Liver tissue insulin measurements as determined by ELISA. There is insulin
expression of day 14 in significant levels (16 times) compared to normal and PTD-GFP group. However, the insulin levels have reduced by day 40. ** = p<0.05. *** = p<0.001.
79
CHAPTER 4 PDX1 PROTEIN THERAPY PREVENTS THE ONSET OF TYPE 1 DIABETES IN NOD
MICE
Introduction
Type 1 Diabetes is an autoimmune disorder characterized by the lymphocyte infiltration
into the pancreatic islets resulting in decreased beta cell mass. The treatment of type 1 diabetes
has been challenging due to lack of complete understanding of disease pathogenesis. The key
elements that need to be addressed in order to cure type 1 diabetes include 1) successful
manipulation of immune system(116), and 2) restoration of beta cell mass(117).
It has been reported that approximately 50% of the genetic risk for type 1 diabetes can be
attributed to the HLA region. The highest risk HLA-DR3/4 DQ8 genotype has been shown to be
frequently associated with beta cell autoimmunity(3;7). The first antibodies described in
association with the development of type 1 diabetes were islet cell autoantibodies (ICA) (9).
Subsequently, antibodies to insulin (IAA)(10), glutamic acid decarboxylase (GAA or GAD) and
protein tyrosine phosphatase (IA2 or ICA512) have been characterized (12).
Non-obese diabetes (NOD) mouse is an animal model for investigating the human
juvenile type 1 diabetes. Female NOD mouse (Jackson labs) spontaneously becomes
hyperglycemic accompanied by polyuria, polydipsia, glucosuria, hypercholesteremia and rapid
weight loss. The incidence of diabetes onset is 80% by 30 weeks of age. Histological
examination of pancreas reveals lymphocyte infiltration around and/or into the islets. This
pathological nature can be observed as early as five weeks of age. The number and size of the
islets are markedly reduced in overt diabetic mice. Although the mechanism of pathogenesis is
not clear yet, the NOD mouse has been extensively used as an animal model for investigating the
human juvenile type 1 diabetes(118).
80
Previous studies have shown that GLP-1R analog (Extendin4) delays the onset of diabetes
in NOD mice(119;120). Studies by other groups in NOD mice have shown that GLP-1 improves
glucose sensitivity in beta cells (121), and protects beta cells from cytokine-induced apoptosis
and necrosis (122). GLP-1 is not only an incretin hormone but also a modulator of cellular
immune system. The multiple pleiotropic effects such as glucoregulatory, proliferative, and
cytoprotective actions of GLP-1 on beta cells are essentially dependent on beta cell Pdx1 gene
expression (122).
The studies conducted in STZ-induced diabetic mice demonstrated that rPdx1 via its
protein transduction domain can enter the targets cells such as pancreatic islets and liver
hepatocytes to promote beta cell regeneration and liver cell transdifferentiation into insulin-
producing cells (IPC’s) towards treatment of diabetes(123). This study is aimed at investigating
the therapeutic effects of rPdx1 treatment in NOD type 1 diabetes mouse model.
Materials and Methods
Animal Studies
Ten-week old female NOD mice (Jackson labs, USA) were injected i.p. daily with 0.1 mg
of rPdx1 (n=20) for 12 weeks or with saline (n=20). Blood glucose (mg/dL) and body weight
(grams) were monitored weekly. Blood glucose was measured using glucometer (Accu-Chek).
IPGTT, serum insulin levels, morphology, and tissue insulin content were examined in NOD
mice between 22-25 weeks of age.
Intraperitoneal Glucose Tolerance Test (IPGTT)
Both the rPdx1-treated and saline treated (n=4 per group) were fasted for six hours before
injecting glucose. To prepare glucose solution, 1 gram of dextrose (Fisher Scientific) was
dissolved in 10 mL of distilled water to make 100 mg/mL solution. After 6 hours of fasting, a
fasting glucose level was obtained using glucometer. Tail tip was pricked with needle to draw
81
drop of blood. The mice were weighed. 2 mg/g body weight glucose was injected
intraperitoneally. Blood glucose values were obtained at 5, 15 30, 60, and 120 min.
Serum Insulin Measurements
The mice were injected with 2 mg/g bd.wt of glucose (Stock-100 mg/mL). Serum
samples were collected after 15 min of glucose injection from rPdx1-treated NOD mice (22
weeks), diabetic control NOD mice (22 weeks), and normal NOD mice (9 weeks); n=4 per
group. The insulin levels were measured using ultra sensitive mouse ELISA kit (Alpco
Diagnostics) according the manufacturer’s instructions as described earlier.
Construction of Truncated Pdx1 Proteins
Site-directed mutagenesis was performed by use of a QuikChange site-directed
mutagenesis kit (Stratagene). The introduction of a stop codon (TAG) mutations into Pdx1
cDNA at the position of the 120th, , 160th , or 200th amino acid, residue , respectively, was
achieved by the use of pET28-rPdx-1 expression vector as template DNA together with the
following pairs of mutagenic primers: for Pdx1-120, fwd( 5'-gcgttcatct ccctttctag aggatgaaat
ccaccaaagctcac) and rev (5'- ttggtggatttcatcctctagaaagggagatgaacgcggc); for Pdx1-160, fwd (5'-
cgggccca gctgctctagatggagaagg aattcttatttaac) and rev (aataagaattccttctccatctagagcagctggg-
cccgagtgtagg); for Pdx1-200, fwd (5'-tccaaaaccg tcgcatctagaggaagaaag aggaagataagaaacgtag)
and rev (5'-ttatcttcctctttcttcctctagatgcgacggttttggaaccag); (the nucleotide changes giving the
appropriate mutations are shown in bold). After initial denaturation at 95°C for 3 min, the
cycling parameters were 0.5 min at 95°C followed by 1.0 min at 55°C and 7 min
at 72°C (30 cycles).The parental, supercoiled double-stranded DNA in the PCR reaction
mixture was digested with DpnI at 37°C for 40 min before being transformed into competent E.
coli BL21(DE3) cells. The cDNA with Mutations were verified by DNA sequencing. The
82
expression and purification of the each pdx-1 truncated protein was done as our previously
reported.
Extraction of Splenocytes from the Spleen
The mice were sacrificed and spleen was extracted immediately. The spleen was placed in
a Petri dish with ice cold PBS. Spleen was then minced into fine pieces by placing it between the
tissue section slides. The entire procedure was conducted in sterile conditions under the laminar
flow hood. The fine particles in saline solution were filtered through the tissue strainer (Fisher
Scientific). The solution collected under the strainer was centrifuged at 1000 rpm for 5 min at
4°C. Supernatant was discarded and the cells were resuspended in 2 mL RBS lysis buffer (BD
pharmingen) and followed by incubation at room temperature for 10 min. The cells were
centrifuged again at 1000 rpm for 5 min at 4°C.The supernatant was discarded and the pellet was
resuspended in DMEM with 10% fetal bovine serum.
Lymphocyte Proliferation Assay
Splenocytes were harvested from the normoglycemic rPdx1-treated and control mice.
Splenocytes were resuspended in 10 mL of PBS. 10 µL of suspension was taken and added to 90
µL trypan blue (10 fold dilution). The cells were counted on hemocytometer in the four
quadrants. The average of the four quadrants was multiplied by dilution factor (10) and total
volume 10 mL * 1000. [No. of Cells = Avg. * Dil. Fac* vol* 1000.] One million cells were
seeded into a 96-well plate in triplicates using DMEM with 10% FBS. The cells were treated
with Glutathione transferase (GST), anti-CD3, insulin, or rPdx1 (40 μg each) for 48 hours
followed by incubation with [3H] thymidine (1microcurie per well) for an additional 24 hours.
After 72 hours, the plate was washed and the radioactivity was measured using scintillation
counter (Beckman Coulter).
83
BDC 2.5 Mice Splenocyte Transfer
Splenocytes were collected from BDC2.5 TCR donor mice(124). The cells were labeled
with carboxyfluorescein diacetate, succinimidyl ester (CFSE) label. 1 million cells were injected
into the age matched rPdx1-treated and control mice (non-diabetic). After 3 days, the
lymphocytes were collected from the pancreatic, cervical and inguinal lymph nodes of rPdx1
treated mice (4 weeks) and control mice. Lymphocytes were analyzed with flow cytometry for
the donor derived CD4+ population.
Results
Administration of rPdx1 to NOD Mice Prevents the Onset of Diabetes
An experimental timeline was designed for rPdx1 protein administration (Fig. 4-1) in pre-
diabetic NOD mice of 10 weeks age group. Mice were intraperitoneally administered with 0.1
mg rPdx1/mouse/day or saline (negative control) for 12 weeks. Random blood glucose levels
(Fig. 4-3) and body weights (Fig. 4-4) were monitored weekly for 40 weeks. 70% of the NOD
mice receiving rPdx1 injections remained normoglycemic until the end of the 40 weeks study
(Fig. 4-2); however, 95% of the NOD mice that received saline became hyperglycemic by 25
weeks of age. These results demonstrated that rPdx1 can significantly prevent the onset of NOD
mice. In order to determine, if short course of treatment can achieve results similar to 12-week
long treatment, NOD mice (n=10) of 10 weeks age were administered with rPdx1 i.p for 4 and 8
weeks. Random blood glucose levels were monitored until the end of 30 weeks of age (Fig. 4-6,
4-8). 70% of the mice that received rPdx1 for 4 and 8 weeks maintained normoglycemia (Fig. 4-
5 and 4-7), while 80% of the saline-treated control mice became hyperglycemic by the end of 30
week study.
84
Beta cell Functional Analysis and Determination of Tissue Insulin Levels
Intraperitoneal glucose tolerance test (IPGTT) (Fig. 4-9) at 25 weeks of age showed that
the mice receiving rPdx1 injection, in contrast to mice that received saline and became diabetic,
exhibited a better, nearly normal IPGTT curve. To further assess the ability of glucose-stimulated
insulin release in the rPdx1-treated and saline-treated mice, they were challenged with
intraperitoneal bolus of glucose. Sera collected from rPdx1-treated, or saline-treated mice at 15
min post glucose injection were assayed for insulin (Fig. 4-9). Serum insulin levels in rPdx1-
treated mice were 7.5 times higher compared to the saline-treated group (Fig. 4-10), indicating a
significant difference in the ability of the rPdx1-treated mice to handle glucose challenge.
Pdx1 Treatment Preserves Islet Mass Possibly by Beta cell regeneration and Promotes Liver Cell Transdifferentiation into Insulin-Producing Cells.
To explore whether treatment of NOD mice with rPdx1 has resulted in preserved islet cell
mass, pancreatic histology and insulin levels were analyzed at 22 weeks age. H&E staining and
immunohistochemical examination confirmed the presence of more number of larger size islets
evident in the pancreata of rPdx1-treated mice, in contrast to rare and scattered small islets in
saline-treated mice (Fig. 4-11). To further characterize the islets, immunohisto-chemical studies
were conducted with anti-insulin and anti-glucagon antibodies. More insulin positive cells and
organized glucagon positive cells were observed in islets of rPdx1-treated mice compared to the
islets from control mice (Fig. 4-11). In the H& E stained tissues, there was evidence of peri-
insulitis (T-cell infiltration along the perimeter of the islet) in the pancreatic sections of rPdx1-
treated mice (Fig. 4-11) while the pancreatic sections of the saline-treated mice showed extreme
insulitis (invasion and destruction of islet by T-cell infiltration). The insulin levels were
determined in the extracts of both pancreas and liver by ELISA and the levels were significantly
higher in rPdx1-treated mice compared to saline-treated mice (Fig. 4-12). These results indicate
85
that rPdx1 treatment preserves beta cell mass and promotes liver cell transdifferentiation into
IPCs.
Detection of Pdx1 Antibodies in Serum Samples of rPdx1/Saline-treated Mice
Administration of rPdx1 to the mice could result in production of anti-Pdx1 antibodies.
ELISA was performed in order to determine the presence of anti-Pdx1 antibodies in the serum.
As expected there were detectable levels of antibodies against rPdx1 protein in the rPdx1-treated
mice, Surprisingly there were detectable levels of anti-Pdx1 antibodies in the saline-treated mice
(Fig. 4-13, panel A). In order to determine if this phenomenon was specific for NOD mice,
ELISA was performed using several sera samples from various mouse strains such as BALB/C,
C57/B6, NOD-SCID and NOD mice. The results indeed confirmed the presence of anti-Pdx1
antibodies specifically in NOD mice (Fig. 4-13, panel B). To further validate the observations,
western blot was performed to determine the specificity of the assay. rPdx1 protein was run on
SDS-polyacrylamide gel. Following transfer onto the nitrocellulose membrane, the membranes
were probed with either serum from BALB/C (negative control), or NOD mouse sera that tested
positive or negative for Pdx1 antibody by ELISA. The 41 kDa band was detectable only in the
serum samples of NOD mice that were determined positive by ELISA (Fig. 4-14). These results
validated the presence of anti-Pdx1 antibodies in the sera of NOD mice.
Determination of Antigenic Epitope of Pdx1 Protein
To determine if anti-Pdx1 antibody is generated as a result of autoimmunity against Pdx1
protein or due to secondary immune as a result of immune cell infiltration into the already
injured beta cells. The autoantibodies that are generated as a result of autoimmunity usually have
a specific antigenic determinant and have a monoclonal antibody production while the antibodies
that are formed as a result of secondary immune response are usually polyclonal in nature. To
determine the position of the antigenic epitope, recombinant truncated proteins were generated
86
by introducing a stop codon at the end of 119, 159, or 199 amino acids. The full-length and
truncated proteins were run on SDS-polyacrylamide gel. Following transfer, the membrane was
incubated with anti-Pdx1 polyclonal rabbit sera or sera from NOD mice. As expected the
polyclonal rabbit sera recognized full-length protein as well as truncated proteins. However, the
serum from NOD mice could recognize only the full-length protein (Fig. 4-15, panel A). This
result indicates that the antigenic epitope is located in the C-terminal portion of the Pdx1 protein
between 200-283 amino acids. In order to demonstrate that the sera from NOD mice can
recognize the 83 amino acids at the C-terminus, a GST fusion protein with C-terminal 83 amino
acid portion (P83) was generated. Western blot using NOD mouse serum was able to recognize
the C-terminal 83 amino acid fragment of the Pdx1 protein (Fig.4-15, panel B). These results
also indicate that sera from NOD mice could be monoclonal which strongly suggests the
autoimmune origin of the antibody.
PAA emerge before the onset of diabetes.
To determine whether the Pdx1 autoantibody can predict disease onset, the relationship
between Pdx1 autoantibody and hyperglycemia was explored (Fig.4-16). Five-week-old female
NOD mice (n = 20) were studied longitudinally and blood samples were taken biweekly until the
onset of diabetes. Blood glucose levels were monitored weekly beginning at 10 weeks of age.
Pdx1 autoantibodies were first detected at ages ranging from 5 to15 weeks, and their levels
gradually increased, peaked, and then declined over the next 2-3 months. Pdx1 autoantibody
often decreased to lower positive levels or disappeared completely after the onset of diabetes and
the peak levels often preceded disease onset. In general, there was an inverse correlation over
time between peak time of Pdx1 autoantibody and blood glucose levels in individual mice.
However, some mice maintained high levels of Pdx1 autoantibody after the onset of diabetes.
Figure 4-16 illustrates the relationship between levels of Pdx1 autoantibody and blood glucose in
87
three mice. As noted, in two mice Pdx1 autoantibody levels peaked prior to the onset of diabetes.
In the third mouse (m19L), low levels were observed consistently without an apparent peak; this
mouse remained normoglycemia at 25 weeks. These results suggest that Pdx1 autoantibody
could be used as diagnostic marker for prediction of the onset of type 1 diabetes in NOD mice.
Demonstration of Autoreactive Lymphocytes Against Pdx1 Protein in NOD Mice
The presence of autoreactive T-lymphocytes is the hallmark of an autoimmune disease.
Immunotherapy with the soluble autoantigen promotes immunomodulation as observed in
previously known autoantigens such as insulin (125) and GAD (11). Lymphocyte proliferation
assay was performed to demonstrate the presence of Pdx1 autoreactive T-lymphocytes in the
NOD mice and to observe if rPdx1 therapy promoted immunomodulation. The splenocytes
extracted from both rPdx1 and saline-treated mice were treated with CD3, gluthathione-
transferase (GST), insulin, rPdx1, or P83. The splenocytes derived from saline- treated control
mice showed increased antigen-dependent proliferation when treated with insulin, rPdx1, and
P83 suggesting the lymphocyte response to autoantigen. There was decreased proliferation in
splenocytes derived from rPdx1-treated mice when treated with insulin, rPdx1 and P83
suggesting the role of rPdx1 treatment in immunomodulation (Fig. 4-17). These results confirm
the presence of pathogenic reactive lymphocytes that get activated in response to the Pdx1
antigen.
Decreased Proliferation of Donor Derived BDC2.5 CD4+ Lymphocytes in Pancreatic Lymph node
To determine if rPdx1 treatment in the NOD mice has promoted immunomodulation, the
donor derived CD4+ lymphocytes specific to an islet antigen were analyzed for the proliferation
in the pancreatic lymph node. The BDC2.5 donor mice splenocytes labeled with
carboxyfluorescein diacetate, succinimidyl ester dye (CFSE) were transplanted into the recipient
88
NOD mice pre-treated with rPdx1 or saline for 4 weeks. Flowcytometric analysis of the donor
derived CD4+ lymphocytes in the pancreatic lymph node demonstrated 39% CD4+ donor cell
population, while the rPdx1 mice showed a 15.1% CD4+ donor cell population. (Fig. 4-18). This
result indicates that the immunomodulatory effect of rPdx1 treatment is due to decrease in
proliferation of islet antigen specific CD4+ T lymphocytes within the pancreatic lymph node.
There was no significant difference in the CD4+ T cell population in cervical and inguinal
lymph nodes indicating the immunomodulatory effect was restricted to islet antigen reactive
CD4+ T-cells in the pancreatic lymph node.
Effect of Mutant-rPdx1 On the Onset of Diabetes in NOD mice
To confirm the immunomodulatory role of rPdx1 protein, the mutant protein (rPdx1-mut)
was generated by deletion of 188-203 amino acids. Deletion of these amino acids eliminated the
DNA binding domain (191-196 amino acids) and antennapedia-like protein transduction domain
(188-203 amino acids), thus making the protein biologically inactive. However, the antigenic
determinant region (203- 283 amino acids) remained intact, thus preserving the immunologically
active component of the rPdx1 protein (Fig. 4-19). To determine the efficacy of the rPdx1-mut
protein, NOD mice were treated daily with 0.1 mg of either full-length rPdx1 or rPdx1-mut
protein for 8 weeks. After 30 weeks of follow up, 70% of mice remained normoglycemic with
no significant difference in the onset of diabetes between both the groups (Full-length rPdx1 and
rPdx1-mut) by 30 weeks of age (Fig. 4-20), thus indicating the predominant immunomodulatory
role of rPdx1 in the prevention of diabetes in the NOD mice.
Discussion
This study demonstrates that daily administration of rPdx1 in NOD mice prevents the onset
of diabetes. There is slight difference in onset of diabetes between long-term (12 weeks) and
short-term (4 and 8 weeks) treatment by 30 weeks of age. The long term treatment maintained
89
normoglycemia in 90% of mice (Fig. 4-2), however short term treatment maintained
normoglycemia in 70% of the mice at 30 weeks of age (Fig. 4-5, 4-7. In the process of
understanding the therapeutic effects of rPdx1 in NOD mice, this study has directed us towards
discovering of a novel Pdx1 autoantigen. Detection of Pdx1 autoantibodies in the control
untreated NOD mice (Fig. 4-13, panel A) has indicated the possible role of Pdx1 as an
autoantigen. There have been extensive studies on the role of autoantibodies such as islet cell
autoantibodies (9), insulin autoantibodies (10), and GAD autoantibodies in the pathogenesis of
type 1 diabetes. In this study, we discovered the presence of Pdx1 autoantibodies in NOD mice
and correlated its presence with the onset of diabetes (Fig. 4-16). It is important to differentiate
between the pathogenic autoantibody and the antibodies that are formed as a secondary immune
response due to infiltration of antigen presenting cells into the already injured beta cells. In case
of autoimmunity, a small peptide epitope region usually evokes a monoclonal antibody response
while the antibodies developed due to immune cell infiltration into injured beta cells are
polyclonal in nature. The fact that NOD serum antibody can recognize only the c-terminal
epitope region indicates the monoclonal and autoimmune nature of the antibody and the possible
role of B-cells in pathogenesis of type 1 diabetes (126).
The in vitro lymphocyte proliferation assay demonstrated a decrease in the proliferation of
lymphocytes derived from rPdx1-treated mice, upon stimulation with Pdx1 autoantigen. This
reduced proliferation was not only limited to stimulation with Pdx1 autoantigen but also spread
to other known beta cell autoantigens such as insulin (Fig. 4-17). This phenomenon of bystander
suppression could possibly be due to production of regulatory cytokines as a result of
administration of rPdx1 soluble antigen (127). These regulatory cytokines produced within the
target tissue (islets) or local lymph node (pancreatic lymph node) are directed against the other
90
locally expressed autoantigens(128). Pancreatic lymph node serves as the hub for autoimmunity
directed against islet antigens with CD4+ T lymphocytes as mediators. The splenocyte transfer
study from donor BDC2.5 TCR mice (124;129) into recipient NOD mice demonstrated a
decreased proliferation of CD4+ lymphocytes in rPdx1-treated mice (Fig. 4-18), thus
demonstrating specifically the immunomodulatory role of rPdx1 on the CD4+ lymphocytes
residing within the pancreatic lymph node.
In this study we employed three distinct approaches to demonstrate that that Pdx1 is a
novel autoantigen. Firstly, demonstration of anti-Pdx1 antibodies specifically in NOD mice
indicates the involvement of B-lymphocytes (Fig. 4-13, panel B). Secondly, mapping out the
epitope region responsible for the antibody production (Fig. 4-15). Thirdly, demonstration of
antigen mediated lymphocyte proliferation in response to Pdx1 antigen (Fig. 4-17). Besides
these, the immunomodulatory role of rPdx1 in the NOD mice corroborates the above findings
(Fig. 4-2, 4-20).
The previously known autoantigens such as Insulin(125), GAD(11), Hsp90(12), and Znt80
(130) have guided in designing effective therapeutic strategies using soluble antigens
(11;14;20;131). On similar lines, treatment of NOD mice with soluble rPdx1 serves as an
effective immunotherapeutic strategy to prevent the onset of diabetes. The treatment with rPdx1
over a period of time could possibly induce immune tolerance as observed in immunotherapeutic
strategies using other soluble autoantigens. The induction of tolerance could be due to the
stimulation of specialized subpopulation of T cells (CD4+, CD25+, FoxP3+ regulatory T cells)
(28;132) resulting in a shift in the balance from Th1 pro-inflammatory to Th2 anti-inflammatory
cytokine release (133). Previous studies have shown that the administration of soluble
autoantigens such as GAD (16) and Hsp60 (20) leads to shift in immune response towards Th2-
91
dependent T-cell cytokine release with preferential production of IL-4, IL-5, and IL-10
production (127;128). We expect a similar phenomenon with the rPdx1 immunotherapy.
The other mechanism by which immune tolerance may be achieved is likely by clonal
deletion or anergy, where frequent administration of the soluble antigen will familiarize the
immune system to recognize Pdx1 as self antigen, thus resulting in peripheral clonal deletion.
(131;134). The antigen induced tolerance was previously studied using evidence in TCR
transgenic mice models (127) hence future studies with Pdx1 antigen specific TCR would reveal
the role of Pdx1 antigen in the pathogenesis of type 1 diabetes.
The treatment of NOD mice with rPdx-mut protein (with no biological function but intact
immunologically active component (Fig. 4-19) has demonstrated incidence of diabetes similar to
the wild type rPdx1 (Fig. 4-20). This suggests the predominant immunomodulatory role of rPdx1
to prevent the onset of type 1 diabetes. However, the contribution of rPdx1 in promoting beta cell
regeneration should not be ignored as in case of prevention trials, there is minimal requirement
for regeneration component for the maintenance of islet mass. IPCs derived by transdifferen-
tiation of liver hepatocytes should play a minor role in contributing towards glucose sensitive
insulin secretion.
In conclusion, this study shows that Pdx1 is a novel auto antigen that could have an active
role in the pathogenesis of type 1 diabetes. Pdx1 autoantibodies could serve as an effective
biomarker for prediction of the disease and Pdx1 antigen-based immunotherapy could serve as
an effective strategy for prevention of the onset of diabetes.
92
1
0 5 10 15 20 25 30 35 40
23
PDx1 treatment (100ug/mouse/day.
1
2
3
Pre-diabetic stage.
IPGTT. Insulin levels, Histology, Lymphocyte assay
Age in weeks
1
0 5 10 15 20 25 30 35 40
23
PDx1 treatment (100ug/mouse/day.
1
2
3
Pre-diabetic stage.
IPGTT. Insulin levels, Histology, Lymphocyte assay
1
0 5 10 15 20 25 30 35 40
23
PDx1 treatment (100ug/mouse/day.
1
2
3
Pre-diabetic stage.
IPGTT. Insulin levels, Histology, Lymphocyte assay
0 5 10 15 20 25 30 35 40
23
PDx1 treatment (100ug/mouse/day.
1
2
3
Pre-diabetic stage.
IPGTT. Insulin levels, Histology, Lymphocyte assay
Age in weeks
Figure 4-1. Time line for the experimental plan for treatment of NOD mice. Ten-week-old
female NOD mice were injected i.p. daily with 0.1 mg of rPdx1 (n=20) for 12 weeks or with saline (n=20). Blood glucose and body weight were monitored regularly. IPGTT, serum insulin levels, morphology and tissue insulin content were examined in NOD mice between 20-25 weeks of age.
93
Incidence of Diabetes
0
20
40
60
80
100
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31Time in weeks
Perc
enta
ge D
iabe
tic
Pdx1 group Ctrl group
10 15 20 25 30 35 40
Pdx1 treatment
Incidence of Diabetes
0
20
40
60
80
100
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31Time in weeks
Perc
enta
ge D
iabe
tic
Pdx1 group Ctrl group
10 15 20 25 30 35 40
Incidence of Diabetes
0
20
40
60
80
100
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31Time in weeks
Perc
enta
ge D
iabe
tic
Pdx1 group Ctrl group
10 15 20 25 30 35 40
Incidence of Diabetes
0
20
40
60
80
100
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31Time in weeks
Perc
enta
ge D
iabe
tic
Pdx1 group Ctrl group
Incidence of Diabetes
0
20
40
60
80
100
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31Time in weeks
Perc
enta
ge D
iabe
tic
Pdx1 group Ctrl group
10 15 20 25 30 35 40
Pdx1 treatment
Figure 4-2. Effect of rPdx1 (12-weeks) on the onset of diabetes in NOD mice. Daily treatment of pre-diabetic female NOD mice with rPdx1 for 12 weeks resulted in significant protection of the mice from the onset of diabetes (90% at 33 weeks, and 80% at 39 weeks, and 70% at 40 weeks). The saline control mice became 95% hyperglycemic (diabetic) at age of 25 week.
94
Figure 4-3. Blood glucose levels of rPdx1 (12-weeks) treated NOD mice. Daily treatment of pre-diabetic female NOD mice with rPdx1 for 12 weeks resulted in maintenance of normoglycemia in 70% of mice at 40 weeks. 3 out of 10 mice became hyperglycemic (>250 mg/dL) at age 17, 35 and 40 weeks (Panel A). The saline- treated control mice became 95% hyperglycemic (diabetic) at the age of 25 weeks (Panel B)
A
B
95
Figure. 4-4. Body weights of rPdx1 (12-weeks) treated NOD mice. Daily treatment of pre-diabetic female NOD mice with rPdx1 for 12 weeks resulted in increase in body weight (Panel A). The saline-treated control mice progressively lost body weights or could not maintain their body weights (Panel B ).
0
5
10
15
20
25
30
10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
1L 1R
1B 1N
2L 2R
2B 2N
3L 3R
0
5
10
15
20
25
30
10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
6L
6R
6B
6N
7L
7R
7B
7N
8L
8R
8B
8N
9L
9R
9B
9N
10L
10R
10B
10N
Time points in weeks
Time points in weeks
Bod
y w
eigh
tsB
ody
wei
ghts
0
5
10
15
20
25
30
10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
1L 1R
1B 1N
2L 2R
2B 2N
3L 3R
0
5
10
15
20
25
30
10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
6L
6R
6B
6N
7L
7R
7B
7N
8L
8R
8B
8N
9L
9R
9B
9N
10L
10R
10B
10N
0
5
10
15
20
25
30
10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
1L 1R
1B 1N
2L 2R
2B 2N
3L 3R
0
5
10
15
20
25
30
10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
6L
6R
6B
6N
7L
7R
7B
7N
8L
8R
8B
8N
9L
9R
9B
9N
10L
10R
10B
10N
Time points in weeks
Time points in weeks
Bod
y w
eigh
tsB
ody
wei
ghts
A
B
96
Pdx1 treatment (4 wks)
0
20
40
60
80
100
1 2 3 4 5 6 7 8 9 101112131415161718192021
Perc
enta
ge D
iabet
ic
Pdx1 (4 wks) Ctrl
Pdx1 treatment
10 15 20 25 30
Pdx1 treatment (4 wks)
0
20
40
60
80
100
1 2 3 4 5 6 7 8 9 101112131415161718192021
Perc
enta
ge D
iabet
ic
Pdx1 (4 wks) Ctrl
Pdx1 treatment
Pdx1 treatment (4 wks)
0
20
40
60
80
100
1 2 3 4 5 6 7 8 9 101112131415161718192021
Perc
enta
ge D
iabet
ic
Pdx1 (4 wks) Ctrl
Pdx1 treatment (4 wks)
0
20
40
60
80
100
1 2 3 4 5 6 7 8 9 101112131415161718192021
Perc
enta
ge D
iabet
ic
Pdx1 (4 wks) Ctrl
Pdx1 treatmentPdx1 treatment
10 15 20 25 30
Figure 4-5. Effect of short term rPdx1treatment (4-weeks) on the onset of diabetes in NOD mice. To determine if short-term treatment with rPdx1 could prevent the onset of diabetes, ten-week-old female NOD mice were administered 0.1 mg rPdx1 i.p. for 4 weeks (n=10). Daily treatment of pre-diabetic female NOD mice with rPdx1 for 4 weeks resulted in significant protection of the mice from the onset of diabetes (70% at 30 weeks).
97
Figure 4-6. Blood glucose levels of rPdx1 (4-weeks) treated NOD mice. Daily treatment of pre-diabetic female NOD mice with rPdx1 for 4 weeks resulted in maintenance of normoglycemia in 70% of mice at 30 weeks.
98
Pdx1 treatment (8 wks)
0
20
40
60
80
100
1 2 3 4 5 6 7 8 9 101112131415161718192021
Perc
entag
e Diab
etic
Pdx1 (8wks) Ctrl
10 15 20 25 30
Pdx1 treatment
Pdx1 treatment (8 wks)
0
20
40
60
80
100
1 2 3 4 5 6 7 8 9 101112131415161718192021
Perc
entag
e Diab
etic
Pdx1 (8wks) Ctrl
10 15 20 25 30
Pdx1 treatment (8 wks)
0
20
40
60
80
100
1 2 3 4 5 6 7 8 9 101112131415161718192021
Perc
entag
e Diab
etic
Pdx1 (8wks) Ctrl
10 15 20 25 30
Pdx1 treatment (8 wks)
0
20
40
60
80
100
1 2 3 4 5 6 7 8 9 101112131415161718192021
Perc
entag
e Diab
etic
Pdx1 (8wks) Ctrl
10 15 20 25 30
Pdx1 treatment (8 wks)
0
20
40
60
80
100
1 2 3 4 5 6 7 8 9 101112131415161718192021
Perc
entag
e Diab
etic
Pdx1 (8wks) Ctrl
10 15 20 25 30
Pdx1 treatment
Figure 4-7. Effect of short term rPdx1treatment (8-weeks) on the onset of diabetes in NOD mice. To determine if short-term treatment with rPdx1 could prevent the onset of diabetes, ten-week-old female NOD mice were administered 0.1 mg rPdx1 i.p. for 8 weeks (n=10). 70% of the rPdx1-treated mice maintained normoglycemia upto 30 weeks.
99
Figure 4-8. Blood glucose levels of rPdx1 (8-weeks) treated NOD mice. Daily treatment of pre-diabetic female NOD mice with rPdx1 for 8 weeks resulted in maintenance of normoglycemia in 70% of mice at 30 weeks. (Panel A). The saline- treated control mice became 90% hyperglycemic (diabetic) at the age of 30 weeks (Panel B).
A
B
A
B
100
IPGTT
050
100150200250300350400450
0 5 15 30 60 120
Time in minutes
Blo
od
Glu
co
se (
mg
/dl)
Pdx1Ctrl
Figure 4-9. Intraperitoneal glucose tolerance test. IPGTT (n=4/group). Mice were injected with 2 mg/g of glucose i.p. Blood glucose was monitored at 0, 5, 15, 30, 60, 120 min. The rPdx1 treated mice at 22 weeks demonstrated better glucose handling ability than the age-matched diabetic control mice.
101
Serum Insulin levels
0123456
Normal Pdx1 Ctrl
Ser
um
In
suli
n (
ug
/L)
* *
Serum Insulin levels
0123456
Normal Pdx1 Ctrl
Ser
um
In
suli
n (
ug
/L)
* ** *
Figure 4-10. Serum insulin measurements as determined by ELISA. Glucose-stimulated (15 min) serum samples were collected from rPdx1 treated NOD mice (22 wks), diabetic control NOD mice (22 wks), and normal NOD mice (9 wks). rPdx1-treated mice have an 8-fold higher serum insulin level compared with the diabetic control mice. (n=4/group) ** = P<0.05; Student’s t-test.
102
Figure 4-11. Haematoxylin & Eosin staining and immunohistochemistry of pancreatic tissue sections. H & E staining of pancreatic tissue sections from rPdx1- treated mice showed many large islets with numerous insulin-stained beta cells. On the contrary, control mice had much fewer and smaller islets and most of the islet cells contained glucagon-positive cells.
103
Pancreatic insulin content
0
500
1000
1500
2000
2500
In
su
lin
co
nte
nt
(n
g)
Normal mice
Pdx1 group
Ctrl group
Liver insulin content
0
100
200
300
400
500
600
700
800
Ins
ulin
co
nte
nt
(ng
/g)
Ctrl
Pdx1
* *
Liver insulin content
0
100
200
300
400
500
600
700
800
Ins
ulin
co
nte
nt
(ng
/g)
Ctrl
Pdx1
* ** *
Figure 4-12. Pancreas and liver tissue insulin levels as determined by ELISA. Tissue insulin was extracted from whole organs of pancreases and livers, measured by ELISA, and normalized with wet tissue weight. Insulin measurements in the pancreas (Left) and liver (right) extracts of rPdx1- treated mice (n=4) are significantly higher than the control diabetic mice. ** = P<0.05; Student’s t-test.
A B
104
Figure 4-13. Detection of Pdx1 antibodies by ELISA in the NOD mice. Serum samples were collected from both female control NOD and pre- and post-Pdx1-treated NOD mice at indicated ages. Presence of anti-Pdx1 antibodies was determined by ELISA. High levels of Pdx1 antibodies were detected in Pdx1-treated mice. However, control mice also had various levels of anti-Pdx1 autoantibodies (A) (panel A). To determine if the antibodies are specific to NOD autoimmune diabetic mouse model, serum samples were collected from other mouse strains such as NOD-SCID, C57/B6 and Balb/C (Panel B). The anti-Pdx1 autoantibodies were highly specific to NOD strain as determined by ELISA.
A
B
105
rPdx1
Balb/c
Western blottingCoomassieblue gel
Pdx1 AA( -)Pdx1 AA(+) ELISAPdx1 AA(-)
NOD mouse sera
1 2 3
rPdx1
rPdx1
Balb/c
Western blottingCoomassieblue gel
Pdx1 AA( -)Pdx1 AA(+) ELISAPdx1 AA(-)
NOD mouse sera
1 2 3
rPdx1
Figure 4-14. Confirmation of anti-Pdx1 antibody in the NOD mice by western blotting. Anti-Pdx1 antibody was confirmed by western blot using purified Pdx1 protein as antigen. The membrane was probed with control serum with high-titer for Pdx1 antibody (lane 2) and serum with basal titer (Lane 3). A mouse serum from BALB/c mice was used as negative control for Pdx1 antibody.
106
Figure 4-15. Determination of antigenic epitope by western blot. Illustration of full-length Pdx1 and truncated proteins. A mix of full-length and truncated proteins was run on SDS-gel. The membrane was probed with either rabbit polyclonal serum, or sera from NOD mice (6L, 4L). The polyclonal sera detected all the proteins bands while the NOD sera detected only the full-length indicating that the epitope is in the C-terminal 83 amino acids (panel A). The C-terminal 83 amino acid portion was expressed as GST fusion protein. Panel B is Coomassie blue stained gel and the results of blotting that were using two autoantibody A(+) mouse sera. Arrows indicate the positions of Pdx1, P83-GST or GST.
A
B
107
Figure.4-16. Relationship between Pdx1 autoantibody levels and onset of diabetes. 5-week old female NOD mice were purchased (n=20) and serum samples were collected biweekly. Pd1 autoantibodies were detected by ELISA and expressed in OD values at 450 nM. Blood glucose levels were monitored weekly via tail vein snipping. Three representative mice data is shown here.
108
T-cell proliferation assay
0
2000
4000
6000
8000
10000
12000
14000
16000
18000
None CD3 GST Ins Pdx1 P83
cpm Pdx1
Ctrl
Figure 4-17. Antigen-stimulated lymphocyte proliferation. Splenocytes were harvested from the rPdx1-treated and control mice. One million cells were seeded into a 96-well plate in triplicates. The cells were treated with anti-CD3, insulin, and Pdx1 for 48 hours followed by incubation with [3H] thymidine for an additional 24 hours. Splenic T-cell lymphocyte proliferation was stimulated in control mice by rPdx1 and insulin, whereas antigen-stimulated splenic T-cell lymphocyte proliferation was significantly lower in 4-week-rPdx1-treated mice compared with control mice.
109
Figure 4-18. Transfer of splenocytes from donor BDC2.5 mice to the recipient NOD mice. The transfer of CFSE labeled splenocytes from donor BDC2.5 mice into the recipient NOD mice pretreated with rPdx1 or saline (4 weeks) demonstrated a decrease in donor-derived CD4-T-cell proliferation in the draining pancreatic lymph nodes of rPdx1 treated mice.
110
Pdx11 283
188 203
1 79
transactivation
146 206homeobox
191 196
DNA Binding
Antennapedia domain
Pdx11 283
Pdx1Pdx11 283
188 203188 203
1 79
transactivation
1 79
transactivation
146 206homeobox
191 196
DNA Binding
Antennapedia domain
146 206homeobox
146 206homeobox
191 196
DNA Binding
191 196
DNA Binding
Antennapedia domain
Figure 4-19. Illustration of Pdx1 and mutant Pdx1proteins. A short 16 amino acid sequence was deleted between amino acids 188-203 of the Pdx1 protein, which eliminated both DNA binding and the antennapedia-like protein transduction domain. Thus a biologically inactive mutant Pdx1 protein was produced.
111
mut-Pdx1 treatment (8 wks)
0
20
40
60
80
100
1 2 3 4 5 6 7 8 9 101112131415161718192021
Perc
enta
ge D
iabe
tic
mut-Pdx1 (8wks) Ctrl Pdx1(8 Wks)
10 15 20 25 30
mut-Pdx1 treatment (8 wks)
0
20
40
60
80
100
1 2 3 4 5 6 7 8 9 101112131415161718192021
Perc
enta
ge D
iabe
tic
mut-Pdx1 (8wks) Ctrl Pdx1(8 Wks)
10 15 20 25 30
Figure 4-20. Effects of mutant-Pdx1 on the onset of diabetes. Ten-week-old female NOD mice were treated with full-length Pdx1 (n=10), mutant Pdx1 (n=10), or saline (n=10). Incidence of diabetes was monitored until 30 weeks. By 30 wks, both full-length Pdx1- and mut-Pdx1 treatments prevented/delayed the onset of diabetes in 70% of NOD mice whereas 80% of the control mice became diabetic.
112
CHAPTER 5 MOLECULAR MECHANISM OF THE ROLE OF PDX1 IN BETA CELL PROLIFERATION
Introduction
Pancreatic and duodenal homeobox 1(Pdx1) is a transcriptional factor that plays a crucial
role in pancreas development and beta cell differentiation during embryogenesis(35;36). It plays
a major role in beta cell maturation, maintenance, and regulation of gene expression in the beta
cell (35;37;38). During embryogenesis, Pdx1 gene expression appears in the duodenum early in
development while in the adult pancreas, Pdx1 gene expression is predominantly restricted to the
insulin-producing islet beta cells and a subset of somatostatin producing delta cells(39-41). Mice
with a null mutant of Pdx1 resulted in agenesis of pancreas with hyperglycemia and could not
survive after birth(35). Pdx1 heterozygous mutant mice failed to increase beta-cell mass in
response to insulin resistance (112). Pdx1 has been found to play key role in beta cell neogenesis
and insulin production(38). Pdx1 is a homeodomain transcription factor that binds to specific
sequences of its target genes and activates them by recruiting other co-transcriptional factors
such as NeuroD, MafA, and Pax4. Conditional expression of Pdx1 in transgenic mice
demonstrated its role in beta cell regeneration(37). Previous studies using growth factors such as
GLP-1, extendin-4, and INGAP have shown that beta cell regeneration is accompanied by
increase in levels of Pdx1 protein (98;135). Our previous studies using the STZ-induced diabetic
mouse model demonstrated that rPdx1 treatment promoted beta cell proliferation(123). Studies
on partial pancreatectomy have demonstrated an increased Pdx1 expression is associated with
beta cell proliferation(45;108). However the molecular mechanisms of the role of Pdx1 in beta
cell regeneration is not known yet.
Several studies were conducted to understand the functional role of cell cycle proteins of
the beta cells which include cyclins, cyclin-dependent kinases, and cyclin-dependent kinase
113
inhibitors(136;137). There is an age dependent decline in the beta cell self-renewal capacity
(138) due to the activation of Ink inhibitors with increasing age (139). Previous studies have
shown that cyclin A2 (135), cyclin B1 (140), cyclin E1 (141), and cyclin D2 (142) are involved
in beta cell proliferation. However, the association between Pdx1 protein and cyclins in beta cell
regeneration is not established yet.
Materials and Methods
Cell Culture
INS-1 cells were grown in RPMI 1640 (Sigma) (430 mL) with 10% fetal bovine serum
supplemented with 5 mL of HEPES (1M), 5 mL of L-glutamine (200 mM), 5 mL of Sodium
pyruvate (100 mM), 5 mL of Pen/Strep, 454 µL of 2-Mercaptoethanol (1000x) and 2 mL
Kanamycin (50 mg/mL) per each bottle (430 mL) of media. 3T3 cells were grown in Dulbecco's
Modified Eagle Medium (Sigma) supplemented with 10% FBS (55 mL) and 2 mL Kanamycin
(50 mg/mL).
Design of siRNA for the Pdx1 Transcript
21-mer siRNA was designed for specific binding to mRNA at three different locations
(Fig. 5-1). Sense Strand (A): GGAAGAUAAGAAACGUAGUUU mRNA loc. 712
Sense Strand (B): GGAUCAUGAGGCUUAACCUUU mRNA loc. 1033
Sense Strand (C): CGAGCAAUCUAAGGUUGAGUU mRNA loc. 1336
siRNA Mediated Knockdown of Pdx1 Transcript in INS-1 Cells
The INS1 cells (2 x 105 cells) were grown upto 60% confluence in 6 well plates at 37° C
in a 5% CO2 incubator. For each transfection, 8 μl of siRNA (Santa cruz Biotechnology, CA)
was diluted (i.e. 1 μg or 80 pmols siRNA) into 100 μl serum free minimal medium (Gibco).
For each transfection, 2 μl of Lipofectamine reagent (Invitrogen) was diluted in 100 μl serum
free minimal medium in a separate tube. Next the siRNA solution was added directly to the
114
diluted transfection reagent. The solution was mixed gently by pipetting the solution up and
down and incubated for 30 minutes at room temperature. The cells were washed once with 2 mL
of serum free minimal medium. The medium was aspirated before proceeding to the next step.
For each transfection, 0.8 mL of siRNA transfection mix was added to each well. The cells were
incubated for 5-7 hours at 37° C in a 5% CO2 incubator. Later, the transfection mix was removed
and replaced with normal growth medium. The cells were harvested at the end of 48, 72, and 96
hours.
Western Blotting with anti-Pdx1 and anti-tubulin Antibody
The cellular protein lysates from 6 well plates were collected using cell lysis RIPA buffer
after 72 and 96 hours of treatment with siRNA. The cellular total protein content was quantified
using spectrophotometer. 50 µg of protein (from cells treated with Pdx1 siRNA and Ctrl siRNA)
was loaded onto SDS-gel. The gel was run at 80V until the dye front migrated through the gel.
After transfer and overnight blocking (1% milk powder in PBST), the membrane was incubated
with rabbit polyclonal anti-Pdx1 antibody (1:1000) for 1hr at room temperature. After washing
the membrane with PBS for 15 min, it was incubated with anti-rabbit IgG conjugated to HRP
(1:20,000) (Amersham Biosciences) for 1 hour at room temperature. After development, the
membrane was stripped-off with strip buffer (2% SDS, 100 mM beta-mercaptoethanol, 50 mM
Tris, pH 6.8) by incubating at 70°C for 30 min. The membrane was then blocked over night and
incubated with anti-tubulin antibody (1:5000; Abcam) followed by anti-mouse-IgG conjugated
with HRP (1:5000; Cayman Chemicals).
BrdU Proliferation Assay
Four thousand cells were plated in 96 well plates in triplicates and allowed to grow until
they became 50% confluent. 0.75 µg of siRNA was added to each well in triplicates and the
cells were incubated for 48 or 72 hours depending on the preferred harvesting time. 50 µM of
115
BrdU was added before the last 18 hours of incubation. The cells were fixed with 4%
paraformaldehyde in vitro for 30 min at 4ºC. Next, the samples were incubated in 0.1 M PBS
(pH 7.4) + 1% Triton X-100 + 1M Glycine + 5% goat serum for 1 hour prior to overnight
incubation at 4°C with mouse anti-BrdU (1:100; BD biosciences). The plate was washed gently
thrice with PBS, followed by incubation with secondary anti-mouse IgG conjugated with HRP
(1:4000; Cayman Chemical Laboratories). The wells were then incubated with TMB solution
(Cell signaling) for 10 min. The reaction was stopped with stop solution (Cell signaling). The
plate was read at 450 nm using 650 nm as reference wavelength.
Real Time PCR
cDNA from INS-1 cells (both Pdx1 siRNA and Ctrl siRNA treated) was subjected to three
independent PCR reactions. Each reaction was performed in duplicate in a thermocycler
sequence detection system (DNA engine opticon 2; MJ Research, Springfield, MO) using SYBR
green (Qiagen, Valencia, CA). RNA was extracted in RNase free tubes using Trizol reagent
(Invitrogen). cDNA was synthesized from 2 µg of total RNA using Superscript reverse
transcriptase enzyme (Invitrogen) with random hexamer primers according to the manufacturer’s
protocol. The expected amplified product using specific primers listed in Table 5-1, was
confirmed by agarose gel electrophoresis. Conditions for real-time PCR were as follows: after
initial denaturation at 95°C for 15 min to activate the enzyme, 35 cycles of PCR (denaturation
0.5 min at 94°C, annealing 0.5 min at 58°C, and elongation 0.5 min at 72°C with a final
extension for 5 min at 72°C) were carried out. Each gene was tested three times. The single band
amplification was verified by observing the melting curve and by agarose gel electrophoresis.
Relative gene expression in INS-1 cells treated by Pdx1 siRNA and Ctrl siRNA was calculated
by the 2ΔΔCt method. More details about calculations were discussed in chapter 3.
116
Construction of pGL4.10-Cyclin B1 Promoter-Luciferase Vector
The -991 bp sequence of the human cyclin B1 promoter was amplified using following
primers Forward- CTCGAGGCTGGTGTGTTTTGAGGAGTA; Reverse-
AGATCTCCAAGGACCTACACC-CAGCAG. Human genomic DNA was used as a template for
PCR amplification. Restriction sites Xho1 and BglII were introduced using forward and reverse
primers respectively. Annealing temperature was programmed at 56°C for 30 sec and the
amplification for 30 cycles. The PCR product (~1000 bp) was cloned into the XhoI and BglII
sites of the pGL4.10 luciferase reporter vector. The shorter version (-551 bp cyclin B1 cloned
into pGL2 vector) was a kind gift from Dr. Karen Katula, Univ. of North Carolina, Greensboro,
NC. The Nkx6.1 promoter with luciferase reporter and CMV-human Nkx6.1 constructs were
obtained as gift from Dr. Raghavendra Mirmira’s lab and CMV-human Pdx1 was purchased
from Open biosystems, AL.
Analysis of Promoter Constructs for Activation by Pdx1 or Nkx6.1 using Luciferase Reporter Assays
NIH 3T3 cells were grown in 6 well plates until they became 50% confluent. For each
well, the cells were co-transfected with 0.5 µg of Tk-renilla plasmid (as internal control) and 1
µg of Nkx6.1/ cyclin B1 promoter driven luciferase plasmid. The cells were treated with
0.5 µg of test plasmids (CMV-Pdx1, CMV-Nkx6.1) or pcDNA3 vector control. The cells were
harvested after 24 hrs in passive lysis buffer (Promega). The lysates were analyzed using dual
luciferase assay kit (Promega). Details of the transfection protocol and luciferase activity
measurements were described in chapter 2.
117
Results
Phenotype of INS-1 Cells Treated with Pdx1 siRNA
INS-1 cells were treated with 1 µg of either Ctrl siRNA or Pdx1 siRNA. A phenotype
change was observed in cells treated with Pdx1 siRNA from flat and polygonal to round and
smaller cells as shown in Fig. 5.2. The cells treated with Ctrl siRNA remained flat and
polygonal. The phenotypes become more pronounced from 24 hours to 72 hours. This indicates
the possibility of cell cycle arrest mediated by Pdx1 siRNA.
siRNA-mediated Knockdown of Pdx1 Transcripts in INS-1 Cells
To study the effects of Pdx1 protein on cell cycle regulation, Pdx1 gene expression was
depleted in INS-1 cells using siRNA against Pdx1 transcript. The decrease in gene expression
was of Pdx1 was observed at both the transcript and protein level using real time PCR (Fig. 5.5)
and western blotting (Fig. 5.3) respectively. Both real time PCR and western blotting confirmed
more than 70% decrease in the gene expression.
Decrease in Cell Proliferation of Pdx1 Knockdown Cells
In order to study if knockdown of Pdx1 has any significant effect on cell proliferation, an
in vitro proliferation assay was conducted using the BrdU incorporation method. INS-1 cells
were treated with 1 µg of Pdx1 siRNA or Ctrl siRNA for a period of 48 or 72 hours. The final 18
hours were incubated with 50 μM BrdU. The BrdU proliferation assay demonstrated that the
Pdx1 siRNA treated cells showed decrease in the proliferation to 59.84% and 70% at 48 and 72
hours respectively as shown in Fig. 5.4. This validates that the knockdown of Pdx1 gene
expression indeed reduced proliferation of INS-cells, thus demonstrating that Pdx1 is essential
for the beta cell proliferation.
118
Analysis of the Gene Expression of Beta Cell Specific transcription factors and Cell Cycle Genes
The decrease in the cell proliferation of Pdx1 knockdown cells could be attributed to
decreased activity of cell cycle proteins and other beta cell specific transcription factors involved
in cell cycle progression, perhaps at the gene expression level. In order to study the effects of
Pdx1 siRNA, specific primers were designed to observe the downstream effects on beta cell
specific transcription factors and cyclin genes. In order to study the association of Pdx1 protein
with cell cycle regulators, cDNA was synthesized from the RNA extracted from the cells treated
with either Pdx1 siRNA or ctrl siRNA. The real time PCR assay demonstrated a significant
decrease in the gene expression of beta cell transcription factors such as Nkx6.1 (50%) and
cyclin genes such as cyclin B1 (40%) and cyclin E1 (65%) (Fig. 5-5).
Analysis of Cyclin B1 Promoter using CMV-Pdx1
Bioinformatic analysis of the human cyclin B1 promoter has revealed multiple potential
Pdx1 protein binding sites. In order to verify this observation experimentally, NIH-3T3 mouse
fibroblast cells were transfected with the 1 µg of cyclin B1 promoter-luciferase reporter vector.
These cells were simultaneously co-transfected with pcDNA3 null vector or CMV-Pdx1 plasmid.
We observed no change in the activity of cyclin B1 promoter when co-transfected with CMV-
Pdx1 (Fig. 5-6) suggesting that Pdx1 protein may not interact directly with cyclin B1 promoter.
Nkx6.1 Activation of Cyclin B1 Promoter
Bioinformatic analysis of the human cyclin B1 promoter has revealed potential binding
sites for Nkx6.1. We also observed a decrease in the transcript levels of Nkx6.1 in Pdx1
knockdown cells (Fig.5-5). We therefore sought to determine the association between Nkx6.1
and cyclin B1 promoter. Cyclin B1 promoter (-991bp) luciferase reporter vector was co-
transfected with either pcDNA3 null vector or CMV-Nkx6.1 plasmid. A 5 fold increase in cyclin
119
B1 promoter activity was observed when co-transfected with CMV-Nkx6.1 plasmid (Fig. 5-7)
demonstrating that Nkx6.1 protein could bind to the cyclin B1 promoter. A truncated version of
the cyclin B1 promoter (-551bp) with no putative binding site for Nkx6.1, when co-transfected
with either pcDNA3 or with CMV-Nkx6.1 plasmid, did not demonstrate any increase in activity
(Fig. 5-7).
Pdx1 Activation of Nkx6.1 Promoter
We determined that Pdx1 did not activate cyclin B1 directly, however, Nkx6.1 could
directly activate cyclin B1 promoter. In order to determine the association between Pdx1 and
Nkx6.1, the Nkx 6.1 promoter was studied using luciferase assay in NIH 3T3 fibroblast cells.
Nkx6.1 promoter-luciferase reporter vector was co-transfected with either pcDNA3 null vector
or CMV-Pdx1 plasmid. There was a 2.5 fold increase in the Nkx6.1 promoter activity, when co-
transfected with Pdx1 plasmid demonstrating that Pdx1 protein activates Nkx6.1 promoter (Fig.
5-8).
Discussion
Pdx1 is a beta cell specific transcriptional factor required for the regeneration and
maintenance of beta cell in the adult stage. During the post natal stage, beta cells within a normal
islet have a finite life span, with slow turn over and with majority of the cells in the resting phase
of cell cycle. However, the dynamics of beta cell proliferation dramatically change upon injury
or mitogenic stimulation(143). Proliferation of beta cells is triggered by mitogens that in turn
initiate an intracellular signaling between set of beta cell specific transcriptional factors and cell
cycle machinery. One such important signaling pathway is the insulin signaling pathway where
insulin binds to the insulin receptor that leads to phosphorylation of tyrosine residues. This
further leads to the activation of the PI-3 kinase-Akt signaling pathway which in turn
phosphorylates FoxO protein and results in the activation of Pdx1 gene expression.
120
Previous studies on partial pancreatectomy have demonstrated that an increased Pdx1
expression is associated with beta cell proliferation (45). Treatment of diabetic animal models
with mitogenic agents such as GLP-1 (121;122), Extendin4 (120), INGAP (98) or rPdx1(123),
results in upregulation of Pdx1. All these studies suggest that local upregulation of Pdx1 above a
threshold level is necessary to activate downstream events that regulate beta cell proliferation.
The question that remains to be investigated is how Pdx1 interacts with beta cell cycle
machinery to induce proliferation. Pdx1 is a homeodomain transcription factor that interacts
with other transcription factors and cofactors such as E47/Pan1, BETA2/NeuroD, p300, hnf1,
and Pax6 (144-148) to perform specific functions within beta cell. The real time PCR has
demonstrated a significant decrease in the levels of Nkx6.1, cyclin B1, and cyclin E1 in the Pdx1
knockdown cells (Fig. 5-5). However, the other cyclins such as cyclin A2 and cyclin D1 may be
playing a role in beta cell regeneration through multiple signaling pathways involving other beta
cell specific transcription factors. Cyclin B1 is the regulatory subunit of serine/threonine kinase
Cdc2 (cdk1) and is essential for the entry into mitosis. Our studies have shown that Pdx1 does
not have a direct interaction with cyclin B1 (Fig. 5-6), however, Nkx6.1 can activate cyclin B1
promoter (Fig. 5-7). At the upstream of Nkx6.1, Pdx1 can activate Nkx6.1 promoter activity
(Fig-5-8). These observations may be one among several other cell cycle events that could be
occurring within the islet beta cells. This does not however, rule out the possibility of
involvement of other signaling pathways and transcriptional factors in beta cell proliferation.
We conclude that beta cell proliferation is induced by local upregulation of Pdx1 protein
by upstream mitogenic signals. Pdx1 protein further autoregulates its own gene expression which
results in amplified levels of Pdx1 protein (113;123). Once the levels reach above the threshold
level, Pdx1 activates Nkx6.1 gene expression that results in increased levels of Nkx6.1 protein
121
which in turn interacts with cyclin B1 promoter to trigger cell entry into the mitotic phase (Fig.
5-9).
122
Table 5-1. Real time PCR Primer name, sequences, size, GenBank #, and PCR condition Genes Forward primer Reverse primer PCR
size GenBank Acc. No
Tm (°C)
Cycle No.
Actin ATTGAACACGGCATTGTCACCA CTGGATGGCTACGTACATGGCT 200 NM_031144.2
58 35
Nkx6.1 AAACGAAGTACTTGGCAGGACC TAATCGTCGTCGTCCTCCTCGTT 167 NM_031737.1
58 35
PDX1 TCCACCAAAGCTCACGCGTGG GAATTCCTTCTCCAGCTCCAGCAG 190 NM_022852.3
58 35
Cyclin A2 TGAAGAGGCAACCAGACATCAC AGCCAAATGCAGGGTCTCAT 178 NM_053702.2
58 35
Cyclin B1 TGAGCCTGAGCCTGAACCTG CTGCATCTACATCACTCACTGC 200 NM_171991.2
58 35
Cyclin D2 CTGCAGAACCTGTTGACTATCGAGC GGTAATTCATGGCCAGAGGAAAG 194 NM_022267.1
58 35
Cyclin E1 GCAATAGAGAAGAGGTCTGGAGGAT GTCCTGTGCCAAGTAGAATGTCTCT 182 NC_005100 58 35
123
Figures
Figure 5-1. Location of 21 mer siRNAs on Pdx1 mRNA transcript.
(A): GGAAGAUAAGAAACGUAGUUU mRNA loc. 712
(B): GGAUCAUGAGGCUUAACCUUU mRNA loc. 1033
(C): CGAGCAAUCUAAGGUUGAGUU mRNA loc. 1336
124
Figure 5-2. Phenotype of INS1 cells treated with Pdx1 siRNA. The INS1 cells grown in serum free minimal medium were treated with Ctrl siRNA and Pdx1 siRNA for 48 hours. The cells treated with Pdx1 siRNA morphologically appeared round and small while the Ctrl siRNA treated cells appeared flat and polygonal (normal).
125
Figure 5-3. Confirmation of Pdx1 knockdown using western blotting. INS-1 cells treated with ctrl siRNA and Pdx1 siRNA for 72 and 96 hours. The cell lysates were analyzed for Pdx1 protein levels using anti-Pdx1 antibody and anti-tubulin antibody as loading control.
1 2 3 4
126
Brdu proliferation assay
100 100
59.8470
020
406080
100120
48 72
Time points (hrs)
Pe
rce
nta
ge
pro
life
rati
on
Ctrl siRNA
Pdx1 siRNA
Figure 5-4. Measurement of INS-1 cell proliferation using BrdU incorporation. INS-1 cells were treated with Ctrl or Pdx1 siRNA for 48 and 72hrs. The final 18 hours were incubated with BrdU. The cells were measured for BrdU incorporation as measured by ELISA using anti-BrdU antibody.
127
Change in Gene expression of cells treated with Pdx1 siRNA
0
0.2
0.4
0.6
0.8
1
1.2
Pdx1 Nkx6.1 Cyc A2 Cyc B1 Cyc D2 Cyc E1
Rel
ativ
e ch
ange
Ctrl siRNA
PDx1 siRNA
Figure 5-5. Analysis of relative change in the gene expression. Real time PCR was performed using specific primers to analyze the change in gene expression in cells treated with Pdx1 siRNA for 48 hours compared to the cells treated with Ctrl siRNA. β-actin primers were used as internal control.
128
Figure 5-6. Analysis of cyclin B1 promoter using CMV-Pdx1. The 3T3 cells were transfected with cyclin B1 promoter (-991 bp) driving luciferase gene construct. The cells were co-transfected with either CMV-Pdx1 plasmid. No change in the activity levels was observed with increased concentration of CMV-Pdx1 plasmid.
0
0.2
0.4
0.6
0.8
1
1.2
1.4
0 0.1 0.5 1 2 5CMV-Pdx1 Concentration (ug)
Rel
ativ
e Lu
cife
rase
Val
ue
129
pcDNA3 + -521CycB1-Luc
Nkx6.1+ -521CycB1-Luc
pcDNA3 + -521CycB1-Luc
Nkx6.1+ -521CycB1-Luc
pcDNA3 + -521CycB1-Luc
Nkx6.1+ -521CycB1-Luc
pcDNA3 + -521CycB1-Luc
Nkx6.1+ -521CycB1-Luc
Figure 5-7. Nkx6.1 activation of Cyclin B1promoter. (Panel A) The 3T3 cells were transfected with cyclin B1 promoter (-991 bp) driving luciferase gene construct. The cells were co-transfected with either pcDNA3 null vector or Nkx6.1 cDNA plasmid. Increased activation was observed in cells treated with Pdx1 cDNA plasmid). (Panel B) The 3T3 cells were transfected with cyclin B1 short promoter (-551 bp) driving luciferase gene construct. The cells were co-transfected with either pcDNA3 null vector or Nkx6.1 cDNA plasmid. No change in the activity levels was observed between the two treatments
pcDNA3 + -921CycB1-Luc Nkx6.1 (0.5ug) + -921CycB1-Luc
pcDNA3 + -921CycB1-Luc Nkx6.1 (0.5ug) + -921CycB1-Luc pcDNA3 + -921CycB1-Luc Nkx6.1 (0.5ug) + -921CycB1-Luc
A
B
130
Figure 5-8. Pdx1 activation of Nkx6.1 promoter. The 3T3 cells were transfected with Nkx6.1 promoter driving luciferase reporter construct. The cells were co-transfected with either (1) pcDNA3 null vector or (2) Pdx1 cDNA plasmid. Increased activation was observed in cells treated with Pdx1 cDNA plasmid.
131
Figure 5-9. Chain of events triggered by Pdx1 towards beta cell cycle progression. Pdx1 protein activates its own promoter to increase Pdx1 levels. The increased pdx1 levels in turn activate Nkx6.1 promoter which further binds to cyclin B1 promoter to promote cell cycle progression into mitotic phase.
Pdx1 promoter
132
CHAPTER 6 FUTURE STUDIES
Reversal of Streptozotocin-induced Diabetes in Mice by Cellular Transduction with Recombinant Pancreatic Transcription Factor, Pancreatic Duodenal Homeobox-1
Future Studies
This study explored a novel approach for treatment of diabetes in STZ-induced diabetes
model. This approach has exploited three properties of Pdx1 protein 1) It is a transcription factor
that promotes beta cell regeneration and liver cell transdifferentiation into IPCs , 2) It has a 16
amino acid inbuilt protein transduction domain, and 3) It has ability to autoregulate its own gene
expression. All the above properties make Pdx1 protein an ideal candidate molecule to promote
beta cell regeneration and liver cell transdifferentiation into IPCs.
Beta cell regeneration is an intriguing phenomenon that dramatically shifts the ability of
the body to maintain glucose homeostasis. There are multiple theories regarding the pattern of
beta cell regeneration. Of these, self duplication/replication of existing beta cells(67;149) and
neogenesis from pancreatic ducts(150-152) are believed to be the most common ways by which
beta cell mass increases. The other theories include recapitulation of embryonic
development(153;154), extra pancreatic stem cell source such as bone marrow(31), and exocrine
cell transdifferentation into beta cell(155). It would be interesting to dissect the pattern of beta
cell regeneration induced by rPdx1 protein therapy. The Cre-Lox and /or Pulse-Chase
approaches in transgenic mice will provide an unambiguous conclusion of the pattern of beta cell
regeneration.
In a clinical setup, Pdx1 therapy would be ideal for type 2 diabetes patients. However, the
STZ-induced diabetic model does not entirely simulate the type 2 diabetic condition. The future
study should determine the therapeutic effects of Pdx1 protein in type 2 diabetic mouse models
such as BB rat, Ob/Ob mice, and db/db mice. These are genetic models of type 2 diabetes with
133
leptin or leptin receptor deficiency. The homozygotes of the ob/ob strains are leptin deficient
mice. They become obese and severely diabetic consequencing in the regression of islets and die
prematurely. They also exhibit hyperphagia, glucose intolerance, elevated plasma insulin,
subfertility, and impaired wound healing. Injection of recombinant leptin into obese
homozygotes sharply reduces their body weight, decreases food intake, increases energy
expenditure, and restores fertility in male mice.
db/db homozygous mice become diabetic due to spontaneous mutation in the leptin
receptor around three to four weeks of age. The mice become hyperglycemic at 4-8 weeks of
age. Homozygous mutant mice exhibit polyphagia, polydipsia, and polyuria. The other
pathological findings exhibited include obesity, uncontrolled rise in blood sugar, and severe
depletion of the insulin-producing beta-cells of the pancreatic islets with death occurring by 10
months of age. However, studies in genetic models of type 2 diabetes may be challenging due to
the complexity of the disease pathogenesis. There are several factors that need to be considered
such as insulin resistance, obesity, and beta cell stress. In order to characterize the therapeutic
effects, a detailed metabolic profile including body weight, plasma insulin, blood glucose,
cholesterol, tri-glycerides, and basic metabolic rate should be evaluated.
Transdifferentiation of cells from one cell type to another(155) and induction of
pluripotent stem cells from adult cells(156-159) have opened a new era for cell based therapy.
However, extensive studies on the epigenetic modifications are yet to be conducted before we
come out with therapeutic implications(160;161). Similarly, it will be interesting to understand
the epigenetic changes that occur within the chromatin of the hepatocytes that transdifferentiated
into IPCs. This could be initiated by isolating transdifferentiated cells by laser capture
microdissection. Epigenetic modifications that occur on Pdx1 as well as the insulin promoter and
134
the role of histone acetyl transferases, deacetylases, and methyltransferases will provide insight
into the mechanism of transdifferentiation.
Pdx1 Protein Therapy for the Treatment of Type 1 Diabetes in NOD Mice
Future Studies
This study has lead to the discovery of a novel autoantigen that could play a major role in
the pathogenesis of type 1 diabetes. Immunotherapy with rPdx1 provides us with clues that Pdx1
autoantigen has a role in the pathogenesis of type 1 diabetes. We need to determine, if Pdx1 is a
primary autoantigen. The future studies should focus on extraction of T-cell clones with
receptors for the Pdx1 peptide. Adoptive transfer studies using such homogenous T- cell clones
would lead to better understanding of the pathogenesis of type 1 diabetes.
The discovery of a novel autoantigen in NOD mice will prove useful if we observe
similar findings in human patients. A screening method needs to be designed with hundreds of
human serum samples. Based on the interpretations from NOD mice, it is important to obtain the
serum samples from high risk patients even before the onset of diabetes. The current screening
methods include evaluation of insulin, GAD and islet cell autoantibodies(162). Multiple antibody
screening approaches are engaged in patients for better specificity, sensitivity and positive-
predictive value(163). However, the current screening methods can be enhanced with the
discovery of new autoantibodies. It is therefore worthwhile to evaluate if anti-Pdx1 antibodies
can be used as a potential biomarker marker for screening the onset of diabetes in population at
risk.
A mechanism of induction of tolerance with rPdx1 immunotherapy needs to be established.
Previous studies using Insulin (125) and GAD (11) immunotherapy have demonstrated the role
of CD4+CD25+, Foxp3+ regulatory T-cells. Induction of tolerance is also mediated by the shift
in balance from the Th1 pro-inflammatory immune response to Th2 anti-inflammatory immune
135
response. A detailed cytokine analysis of both pro-and anti-inflammatory mediators using the
serum obtained from peripheral blood or in vitro cytokine stimulation from the splenocytes or
lymph nodes should be determined.
Molecular Mechanism of the Role of Pdx1 in Beta Cell Proliferation
Future Studies
The experiments to understand the role of Pdx1 in beta cell proliferation were conducted
using Rat INS-1 beta cell line. It is a transformed cell line(164) where variations in the activity of
cell cycle machinery compared to the pancreatic islet cells are possible. The future studies should
include Pdx1 knockdown studies in human pancreatic islets. In order to knockdown Pdx1 in
pancreatic islets, a more efficient siRNA approach using viral vectors as opposed to use of
oligomers must be designed to attain better knockdowns. Similarly, it is well known that the rate
of beta cell replication decreases with increasing age (138;143). It is important to study how the
cell cycle events differ between islets from young mice and older mice with respect to Pdx1
interaction with cell cycle machinery.
These in vitro studies must be further continued to understand the role of Pdx1 in beta cell
replication in vivo. The Pdx1 gene conditional knockout mouse would be an ideal model that will
have synergistic advantages to providing insights into the role of Pdx1 in beta cell regeneration.
136
APPENDIX A NOD MICE TRIAL 1
Table A-1. Mice database of trial 1 Animal Number Trial 1
Rx Duration of Rx
Blood glucose before Sac
Time of Sac
Serum Formalin Fix
Frozen Liver
Insulin Ext
Splenocytes
1L Pdx1 12 wks 96 40 wks Yes Yes Yes 1R Pdx1 12 wks 147 32 wks Yes Yes Yes 1B Pdx1 12 wks 600 35 wks 1N Pdx1 12 wks 600 20 wks Yes Yes Yes Yes 2L Pdx1 12 wks 117 33 w/die 2R Pdx1 12 wks 127 40 wks Yes Yes Yes 2B Pdx1 12 wks 122 22 wks Yes Yes 2N Pdx1 12 wks 318 40 wks Yes Yes Yes 3L Pdx1 12 wks 122 40 wks Yes Yes Yes 3R Pdx1 12 wks 134 40 wks Yes Yes Yes 3B Pdx1 16 wks 103 34 w/ die 3N Pdx1 16 wks 110 32 wks 4L Pdx1 16 wks 123 32 wks Yes Yes Yes 4R Pdx1 16 wks 412 35 w/ die 4B Pdx1 16 wks 600 40 wks Yes Yes Yes 4N Pdx1 16 wks 174 38 wks Yes 5L Pdx1 16 wks 136 32 wks Yes Yes Yes 5R Pdx1 16 wks 530 17 wks Yes Yes Yes 5B Pdx1 16 wks 97 25 w/die 5N Pdx1 16 wks 121 32 wks Yes 6L Saline 10 wks 600 20 wks Yes Yes Yes 6R Saline 12 wks 600 22 wks Yes Yes Yes 6B Saline 12 wks 327 23 wks Yes 6N Saline 12 wks 316 23 wks Yes 7L Saline 12 wks 600 22 wks Yes Yes Yes 7R Saline 12 wks 435 22 wks Yes Yes Yes 7B Saline 7 wks 528 17 wks Yes Yes Yes 7N Saline 11 wks 600 21 wks Yes Yes Yes 8L Saline 12 wks 94 24 wks Yes Yes 8R Saline 7 wks 600 17 wks Yes Yes Yes 8B Saline 8 wks 600 18 wks Yes Yes Yes 8N Saline 11 wks 600 21 wks Yes Yes Yes 9L Saline 12 wks 330 22 wks Yes Yes Yes 9R Saline 7 wks 600 17 wks Yes Yes Yes 9B Saline 8 wks 600 18 w/die 9N Saline 8 wks 600 18 w/die 10L Saline 8 wks 600 18 wks Yes Yes Yes 10R Saline 12 wks 600 22 wks Yes Yes Yes 10B Saline 12 wks 241 22 wks Yes Yes Yes 10N Saline 12 wks 600 22 wks Yes Yes Yes
137
APPENDIX B
NOD MICE TRIAL 2
Table B-1. Mice database of trial 2 Animal Number Trial 2
Rx Duration of Rx
Blood glucose before Sac
Time of Sac
Serum Formalin Fix
Frozen Liver
Insulin Ext
Splenocytes
11L Pdx1 4 wks 118 27 wks Yes Yes Yes 11R Pdx1 4 wks 112 28 wks Yes Yes Yes 11B Pdx1 4 wks 600 27 wks Yes Yes 11N Pdx1 4 wks 131 30 wks Yes Yes Yes 12L Pdx1 4 wks 124 20 wks Yes Yes Yes, LNs 12R Pdx1 4 wks 108 20 wks Yes Yes Yes, LNs 12B Pdx1 4 wks 600 23 w/die 12N Pdx1 4 wks 102 20 wks Yes Yes Yes, LNs 13L Pdx1 4 wks 122 13R Pdx1 4 wks 415 23 wks 13B Pdx1 4 wks 103 13N Pdx1 8wks 110 14L Pdx1 8wks 146 32 wks Yes Yes Yes, LNs 14R Pdx1 8wks 118 20 wks Yes Yes Yes, LNs 14B Pdx1 8wks 252 20 wks Yes 14N Pdx1 8wks 109 20 wks Yes Yes Yes, LNs 15L Pdx1 8wks 124 25w/die 15R Pdx1 8wks 600 26 wks Yes 15B Pdx1 8wks 203 30 wks Yes Yes Yes 15N Pdx1 8wks 121 30 wks Yes Yes Yes 16L Mutant 8wks 154 30 wks Yes Yes Yes 16R Mutant 8wks 136 34 wks Yes Yes Yes 16B Mutant 8wks 600 26 wks Yes Yes 16N Mutant 8wks 199 30 wks Yes Yes Yes 17L Mutant 8wks 121 30 wks 17R Mutant 8wks 106 30 wks Yes Yes Yes 17B Mutant 8wks 600 24 wks 17N Mutant 8wks 600 27 wks 18L Mutant 8wks 134 34 wks Yes Yes Yes 18R Mutant 8wks 131 34 wks Yes Yes Yes 18B Mutant 8wks 116 34wks Yes Yes Yes 18N Saline 11 wks 540 24 wks 19L Saline 12 wks 113 28 wks Yes Yes Yes 19R Saline 7 wks 336 17 wks 19B Saline 8 wks 546 16 wks 19N Saline 8 wks 248 28 wks Yes Yes Yes 20L Saline 8 wks 262 22 wks 20R Saline 12 wks 600 23 wks 20B Saline 12 wks 560 17 wks 20N Saline 12 wks 600 16 wks Yes
138
REFERENCES
1. Atkinson,M.A. and Eisenbarth,G.S. 2001. Type 1 diabetes: New perspectives on disease pathogenesis and treatment. Lancet 358:221-229.
2. Wilson,K. and Eisenbarth,G.S. 1990. Immunopathogenesis and immunotherapy of type 1 diabetes. Annu.Rev.Med. 41:497-508.
3. Jahromi,M.M. and Eisenbarth,G.S. 2006. Genetic determinants of type 1 diabetes across populations. Ann.N.Y.Acad.Sci. 1079:289-299.
4. Kahn,C.R., Vicent,D., and Doria,A. 1996. Genetics of non-insulin-dependent (type-II) diabetes mellitus. Annu.Rev.Med. 47:509-531.
5. Doria,A., Patti,M.E., and Kahn,C.R. 2008. The emerging genetic architecture of type 2 diabetes. Cell Metab 8:186-200.
6. Yoon,J.W. and Jun,H.S. 2001. Cellular and molecular pathogenic mechanisms of insulin-dependent diabetes mellitus. Ann.N.Y.Acad.Sci. 928:200-211.
7. Jahromi,M.M. and Eisenbarth,G.S. 2007. Cellular and molecular pathogenesis of type 1A diabetes. Cell Mol.Life Sci. 64:865-872.
8. Peng,H. and Hagopian,W. 2006. Environmental factors in the development of Type 1 diabetes. Rev.Endocr.Metab Disord. 7:149-162.
9. Bottazzo,G.F., Florin-Christensen,A., and Doniach,D. 1974. Islet-cell antibodies in diabetes mellitus with autoimmune polyendocrine deficiencies. Lancet 2:1279-1283.
10. Miao,D., Yu,L., and Eisenbarth,G.S. 2007. Role of autoantibodies in type 1 diabetes. Front Biosci. 12:1889-1898.
11. Kaufman,D.L., Clare-Salzler,M., Tian,J., Forsthuber,T., Ting,G.S., Robinson,P., Atkinson,M.A., Sercarz,E.E., Tobin,A.J., and Lehmann,P.V. 1993. Spontaneous loss of T-cell tolerance to glutamic acid decarboxylase in murine insulin-dependent diabetes. Nature 366:69-72.
12. Taplin,C.E. and Barker,J.M. 2008. Autoantibodies in type 1 diabetes. Autoimmunity 41:11-18.
13. Daniel,D. and Wegmann,D.R. 1996. Intranasal administration of insulin peptide B: 9-23 protects NOD mice from diabetes. Ann.N.Y.Acad.Sci. 778:371-372.
14. Daniel,D. and Wegmann,D.R. 1996. Protection of nonobese diabetic mice from diabetes by intranasal or subcutaneous administration of insulin peptide B-(9-23). Proc.Natl.Acad.Sci.U.S.A 93:956-960.
139
15. Tian,J., Clare-Salzler,M., Herschenfeld,A., Middleton,B., Newman,D., Mueller,R., Arita,S., Evans,C., Atkinson,M.A., Mullen,Y. et al. 1996. Modulating autoimmune responses to GAD inhibits disease progression and prolongs islet graft survival in diabetes-prone mice. Nat.Med. 2:1348-1353.
16. Tian,J., Atkinson,M.A., Clare-Salzler,M., Herschenfeld,A., Forsthuber,T., Lehmann,P.V., and Kaufman,D.L. 1996. Nasal administration of glutamate decarboxylase (GAD65) peptides induces Th2 responses and prevents murine insulin-dependent diabetes. J.Exp.Med. 183:1561-1567.
17. Tisch,R., Yang,X.D., Singer,S.M., Liblau,R.S., Fugger,L., and McDevitt,H.O. 1993. Immune response to glutamic acid decarboxylase correlates with insulitis in non-obese diabetic mice. Nature 366:72-75.
18. Tisch,R., Wang,B., Atkinson,M.A., Serreze,D.V., and Friedline,R. 2001. A glutamic acid decarboxylase 65-specific Th2 cell clone immunoregulates autoimmune diabetes in nonobese diabetic mice. J.Immunol. 166:6925-6936.
19. Tisch,R., Liblau,R.S., Yang,X.D., Liblau,P., and McDevitt,H.O. 1998. Induction of GAD65-specific regulatory T-cells inhibits ongoing autoimmune diabetes in nonobese diabetic mice. Diabetes 47:894-899.
20. Elias,D., Reshef,T., Birk,O.S., van der,Z.R., Walker,M.D., and Cohen,I.R. 1991. Vaccination against autoimmune mouse diabetes with a T-cell epitope of the human 65-kDa heat shock protein. Proc.Natl.Acad.Sci.U.S.A 88:3088-3091.
21. Bowman,M. and Atkinson,M.A. 2002. Heat shock protein therapy fails to prevent diabetes in NOD mice. Diabetologia 45:1350-1351.
22. Skyler,J.S., Krischer,J.P., Wolfsdorf,J., Cowie,C., Palmer,J.P., Greenbaum,C., Cuthbertson,D., Rafkin-Mervis,L.E., Chase,H.P., and Leschek,E. 2005. Effects of oral insulin in relatives of patients with type 1 diabetes: The Diabetes Prevention Trial--Type 1. Diabetes Care 28:1068-1076.
23. 2002. Effects of insulin in relatives of patients with type 1 diabetes mellitus. N.Engl.J.Med. 346:1685-1691.
24. Raz,I., Avron,A., Tamir,M., Metzger,M., Symer,L., Eldor,R., Cohen,I.R., and Elias,D. 2007. Treatment of new-onset type 1 diabetes with peptide DiaPep277 is safe and associated with preserved beta-cell function: extension of a randomized, double-blind, phase II trial. Diabetes Metab Res.Rev. 23:292-298.
25. DeFronzo,R.A. 1997. Insulin resistance: a multifaceted syndrome responsible for NIDDM, obesity, hypertension, dyslipidaemia and atherosclerosis. Neth.J.Med. 50:191-197.
26. Kahn,B.B. and Rossetti,L. 1998. Type 2 diabetes--who is conducting the orchestra? Nat.Genet. 20:223-225.
140
27. Stumvoll,M., Goldstein,B.J., and van Haeften,T.W. 2005. Type 2 diabetes: Principles of pathogenesis and therapy. Lancet 365:1333-1346.
28. Li,L., Yi,Z., Tisch,R., and Wang,B. 2008. Immunotherapy of type 1 diabetes. Arch.Immunol.Ther.Exp.(Warsz.) 56:227-236.
29. Sari,R. and Balci,M.K. 2005. Relationship between C peptide and chronic complications in type-2 diabetes mellitus. J.Natl.Med.Assoc. 97:1113-1118.
30. Shapiro,A.M., Ricordi,C., Hering,B.J., Auchincloss,H., Lindblad,R., Robertson,R.P., Secchi,A., Brendel,M.D., Berney,T., Brennan,D.C. et al. 2006. International trial of the Edmonton protocol for islet transplantation. N.Engl.J.Med. 355:1318-1330.
31. Ianus,A., Holz,G.G., Theise,N.D., and Hussain,M.A. 2003. In vivo derivation of glucose-competent pancreatic endocrine cells from bone marrow without evidence of cell fusion
250. J.Clin.Invest 111:843-850. 32. Voltarelli,J.C., Couri,C.E., Stracieri,A.B., Oliveira,M.C., Moraes,D.A., Pieroni,F.,
Coutinho,M., Malmegrim,K.C., Foss-Freitas,M.C., Simoes,B.P. et al. 2007. Autologous nonmyeloablative hematopoietic stem cell transplantation in newly diagnosed type 1 diabetes mellitus. JAMA 297:1568-1576.
33. Denner,L. and Urban,R.J. 2008. Critical issues for engineering cord blood stem cells to produce insulin. Expert.Opin.Biol.Ther. 8:1251-1254.
34. Kroon,E., Martinson,L.A., Kadoya,K., Bang,A.G., Kelly,O.G., Eliazer,S., Young,H., Richardson,M., Smart,N.G., Cunningham,J. et al. 2008. Pancreatic endoderm derived from human embryonic stem cells generates glucose-responsive insulin-secreting cells in vivo. Nat.Biotechnol. 26:443-452.
35. Jonsson,J., Carlsson,L., Edlund,T., and Edlund,H. 1994. Insulin-promoter-factor 1 is required for pancreas development in mice. Nature 371:606-609.
36. Offield,M.F., Jetton,T.L., Labosky,P.A., Ray,M., Stein,R.W., Magnuson,M.A., Hogan,B.L., and Wright,C.V. 1996. PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development 122:983-995.
37. Holland,A.M., Gonez,L.J., Naselli,G., MacDonald,R.J., and Harrison,L.C. 2005. Conditional expression demonstrates the role of the homeodomain transcription factor Pdx1 in maintenance and regeneration of beta-cells in the adult pancreas. Diabetes 54:2586-2595.
38. Sharma, A. and Stein, R. Glucose-induced transcription of the insulin gene is mediated by factors required for beta-cell-type-specific expression. Mol.Cell Biol. 14(2), 871-879. 1994.
39. Gerrish,K., Gannon,M., Shih,D., Henderson,E., Stoffel,M., Wright,C.V., and Stein,R.
2000. Pancreatic beta cell-specific transcription of the pdx-1 gene. The role of conserved
141
upstream control regions and their hepatic nuclear factor 3beta sites. J.Biol.Chem. 275:3485-3492.
40. Guz,Y., Montminy,M.R., Stein,R., Leonard,J., Gamer,L.W., Wright,C.V., and Teitelman,G. 1995. Expression of murine STF-1, a putative insulin gene transcription factor, in beta cells of pancreas, duodenal epithelium and pancreatic exocrine and endocrine progenitors during ontogeny. Development 121:11-18.
41. Habener, J. F., Kemp, D. M., and Thomas, M. K. Minireview: transcriptional regulation in pancreatic development. Endocrinology 146(3), 1025-1034. 2005.
42. Waeber, G., Thompson, N., Nicod, P., and Bonny, C. Transcriptional activation of the
GLUT2 gene by the IPF-1/STF-1/IDX-1 homeobox factor. Mol.Endocrinol. 10(11), 1327-1334. 1996.
43. Watada, H., Kajimoto, Y., Miyagawa, J., Hanafusa, T., Hamaguchi, K., Matsuoka, T.,
Yamamoto, K., Matsuzawa, Y., Kawamori, R., and Yamasaki, Y. PDX-1 induces insulin and glucokinase gene expressions in alphaTC1 clone 6 cells in the presence of betacellulin. Diabetes 45(12), 1826-1831. 1996.
44. Gerrish,K., Cissell,M.A., and Stein,R. 2001. The role of hepatic nuclear factor 1 alpha
and PDX-1 in transcriptional regulation of the pdx-1 gene. J.Biol.Chem. 276:47775-47784.
45. Sharma,A., Zangen,D.H., Reitz,P., Taneja,M., Lissauer,M.E., Miller,C.P., Weir,G.C., Habener,J.F., and Bonner-Weir,S. 1999. The homeodomain protein IDX-1 increases after an early burst of proliferation during pancreatic regeneration. Diabetes 48:507-513.
46. Ashizawa, S., Brunicardi, F. C., and Wang, X. P. PDX-1 and the pancreas. Pancreas 28(2), 109-120. 2004.
47. Joliot,A. and Prochiantz,A. 2004. Transduction peptides: from technology to physiology.
Nat.Cell Biol. 6:189-196.
48. Sandgren, S., Cheng, F., and Belting, M. Nuclear targeting of macromolecular polyanions by an HIV-Tat derived peptide. Role for cell-surface proteoglycans. J.Biol.Chem. 277(41), 38877-38883. 10-11-2002.
49. Wadia,J.S., Stan,R.V., and Dowdy,S.F. 2004. Transducible TAT-HA fusogenic peptide
enhances escape of TAT-fusion proteins after lipid raft macropinocytosis. Nat.Med. 10:310-315.
50. Frankel, A. D. and Pabo, C. O. Cellular uptake of the tat protein from human immunodeficiency virus. Cell 55(6), 1189-1193. 12-23-1988.
142
51. Green,M. and Loewenstein,P.M. 1988. Autonomous functional domains of chemically synthesized human immunodeficiency virus tat trans-activator protein. Cell 55:1179-1188.
52. Joliot, A. Transduction peptides within naturally occurring proteins. Sci.STKE. 2005(313), e54. 12-6-2005.
53. Nolden,L., Edenhofer,F., Haupt,S., Koch,P., Wunderlich,F.T., Siemen,H., and Brustle,O.
2006. Site-specific recombination in human embryonic stem cells induced by cell-permeant Cre recombinase. Nat.Methods 3:461-467.
54. Shibagaki, N. and Udey, M. C. Dendritic cells transduced with protein antigens induce cytotoxic lymphocytes and elicit antitumor immunity. J.Immunol. 168(5), 2393-2401. 3-1-2002.
55. Krosl,J., Austin,P., Beslu,N., Kroon,E., Humphries,R.K., and Sauvageau,G. 2003. In
vitro expansion of hematopoietic stem cells by recombinant TAT-HOXB4 protein. Nat.Med. 9:1428-1432.
56. Nagahara,H., Vocero-Akbani,A.M., Snyder,E.L., Ho,A., Latham,D.G., Lissy,N.A., Becker-Hapak,M., Ezhevsky,S.A., and Dowdy,S.F. 1998. Transduction of full-length TAT fusion proteins into mammalian cells: TAT-p27Kip1 induces cell migration. Nat.Med. 4:1449-1452.
57. Zhou,H., Wu,S., Joo,J.Y., Zhu,S., Han,D.W., Lin,T., Trauger,S., Bien,G., Yao,S., Zhu,Y. et al. 2009. Generation of Induced Pluripotent Stem Cells Using Recombinant Proteins. Cell Stem Cell.
58. Schwarze, S. R. and Dowdy, S. F. In vivo protein transduction: intracellular delivery of biologically active proteins, compounds and DNA. Trends Pharmacol.Sci. 21(2), 45-48. 2000.
59. Myou, S., Zhu, X., Myo, S., Boetticher, E., Meliton, A. Y., Liu, J., Munoz, N. M., and
Leff, A. R. Blockade of airway inflammation and hyperresponsiveness by HIV-TAT-dominant negative Ras. J.Immunol. 171(8), 4379-4384. 10-15-2003.
60. Bucci, M., Gratton, J. P., Rudic, R. D., Acevedo, L., Roviezzo, F., Cirino, G., and Sessa,
W. C. In vivo delivery of the caveolin-1 scaffolding domain inhibits nitric oxide synthesis and reduces inflammation. Nat.Med. 6(12), 1362-1367. 2000.
61. Shibagaki, N. and Udey, M. C. Dendritic cells transduced with TAT protein transduction
domain-containing tyrosinase-related protein 2 vaccinate against murine melanoma. Eur.J.Immunol. 33(4), 850-860. 2003.
62. Asoh, S. and Ohta, S. [Protein transduction and protection of cells against apoptosis]. Seikagaku 76(7), 654-658. 2004.
143
63. Noguchi,H., Kaneto,H., Weir,G.C., and Bonner-Weir,S. 2003. PDX-1 protein containing its own antennapedia-like protein transduction domain can transduce pancreatic duct and islet cells. Diabetes 52:1732-1737.
64. Noguchi,H. and Matsumoto,S. 2006. Protein transduction technology: a novel therapeutic perspective. Acta Med.Okayama 60:1-11.
65. Noguchi,H., Matsushita,M., Matsumoto,S., Lu,Y.F., Matsui,H., and Bonner-Weir,S. 2005. Mechanism of PDX-1 protein transduction. Biochem.Biophys.Res.Commun. 332:68-74.
66. Noguchi,H., Matsumoto,S., Okitsu,T., Iwanaga,Y., Yonekawa,Y., Nagata,H., Matsushita,M., Wei,F.Y., Matsui,H., Minami,K. et al. 2005. PDX-1 protein is internalized by lipid raft-dependent macropinocytosis. Cell Transplant. 14:637-645.
67. Dor,Y., Brown,J., Martinez,O.I., and Melton,D.A. 2004. Adult pancreatic beta-cells are formed by self-duplication rather than stem-cell differentiation. Nature 429:41-46.
68. Nir, T., Melton, D. A., and Dor, Y. Recovery from diabetes in mice by beta cell regeneration. J.Clin.Invest 117(9), 2553-2561. 9-4-2007.
69. Harmon,J.S., Gleason,C.E., Tanaka,Y., Oseid,E.A., Hunter-Berger,K.K., and
Robertson,R.P. 1999. In vivo prevention of hyperglycemia also prevents glucotoxic effects on PDX-1 and insulin gene expression. Diabetes 48:1995-2000.
70. Robertson,R., Zhou,H., Zhang,T., and Harmon,J.S. 2007. Chronic oxidative stress as a mechanism for glucose toxicity of the beta cell in Type 2 diabetes. Cell Biochem.Biophys. 48:139-146.
71. Robertson,R.P. and Harmon,J.S. 2006. Diabetes, glucose toxicity, and oxidative stress: A case of double jeopardy for the pancreatic islet beta cell. Free Radic.Biol.Med. 41:177-184.
72. Sharma,A., Olson,L.K., Robertson,R.P., and Stein,R. 1995. The reduction of insulin gene transcription in HIT-T15 beta cells chronically exposed to high glucose concentration is associated with the loss of RIPE3b1 and STF-1 transcription factor expression. Mol.Endocrinol. 9:1127-1134.
73. Kito, H., Ose, Y., Mizuhira, V., Sato, T., Ishikawa, T., and Tazawa, T. Separation and purification of (Cd, Cu, Zn)-metallothionein in carp hepato-pancreas. Comp Biochem.Physiol C. 73(1), 121-127. 1982.
74. Meivar-Levy, I. and Ferber, S. New organs from our own tissues: liver-to-pancreas
transdifferentiation. Trends Endocrinol.Metab 14(10), 460-466. 2003. 75. Michalopoulos,G.K. and DeFrances,M.C. 1997. Liver regeneration. Science 276:60-66.
144
76. Yang, H., Morrison, C. M., Conlon, J. M., Laybolt, K., and Wright, J. R., Jr. Immunocytochemical characterization of the pancreatic islet cells of the Nile Tilapia (Oreochromis niloticus). Gen.Comp Endocrinol. 114(1), 47-56. 1999.
77. Wolf,H.K., Burchette,J.L., Jr., Garcia,J.A., and Michalopoulos,G. 1990. Exocrine
pancreatic tissue in human liver: a metaplastic process? Am.J.Surg.Pathol. 14:590-595.
78. Tang,D.Q., Lu,S., Sun,Y.P., Rodrigue,E., Chou,W., Yang,C., Chang,L.J., and Yang,L.J. 2006. Reprogramming Liver-Stem WB Cells into Functional Insulin-Producing Cells by Persistent Expression of Pdx1- and Pdx1-VP16 Mediated by Lentiviral Vectors. Lab Invest 86:83-93.
79. Tang,D.Q., Cao,L.Z., Chou,W., Shun,L., Farag,C., Atkinson,M.A., Li,S.W., Chang,L.J., and Yang,L.J. 2006. Role of Pax4 in Pdx1-VP16-mediated liver-to-endocrine pancreas transdifferentiation. Lab Invest 86:829-841.
80. Fodor, A., Harel, C., Fodor, L., Armoni, M., Salmon, P., Trono, D., and Karnieli, E. Adult rat liver cells transdifferentiated with lentiviral IPF1 vectors reverse diabetes in mice: an ex vivo gene therapy approach. Diabetologia 50(1), 121-130. 2007.
81. Yechoor,V., Liu,V., Espiritu,C., Paul,A., Oka,K., Kojima,H., and Chan,L. 2009.
Neurogenin3 is sufficient for transdetermination of hepatic progenitor cells into neo-islets in vivo but not transdifferentiation of hepatocytes. Dev.Cell 16:358-373.
82. Meivar-Levy,I., Sapir,T., Gefen-Halevi,S., Aviv,V., Barshack,I., Onaca,N., Mor,E., and Ferber,S. 2007. Pancreatic and duodenal homeobox gene 1 induces hepatic dedifferentiation by suppressing the expression of CCAAT/enhancer-binding protein beta. Hepatology 46:898-905.
83. Ber,I., Shternhall,K., Perl,S., Ohanuna,Z., Goldberg,I., Barshack,I., Benvenisti-Zarum,L., Meivar-Levy,I., and Ferber,S. 2003. Functional, persistent, and extended liver to pancreas transdifferentiation. J.Biol.Chem. 278:31950-31957.
84. Ferber,S., Halkin,A., Cohen,H., Ber,I., Einav,Y., Goldberg,I., Barshack,I., Seijffers,R., Kopolovic,J., Kaiser,N. et al. 2000. Pancreatic and duodenal homeobox gene 1 induces expression of insulin genes in liver and ameliorates streptozotocin-induced hyperglycemia. Nat.Med. 6:568-572.
85. Sapir,T., Shternhall,K., Meivar-Levy,I., Blumenfeld,T., Cohen,H., Skutelsky,E.,
Eventov-Friedman,S., Barshack,I., Goldberg,I., Pri-Chen,S. et al. 2005. Cell-replacement therapy for diabetes: Generating functional insulin-producing tissue from adult human liver cells. Proc.Natl.Acad.Sci.U.S.A 102:7964-7969.
86. Shternhall-Ron,K., Quintana,F.J., Perl,S., Meivar-Levy,I., Barshack,I., Cohen,I.R., and Ferber,S. 2007. Ectopic PDX-1 expression in liver ameliorates type 1 diabetes. J.Autoimmun.
145
87. Kojima,H., Fujimiya,M., Matsumura,K., Younan,P., Imaeda,H., Maeda,M., and Chan,L. 2003. NeuroD-betacellulin gene therapy induces islet neogenesis in the liver and reverses diabetes in mice. Nat.Med. 9:596-603.
88. Koizumi,M., Doi,R., Toyoda,E., Tulachan,S.S., Kami,K., Mori,T., Ito,D., Kawaguchi,Y.,
Fujimoto,K., Gittes,G.K. et al. 2004. Hepatic regeneration and enforced PDX-1 expression accelerate transdifferentiation in liver. Surgery 136:449-457.
89. Kim,S., Shin,J.S., Fisher,R.C., Lee,M.J., and Kim,K.W. 2007. Streptozotocin-induced diabetes can be reversed by hepatic oval cell activation through hepatic transdifferentiation and pancreatic islet regeneration. Lab Invest In press.
90. Bonner-Weir,S. and Weir,G.C. 2005. New sources of pancreatic beta-cells. Nat.Biotechnol. 23:857-861.
91. Meier,J.J., Bhushan,A., and Butler,P.C. 2006. The potential for stem cell therapy in diabetes. Pediatr.Res. 59:65R-73R.
92. Trucco,M. 2006. Is facilitating pancreatic beta cell regeneration a valid option for clinical therapy? Cell Transplant. 15 Suppl 1:S75-S84.
93. Perfetti,R., Zhou,J., Doyle,M.E., and Egan,J.M. 2000. Glucagon-like peptide-1 induces cell proliferation and pancreatic- duodenum homeobox-1 expression and increases endocrine cell mass in the pancreas of old, glucose-intolerant rats
31. Endocrinology 141:4600-4605.
94. Stoffers,D.A., Kieffer,T.J., Hussain,M.A., Drucker,D.J., Bonner-Weir,S., Habener,J.F., and Egan,J.M. 2000. Insulinotropic glucagon-like peptide 1 agonists stimulate expression of homeodomain protein IDX-1 and increase islet size in mouse pancreas. Diabetes 49:741-748.
95. Xu,G., Stoffers,D.A., Habener,J.F., and Bonner-Weir,S. 1999. Exendin-4 stimulates both beta-cell replication and neogenesis, resulting in increased beta-cell mass and improved glucose tolerance in diabetic rats
1. Diabetes 48:2270-2276.
96. Zhou,J., Pineyro,M.A., Wang,X., Doyle,M.E., and Egan,J.M. 2002. Exendin-4 differentiation of a human pancreatic duct cell line into endocrine cells: Involvement of PDX-1 and HNF3beta transcription factors. J.Cell Physiol 192:304-314.
97. Pittenger,G.L., Taylor-Fishwick,D.A., Johns,R.H., Burcus,N., Kosuri,S., and Vinik,A.I. 2007. Intramuscular injection of islet neogenesis-associated protein peptide stimulates pancreatic islet neogenesis in healthy dogs. Pancreas 34:103-111.
98. Gagliardino,J.J., Del Zotto,H., Massa,L., Flores,L.E., and Borelli,M.I. 2003. Pancreatic duodenal homeobox-1 and islet neogenesis-associated protein: a possible combined marker of activateable pancreatic cell precursors. J.Endocrinol. 177:249-259.
146
99. Holland,A.M., Hale,M.A., Kagami,H., Hammer,R.E., and MacDonald,R.J. 2002. Experimental control of pancreatic development and maintenance. Proc.Natl.Acad.Sci.U.S.A 99:12236-12241.
100. Stoffers,D.A., Zinkin,N.T., Stanojevic,V., Clarke,W.L., and Habener,J.F. 1997. Pancreatic agenesis attributable to a single nucleotide deletion in the human IPF1 gene coding sequence. Nat.Genet. 15:106-110.
101. Yang,L.J. 2006. Liver stem cell-derived beta-cell surrogates for treatment of type 1 diabetes. Autoimmun.Rev. 5:409-413.
102. Prochiantz,A. and Joliot,A. 2003. Can transcription factors function as cell-cell signalling molecules? Nat.Rev.Mol.Cell Biol. 4:814-819.
103. Noguchi, H. and Matsumoto, S. Protein transduction technology offers a novel therapeutic approach for diabetes. J.Hepatobiliary.Pancreat.Surg. 13(4), 306-313. 2006.
104. Jin, L. H., Bahn, J. H., Eum, W. S., Kwon, H. Y., Jang, S. H., Han, K. H., Kang, T. C.,
Won, M. H., Kang, J. H., Cho, S. W., Park, J., and Choi, S. Y. Transduction of human catalase mediated by an HIV-1 TAT protein basic domain and arginine-rich peptides into mammalian cells. Free Radic.Biol.Med. 31(11), 1509-1519. 12-1-2001.
105. Coleman,W.B., McCullough,K.D., Esch,G.L., Faris,R.A., Hixson,D.C., Smith,G.J., and
Grisham,J.W. 1997. Evaluation of the differentiation potential of WB-F344 rat liver epithelial stem-like cells in vivo. Differentiation to hepatocytes after transplantation into dipeptidylpeptidase-IV-deficient rat liver. Am.J.Pathol. 151:353-359.
106. Couchie,D., Holic,N., Chobert,M.N., Corlu,A., and Laperche,Y. 2002. In vitro differentiation of WB-F344 rat liver epithelial cells into the biliary lineage. Differentiation 69:209-215.
107. Narushima,Y., Unno,M., Nakagawara,K., Mori,M., Miyashita,H., Suzuki,Y., Noguchi,N., Takasawa,S., Kumagai,T., Yonekura,H. et al. 1997. Structure, chromosomal localization and expression of mouse genes encoding type III Reg, RegIII alpha, RegIII beta, RegIII gamma. Gene 185:159-168.
108. Peshavaria,M., Larmie,B.L., Lausier,J., Satish,B., Habibovic,A., Roskens,V., Larock,K., Everill,B., Leahy,J.L., and Jetton,T.L. 2006. Regulation of pancreatic beta-cell regeneration in the normoglycemic 60% partial-pancreatectomy mouse. Diabetes 55:3289-3298.
109. Guz,Y., Nasir,I., and Teitelman,G. 2001. Regeneration of pancreatic beta cells from intra-islet precursor cells in an experimental model of diabetes. Endocrinology 142:4956-4968.
110. O'Doherty,R.M., Lehman,D.L., Telemaque-Potts,S., and Newgard,C.B. 1999. Metabolic impact of glucokinase overexpression in liver: lowering of blood glucose in fed rats is accompanied by hyperlipidemia. Diabetes 48:2022-2027.
147
111. Waguri,M., Yamamoto,K., Miyagawa,J.I., Tochino,Y., Yamamori,K., Kajimoto,Y., Nakajima,H., Watada,H., Yoshiuchi,I., Itoh,N. et al. 1997. Demonstration of two different processes of beta-cell regeneration in a new diabetic mouse model induced by selective perfusion of alloxan. Diabetes 46:1281-1290.
112. Kulkarni,R.N., Jhala,U.S., Winnay,J.N., Krajewski,S., Montminy,M., and Kahn,C.R. 2004. PDX-1 haploinsufficiency limits the compensatory islet hyperplasia that occurs in response to insulin resistance. J.Clin.Invest 114:828-836.
113. Marshak,S., Benshushan,E., Shoshkes,M., Havin,L., Cerasi,E., and Melloul,D. 2000. Functional conservation of regulatory elements in the pdx-1 gene: PDX-1 and hepatocyte nuclear factor 3beta transcription factors mediate beta- cell-specific expression
37. Mol.Cell Biol. 20:7583-7590.
114. Kushner,J.A., Ye,J., Schubert,M., Burks,D.J., Dow,M.A., Flint,C.L., Dutta,S., Wright,C.V., Montminy,M.R., and White,M.F. 2002. Pdx1 restores beta cell function in Irs2 knockout mice. J.Clin.Invest 109:1193-1201.
115. Hui,H. and Perfetti,R. 2002. Pancreas duodenum homeobox-1 regulates pancreas development during embryogenesis and islet cell function in adulthood. Eur.J.Endocrinol. 146:129-141.
116. Sherry,N.A., Kushner,J.A., Glandt,M., Kitamura,T., Brillantes,A.M., and Herold,K.C. 2006. Effects of autoimmunity and immune therapy on beta-cell turnover in type 1 diabetes. Diabetes 55:3238-3245.
117. Ablamunits,V., Sherry,N.A., Kushner,J.A., and Herold,K.C. 2007. Autoimmunity and Beta cell regeneration in mouse and human type 1 diabetes: the peace is not enough. Ann.N.Y.Acad.Sci. 1103:19-32.
118. Makino,S., Kunimoto,K., Muraoka,Y., Mizushima,Y., Katagiri,K., and Tochino,Y. 1980. Breeding of a non-obese, diabetic strain of mice. Jikken Dobutsu 29:1-13.
119. Zhang,J., Tokui,Y., Yamagata,K., Kozawa,J., Sayama,K., Iwahashi,H., Okita,K., Miuchi,M., Konya,H., Hamaguchi,T. et al. 2007. Continuous stimulation of human glucagon-like peptide-1 (7-36) amide in a mouse model (NOD) delays onset of autoimmune type 1 diabetes. Diabetologia 50:1900-1909.
120. Hadjiyanni,I., Baggio,L.L., Poussier,P., and Drucker,D.J. 2008. Exendin-4 modulates diabetes onset in nonobese diabetic mice. Endocrinology 149:1338-1349.
121. Linn,T., Schneider,K., Goke,B., and Federlin,K. 1996. Glucagon-like-peptide-1 (7-36) amide improves glucose sensitivity in beta-cells of NOD mice. Acta Diabetol. 33:19-24.
122. Li,Y., Cao,X., Li,L.X., Brubaker,P.L., Edlund,H., and Drucker,D.J. 2005. beta-Cell Pdx1 expression is essential for the glucoregulatory, proliferative, and cytoprotective actions of glucagon-like peptide-1. Diabetes 54:482-491.
148
123. Koya,V., Lu,S., Sun,Y.P., Purich,D.L., Atkinson,M.A., Li,S.W., and Yang,L.J. 2008. Reversal of streptozotocin-induced diabetes in mice by cellular transduction with recombinant pancreatic transcription factor pancreatic duodenal homeobox-1: a novel protein transduction domain-based therapy. Diabetes 57:757-769.
124. Katz,J.D., Wang,B., Haskins,K., Benoist,C., and Mathis,D. 1993. Following a diabetogenic T cell from genesis through pathogenesis. Cell 74:1089-1100.
125. Zhang,L., Nakayama,M., and Eisenbarth,G.S. 2008. Insulin as an autoantigen in NOD/human diabetes. Curr.Opin.Immunol. 20:111-118.
126. Wong,F.S., Wen,L., Tang,M., Ramanathan,M., Visintin,I., Daugherty,J., Hannum,L.G., Janeway,C.A., Jr., and Shlomchik,M.J. 2004. Investigation of the role of B-cells in type 1 diabetes in the NOD mouse. Diabetes 53:2581-2587.
127. Bach,J.F. and Chatenoud,L. 2001. Tolerance to islet autoantigens in type 1 diabetes. Annu.Rev.Immunol. 19:131-161.
128. Bach,J.F. 2001. Immunotherapy of insulin-dependent diabetes mellitus. Curr.Opin.Immunol. 13:601-605.
129. Hoglund,P., Mintern,J., Waltzinger,C., Heath,W., Benoist,C., and Mathis,D. 1999. Initiation of autoimmune diabetes by developmentally regulated presentation of islet cell antigens in the pancreatic lymph nodes. J.Exp.Med. 189:331-339.
130. Wenzlau,J.M., Juhl,K., Yu,L., Moua,O., Sarkar,S.A., Gottlieb,P., Rewers,M., Eisenbarth,G.S., Jensen,J., Davidson,H.W. et al. 2007. The cation efflux transporter ZnT8 (Slc30A8) is a major autoantigen in human type 1 diabetes. Proc.Natl.Acad.Sci.U.S.A 104:17040-17045.
131. Tisch,R. and McDevitt,H.O. 1994. Antigen-specific immunotherapy: is it a real possibility to combat T-cell-mediated autoimmunity? Proc.Natl.Acad.Sci.U.S.A 91:437-438.
132. Pasquali,L., Giannoukakis,N., and Trucco,M. 2008. Induction of immune tolerance to facilitate beta cell regeneration in type 1 diabetes. Adv.Drug Deliv.Rev. 60:106-113.
133. Raz,I., Eldor,R., and Naparstek,Y. 2005. Immune modulation for prevention of type 1 diabetes mellitus. Trends Biotechnol. 23:128-134.
134. Liblau,R.S., Pearson,C.I., Shokat,K., Tisch,R., Yang,X.D., and McDevitt,H.O. 1994. High-dose soluble antigen: peripheral T-cell proliferation or apoptosis. Immunol.Rev. 142:193-208.
135. Song,W.J., Schreiber,W.E., Zhong,E., Liu,F.F., Kornfeld,B.D., Wondisford,F.E., and Hussain,M.A. 2008. Exendin-4 stimulation of cyclin A2 in beta-cell proliferation. Diabetes 57:2371-2381.
149
136. Lee,Y.C. and Nielsen,J.H. 2009. Regulation of beta cell replication. Mol.Cell Endocrinol. 297:18-27.
137. Heit,J.J., Karnik,S.K., and Kim,S.K. 2006. Intrinsic regulators of pancreatic beta-cell proliferation. Annu.Rev.Cell Dev.Biol. 22:311-338.
138. Rankin,M.M. and Kushner,J.A. 2009. ADAPTIVE BETA CELL PROLIFERATION IS SEVERELY RESTRICTED WITH ADVANCED AGE. Diabetes.
139. Krishnamurthy, J., Ramsey, M. R., Ligon, K. L., Torrice, C., Koh, A., Bonner-Weir, S., and Sharpless, N. E. p16INK4a induces an age-dependent decline in islet regenerative potential. Nature 443(7110), 453-457. 9-28-2006.
140. Schisler,J.C., Fueger,P.T., Babu,D.A., Hohmeier,H.E., Tessem,J.S., Lu,D., Becker,T.C.,
Naziruddin,B., Levy,M., Mirmira,R.G. et al. 2008. Stimulation of human and rat islet beta-cell proliferation with retention of function by the homeodomain transcription factor Nkx6.1. Mol.Cell Biol. 28:3465-3476.
141. Cozar-Castellano,I., Harb,G., Selk,K., Takane,K., Vasavada,R., Sicari,B., Law,B., Zhang,P., Scott,D.K., Fiaschi-Taesch,N. et al. 2008. Lessons from the first comprehensive molecular characterization of cell cycle control in rodent insulinoma cell lines. Diabetes 57:3056-3068.
142. Kushner,J.A., Ciemerych,M.A., Sicinska,E., Wartschow,L.M., Teta,M., Long,S.Y., Sicinski,P., and White,M.F. 2005. Cyclins D2 and D1 are essential for postnatal pancreatic beta-cell growth. Mol.Cell Biol. 25:3752-3762.
143. Teta,M., Long,S.Y., Wartschow,L.M., Rankin,M.M., and Kushner,J.A. 2005. Very slow turnover of beta-cells in aged adult mice. Diabetes 54:2557-2567.
144. Andersen, F. G., Jensen, J., Heller, R. S., Petersen, H. V., Larsson, L. I., Madsen, O. D., and Serup, P. Pax6 and Pdx1 form a functional complex on the rat somatostatin gene upstream enhancer. FEBS Lett. 445(2-3), 315-320. 2-26-1999.
145. Goudet,G., Delhalle,S., Biemar,F., Martial,J.A., and Peers,B. 1999. Functional and
cooperative interactions between the homeodomain PDX1, Pbx, and Prep1 factors on the somatostatin promoter. J.Biol.Chem. 274:4067-4073.
146. Peers, B., Sharma, S., Johnson, T., Kamps, M., and Montminy, M. The pancreatic islet factor STF-1 binds cooperatively with Pbx to a regulatory element in the somatostatin promoter: importance of the FPWMK motif and of the homeodomain. Mol.Cell Biol. 15(12), 7091-7097. 1995.
147. Qiu,Y., Sharma,A., and Stein,R. 1998. p300 mediates transcriptional stimulation by the
basic helix-loop-helix activators of the insulin gene. Mol.Cell Biol. 18:2957-2964.
150
148. Qiu,Y., Guo,M., Huang,S., and Stein,R. 2002. Insulin gene transcription is mediated by interactions between the p300 coactivator and PDX-1, BETA2, and E47. Mol.Cell Biol. 22:412-420.
149. Teta,M., Rankin,M.M., Long,S.Y., Stein,G.M., and Kushner,J.A. 2007. Growth and regeneration of adult beta cells does not involve specialized progenitors. Dev.Cell 12:817-826.
150. Bonner-Weir, S., Toschi, E., Inada, A., Reitz, P., Fonseca, S. Y., Aye, T., and Sharma, A. The pancreatic ductal epithelium serves as a potential pool of progenitor cells. Pediatr.Diabetes 5 Suppl 2, 16-22. 2004.
151. Bonner-Weir,S. and Sharma,A. 2002. Pancreatic stem cells. J.Pathol. 197:519-526. 152. Dor,Y. and Melton,D.A. 2008. Facultative endocrine progenitor cells in the adult
pancreas. Cell 132:183-184.
153. Bonner-Weir,S., Baxter,L.A., Schuppin,G.T., and Smith,F.E. 1993. A second pathway for regeneration of adult exocrine and endocrine pancreas. A possible recapitulation of embryonic development. Diabetes 42:1715-1720.
154. Gu,G., Dubauskaite,J., and Melton,D.A. 2002. Direct evidence for the pancreatic lineage: NGN3+ cells are islet progenitors and are distinct from duct progenitors
3. Development 129:2447-2457.
155. Zhou,Q., Brown,J., Kanarek,A., Rajagopal,J., and Melton,D.A. 2008. In vivo reprogramming of adult pancreatic exocrine cells to beta-cells. Nature 455:627-632.
156. Yamanaka,S. and Takahashi,K. 2006. [Induction of pluripotent stem cells from mouse fibroblast cultures]. Tanpakushitsu Kakusan Koso 51:2346-2351.
157. Takahashi,K. and Yamanaka,S. 2006. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:663-676.
158. Lewitzky,M. and Yamanaka,S. 2007. Reprogramming somatic cells towards pluripotency by defined factors. Curr.Opin.Biotechnol. 18:467-473.
159. Wernig,M., Meissner,A., Foreman,R., Brambrink,T., Ku,M., Hochedlinger,K., Bernstein,B.E., and Jaenisch,R. 2007. In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature 448:318-324.
160. Maherali,N., Sridharan,R., Xie,W., Utikal,J., Eminli,S., Arnold,K., Stadtfeld,M., Yachechko,R., Tchieu,J., Jaenisch,R. et al. 2007. Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution. Cell Stem Cell 1:55-70.
151
161. Mikkelsen,T.S., Ku,M., Jaffe,D.B., Issac,B., Lieberman,E., Giannoukos,G., Alvarez,P., Brockman,W., Kim,T.K., Koche,R.P. et al. 2007. Genome-wide maps of chromatin state in pluripotent and lineage-committed cells. Nature 448:553-560.
162. Korhonen,S., Knip,M.M., Kulmala,P., Savola,K., Akerblom,H.K., and Knip,M. 2002. Autoantibodies to GAD, IA-2 and insulin in ICA-positive first-degree relatives of children with type 1 diabetes: a comparison between parents and siblings. Diabetes Metab Res.Rev. 18:43-48.
163. Knip,M. 2002. Can we predict type 1 diabetes in the general population? Diabetes Care 25:623-625.
164. Hohmeier,H.E. and Newgard,C.B. 2004. Cell lines derived from pancreatic islets. Mol.Cell Endocrinol. 228:121-128.
152
BIOGRAPHICAL SKETCH
Vijay Koya was born in India, in 1978. He graduated from Jubilee Hills Public School in
1993. Following high school, he enrolled into two year college program in biological sciences. In
1996, he was admitted into Acharya N.G. Ranga Agriculture University. He completed his
bachelor’s degree in veterinary medicine in 2001. Due to his interest in basic sciences, he moved
on to pursue graduate studies in United States. In the spring of 2002, he was admitted into
master’s program in the Department of Molecular Biology & Microbiology at the University of
Central Florida, Orlando. In the summer of 2002, Vijay joined Dr. Henry Daniell’s laboratory to
conduct research on the development of new generation anthrax vaccine in transgenic plants.
Besides research, he has actively participated in teaching human anatomy for pre-medical
students. During his master’s program, he received “University Merit Scholar Award” for
academic excellence. Vijay graduated with MS degree in molecular biology& microbiology in
fall 2004 and continued to work in Dr. Henry Daniell’s lab until the end of summer 2005. During
this period, he worked on developing a prototype model for oral delivery of plant expressed
therapeutic proteins. In the fall of 2005, he was admitted into the Interdisciplinary Program (IDP)
in Biomedical Sciences at the College of Medicine at the University of Florida. Vijay joined Dr.
Lijun Yang’s lab in the Department of Pathology to conduct doctoral research. He investigated
on the Pdx1 protein therapy; a novel approach for the treatment of diabetes. He has received
Scientific Achievement Award for the best abstract, at the Annual Rachmiel Levine Symposium,
for two consecutive years 2008 and 2009. He received Ph.D from the University of Florida in the
summer of 2009.
