YY1 Regulates Melanocyte Development and Function by Cooperating with MITF

YY1 Regulates Melanocyte Development and Functionby Cooperating with MITFJuying Li1., Jun S. Song2,3.*, Robert J. A. Bell2, Thanh-Nga T. Tran1, Rizwan Haq1,4, Huifei Liu5,

Kevin T. Love6, Robert Langer6,7,8, Daniel G. Anderson6,7,8, Lionel Larue9, David E. Fisher1*

1 Department of Dermatology, Cutaneous Biology Research Center, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts, United States of

America, 2 Institute for Human Genetics, University of California San Francisco, San Francisco, California, United States of America, 3 Department of Epidemiology and

Biostatistics, Department of Bioengineering and Therapeutic Sciences, The Eli and Edythe Broad Center of Regeneration Medicine and Stem Cell Research, University of

California San Francisco, San Francisco, California, United States of America, 4 Division of Medical Oncology, Massachusetts General Hospital, Boston, Massachusetts,

United States of America, 5 Children’s Hospital Boston, Harvard Medical School, Boston, Massachusetts, United States of America, 6 Department of Chemical Engineering,

Massachusetts Institute of Technology, Cambridge, Massachusetts, United States of America, 7 David H. Koch Institute for Integrative Cancer Research, Massachusetts

Institute of Technology, Cambridge, Massachusetts, United States of America, 8 Harvard–MIT Division of Health Sciences and Technology, Cambridge, Massachusetts,

United States of America, 9 Institut Curie, Developmental Genetics of Melanocytes, U1021 INSERM, UMR 3347 CNRS, Orsay, France

Abstract

Studies of coat color mutants have greatly contributed to the discovery of genes that regulate melanocyte developmentand function. Here, we generated Yy1 conditional knockout mice in the melanocyte-lineage and observed profoundmelanocyte deficiency and premature gray hair, similar to the loss of melanocytes in human piebaldism and Waardenburgsyndrome. Although YY1 is a ubiquitous transcription factor, YY1 interacts with M-MITF, the Waardenburg Syndrome IIAgene and a master transcriptional regulator of melanocytes. YY1 cooperates with M-MITF in regulating the expression ofpiebaldism gene KIT and multiple additional pigmentation genes. Moreover, ChIP–seq identified genome-wide YY1 targetsin the melanocyte lineage. These studies mechanistically link genes implicated in human conditions of melanocytedeficiency and reveal how a ubiquitous factor (YY1) gains lineage-specific functions by co-regulating gene expression with alineage-restricted factor (M-MITF)—a general mechanism which may confer tissue-specific gene expression in multiplelineages.

Citation: Li J, Song JS, Bell RJA, Tran T-NT, Haq R, et al. (2012) YY1 Regulates Melanocyte Development and Function by Cooperating with MITF. PLoS Genet 8(5):e1002688. doi:10.1371/journal.pgen.1002688

Editor: Marcus Bosenberg, Yale School of Medicine, United States of America

Received October 18, 2011; Accepted March 20, 2012; Published May 3, 2012

Copyright: � 2012 Li et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricteduse, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: JL acknowledges support from MGH Tosteson Postdoctoral Fellowship and NIH Dermatology Training Grant (2T32AR007098-37). JSS was partiallysupported by the PhRMA Foundation and the National Cancer Institute (R01CA163336). DEF gratefully acknowledges grant support from the Doris Duke MedicalFoundation, National Institutes of Health (NIAMS), Dr. Miriam and Sheldon Adelson Medical Research Foundation, Melanoma Research Alliance, and U.S.–IsraelBinational Science Foundation. DGA was partially supported by NIH RO1 EB000244. The funders had no role in study design, data collection and analysis, decisionto publish, or preparation of the manuscript.

Competing Interests: The authors have declared that no competing interests exist.

* E-mail: [email protected] (JSS); [email protected] (DEF)

. These authors contributed equally to this work.

Introduction

Waardenburg syndrome, Tietz syndrome and piebaldism

represent disorders of melanocyte migration, proliferation, or

survival during embryonic development and are characterized by

stable congenital white patches of the skin and hair. They are

caused by mutations in various genes, including PAX3 (paired-box

3), SOX10 (sex-determining region Y-box 10), MITF (microph-

thalmia-associated transcription factor), EDN3 (endothelin 3),

EDNRB (endothelin receptor B) and KIT, resulting in hypopig-

mentation due to a lack of melanocytes rather than a lack of

pigment in viable melanocytes, as occurs in albinism [1,2,3].

Among these genes, MITF is one of the earliest melanocyte-

specific transcription factors and is a master regulator of

melanocyte development and function. In humans, germline

loss-of-function mutations of MITF are associated with Waarden-

burg Syndrome (WS) type IIA and Tietz syndrome, autosomal

dominant conditions which exhibit melanocytic deficiencies and

pigmentation abnormalities together with variable severity of

sensorineural deafness [4,5,6]. M-MITF is the melanocyte-specific

isoform of MITF. The importance of MITF in melanocyte

differentiation is highlighted by its direct and lineage-specific

transcription of essential pigmentation enzymes and melanosome

components, e.g., tyrosinase (TYR), dopachrome tautomerase (DCT) and

silver (SILV). MITF also regulates the receptor tyrosine kinase KIT

[7], which is necessary for the survival and dispersal of melanocyte

precursors from the migration staging area. Inactivating mutations

or deletion of KIT lead to piebaldism in humans, with loss of

melanocytes typically restricted to the hair and skin [3,8,9]. MITF

thus has diverse functions in melanocyte differentiation, growth

and survival pathways [10,11,12].

Yin Yang 1 (YY1) is a ubiquitously expressed zinc-finger

transcription factor. It can act as transcriptional repressor or

activator [13]. The essential role of YY1 in development is

underscored by the fact that genetic ablation of Yy1 in mice

resulted in peri-implantation lethality [14]. During B cell and

oligodendrocyte lineage development, YY1 functions as a pro-

differentiation factor [15,16]. In mouse spermatogenesis, YY1 is

PLoS Genetics | www.plosgenetics.org 1 May 2012 | Volume 8 | Issue 5 | e1002688

required for maintaining heterochromatin structure integrity [17].

YY1 thus has important functions in several lineages, but given its

ubiquitous expression in the majority of tissues, it is not known

whether it is able to regulate select genes in a lineage-specific

manner. This paper reports a key role for YY1 in melanocytic

lineage development and describes how melanocyte-specific

functions of YY1 may be directed by its interaction with M-MITF.

Results

YY1 is required for melanocyte development and survivalin vivo and in vitro

To study the function of YY1 in melanocyte development, we

generated melanocyte-specific Yy1 conditional knockout mice

(TyrCre, yy1f/f) by crossing yy1flox/flox mice [18] with TyrCre

mice in which Cre expression is constitutively driven by the

melanocyte-specific tyrosinase (Tyr) promoter [19]. Cre-mediated

genetic recombination starts from embryonic day 10.5. TyrCre,

yy1f/f mice were born at the expected Mendelian ratio. Shortly

after birth (P4), TyrCre, yy1f/f mice showed profoundly lighter skin

pigmentation compared with littermate controls TyrCre, yy1f/+(Figure 1A, P4). In the first hair cycle (P0–P28), ventral hairs of

TyrCre, yy1f/f mice were essentially devoid of pigment (Figure 1A,

P10). Hairs from dorsal skin of TyrCre, yy1f/f mice were much less

pigmented than those in control mice (Figure 1A, P10), and H&E

sections of dorsal skin revealed small amounts of residual hair

follicle melanin (Figure 1B, P4, arrows). As indicated by

immunofluorescence (Figure 1C–1H), the residual dorsal melano-

cytes (DCT positive, Figure 1D) continued to express YY1

(compare nuclear YY1 signal to cytoplasmic DCT, Figure 1G),

indicating incomplete Cre-mediated deletion. MITF expression

was not affected in the residual hair follicle melanocytes of P4

TyrCre, yy1f/f mice (Figure S1A). In the second hair cycle anagen

phase (P28–P42), new dorsal hair follicles of TyrCre, yy1f/f mice

completely lacked melanin pigment (Figure 1B, P38) as well as

DCT positive melanocytes (Figure 1I and 1J) and corresponded to

subsequent white dorsal fur (Figure 1A, P45), indicating an

ongoing need for YY1 in post-developmental melanocytes. Further

support for melanocyte absence, rather than absence of pigment

within viable melanocytes, came from TyrCre, yy1f/f, Dct-lacZ mice,

which carry a lacZ reporter under the control of the melanocytic-

specific Dct promoter [20]. XGal staining of whole-mount skin

sections confirmed the absence of melanocytes or pigment in hair

follicles of TyrCre, yy1f/f, Dct-lacZ mice at the anagen phase of the

second hair cycle (P38) (Figure 1K and 1L, Figure S1B).

Collectively these data suggest that YY1 is required for melanocyte

development and post-developmental survival in vivo.

To determine whether YY1 is also required for melanocytic cell

survival in vitro, we stably knocked down endogenous YY1 using

two lentiviral shRNAs (yy1shR#1&#6) (Figure 2A). Prolonged

depletion of YY1 led to decreased cell numbers in both YY1

knockdown MALME-3M melanoma cells and human foreskin

primary melanocytes (HFM), similar to MITF knockdown

(Figure 2B and 2C, Figure S2A). While a decrease in cell numbers

clearly indicates cell death, it is plausible that there could also be

anti-proliferative effects in some (surviving) cells, a possibility that

will require additional study.

YY1 is required for the expression of melanocyte survivaland differentiation genes

Melanocyte deficiency and premature gray hair in melanocyte-

specific Yy1 conditional knockout mice are reminiscent of the

melanocyte deficiency phenotype in human Waardenburg syn-

drome and related disorders and suggest that YY1 may

transcriptionally regulate genes important for lineage development

or survival. We therefore performed expression profiling analysis

using MALME-3M melanoma cells with or without YY1

knockdown. Although the Waardenburg syndrome genes PAX3,

SOX10, MITF, EDN3 and EDNRB were not dramatically affected

at the mRNA level (Table S1), expression of the piebaldism gene

KIT was significantly down-regulated upon loss of YY1 (Table S1

and Figure 2D). It is currently unclear whether the diminished

MALME-3M viability upon loss of YY1 is mediated by

suppression of KIT expression, or the other survival factors. As

demonstrated by immunofluorescence, KIT protein was signifi-

cantly reduced in the residual hair follicle melanocytes (DCT

positive) in P4 TyrCre, yy1f/f mice (Figure S2B). The mRNA levels

of multiple melanocyte differentiation factors TYR, SLC45A2,

MLANA, TRPM1, and GPNMB, were also down-regulated in YY1

knockdown cells (Table S1 and Figure 2D). These melanocyte

differentiation genes are well-known direct targets of MITF [11].

Indeed, MITF knockdown also strongly down-regulated these and

other pigmentation genes (e.g. DCT and SILV, whose MITF

binding sites have been previously reported [21,22]) (Figure 2E

and 2F). KIT has been shown to be a target of MITF in mast cells

[7]. MITF knockdown also reduced the expression of KIT in

MALME-3M melanoma cells (Figure 2F). BCL2, another known

target of MITF [23], was modestly down-regulated in both MITF

and YY1 knockdown MALME-3M cells (Figure S2C).

As knockdown of YY1 did not change MITF protein levels

(Figure 2A), the fact that it significantly affected the levels of many

MITF target genes suggested that YY1 might functionally

cooperate with MITF. To explore this possibility, we performed

expression profiling analysis with MITF knockdown melanoma

cells (Figure 2E). We found that 1241 RefSeq genes showed

significantly reduced expression after MITF knockdown (Table

S1). YY1’s DNA binding sequence was one of the top five motifs

showing the greatest enrichment in open chromatin regions of the

MITF-responsive gene promoters (Materials and Methods, and

Table S2), further strengthening the possibility that YY1 might

cooperate with MITF.

YY1 interacts with MITFTo test whether YY1 and MITF physically interact in a protein

complex, we first co-transfected expression constructs of Flag-

tagged YY1 and HA-tagged M-MITF or a close MiT family

member TFE3 into 293T cells. Flag-tagged YY1 co-immunopre-

cipitated with M-MITF as well as with TFE3 (Figure 3A).

Interaction of TFE3 with E2F3b but not with E2F2 served as

positive and negative controls respectively, as previously described

[24]. Endogenous YY1 also co-immunoprecipitated with endog-

Author Summary

Skin and hair pigmentation is among the most identifiablehuman traits. Disorders of pigment cells, melanocytes,result in multiple hypopigmentation conditions. Here, wedescribed the phenotype of loss of a ubiquitous transcrip-tion factor YY1 in mouse melanocytes, which is reminis-cent of certain human hypopigmentation conditions. Werevealed at a molecular level that YY1 cooperates with amelanocyte-specific transcription factor M-MITF to regu-late survival and pigmentation gene expression. This studyis the first report of YY1 function in melanocyte lineage,and it reveals how a ubiquitous transcription factor gainslineage-specific functions by co-regulating gene expres-sion with a lineage-restricted transcription factor.

YY1 Cooperates with MITF in Melanocytes


enous MITF in MALME-3M cells (Figure 3B). YY1 contains an

N-terminal histidine-rich region (His) flanked by acidic amino

acids (Acidic), a central glycine/lysine-rich region (GK) and C-

terminal zinc fingers [25] (Figure 3C). MITF contains a central

basic helix-loop-helix leucine-zipper domain (b-HLH-Zip) and two

transcription activation domains (TAD) (Figure 3C and reference

therein [10]). Expression constructs encoding full-length or

truncated mutants of YY1 and M-MITF revealed required

binding domains for YY1-MITF complex formation: M-MITF

interacted with full-length as well as the C-terminal domain

(amino acid 251–320) of YY1 (Figure 3D, Figure S3A); YY1

interacted with full-length, N-terminal TAD (amino acid 1–180)

and central b-HLH-Zip (amino acid 181–300) of M-MITF, but

not with C-terminal TAD (amino acid 301–419) (Figure 3E,

Figure S3B). A smaller b-HLH-Zip domain (amino acid 181–264)

of MITF showed a weaker interaction with YY1 compared with

the full length central domain (Figure S3B), suggesting that the

whole b-HLH-Zip domain is important in mediating the strongest

interaction

YY1 cooperates with MITF in gene transcriptionUsing the expression profiling data, we further analyzed the

cooperation between YY1 and MITF. Figure 4A shows the scatter

plot of log fold-change of gene expression in MITF and YY1

knockdown cells relative to that in control cells. The bagged

regression curve (red line) shows a significant association between

the sets of genes co-activated by MITF and YY1, as well as genes

co-repressed by MITF and YY1. We also compared the overlap

between the top ranking differentially expressed genes after MITF

knockdown or YY1 knockdown. Statistical significance is observed

for genes that are either co-repressed or co-activated by MITF and

YY1, but not for genes on which MITF and YY1 have

antagonistic effects (Figure 4B). The statistical significance is seen

to be robust and independent of the number of top ranking

Figure 1. YY1 is required for melanocyte development in vivo. (A) Skin and hair pigmentation phenotype of TyrCre, yy1f/fl in the first (P4, P10)and second (P45) hair cycles. (B) H&E staining of hair follicles from skin sections of TyrCre, yy1f/+ and TyrCre, yy1f/f mice in the first (P4) and second(P38) hair cycles. Arrows point to the hair follicles still containing pigment. (C,D) Immunofluorescence staining of DCT (red) in P4 hair follicles ofTyrCre, yy1f/+ (C) and TyrCre, yy1f/f (D) mice. Skin sections were stained with goat anti-DCT primary antibody and donkey anti-goat Alexa 594secondary antibody. Nuclei were counterstained with DAPI (blue). (E,F) Immunofluorescence staining of DCT (red) and YY1 (green) in P4 hair folliclesof TyrCre, yy1f/+ (E) and TyrCre, yy1f/f (F) mice. Skin sections were double-stained with goat anti-DCT and rabbit anti-YY1 primary antibodies and thendonkey anti-goat Alexa 594 and goat anti-rabbit Alexa 488 secondary antibodies. (G,H) Zoom-in view of the dashed box area in (F). DAPI stain is inblue in (H). (I,J) Immunofluorescence staining of DCT (red) in P38 hair follicles of TyrCre, yy1f/+ (I) and TyrCre, yy1f/f (J) mice. Nuclei were stained withDAPI (blue). (K&L) XGal stain of whole-mount skin sections from P38 TyrCre, yy1f/+, Dct-LacZ (K) and TyrCre, yy1f/f, Dct-LacZ (L) mice.doi:10.1371/journal.pgen.1002688.g001



differentially expressed genes (Figure 4B). Of note, MITF and YY1

knockdown effects correlated for 131 pigmentation-related genes

(Figure 4C).

Although knockdown of endogenous YY1 affected the basal

transcription of multiple melanocyte differentiation genes

(Figure 2D), overexpression of YY1 alone did not affect the

expression of these genes (data not shown). In MALME-3M (high

endogenous M-MITF level) and UACC62 cells (low endogenous

M-MITF level), overexpression of M-MITF by adenovirus

infection was sufficient to induce the transcription of multiple

melanocyte differentiation genes (Figure 4D and 4E, Figure S4).

However knockdown of YY1 inhibited the M-MITF-dependent

transcriptional upregulation of most of these genes except TYR.

These results suggest a dependency of M-MITF-induced tran-

scription on YY1. Moreover this dependency is target specific: M-

MITF depends on YY1 to upregulate the transcription of many

target genes, like SLC45A2, MLANA, GPNMB, SILV, DCT and

TRPM1; for other targets like TYR, although YY1 cooperates with

Figure 2. YY1 is required for melanocyte survival and the expression of melanocyte differentiation markers in vitro. (A,E) Knockdownof endogenous YY1 (A) and MITF (E) in MALME-3M cells. MALME-3M cells were infected with lentivirus carrying YY1 shRNA (yy1shR#1 & #6), MITFshRNA (mitfshR#4 & #5) or control shRNA (shLuc). After overnight infection, cells were selected with puromycin for 3 days. Total RNA and cell lysateswere harvested for mRNA and protein measurements by RT-qPCR and western blotting. mRNA levels were normalized to b-actin (actB). (B) Growthcurve of YY1 knockdown MALME-3M cells. After 3 days of puromycin selection of YY1 knockdown and control cells as in (A), cells were re-seeded at16105 per 6 cm plate. Cell numbers were counted every other day. (C) Growth curve of YY1 knockdown HFM cells. HFM were infected and selectedwith puromycin as in (A). After puromycin selection, cell numbers were counted on days 0, 3, 5, 7. (D,F) mRNA levels were quantitated for KIT andmultiple melanocyte differentiation genes in YY1 (D) and MITF (F) knockdown cells. Error bars represent s.d. of triplicates. *, p,0.05; **, p,0.01(Student t-test).doi:10.1371/journal.pgen.1002688.g002



MITF for its basal transcription (Figure 2D), knockdown of YY1

did not affect M-MITF-dependent transcriptional upregulation

(Figure 4E), suggesting that M-MITF is a dominant factor in

controlling their induction. The mechanistic basis for these

variable dependencies will require further analysis.

To globally identify YY1 target genes in the melanocytic

lineage, we performed a ChIP-seq analysis in MALME-3M

melanoma cells. We obtained 15,940 peaks by using the Skellam

statistic at a p-value cutoff of 1026 (Materials and Methods, and

Table S3). The overlap between recently published MITF binding

sites [12] and our YY1 binding sites is 30% (Figure 4F), higher

than the overlap for c-Myc, which has been previously

documented to interact with YY1 [26]. Figure 4F shows that

apart from some general transcription factors, MITF is the top

differentiation factor whose binding sites significantly overlap with

those of YY1. Gene ontology analysis found that MITF and YY1

co-regulate pathways involving mitochondria biogenesis, cytoskel-

eton, mitosis, as well as pigment granule and melanosome

synthesis (Table S4).

We designed ChIP-qPCR primers at multiple reported MITF

binding sites of the pigmentation genes [11,12], and confirmed

that YY1 co-localized with MITF on the proximal promoter of

TRPM1, MLANA, GPNMB, TYR and DCT (Figure 4G). For

SLC45A2 and SILV, YY1 co-localized with MITF at the 2nd

nearest MITF binding sites [12] (Figure 4G). We obtained 8,899

melanocyte-specific YY1 binding sites by removing the sites that

are found within 5 kb of YY1 ChIP-seq sites in GM12878, K562,

and NT2D cell lines profiled by the ENCODE Consortium. We

found that the nearest YY1 binding site on the KIT gene is

localized in the 7th intron (peak at 56899 bp from the

transcription start site). This YY1 binding site is melanocyte-

specific and has an MITF binding site [12] within 50 bp, as

confirmed by ChIP-qPCR (Figure 4G).

To validate the cooperativity of MITF and YY1 on a target

gene promoter, we utilized a 700 bp upstream promoter region of

TRPM1 fused to a firefly luciferase reporter [27]. There are three

MITF consensus binding E-box sequences (E1, catgtg; E2, catgtg;

E3, cacatg) and one YY1 consensus binding sequence (Y1, gccatc)

Figure 3. YY1 interacts with MITF. (A) Interaction between Flag-tagged YY1 and HA-tagged M-MITF in 293T cells. Total cell lysate of 293T cellstransfected with indicated plasmids was immunoprecipitated with anti-Flag M2 agarose beads. Immunocomplex and lysate input were analyzed bywestern blotting with anti-Flag and anti-HA antibodies. (B) Endogenous protein interaction between YY1 and MITF. Total cell lysate of MALME-3Mwas immunoprecipitated with mouse control IgG (ctlIgG) or mouse anti-MITF monoclonal antibody (C5). Immunocomplex (elute) and lysate inputwere analyzed by western blotting with anti-MITF and anti-YY1 antibodies. (C) Schematic diagrams of YY1 and M-MITF proteins. GK, glycine and lysinerich region; TAD, transcription activation domain; b-HLH-Zip, basic helix-loop-helix leucine zipper. (D) M-MITF interacts with the C-terminal domain(a.a. 251–414) of YY1. (E) YY1 interacts with the N-terminal TAD (a.a. 1–180) and the central b-HLH-Zip (a.a. 181–300) of M-MITF.doi:10.1371/journal.pgen.1002688.g003



Figure 4. YY1 cooperates with MITF in gene transcription. (A) Scatter plot of mean log fold-changes in MALME-3M and UACC62 cells treatedwith MITF shRNA (shMITF) and YY1 shRNA (shYY1) relative to the control (shLuc). The red line is the average of 100 lowess regression curves fitted to100 bootstrap simulations. The cyan curves represent the upper and lower bounds of 1000 lowess curves fitted to the data obtained by randomizingthe x-coordinates of differentially expressed genes after YY1-shRNA. The fact that the observed fit lies well outside the error bounds of randomizeddata in the lower left quadrant shows that YY1 and MITF co-activate a statistically significant number of common target genes. (B) Fisher’s exact testp-values are plotted for the significance of the overlap between the top ranking differentially expressed genes after shMITF and shYY1, where the



within this promoter region, as shown in Figure S5. We mutated

E-box sequences (mut2) or YY1 binding sequence (mut1) and

found that mutation of the YY1 binding sequence modestly, but

significantly reduced reporter activity by 22%, while mutation of

MITF binding sequences dramatically reduced the reporter

activity (Figure S5). While TRPM1 appears to be a melanocyte-

specific gene (also called ‘‘melastatin’’ [27]), these experiments

demonstrated a measurable contribution to its expression by the

ubiquitous factor YY1.

Discussion

In summary, our findings reveal a critical role of YY1 in

melanocytic lineage development and function, as melanocyte-

specific Yy1 conditional knockout mice display complete loss of

hair follicle melanocytes and premature gray hair after the first

hair cycle. For a ubiquitous protein such as YY1 to gain cell type-

specific functions, one of the most frequently adopted strategies is

to interact with additional factors [25]. YY1 has been shown to

directly interact with other ubiquitous factors, Smads, to activate

cardiac development genes [28]. Here, we show that YY1 interacts

with a lineage-specific transcription factor, M-MITF, to activate

critical survival and pigmentation genes in melanocytic cells and

that the transcriptional activity of M-MITF is dependent on YY1

for many target genes. Importantly, we demonstrate that despite

its ubiquitous expression, YY1 acquires cell type-specific functions

by interacting with a lineage-specific transcription factor. Since

YY1 most strongly interacts with the intact b-HLH-Zip region of

M-MITF (Figure 3E), which is present in other non-melanocytic

isoforms of MITF, other isoforms of MITF might also interact

with YY1 and potentially undergo functional effects within

different lineages on the basis of similar biochemical forms of

cooperativity. Novel mechanisms through which MITF and YY1

cooperate to confer survival to the melanocyte lineage are

interesting subjects for future investigation.

Materials and Methods

ReagentsAntibodies used were anti-DCT (D-18), anti-YY1 (H-414) and

anti-c-Kit (H-300) from Santa Cruz Biotechnology, anti-MITF

(C5 mouse monoclonal and rabbit polyclonal) [22], anti-Flag

(F3165, Sigma) and anti-HA (HA.11, Covance). Anti-Flag M2

agarose beads were obtained from Sigma-Aldrich.

Generation and genotyping of TyrCre, yy1f/f miceAll animal work has been conducted according to MGH and

national guidelines. Male TyrCre mouse (Cre transgene is on the X

chromosome) [19] was crossed with yy1f/f female mouse to obtain

TyrCre, yy1f/+ female (F1). TyrCre, yy1f/+ F1 female was then

crossed with yy1f/f male to obtain TyrCre, yy1f/f male (F2).

Genotyping primers are listed in Table S5.

Histology and immunofluorescence stainingMouse skin was fixed in 10% formalin after dissection and

submitted to our histopathology core (Massachusetts General

Hospital) for paraffin embedding, tissue section and H&E staining.

For immunofluorescence staining, paraffin-embedded sections

were washed twice in Xylene and then passed through 100%,

100%, 95% and 80% ethanol and H2O. Antigen retrieval was

performed in EDTA buffer (5 mM Tris-HCl, 1 mM EDTA,

PH 8.0) at 98uC for 20 min followed by cooling for 1 h. After PBS

washing, tissue sections were blocked in 3%BSA/PBS for 1 h and

then incubated with primary antibodies (1:100 dilution) at 4uCovernight. After PBS washing three times, tissue sections were

incubated with fluorescent secondary antibody (1:1000 dilution) at

room temperature for 1 h. Slides were mounted using VECTA-

SHIELD mounting media with DAPI (Vector Laboratories).

Fluorescent images were taken under Zeiss Axio Observer A1

microscope with AxioVision software.

Whole-mount LacZ stainingSkin samples from Dct-LacZ mice were washed sequentially with

PBS and LacZ wash buffer (2 mM MgCl2, 0.01% sodium

deoxycholate, 0.02% Nonidet P40 in PBS PH 7.4). Samples were

then incubated with LacZ solution (0.5 mg/ml XGal, 5 mM

potassium ferricyanide, 5 mM potassium ferrocyanide in LacZ

wash buffer) at 37uC for 24 h. After PBS washing, samples were

fixed with fresh 4% paraformaldehyde/PBS for 10 min at room

temperature. Stained (and fixed) samples were transferred onto

microscope slides and mounted in Fluoromount-G mounting

media (SouthernBiotech).

Construction of YY1 and M-MITF expression plasmidsA plasmid containing cDNA encoding full-length human YY1

was obtained from the American Type Culture Collection

(IMAGE clone ID, 5815774). The cDNA fragments encoding

full-length or truncated YY1 were PCR amplified from IMAGE

clone and inserted into p3XFLAG-CMV vector at EcoRI/BamHI

sites. The cDNA fragments encoding truncated M-MITF were

PCR amplified from pCDNA3-HA-hMi plasmid and inserted into

pCDNA3-HA vector at EcoRI/NotI sites.

MITF and YY1 RNAiLentiviral shRNA vector (pLKO.1) containing MITF and YY1

RNAi sequences were obtained from the Broad Institute RNAi

Consortium (Cambridge, MA). Lentivirus was generated in 293T

cells 72 h post transfection. Cells were infected with lentivirus for

24 h and selected in puromycin for 3 days. The shRNA sequences

are: MITFshRNA#4, CGTGGACTATATCCGAAAGTT (sense);

MITFshRNA#5, CGGGAAACTTGATTGATCTTT (sense);

YY1shRNA#1, GCCTCTCCTTTGTATATTATT (sense) and

YY1shRNA#6, GGGAGCAGAAGCAGGTGCAGAT (sense).

Synthetic siRNA oligos targeting YY1 (siGENOME SMARTpool)

and non-targeting control oligos were obtained from Thermo Fisher

differential expression was ranked by RSA analysis p-values. Statistical significance is observed for genes that are either co-repressed or co-activatedby MITF and YY1, but not for genes on which MITF and YY1 have antagonistic effects. (C) Gene Ontology analysis found 131 genes to play a role inmelanosome function and pigmentation regulation. The heatmap shows the log expression fold-change of those 131 genes after MITF and YY1knockdown. (D,E) Loss of YY1 inhibits M-MITF-dependent transcriptional up-regulation of multiple melanocytic markers. MALME-3M cells (D) orUACC62 cells (E) were transfected with 10 nM of YY1 siRNA (siYY1) or control siRNA (siCTL). After 24 h, cells were infected with adenovirus encodingcDNA of M-MITF or GFP at MOI 500 (D) or 100 (E). Cells were harvested 48 hours post infection. mRNA levels of the different genes were measured byRT-qPCR and normalized to b-actin (actB). Error bars represent s.d. of triplicates. (F) The fraction of transcription factor (TF) binding sites overlappingwith YY1 was computed for 42 TFs mapped by the ENCODE consortium in the K562 cell line (black bar). The overlap between MITF binding sites in501MEL and YY1 binding sites in MALME-3M (red bar) was 30%. (G) Co-localization of YY1 and MITF at the proximal promoter of multiple melanocytedifferentiation markers in MALME-3M cells. ChIP-qPCR primer position relative to the transcription start site is indicated in brackets. Data arenormalized to control IgG ChIP. Error bar represents s.d. of triplicates.doi:10.1371/journal.pgen.1002688.g004



Scientific. Cells were transfected with siRNA using lipidoid reagent

C12-113 and assayed 72 h post transfection.

Lipidoid synthesisLipidoid delivery agent C12-113 was synthesized and charac-

terized as previously described [29]. Briefly, 3 equivalents of 1,2-

epoxydodecane was combined with 1 equivalent of 2,29-diamino-

N-methyldiethylamine (TCI America) in a glass scintillation vial.

Reaction was stirred for 3 days at 90uC. Following synthesis,

reaction mixture was characterized by MALDI-TOF mass

spectroscopy to confirm mass of expected products. Synthesized

material is used in in vitro biological assays without further

purification. Lipidoid was dissolved in 25 mM NaOAc buffer

(pH,5.2) and added to solution of siRNA for complexation.

Real-time quantitative PCRThe total volume of each reaction was 25 ml, including 12.5 ml

26SYBR Green master mix (Bio-Rad), 0.25 ml reverse transcrip-

tase (Qiagen), 1 ml of each primer (10 mM stock) and 100 ng of

total RNA. Reverse transcription was carried out at 48uC for

30 min. Then 40 cycles of PCR reaction were carried out at 95uCfor 15 s and 60uC for 30 s using 7500 Fast Real Time PCR system

(Applied Biosystems). Data were acquired and analyzed with 7500

Fast System SDS software. qPCR primer sequences are listed in

Table S5.

Chromatin immunoprecipitation (ChIP)Cells were fixed by adding formaldehyde to the culture media to

a final concentration of 1% and incubated for 20 min at room

temperature. Cells were harvested by scraping with ice cold PBS

containing protease inhibitor (Roche). Cell pellets were re-

suspended in SDS lysis buffer (1%SDS, 10 mM EDTA, 50 mM

Tris-HCl, pH 8.0), incubated for 10 min on ice, and then

sonicated to reduce DNA length to ,500 base pairs. Samples

were centrifuged to remove debris and then diluted 10 fold in IP

buffer (0.01% SDS, 1.1% TritonX-100, 1.2 mM EDTA,

16.7 mM Tris-HCl, pH 8.0, 167 mM NaCl and protease

inhibitors). To reduce nonspecific background, chromatin solution

was pre-cleared with 80 ml of 50% protein A/G slurry containing

0.25 mg/ml sonicated salmon sperm DNA and 1 mg/ml BSA in

TE (10 mM Tris, 1 mM EDTA, pH 8.0) for 1 h at 4uC.

Antibodies were then added to pre-cleared chromatin solution

and incubated overnight at 4uC. Protein A/G slurry (as used in the

pre-clear step) were added to the sample and incubated for

another 1 h at 4uC. The immuno-complexes were washed

sequentially with buffer I (0.1% SDS, 1% TritonX-100, 2 mM

EDTA, 20 mM Tris-HCl, pH 8.0, 150 mM NaCl), buffer II

(0.1% SDS, 1% TritonX-100, 2 mM EDTA, 20 mM Tris-HCl,

pH 8.0, 500 mM NaCl), buffer III (0.25M LiCl, 1% NP40, 1%

sodium deoxycholate, 1 mM EDTA, 10 mM Tris-HCl, pH 8.0)

and twice with TE. The immuno-complexes were eluted from

beads with 1% SDS in 0.1M NaHCO3 twice for 15 min at room

temperature. Crosslinks were reversed overnight at 65uC. Protein

was digested with proteinase K for 1 h at 55uC. DNA was purified

with QIAquick PCR purification kit (Qiagen). qPCR primers are

listed in Table S5.

Adenovirus infectionAdenoviruses encoding wild-type M-MITF or GFP were

generated as previously described [27]. 26105 cells were plated

in 6-well plates for 24 h. Cells were infected overnight with

concentrated adenoviruses in complete media at MOI 500 for

MALME-3M cells or MOI 100 for UACC62 cells and HFM.

Media was changed the next day and total RNA was harvest with

RNeasy plus mini kit (Qiagen) 48 h post infection.

Expression profilingmRNA expression in the melanoma cell lines MALME-3M and

UACC62 were profiled using Affymetrix U133P2 microarrays.

Each cell line had four samples, corresponding to two experiments

treated with two independent shRNA constructs against MITF

and two controls transfected with shRNA against luciferase. We

also obtained two additional paired samples before and after

siMITF (GSE16249, Gene Expression Omnibus). The data were

normalized using RMA and the latest RefSeq probe mapping to

the reference human genome [30,31]. For each gene g, let xM1,g

and xM2,g denote the fold-changes in shMITF-treated MALME-

3M relative to the average control expression values in MALME-

3M. Similarly denote the fold-changes in UACC62 and

GSE16249 as xU1,g, xU2,g and xG1,g, xG2,g, respectively. In order to

assess the significance of differential expression after knocking

down MITF, we pooled together these 6 fold-changes for all genes

and ranked them in an increasing order, and we then computed

the minimum p-value for the rank distribution of each gene’s fold-

changes by using the hypergeometric test, as was done in the

Redundant siRNA Activity (RSA) analysis [32]. The p-values were

adjusted for multiple hypothesis testing and turned into q-values,

as described in [33]. At a q-value cutoff of 1022, 1241 RefSeq

genes showed significantly reduced expression after MITF

knockdown. A similar RSA analysis was performed for YY1

shRNA.

Motif analysisWe found 814 open chromatin regions within the 1241 MITF-

responsive RefSeq promoters in melanocytes, as recently mapped

by the ENCODE Consortium. We also generated 814 matching

random regions in the human genome. We then scanned the open

chromatin and random regions with TRANSFAC and JASPAR

position-specific scoring matrices (PSSM); the cutoff PSSM scores

were chosen separately for each motif to minimize the binomial p-

value for the over-representation or under-representation of each

motif in the open chromatin regions of MITF-responsive

promoters relative to random sequences.

YY1 ChIP–seqYY1 chromatin-immunoprecipitated DNA was sequenced by

using Illumina Genome Analyzer II, yielding ,15 million

mappable reads. As a control, ,9 million DNA fragments from

randomly sonicated chromatin were also sequenced. Peaks were

detected by using the Skellam distribution as a null model, similar

to the Poisson null model used by MACS [34]. We used a p-value

cutoff of 1026; see Text S1 for further discussion. Regions

containing satellites and rRNAs (ENCODE Duke Excluded

Regions) were filtered out. Normalization of ChIP-seq data is

described in detail in Text S1.

Pathway analysisWe considered the genes down-regulated by both MITF and

YY1 KD at a q-value cutoff of 0.01 and also bound by YY1 within

5 kb of transcriptional start site or in intron (Table S1). Gene

ontology of those genes was analyzed by using DAVID (http://

david.abcc.ncifcrf.gov).

GSK cancer cell line expression analysis954 CEL files were normalized together by using RMA [30]

and the RefSeq CDF [31]. Replicate samples were averaged to



yield summary expression levels for each cell line. Cell lines were

then grouped into cancer subtypes, and the t-test was applied

between each cancer subtype and the rest.

Supporting Information

Figure S1 (A) Immunofluorescence staining of MITF in P4 hair

follicles of TyrCre, yy1f/+ and TyrCre, yy1f/f mice. Skin sections

were stained with rabbit anti-MITF primary antibody and goat

anti-rabbit Alexa 594 secondary antibody. MITF positive

melanocytes were indicated by arrows. (B) Loss of melanoblasts

and differentiated melanocytes in whisker hair follicles of P38

TyrCre, yy1f/f, Dct-LacZ mice. XGal stain of whole-mount whiskers

from P38 TyrCre, yy1f/+, Dct-LacZ and TyrCre, yy1f/f, Dct-LacZ

mice. The distribution of Dct-LacZ+ melanocyte stem cells

(melanoblasts) is indicated by double arrow.

(PDF)

Figure S2 (A) Growth curve of MITF knockdown HFM cells.

Experiment procedure is the same as in Figure 2C. (B)

Immunofluorescence staining of KIT (green) and DCT (red) in

P4 hair follicles of TyrCre, yy1f/+ and TyrCre, yy1f/f mice. Skin

sections were stained with rabbit anti-KIT and goat anti-DCT

primary antibodies, followed by donkey anti-rabbit Alexa 488 and

donkey anti-goat Alexa 594 secondary antibodies. (C) mRNA

expression of BCL2 in MITF and YY1 knockdown MALME-3M

cells. MITF and YY1 were knocked down in MALME-3M cells as

in Figure 2. mRNA level of BCL2 was measured by RT-qPCR

and normalized by beta-actin (actB).

(PDF)

Figure S3 Fine mapping of the interaction regions between M-

MITF and YY1. Experiment procedure is the same as in Figure 3D

and 3E.

(PDF)

Figure S4 mRNA levels of YY1 after siRNA knockdown.

Experiment procedure is the same as in Figure 4D and 4E.

(PDF)

Figure S5 Mutation of MITF binding sites (E-boxes) or YY1

binding site on the TRPMI promoter inhibits luciferase reporter

activity. 700 bp upstream promoter region of TRPM1 was cloned

and fused with a firefly luciferase reporter (Miller AJ, 2004). There

are three MITF consensus binding E-box sequences (E1, catgtg;

E2, catgtg; E3, cacatg) and one YY1 consensus binding sequence

(Y1, gccatc) within this promoter region. E1, E2 and E3 were

mutated as in Miller AJ, 2004. Y1 site was mutated to gctgcc using

QuickChange Site-Directed Mutagenesis kit (Stratagene). 0.2 mg

of wild type (wt) or mutant (mut) firefly reporter constructed was

co-transfected with 1 ng of renila construct into MALME-3M

cells. Luciferase activity was measured by Dual-Luciferase reporter

assay system (Promega). *p,0.05, ***p,0.001.

(PDF)

Table S1 Genes that are down-regulated after MITF and YY1

knock-down at RSA q-value cutoff of 1e-2 and also with a YY1

binding site either within 5 kb of transcription start site or in gene

body.

(XLS)

Table S2 Enriched motifs in the promoters of genes that

respond to MITF shRNA. The TF names show either

TF.TRANSFAC_Matrix_ID or JASPAR matrix names.

(XLS)

Table S3 YY1 bindings locations in MALME-3M. The

coordinates are in HG18.

(XLS)

Table S4 Gene ontology analysis of genes down-regulated by

both MITF and YY1 knockdown at a q-value cutoff of 0.01 and

also bound by YY1 within 5 kb of transcriptional start site or in

intron.

(XLS)

Table S5 Genotyping and qPCR primer sequences.

(DOC)

Text S1 Supplemental methods.

(DOC)

Acknowledgments

We thank Dr. Nunciada Salma for technical advice on ChIP, Dr. Akinori

Kawakami for sharing E2F2 and E2F3b expression plasmids, and

Suprabha P. Devi for assistance with mouse work. We thank all Fisher

lab members for helpful suggestions during the course of this work. We

thank Prof. Yang Shi (Harvard Medical School) for reading and

commenting on the manuscript.

Author Contributions

Conceived and designed the experiments: JL JSS DEF. Performed the

experiments: JL JSS. Analyzed the data: JSS RJAB. Contributed reagents/

materials/analysis tools: T-NTT RH HL KTL RL DGA LL. Wrote the

paper: JL JSS DEF.

References

1. Dessinioti C, Stratigos AJ, Rigopoulos D, Katsambas AD (2009) A review of

genetic disorders of hypopigmentation: lessons learned from the biology of

melanocytes. Exp Dermatol 18: 741–749.

2. Pingault V, Ente D, Dastot-Le Moal F, Goossens M, Marlin S, et al. (2010)

Review and update of mutations causing Waardenburg syndrome. Hum Mutat

31: 391–406.

3. Thomas I, Kihiczak GG, Fox MD, Janniger CK, Schwartz RA (2004)

Piebaldism: an update. Int J Dermatol 43: 716–719.

4. Smith SD, Kelley PM, Kenyon JB, Hoover D (2000) Tietz syndrome

(hypopigmentation/deafness) caused by mutation of MITF. J Med Genet 37:

446–448.

5. Hughes AE, Newton VE, Liu XZ, Read AP (1994) A gene for Waardenburg

syndrome type 2 maps close to the human homologue of the microphthalmia

gene at chromosome 3p12–p14.1. Nat Genet 7: 509–512.

6. Tassabehji M, Newton VE, Read AP (1994) Waardenburg syndrome type 2

caused by mutations in the human microphthalmia (MITF) gene. Nat Genet 8:

251–255.

7. Tsujimura T, Morii E, Nozaki M, Hashimoto K, Moriyama Y, et al. (1996)

Involvement of transcription factor encoded by the mi locus in the expression of

c-kit receptor tyrosine kinase in cultured mast cells of mice. Blood 88:

1225–1233.

8. Giebel LB, Spritz RA (1991) Mutation of the KIT (mast/stem cell growth factorreceptor) protooncogene in human piebaldism. Proc Natl Acad Sci U S A 88:

8696–8699.

9. Fleischman RA, Saltman DL, Stastny V, Zneimer S (1991) Deletion of the c-kit

protooncogene in the human developmental defect piebald trait. Proc Natl Acad

Sci U S A 88: 10885–10889.

10. Levy C, Khaled M, Fisher DE (2006) MITF: master regulator of melanocyte

development and melanoma oncogene. Trends Mol Med 12: 406–414.

11. Hoek KS, Schlegel NC, Eichhoff OM, Widmer DS, Praetorius C, et al. (2008)

Novel MITF targets identified using a two-step DNA microarray strategy.

Pigment Cell Melanoma Res 21: 665–676.

12. Strub T, Giuliano S, Ye T, Bonet C, Keime C, et al. (2011) Essential role of

microphthalmia transcription factor for DNA replication, mitosis and genomicstability in melanoma. Oncogene.

13. Deng Z, Cao P, Wan M, Sui G (2010) Yin Yang 1: A multifaceted protein

beyond a transcription factor. Transcr 1: 81–84.

14. Donohoe ME, Zhang X, McGinnis L, Biggers J, Li E, et al. (1999) Targeted

disruption of mouse Yin Yang 1 transcription factor results in peri-implantationlethality. Mol Cell Biol 19: 7237–7244.

15. Liu H, Schmidt-Supprian M, Shi Y, Hobeika E, Barteneva N, et al. (2007) Yin

Yang 1 is a critical regulator of B-cell development. Genes Dev 21: 1179–1189.



https://www.researchgate.net/publication/8901409_Transcriptional_Regulation_of_the_Melanoma_Prognostic_Marker_Melastatin_TRPM1_by_MITF_in_Melanocytes_and_Melanoma?el=1_x_8&enrichId=rgreq-151a5534-5304-4452-9db2-0e3fb6b24548&enrichSource=Y292ZXJQYWdlOzIyNDkyNjUyOTtBUzoxMDQ3NDU4OTMxMDU2NjVAMTQwMTk4NDc3NTE0OQ==

16. He Y, Dupree J, Wang J, Sandoval J, Li J, et al. (2007) The transcription factor

Yin Yang 1 is essential for oligodendrocyte progenitor differentiation. Neuron

55: 217–230.

17. Wu S, Hu YC, Liu H, Shi Y (2009) Loss of YY1 impacts the heterochromatic

state and meiotic double-strand breaks during mouse spermatogenesis. Mol Cell

Biol 29: 6245–6256.

18. Affar el B, Gay F, Shi Y, Liu H, Huarte M, et al. (2006) Essential dosage-

dependent functions of the transcription factor yin yang 1 in late embryonic

development and cell cycle progression. Mol Cell Biol 26: 3565–3581.

19. Delmas V, Martinozzi S, Bourgeois Y, Holzenberger M, Larue L (2003) Cre-

mediated recombination in the skin melanocyte lineage. Genesis 36: 73–80.

20. Mackenzie MA, Jordan SA, Budd PS, Jackson IJ (1997) Activation of the

receptor tyrosine kinase Kit is required for the proliferation of melanoblasts in

the mouse embryo. Dev Biol 192: 99–107.

21. Yasumoto K, Takeda K, Saito H, Watanabe K, Takahashi K, et al. (2002)

Microphthalmia-associated transcription factor interacts with LEF-1, a mediator

of Wnt signaling. EMBO J 21: 2703–2714.

22. Du J, Widlund HR, Horstmann MA, Ramaswamy S, Ross K, et al. (2004)

Critical role of CDK2 for melanoma growth linked to its melanocyte-specific

transcriptional regulation by MITF. Cancer Cell 6: 565–576.

23. McGill GG, Horstmann M, Widlund HR, Du J, Motyckova G, et al. (2002) Bcl2

regulation by the melanocyte master regulator Mitf modulates lineage survival

and melanoma cell viability. Cell 109: 707–718.

24. Giangrande PH, Hallstrom TC, Tunyaplin C, Calame K, Nevins JR (2003)

Identification of E-box factor TFE3 as a functional partner for the E2F3

transcription factor. Mol Cell Biol 23: 3707–3720.

25. He Y, Casaccia-Bonnefil P (2008) The Yin and Yang of YY1 in the nervous

system. J Neurochem 106: 1493–1502.26. Shrivastava A, Yu J, Artandi S, Calame K (1996) YY1 and c-Myc associate in

vivo in a manner that depends on c-Myc levels. Proc Natl Acad Sci U S A 93:

10638–10641.27. Miller AJ, Du J, Rowan S, Hershey CL, Widlund HR, et al. (2004)

Transcriptional regulation of the melanoma prognostic marker melastatin(TRPM1) by MITF in melanocytes and melanoma. Cancer Res 64: 509–516.

28. Lee KH, Evans S, Ruan TY, Lassar AB (2004) SMAD-mediated modulation of

YY1 activity regulates the BMP response and cardiac-specific expression of aGATA4/5/6-dependent chick Nkx2.5 enhancer. Development 131: 4709–4723.

29. Love KT, Mahon KP, Levins CG, Whitehead KA, Querbes W, et al. (2010)Lipid-like materials for low-dose, in vivo gene silencing. Proc Natl Acad Sci U S A

107: 1864–1869.30. Irizarry RA, Hobbs B, Collin F, Beazer-Barclay YD, Antonellis KJ, et al. (2003)

Exploration, normalization, and summaries of high density oligonucleotide array

probe level data. Biostatistics 4: 249–264.31. Dai M, Wang P, Boyd AD, Kostov G, Athey B, et al. (2005) Evolving gene/

transcript definitions significantly alter the interpretation of GeneChip data.Nucleic Acids Res 33: e175.

32. Konig R, Chiang CY, Tu BP, Yan SF, DeJesus PD, et al. (2007) A probability-

based approach for the analysis of large-scale RNAi screens. Nat Methods 4:847–849.

33. Storey JD (2002) A direct approach to false discovery rates. Journal of the RoyalStatistical Society Series B-Statistical Methodology 64: 479–498.

34. Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, et al. (2008) Model-basedanalysis of ChIP-Seq (MACS). Genome Biol 9: R137.



Documents

YY1 Regulates Melanocyte Development and Function by Cooperating with MITF