476 AJVR,Vol71,No.4,April2010

Recurrent airway obstruction in horses is a common asthma-like pulmonary disease that primarily af-

fects the peripheral respiratory (bronchioles) system of mature horses in all parts of the world.1–3 There are 2 forms of RAO.1 One form is chronic obstructive pulmo-nary disease that develops in horses housed in stables and fed hay during winter months.3 This form is seen most often in northern regions of the United States. The

Transcriptional changes associated with recurrent airway obstruction in affected

and unaffected horses

Changaram S. Venugopal, BVSc, PhD; Luiz Claudio N. Mendes, DVM, PhD; Juliana R. Peiró, DVM, PhD; Susan S. Laborde, MS; Ashley M. Stokes, DVM, PhD;

Rustin M. Moore, DVM, PhD

Objective—Toidentifydifferentiallyexpressedgenesinpulmonarytissuesofhorsesaffectedwithsummerpasture-associatedobstructivepulmonarydisease(SPAOPD),whichisaformofrecurrentairwayobstruction(RAO),comparedwiththoseofunaffectedhorses.Animals—6horseswithSPAOPD-RAOand6unaffected(healthy)horses.Procedures—Horseswereassignedto2groupsonthebasisofmedicalhistory,clinicalscore,andtranspleuralpressure.TotalRNAfromeachofthe5lunglobesofeachofthe6SPAOPD-RAO–affectedhorseswasextractedandpooled.Similarly,totalRNAfromunaf-fected horses was pooled. Differential display (DD) PCR assay was performed, and dif-ferentiallyexpressedbandswerepurifiedandclonedintoaplasmidvector.Plasmidswereextractedfromrecombinantcolonies,andpurifiedDNAwassequenced.GenesofinterestforRAOpathogenesiswereidentified.Real-timePCRassaywasperformedtoconfirmfind-ingsfortheDDPCRassay.Results—18 differentially expressed genes (17 upregulated and 1 downregulated) wereidentified.Threegenesofparticularinterestwerefoundtobealtered(2upregulatedand1downregulated)inhorseswithSPAOPD-RAObyuseofreal-timePCRassay,andthesefindingsmatchedthedifferentialexpressionfoundbyuseoftheDDPCRassay.Conclusions and Clinical Relevance—SPAOPD-RAOinhorsesisamultifactorial,complexdiseaseinvolvingseveralgenes.Upregulatedgenes,particularlyβ2-microglobulin,andthedownregulatedsecretoglobingenecanserveasmarkergenesthatmayhelp to identifySPAOPD-RAOatanearlyage.(Am J Vet Res2010;71:476–482)

other form is SPAOPD that primarily develops during the summer months in grazing horses in the southeast-ern United States.4,5 The pathophysiologic changes for these 2 forms of the disease are similar.6,7 Recurrent airway obstruction can be induced by allergens, such as fungal spores, and proinflammatory agents, such as dust-derived bacterial endotoxins.8,9 Once the disease is initiated, it progresses through various stages, which are often episodic, recurrent, and progressive, and are determined by the host’s response until the affected animal eventually recovers (remission) or reaches ad-vanced stages that lead to death or require the animal to be euthanized. The disease is severely debilitating and

Received December 2, 2008.Accepted April 29, 2009.From the Equine Health Studies Program, Department of Veterinary

Clinical Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA 70803 (Venugopal, Laborde, Stokes); Department of Clinics, Surgery and Animal Reproduction, Sao Paulo State University, UNESP, R Clovis Pestana 793, Aracatuba, SP 16050-680, Brazil (Mendes, Peiró); and Department of Veterinary Clinical Sciences, College of Veterinary Medicine, The Ohio State University, Columbus, OH 43210-1089 (Moore). Dr. Stokes’ present address is the Department of Human Nutrition, Food and Animal Sciences, College of Tropical Agriculture and Human Resources, University of Hawaii, Honolulu, HI 96822.

Supported by the Equine Health Studies Program, School of Veteri-nary Medicine, Louisiana State University. Dr. Mendes was support-ed by a scholarship from CNPq – Brazil (201044/2005-6).

Presented in abstract form at the Experimental Biology Annual Meet-ing, Washington, DC, April–May 2007.

Address correspondence to Dr. Venugopal (cvenugopal@vetmed.lsu.edu).

AbbreviAtionsBLAST Basic local alignment search toolCC Clara cellCCSP Clara cell secretory proteinCT Threshold cycleDD Differential displayDEG Differentially expressed geneFUSE Far upstream elementRAO Recurrent airway obstructionSPAOPD Summer pasture-associated obstructive pulmonary disease

08-12-0391r.indd 476 3/22/2010 9:53:04 AM

AJVR,Vol71,No.4,April2010 477

devastating and is often a career-ending or life-threat-ening condition.

The causes and pathogenesis of RAO are not clear-ly understood. The condition is characterized by airway inflammation, neutrophilia in bronchoalveolar fluid, frequent bronchoconstriction and spasm, hypersecre-tion of mucus, chronic coughing, exercise intolerance, and dyspnea.3,5 Current therapeutic measures for RAO are avoidance of potential causative agents, immuno-therapy if an allergic component is identified, and con-trol of the disease by palliative treatments.

During periods of airway obstruction, horses de-velop airway hyperreactivity (hyperresponsiveness and hypersensitivity) to inflammatory mediators released locally into the airway lumen and across bronchial smooth muscle.1,2 These mediators are re-sponsible for bronchial smooth muscle contraction, increased vascular permeability, increased mucus secretion, and damage to the airway epithelium.1 A positive correlation exists between the intensity of airway hyperreactivity and the quantity of chemi-cal mediators released locally in the lungs.2 Com-monly accepted inflammatory mediators involved in airway disease include histamine, bradykinin, pros-taglandins, leukotrienes, platelet-activating factor, endothelin-1, and neurokinin-A.1,10 It has been sug-gested1 that a wide range of factors, such as charged particles, various forms of dust, fumes, and irritating agents, can induce airway hyperreactivity through overexpression or underexpression of genes for sev-eral endogenous chemical mediators. However, there is a paucity of information regarding changes in pul-monary gene expression for this disease.

Techniques designed to identify DEGs in cells for various physiologic stages or experimental conditions have become pivotal in modern biological investiga-tions.11 The DEG technique is an improvement over the DD PCR assay for isolating DEGs because it yields PCR products that can be detected on agarose gels.12

The purpose of the study reported here was to identify DEGs in pulmonary tissues obtained from horses with naturally acquired SPAOPD-RAO and from healthy horses. The objective of the study was to use DD PCR methods to determine whether any genes would be upregulated or downregulated in pulmonary tissues of SPAOPD-RAO–affected horses, compared with gene expression for unaffected horses.

Materials and Methods

Animals—Twelve horses (6 clinically unaffected [healthy] horses and 6 horses affected with SPAOPD-RAO) were used in the study. All horses were acquired by donation. The 6 healthy horses (2 mares, 3 stallions, and 1 gelding) consisted of 3 Thoroughbreds, 2 Quar-ter Horses, and 1 mixed-breed horse. The 6 SPAOPD-RAO–affected horses (3 mares, 2 stallions, and 1 geld-ing) consisted of 4 Thoroughbreds, 1 Quarter Horse, and 1 mixed-breed horse. Both groups of horses ranged from 10 to 20 years of age. Mean ± SD age of the healthy horses was 15.5 ± 4.3 years, whereas mean age of the SPAOPD-RAO–affected horses was 14.3 ± 3.9 years. The study was approved by the Louisiana State Univer-sity Institutional Animal Care and Use Committee.

Horses were assigned to the respective groups on the basis of medical history, clinical score, and transpleural pressure. The SPAOPD-RAO–affected horses had a history of recurring signs of obstructive pulmonary disease that developed after exposure to pasture during summer months. None of these horses received medications within 7 days prior to assessment, and none had signs of respiratory tract disease other than SPAOPD-RAO.

Transpleural pressure was measured indirectly by use of an esophageal balloon secured over the end of a catheter connected to a pressure transducer interfaced with a polygraph. A 10-cm-long, 3.5-cm-circumference balloon was placed over the end of a 2-m-long, 2-mm (internal diameter) cannula. The balloon was inserted through a lubricated nasogastric tube that was passed into the rostral portion of the esophagus. Once the esophageal balloon was located between the heart and diaphragm, the nasogastric tube was retracted. The bal-loon was inflated with 1.5 mL of saline (0.9% NaCl) solution, and a measurement was obtained during a 3-minute period. Changes in esophageal pressure (peak inspiratory pressure minus peak expiratory pressure) during tidal breathing measured with this system re-flected changes in pleural pressure.

During the initial assessment, SPAOPD-RAO– affected horses were assigned a clinical score deter-mined by use of the following equation9,13:

Clinical score = ([flare of the medial nostril + flare of the lateral nostril]/2) + abdominal lift

Each of the variables in the equation was scored on a scale of 0 to 4; thus, the maximum clinical score was 8. For nostril flare, a score of 0 indicated the nostril had little movement, whereas a score of 4 indicated the nos-tril remained maximally flared throughout the respira-tory cycle. For abdominal lift, a score of 0 indicated that the ventral aspect of the flank had little or no move-ment, whereas a score of 4 indicated the abdominal lift resulted in a visible groove (heave line) that extended cranially to the fifth intercostal space attributable to hy-pertrophy of the external abdominal oblique muscles resulting from an enhanced abdominal component of expiration.

To be included in the SPAOPD-RAO–affected group, it was required that a horse have a history of RAO disease following exposure to summer pasture, a clinical score ≥ 5, and a change in pleural pressure > 15 cm H

2O. Healthy horses had changes in pleural pres-

sure < 10 cm H2O and a clinical score ≤ 4.14

Tissue collection—The horses were euthanized the day after pulmonary function tests were performed and clinical scores were assigned. Horses were eutha-nized by administration of an overdose of pentobarbital sodium (90 mg/kg, IV). Gross postmortem evaluation of the lungs was conducted during their removal from the thoracic cavity to verify and confirm that the health status of the horses and group assignments were accu-rate. Pulmonary tissue samples were collected immedi-ately after the horses were euthanized. Tissue samples were obtained from the central area of each lung lobe (respiratory zone) in each horse. Tissue samples were

08-12-0391r.indd 477 3/22/2010 9:53:04 AM

478 AJVR,Vol71,No.4,April2010

snap frozen with liquid nitrogen and stored at –80°C for later use.

DD PCR assay—Samples were thawed prior to use but were kept on ice during RNA extraction. One sample from each lobe was used for RNA extraction. Standard extraction techniques with a reagenta were used to isolate total RNA from frozen-thawed lung tissue. Total RNA from each of the 5 lobes of each of the 6 SPAOPD-RAO–affected horses was pooled, and total RNA from each of the 5 lobes of each of the 6 healthy horses was pooled (ie, 1 pool/group). Total RNA concentration was determined by use of spectrophotometry and was analyzed for quality by use of agarose gel electrophoresis. The DD PCR assay was performed with a commercially available DEG kitb in accordance with the manufacturer’s instruc-tions. Briefly, first-strand cDNA was synthesized with reagents provided in the DEG kit.b The DD PCR as-say was performed by use of 50 ng of cDNA with the annealing control primer paired with 1 of the 80 ar-bitrary primers. The PCR reaction was performed by use of the following program: 3 minutes at 94°C; fol-lowed by 50°C for 3 minutes and 1 minute at 72°C; followed by 40 cycles at 94°C for 40 seconds, 54°C for 40 seconds, and 72°C for 40 seconds; followed by a final extension at 72°C for 5 minutes. The PCR amplicons were analyzed on 2% agarose gels and de-veloped by use of ethidium bromide. Differentially expressed bands were excised from the gel and puri-fied with a DNA purification kitc performed in accor-dance with the manufacturer’s instructions.

Purified PCR products were cloned by use of a clon-ing kit.d At least 3 colonies resulting from the transfor-mation were analyzed for recombinant plasmids by use of a PCR assay with universal primers. The PCR ampli-cons were analyzed on 1.2% agarose gels and developed by use of ethidium bromide. Plasmids were extracted from the recombinant colonies by use of a commer-

cially available kit.e Purified DNA was sequenced. To confirm the findings of the DD PCR assay, a real-time PCR assay was performed via a real-time PCR system.f

Primers and probes were designed by use of softwareg (Appendix). We used β-glucoronidase as the endog-enous control gene.

A standard curve was constructed from results for equine lung tissues to define the relationship between input cDNA concentration and CT values. To examine genes of interest, cDNA generated in the same manner as described previously for the 6 healthy horses and 6 SPAOPD-RAO–affected horses was used separately. Real-time PCR assay was performed in duplicate reac-tions (20 µL/reaction) in a 384-well plate. Amplifica-tion was performed as follows: 1 cycle at 50°C for 2 minutes and 95°C for 10 minutes and 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. Fold differences between the groups were calculated by use of the ∆∆CT method.

The protocol can be summarized as follows: from the pooled pulmonary tissue RNA of each group, first-strand cDNA was synthesized by reverse transcription by use of dT-ACP1. The DEGs were amplified with arbitrary ACP and dT-ACP2. The PCR products with differential expression were removed from the agarose gel, and their sequences were identified by use of a BLAST. Real-time PCR assay was performed on selected sequences.

Results

Gene expression differed in pulmonary tissues obtained from the SPAOPD-RAO–affected and healthy horses; 88 genes were differentially expressed. Of the 88 genes, 18 were identified by use of a BLAST on sequences contained in the National Center for Biotechnology Information database as potentially important in SPAOPD-RAO (Table 1); the other 70 unknown nucleotide sequences were eliminated

GenBank No.ofbasepairsClone Expression Gene accessionNo. sequenced Homology(%)

25A Upregulated Uridinephosphorylase1 XM_592968 407 87.828A3 Upregulated CystatinC DQ661047 716 84.236A Upregulated Translationelongationfactor1 XM_854805 541 93.037A1 Upregulated Pleckstrinhomologydomain-containing XM_847491 547 94.4and90.6* protein

41A2 Upregulated Solutecarrier XM_532844 521 93.045C Downregulated Secretoglobin AY885562 476 97.8and98.7*46A Upregulated Ferritinlightchain AB175617 712 99.653A Upregulated Insulin-likegrowthfactor-2 ECILGF22 287 10061A Upregulated AnnexinA2 BC013843 665 96.2and87.6*

63A Upregulated Eukaryotictranslationinitiationfactor1A BC008710 640 88.069B Upregulated Majorhistocompatibilitycomplex NM_002124 549 87.8and88.6*72C Upregulated FUSE-bindingprotein–interactingrepressor XM_851947 442 93.175A Upregulated β2-microglobulin X69083 967 98.976B Upregulated Coldshockdomain-containingE1 XM_851743 355 97.8

77B Upregulated Thymosinβ-4 NM_001002885 532 93.8and100*78A Upregulated Kelch-likeECH–associatedprotein1 XM_592838 259 99.283F Upregulated Glucose-6-phosphateisomerase XM_848765 990 89.892F Upregulated Galactoside-bindinglectin NM_002305 227 94.0

*Representsresultsforpercentagehomologybasedonthenumberofidenticalnucleotidesatasite.

Table1—Differentialexpressionofgenesinpulmonarytissuesobtainedfrom6horsesaffectedwithSPAOPD-RAO,comparedwithgeneexpressioninpulmonarytissuesobtainedfrom6healthyhorses.

08-12-0391r.indd 478 3/22/2010 9:53:04 AM

AJVR,Vol71,No.4,April2010 479

from the study. Of the 18 genes identified, 17 were considered upregulated and 1 gene was considered downregulated. The DD PCR gel had strong bands for uridine phophorylase 1 and insulin-like growth factor-2 genes and a faint band for the secretoglobin gene (Figure 1).

Real-time PCR assay was performed for selected genes, such as uridine phophorylase 1 (1.3-fold in-crease), annexin A2 (1.2-fold increase), β2-micro-globulin (1.2-fold increase), and thymosin β-4 (1.3-fold increase), because of the potential importance of these genes during RAO. The major histocom-patability gene primers and probe set did not yield good results. All identified genes were classified cat-egorically on the basis of their potential involvement at various stages of development of SPAOPD-RAO (Table 2). The products of these genes are believed to be involved in protection, defense, mediation of proinflammatory responses, promotion of oxidative stress, protection from oxidative stress, mediation of anti-inflammatory responses, recovery (repair and airway remodeling), protection from mitogenesis, and control of mitogenesis.

Discussion

Analysis of results for the study reported here re-vealed alterations in the expression (upregulation or downregulation) of 18 genes associated with SPAOPD-RAO in horses. The genes identified in this study en-code proteins that have established biological func-tions. On the basis of this information, the genes were categorized into groups with specific functions during various stages in the course of SPAOPD-RAO, including initiation, progression, and finally recovery (remission). Long before an affected horse develops signs of disease, it is likely that there are alterations in gene expression in pulmonary tissues of that animal. These alterations presumably continue as the disease progresses and are carefully controlled via appropriate gene expression by the host’s defense system. Therefore, we expected gene expression to principally reflect the current stage of the disease. Frequent exacerbation of seasonal episodes of disease with intermittent seasonal remission character-izes horses with SPAOPD-RAO.1 During remission after each episode, the horse may appear to be clinically nor-mal, although intermittent recurrent episodes can in-duce chronic airway changes. These chronic changes include repair of airway damage (primarily in the epi- thelium) with subsequent airway remodeling (pri-marily in the airway smooth muscle) characterized by proliferation of airway smooth muscle (mitogenic activity) that leads to peribronchial fibrosis and in-flammation. All these changes lead to progressive and intractable airway obstruction. With each epi-sode, acute components of the disease will be active, such as a release of mediators that leads to a cascade of events, which includes inflammation and severe bronchoconstriction. In this study, all affected horses had a history of SPAOPD-RAO and chronic changes (including airway remodeling) were expected. Gene expression in these horses supported this expecta-tion. The affected horses had signs of airway obstruc-tion as indicated on the basis of the clinical scores and transpulmonary pressure changes.

The speculated functional roles of the genes with altered expression in horses with SPAOPD-RAO in-clude protection, defense, mediation of inflammatory responses, promotion of oxidative stress, protection from oxidative stress, mediation of anti-inflammatory

Figure 1—Agarose gels with results of DD PCR assay per-formed on pulmonary samples obtained from 6 unaffected(healthy) horses and 6 horses affected with SPAOPD-RAO.Gene expression was upregulated for uridine phosphorylase1(clone25A)andinsulin-likegrowthfactor-2(clone53A)anddownregulated for secretoglobin (clone 45C) in SPAOPD-RAO–affected horses, compared with gene expression inhealthyhorses.

Proposedfunctionalrole Gene Expression*

Protection Secretoglobin DownregulatedDefense β2-microglobulin UpregulatedProinflammatoryresponse AnnexinA2,glucose-6-phosphateisomerase UpregulatedPromotionofoxidativestress Kelch-likeECH–associatedprotein1 UpregulatedProtectionfromoxidativestress Ferritinlightchain Upregulated

Anti-inflammatoryresponse Majorhistocompatibilitycomplex UpregulatedRecovery(repairandcell Uridinephosphorylase1,translationelongationfactor1,pleckstrin Upregulatedproliferationinairway homologydomain-containingprotein,solutecarrier,insulin-likeremodeling) growthfactor-2,eukaryotictranslationinitiationfactor1A, thymosinβ-4,andgalactoside-bindinglectin

Protectionduringmitogenesis Coldshockdomain-containingE1 UpregulatedControlofmitogenesis FUSE-bindingprotein–interactingrepressorandcystatinC Upregulated

*Representsgeneexpressionforpulmonarysamplesobtainedfrom6SPAOPD-RAO–affectedhorses,comparedwithgeneexpressionforpulmonarysamplesobtainedfrom6healthyhorses.

Table2—ClassificationofeachidentifiedgeneonthebasisofitsproposedroleinSPAOPD-RAOinaffectedhorses.

08-12-0391r.indd 479 3/22/2010 9:53:05 AM

480 AJVR,Vol71,No.4,April2010

responses, recovery, protection during mitogenesis, and control of mitogenesis.

Although exposure to inhalant allergens is the triggering mechanism for SPAOPD-RAO,15 all exposed horses do not develop SPAOPD-RAO. The genetic com-position predisposes each horse to development of SPAOPD-RAO. Clinically normal horses are protected from development of airway inflammation and obstruc-tion by several proteins secreted by airway epithelium. In the study reported here, the gene encoding secre-toglobin was downregulated in SPAOPD-RAO horses. Secretoglobin (ie, CCSP) consists of CC10, CC16, uteroglobin, and uteroglobin-related protein-1; they block activation of phospholipase A

2 that triggers release

of arachidonic acid from cell membrane phospholipids and leads to production of arachidonic acid metabo-lites, such as leukotrienes and prostaglandins.16,17 Hors-es predisposed to inflammatory diseases of the airways are believed to have low concentrations of CCSP, which thus makes it a marker for detecting animals with a predisposition to airway inflammation.16,18 It has been suggested in studies19,20 in humans that exogenous ad-ministration of CCSP suppresses airway inflammation.

When allergens gain access to the body, gene ex-pression of the host increases to encode proteins (eg, β2-microglobulin) that can combine with the anti-gen to facilitate recognition by T cells or B cells.21 This protein is also a mitogen that plays a role in repair and airway remodeling. It is synthesized by all nucleated cells and serves as a marker for airway inflammation.21

Proinflammatory genes that encode annexin A2 and glucose-6-phosphate isomerase were upregulated in the SPAOPD-RAO–affected horses in this study. An-nexin A2 stimulates synthesis of cytokines and acti-vates macrophages by enhancing activity of mitogen-activated protein kinase and facilitating translocation of transcription factor nuclear factor κB into the nucleus of cells22 for initiation and propagation of inflamma-tion as a response to airway injury. It also stimulates synthesis of tumor necrosis factor-α, interleukin-1, and interleukin-6. Glucose-6-phosphate isomerase induces B-cell–dependent chronic inflammation23 and promotes expression of proangiogenesis genes to prepare tissues for proliferative changes during airway remodeling.24

Oxidative stress, a hallmark of RAO, is caused by an imbalance between the generation of reactive oxy-gen species (ie, superoxide, hydroxyl, and peroxide radicals) and scavenging by endogenous antioxidants. Excess amounts of reactive oxygen species cause exten-sive cellular damage, which includes damage to DNA, lipids, and proteins and is associated with the aging process.25 Incidentally, RAO is common in older horses. Inflammatory mediators, such as endothelin-1, are re-leased during RAO-induced oxidative stress. The gene that encodes kelch-like ECH–associated protein-1, which is a suppressor of the host’s antioxidant protec-tor of oxidative stress (ie, nuclear factor erythroid-2),26 was upregulated in affected horses of the study reported here.

When oxidative stress increases, the body responds with counteractive measures. In the present study, the gene that encodes ferritin light-chain protein (an anti-

apoptotic that acts by reducing peroxide concentra-tions) was upregulated.27,28

When there are inflammatory changes, homeo-static mechanisms of the host counteract the intensity of those changes. In the present study, the gene that encodes the protein major histocompatibilty complex was upregulated. In vertebrates, this protein plays an important role in the immune system and autoimmu-nity. The major histocompatability complex proteins are anti-inflammatory compounds and facilitate (di-rectly or through the action of T cells) disintegration of antigens.29

Recovery includes repair and cell proliferation for airway remodeling. Genes involved in these processes encode uridine phosphorylase-1, translation elonga-tion factor-1, pleckstrin homology domain-containing protein, solute carrier, insulin-like growth factor-2, eu-karyotic translation initiation factor 1A, thymosin β-4, and galactoside-binding lectin. Their functions include synthesizing proteins during airway remodeling30; cata-lyzing critical steps in repair mechanisms31; building cytoskeleton components32; transporting nucleotide sugars to the Golgi apparatus33; modulating proliferation of cells in the lungs34,35; initiating protein synthesis36; modulating proliferation, migration, and differentiation of cells34; producing metalloproteinases for angiogen-esis37; reducing inflammation38; and repairing ulcerated tissues.39 Upregulation of genes in the SPAOPD-RAO–affected horses of the study reported here indicated that the horses already had passed through an acute stage of disease and had fundamental structural changes, which would lead to airway repair and remodeling.

Homeostatic mechanisms of cell proliferation for repair and airway remodeling lead to cellular stress. During this time, there is upregulation of the cold shock domain-containing family of genes. The encoded proteins safeguard cells from stress that results during periods of proliferative activity, a function that has been clearly described during embryogenesis.40

The remaining 2 genes upregulated in the study were FUSE-binding protein–interacting repressor and cystatin C genes. These genes control excessive activity of airway remodeling and prevention of tumor growth. The FUSE-binding protein–interacting repressor gene encodes the Ro ribonucleoprotein–binding protein, which inhibits activation of transcription.41 The cys-tatin C gene encodes cystatin C protein, which is a cys-teine proteinase inhibitor. Several airway-relevant cys-teine proteases and antiproteases are reported42 to play a critical role in maintaining alveolar morphology.

In the study reported here, 18 genes were detected with altered expression in SPAOPD-RAO–affected hors-es; 1 gene was downregulated, and the remaining 17 were upregulated. On the basis of the existing knowl-edge of these genes, we propose a speculative role for these genes in the course of SPAOPD-RAO in horses. These genes are categorized functionally into 9 classes, including roles in protection, defense, mediation of in-flammatory processes, promotion of oxidative stress, protection from oxidative stress, mediation of anti- inflammatory processes, recovery, protection during mitogenesis, and control of mitogenesis. Hopefully, the information reported here will provide new avenues for

08-12-0391r.indd 480 3/22/2010 9:53:05 AM

AJVR,Vol71,No.4,April2010 481

selective breeding, better management, and improved treatment of horses with SPAOPD-RAO.

a. Tri-reagent, Ambion Inc, Austin, Tex.b. SeeGene Inc, Songpa-Gu, Seoul, Korea.c. UltraClean GelSpin DNA purification kit, MoBio Inc, Carlsbad,

Calif.d. pTOPO TA cloning kit, Invitrogen Corp, Carlsbad, Calif.e. QiaPrep Spin Miniprep kit, Qiagen Inc, Valencia, Calif.f. 7900HT Fast real-time PCR system, Applied Biosystems, Foster

City, Calif.g. Primer express software, Applied Biosystems, Branchburg, NJ.

References

1. Robinson NE. Recurrent airway obstruction. In: Equine respira-tory diseases. Lekeux P, ed. Ithaca, NY: International Veterinary Information Service. 2001. Available at: www.ivis.org. Accessed Jun 28, 2006.

2. Buechner-Maxwell V. Airway hyperresponsiveness. Equine respi-ratory diseases. Compend Contin Educ Pract Vet 1993;15:1379–1389.

3. Robinson NE, Derkson FJ, Olszewski MA. The pathogenesis of chronic obstructive pulmonary disease in horses. Br Vet J 1996;152:283–306.

4. Beadle RE. Summer pasture-associated obstructive pulmonary disease. In: Robinson NE, ed. Current therapy in equine medicine. Philadelphia: WB Saunders Co, 1983;512–516.

5. Seahorn TL, Beadle RE. Summer pasture-associated obstructive pulmonary disease. Equine Pract 1994;16(7):39–41.

6. Kaup FJ, Drommer W, Damsch S, et al. Ultrastructural findings in horses with chronic obstructive pulmonary disease (COPD). I: alterations of the larger conducting airways. Equine Vet J 1990;22:343–348.

7. Naylor JM, Clark EG, Clayton HM. Chronic obstructive pul-monary disease: usefulness of clinical signs, bronchoalveolar lavage, and lung biopsy as diagnostic and prognostic aids. Can Vet J 1992;33:591–598.

8. Laan TTJM, Bull S, Pirie S, et al. Evaluation of cytokine produc-tion by equine alveolar macrophages exposed to lipopolysac-charide, Aspergillus fumigatus, and a suspension of hay dust. Am J Vet Res 2005;66:1584–1589.

9. Seahorn TL, Beadle RE, McGorum BC, et al. Quantification of antigen-specific antibody concentrations in tracheal lavage fluid of horses with summer pasture-associated obstructive pulmo-nary disease. Am J Vet Res 1997;58:1408–1411.

10. Venugopal CS, Moore RM, Holmes EP, et al. Comparative re-sponses of bronchial rings to mediators of airway hyperreac-tivity in healthy horses and those affected with summer pas-ture-associated obstructive pulmonary disease. Am J Vet Res 2001;62:259–263.

11. Kim YJ, Kwak CI, Gu YY, et al. Annealing control primer system for identification of differentially expressed genes on agarose gels. Biotechniques 2004;36:424–434.

12. Lee MY, Shin KH, Kim YK, et al. Induction of thioredoxin is required for nodule development to reduce reactive oxygen species levels in soybean roots. Plant Physiol 2005;139:1881–1889.

13. Costa LR, Seahorn TL, Moore RM, et al. Correlation of clinical score, intrapleural pressure, cytologic findings of bronchoal-veolar fluid, and histopathologic lesions of pulmonary tissue in horses with summer pasture-associated obstructive pulmonary disease. Am J Vet Res 2000;61:167–173.

14. Venugopal CS, Polikepahad S, Holmes EP, et al. Endothelin re-ceptor alterations in equine airway hyperreactivity. Can J Vet Res 2006;70:50–57.

15. Verones B, Oortgiesen M. Neurogenic inflammation and partic-ulate matter (PM) air pollutants. Neurotoxicology 2001;22:795–810.

16. Katavolos P, Ackerley CA, Viel L, et al. Clara cell secretary protein is reduced in equine recurrent airway obstruction. Vet Pathol 2009;46:604–613.

17. Yoshikawa S, Miyahara T, Reynolds SD, et al. Clara cell secretory

protein and phospholipase A2 activity modulate acute ventila-tor-induced lung injury in mice. J Appl Physiol 2005;98:1264–1271.

18. Ray R, Choi M, Zhang Z, et al. Uteroglobin suppresses SCCA gene expression associated with allergic asthma. J Biol Chem 2005;280:9761–9764.

19. Mandal AK, Zhang Z, Ray R, et al. Uteroglobin represses aller-gen-induced inflammatory response by blocking PGD2 receptor mediated functions. J Exp Med 2003;199:1317–1330.

20. Reynolds SD, Reynolds PR, Pryhuber GS, et al. Secretoglobins SCGB3A1 and SCGB3A2 define secretory cell subsets in mouse and human airways. Am J Respir Crit Care Med 2002;166:1498–1509.

21. Bethea M, Forman DT. Beta 2-microglobulin: its significance and clinical uses. Ann Clin Lab Sci 1990;20:163–168.

22. Swisher JFA, Khatri U, Feldman GM. Annexin A2 is a soluble mediator of macrophage activation. J Leukoc Biol 2007;82:1174–1184.

23. Bockermann R, Schubert D, Kamradt T, et al. Induction of a B-cell dependent chronic arthritis with glucose-6-phosphate isomerase. Arthritis Res Ther 2005;7:R1316–R1324.

24. Banerjee SK, Young HWJ, Volmer JB, et al. Gene expression pro-filing in inflammatory airway disease associated with elevated adenosine. Am J Physiol Lung Cell Mol Physiol 2002;282:L169–L182.

25. Rice-Evans CA, Gopinathan V. Oxygen toxicity, free radicals and anti-oxidants in human disease: biochemical implications in atherosclerosis and the problems of premature neonates. Es-says Biochem 1995;29:39–63.

26. Itoh K, Wakabayashi N, Katoh Y, et al. Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev 1999;13:76–86.

27. Ryan TP, Krzesicki RF, Blakeman DP, et al. Pulmonary ferritin: differential effects of hyperoxic lung injury on subunit mRNA levels. Free Radic Biol Med 1997;22:901–908.

28. Aung W, Hasegawa S, Furukawa T, et al. Potential role of ferritin heavy chain in oxidative stress and apoptosis in hu-man mesothelial and mesothelioma cells: implications for asbestos-induced oncogenesis. Carcinogenesis 2007;28:2047–2052.

29. Vambutas A, Bonagura VR, Steinberg BM. Altered expression of TAP-1 and major histocompatibility complex class I in laryngeal papillomatosis: correlation of TAP-1 with disease. Clin Diagn Lab Immunol 2000;7:79–85.

30. Pizzorno G, Cao D, Leffert JJ, et al. Homeostatic control of uri-dine and role of uridine phosphorylase: a biological and clinical update. Biochim Biophys Acta 2002;1587:133–144.

31. Hanbauer I, Boja ES, Moskovitz J. A homologue of elongation factor 1γ regulates methionine sulfoxide reductase A gene ex-pression in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 2003;100:8199–8204.

32. Canton DA, Olsten MEK, Kim K, et al. The pleckstrin homology domain-containing protein CKIP-1 is involved in regulation of cell morphology and the actin cytoskeleton and interaction with actin capping protein. Mol Cell Biol 2005;25:3519–3534.

33. Ashikov A, Routier F, Fuhlrott J, et al. The human solute carrier gene SLC35B4 encodes a bifunctional nucleotide sugar trans-porter with specificity for UDP-xylose and UDP-N-acetylglu-cosamine. J Biol Chem 2005;280:27230–27235.

34. Noveral JP, Bhala A, Hintz RL, et al. Insulin-like growth fac-tor axis in airway smooth muscle cells. Am J Physiol 1994;267:L761–L765.

35. Yamashita N, Tashimo H, Ishida H, et al. Role of insulin-like growth factor-1 in allergen-induced airway inflammation and remodeling. Cell Immunol 2005;235:85–91.

36. Chaudhuri J, Si K, Maitra U. Function of eukaryotic translation initiation factor 1A (eIF1A) (formerly called eIF-4C) in initia-tion of protein synthesis. J Biol Chem 1997;272:7883–7891.

37. Malinda KM, Goldstein AL, Kleinman HK. Thymosin beta 4 stimulates directional migration of human umbilical vein endo-thelial cells. FASEB J 1997;11:474–481.

38. Badamchian M, Fagarasan MO, Danner RL, et al. Thymosin beta (4) reduces lethality and down-regulates inflammatory media-

08-12-0391r.indd 481 3/22/2010 9:53:05 AM

482 AJVR,Vol71,No.4,April2010

tors in endotoxin-induced septic shock. Int Immunopharmacol 2003;3:1225–1233.

39. Goldstein AL, Hannappe E, Kleinman HK. Thymosin beta 4: actin-sequestering protein moonlights to repair injured tissues. Trends Mol Med 2005;11:421–429.

40. Lu ZH, Books JT, Ley TJ. Cold shock domain family members YB-1 and MSY4 share essential function during murine embryo-genesis. Mol Cell Biol 2006;26:8410–8417.

41. Matsushita K, Tomonaga T, Shimada H, et al. An essential role of alternative splicing of c-myc suppressor FUSE-bind-ing protein-interacting repressor in carcinogenesis. Cancer Res 2006;66:1409–1417.

42. Takeyabu K, Betsuyaku T, Nishimura M, et al. Cyteine proteinases and cystatin C in bronchoalveolar lavage fluid from subjects with subclinical emphysema. Eur Respir J 1998;12:1033–1039.

Gene Probesequence(5′FAM–BHQ3′) Primersequence(5′–3′)

25 TCTCGGCGCCCGACGTCC ForwardGGCCACTTCATCAAGAAATGC ReverseAACGCTCCCCTTTGAGGCT61A CCACACAGGTACAGCAGCGCCTTCT ForwardGACAGGCTTCAGTCATCCCC ReverseCAAGACACCAAGGGCGACTAC69B AGGACACACAGGACTTCAGCCAACAGG Forward1TCCACCGCAGGAACCAGA Reverse1CGTCATCTACACTTCAACTCAGGAG TGTCCCAGCTTCTC Forward2TGACGACACTCAAAGAAGAACCTT Reverse2CAAGCAGGAAACCTTTTCATGC75A TCTCCTTGTTTGACCTGTGTGGGCAG ForwardTCTTTATAACTCTACTTTGGCCGCTAT ReverseTGCCAGGATCTCCCTCTAG

AppendixPrimersandprobesusedforthereal-timePCRassay.

08-12-0391r.indd 482 3/22/2010 9:53:05 AM