Topological analysis and role of the transmembrane domain in polar targeting of PilS, a Pseudomonas aeruginosa sensor kinase

Molecular Microbiology (2000) 38(4), 891±903

Topological analysis and role of the transmembranedomain in polar targeting of PilS, a Pseudomonasaeruginosa sensor kinase

Julie Ethier and Jessica M. Boyd*

University of Calgary, Microbiology and Infectious

Diseases, 3330 Hospital Drive, NW, Calgary, Alberta,

Canada, T2N 4N1.

Summary

In Pseudomonas aeruginosa, synthesis of pilin, the

major protein subunit of the pili, is regulated by a

two-component signal transduction system in which

PilS is the sensor kinase. PilS is an inner membrane

protein found at the poles of the bacterial cell. It is

composed of three domains: an N-terminal hydro-

phobic domain; a central cytoplasmic linker region;

and the C-terminal transmitter region conserved

among other sensor kinases. The signal that acti-

vates PilS and, consequently, pilin transcription

remains unknown. The membrane topology of the

hydrophobic domain was determined using the lacZ

and phoA gene fusion approach. In this report, we

describe a topological model for PilS in which the

hydrophobic domain forms six transmembrane

helices, whereas the N- and C-termini are cytoplas-

mic. This topology is very stable, and the cytoplasmic

C-terminus cannot cross the inner membrane. We

also show that two of the six transmembrane

segments are sufficient for membrane anchoring

and polar localization of PilS.

Introduction

Pseudomonas aeruginosa is a ubiquitous Gram-negative

bacillus capable of surviving in harsh and nutritionally

scarce environments. P. aeruginosa is also an important

nosocomial and opportunistic pathogen that causes

severe infections in individuals with a compromised

immune system, such as AIDS, cancer, transplant and

burn patients (Van Delden and Iglewski, 1998). Cystic

fibrosis patients are particularly susceptible to chronic,

and eventually fatal, lung infections from P. aeruginosa

(Gilligan, 1991). The pili produced by P. aeruginosa

are the agents principally responsible for adhesion to

epithelial cells, the initial step in the infection process

(Woods et al., 1980). These type IV pili are localized to

one pole of the bacterial cell and are composed of pilin,

the major structural subunit encoded by pilA.

Transcription of pilA is regulated by a two-component

signal transduction system composed of PilS and PilR

(Ishimoto and Lory, 1992; Hobbs et al., 1993; Boyd and

Lory, 1996) and RpoN, or s54, an alternative sigma factor

(Ishimoto and Lory, 1989; Totten et al., 1990). PilS is a

sensor kinase, it is a 59 kDa protein embedded in the

inner membrane (Boyd and Lory, 1996) and retained at

the poles of the cell (Boyd, 2000). PilS can be divided into

three domains or regions based on the current knowledge

of its structure and function. The N-terminal domain from

residues 1 to 174 is highly hydrophobic and is required for

membrane insertion. The central or linker domain from

residues 175 to 296 is predicted to be cytosolic and has

weak homology to PAS domains. PAS domains are found

in sensor proteins from all kingdoms and are identified

based on weak primary sequence similarity (Ponting and

Aravind, 1997; Zhulin et al., 1997). The transmembrane

(TM) and linker domains are necessary to keep PilS at the

cell poles. The C-terminal transmitter domain (residues

297±530) contains all the conserved amino acids char-

acteristic of sensor kinases including the invariant histidine

residue (His-319), which is probably the site of phosphoryl-

ation (Boyd and Lory, 1996). PilR, the response regulator,

is homologous to NtrC. It receives the phosphate from

PilS, binds to four upstream activating sequences in the

pilA promoter region and interacts with RpoN and the

RNA polymerase to initiate pilin transcription (Jin et al.,

1994).

The activating stimulus, which is unknown, is probably

detected via the N-terminal domain, the central linker

region or both. Therefore, a precise determination of

the structure of this region is critical to an understanding

of the signal transduction events. Based on computer

analysis using the programs TOPPRED II (Claros and von

Heijne, 1994) and TMPRED (Hofmann and Stoffel, 1993),

the N-terminal 174 amino acids of PilS are predicted to

form six TM helices (Boyd and Lory, 1996). Although

computer-generated topological models are fairly accu-

rate, they are not flawless and need to be confirmed with

biological approaches. We used the established method

of gene fusions (Hoffman and Wright, 1985; Manoil and

Q 2000 Blackwell Science Ltd

Accepted 13 September, 2000. *For correspondence. E-mail [email protected]; Tel. (11) 403 220 8479; Fax (11) 403 270 2772.

Beckwith, 1986; Manoil et al., 1988; Boyd et al., 1993;

Traxler et al., 1993) to confirm the predicted topology of

PilS. Alkaline phosphatase and b-galactosidase were

used as reporter proteins. Internal helix deletions were

also created to determine the role of the TM domain and,

more specifically, of individual helices on membrane

insertion and polar targeting of PilS. An accurate topological

model of the N-terminus of PilS will provide valuable

information about its function and may give clues to the

nature of the activating signal(s) with which it interacts.

Results

Construction and analysis of the gene fusions

A hydrophobicity profile of PilS was obtained using the

Kyte±Doolittle scale (Kyte and Doolittle, 1982). Six peaks

of hydrophobicity greater than 2.00 were observed,

suggesting the presence of six TM segments (data not

shown). Similar hydrophobicity analysis and secondary

structure predictions were obtained using the computer

programs TOPPREDII (Claros and von Heijne, 1994) and

TMPRED (Hofmann and Stoffel, 1993). A topological model

was predicted that consisted of six TM helices with short

hydrophilic periplasmic and cytoplasmic connecting loops,

in which both N- and C-termini are cytoplasmic; our

proposed model is shown in Fig. 1.

In order to confirm the presence of these six helices and

the predicted topological model of PilS, we constructed a

series of translational fusions of b-galactosidase (LacZ)

and alkaline phosphatase (PhoA) to each of the predicted

connecting loops of PilS and various deletion mutants of

PilS. A lacZ gene missing the first eight codons (including

the start codon) was used as a negative control for b-

galactosidase activity. Similarly, a phoA gene missing its

leader sequence and start codon was used as a negative

control for alkaline phosphatase activity.

Hybrid constructs were carried on the broad-host-range

vector pMMB67 and were expressed from the inducible

tac promoter with the addition of IPTG. We tested the

hybrids in three bacterial strains: the Escherichia coli

lacZ±phoA strain CC118; wild-type P. aeruginosa PAK;

and the in frame pilS deletion mutant PAK-DS2. Western

immunoblotting of whole-cell lysates verified the stable

expression of all the hybrid proteins (data not shown). As

expected, each pair of hybrid proteins, with the exception

of the negative controls, showed contrasting patterns

of activity. Similar patterns of enzymatic activity are

observed in the two strains of P. aeruginosa, although

PhoA activity is consistently higher in wild-type PAK than

in the pilS knock-out. Furthermore, in all cases, the same

patterns of enzymatic activities are observed in E. coli as

in P. aeruginosa, although the values are much lower in E.

coli than in P. aeruginosa even when more IPTG is added

to increase protein expression. This difference in activity

was caused by lower fusion protein expression in E. coli

(as observed by Western blots; data not shown) and not

by a difference in specific activity. Only the results of the

P. aeruginosa experiments are shown.

To determine whether the fusion of the reporter proteins

impaired PilS function, we performed Western blot

analysis with antipilin antibodies to estimate the amount

of pilin produced by strains carrying the PilS±PhoA and

PilS±LacZ fusions. The full-length PilS fusions (C-term±

PhoA and C-term±LacZ) were able to complement fully

the pilS deletion in PAK-DS2 and produce wild-type levels

of pilin (data not shown).

PilS possesses six TM segments

The series of LacZ and PhoA fusions to each of the

predicted cytoplasmic and periplasmic loops was ana-

lysed first. As shown in Fig. 2, fusions of the reporter

proteins to sites in PilS located downstream of the

predicted helices TM1, TM3 and TM5 show a PhoA1/

LacZ2 phenotype, suggesting a periplasmic location of

these fusion sites in both the wild-type and the pilS2

strains. In contrast, a PhoA2/LacZ1 phenotype suggest-

ing a cytoplasmic position is observed for fusions of the

reporters to sites downstream of the predicted helices

TM2, TM4 and TM6, the linker domain and at the C-

terminus of full-length PilS. Figure 1 summarizes these

results in a schematic manner. These results are in

agreement with and confirm the topological model

obtained by computer analysis.

The linker and transmitter regions cannot cross the inner

membrane

To confirm the six TM model further and determine the

effect of helix deletions in PilS membrane insertion, four

other helix deletion hybrid proteins were constructed. This

series of deletion hybrid proteins (referred to as the 529

deletion hybrids; Fig. 3) carries a deletion of one or more

TM helices but retains the complete linker and transmitter

domains. The reporters are fused to the C-terminus of

these PilS deletion mutants (residue 529 of the wild-type

protein). We expected that the deletion of an even number

of helices would not reverse the orientation of the

downstream helices or affect the topological model,

whereas deletion of an odd number of helices would

reverse the orientation of the following TMs and, conse-

quently, move the linker and transmitter regions of PilS

into the periplasm.

As shown in Fig. 3, fusions DTM2±6C, DTM5±6C,

DTM2±4C and DTM4C all present a LacZ1/PhoA2

phenotype, similar to the complete PilS fusions (C-term).

DTM2±6C exhibits moderate PhoA activity, suggesting

892 J. Ethier and J. M. Boyd

Q 2000 Blackwell Science Ltd, Molecular Microbiology, 38, 891±903

that some of the fusion protein can cross the inner

membrane, but we consider this value to be minimal

compared with other constructs that exhibit positive PhoA

activity The values for the DTM2±6±LacZ hybrid are

within the average range for positive LacZ activity of the

other fusions. Therefore, we consider this deletion to be

PhoA2/LacZ1.

The phenotypes observed for the DTM5±6C fusion pair

are expected, as our hypothesis is that deletion of two of

the six helices would not affect the orientation of the

remaining helices or the position of the C-terminus.

However, the phenotype observed for the other three

pairs of fusions contradicts this hypothesis, as the C-

terminus of the proteins remains cytoplasmic despite the

removal of an odd number of helices.

Further study of the amino acid sequence of PilS

revealed the presence of a strong hydrophilic segment

just C-terminal of TM6 (amino acids 175±206). Other

shorter but strong hydrophilic segments are also present

throughout the linker and transmitter domains of PilS. In

order to determine whether these hydrophilic sequences

inhibited transfer of the reporters across the membrane,

another series of six deletion hybrid proteins, referred to

as the 154 deletion hybrids (see Fig. 4), was constructed.

In this series, various individual helices or combinations of

helices were removed, and the reporters were fused to a

site located downstream of TM5 of wild-type PilS. The

removal of TM6 and the hydrophilic linker and transmitter

regions (residues 155±530) negates the possible insertion

inhibitory effect of these domains.

As shown in Fig. 4, deletion of the pairs TM1±2

(DTM1±2) and TM3±4 (DTM3±4) did not change the

periplasmic location of the reporters, compared with the

TM5 fusions, as demonstrated by strong PhoA activity.

Elevated LacZ activity was observed for fusions DTM2±

4±LacZ and DTM4±LacZ compared with TM5±LacZ,

suggesting a cytoplasmic fusion site and an inversion in

the topology. These observations are consistent with our

hypothesis that the removal of an odd number of TM

segments will reverse the topology of helices after the

deletion. However, deletions of TM1 (DTM1) and TM2

(DTM2) did not reverse the topology, as shown by their

high PhoA activity and low LacZ activity.

High LacZ enzymatic activity would be observed if the

hybrid proteins were unable to be inserted efficiently into

the membrane and therefore remained in the cytoplasm

in a soluble form, giving a false interpretation of a

cytoplasmic localization of the fusion site. To ensure

that this was not the case, cell fractionation experiments

were performed on the LacZ fusions showing high

enzymatic activity (Fig. 5). All but two of the LacZ fusions

tested were found solely in the membrane fraction (M

fraction). Fusions TM2 and DTM2±4 were predominantly

found in the M fraction, but a minor band was detected in

Fig. 1. Topological model of PilS as suggested from hydrophobicity and secondary structure prediction analyses. The shaded rectanglerepresents the inner membrane, and the periplasm is on top. The residues shown in a shaded triangle represent the three fusion sitesexhibiting a LacZ2/PhoA1 phenotype, whereas those shown in a shaded hexagon indicate the fusions showing a LacZ1/PhoA2 phenotype.The amino acid number of the fusion site and the name of the fusion is also indicated.

Topology of PilS 893


the soluble fraction (S fraction). This indicated that these

two hybrid proteins, which only possess two TM helices,

did not insert into the inner membrane with the same

efficiency and stability as those constructs with more TM

helices. The efficiency of separation of the M and S

fractions was assessed by probing identical Western

blot membranes of each fraction with antibodies to OprF

(an outer membrane-bound protein) and b-lactamase (a

soluble periplasmic protein). In all cases, segregation of

these two proteins into the M or S fractions was complete,

and there was no evidence of cross-contamination

between the two fractions (data not shown).

Cellular localization of the internal deletion PilS mutants

Recent work in this laboratory (Boyd, 2000) using the

green fluorescent protein (GFP) as a reporter has shown

that PilS is located at the poles of the P. aeruginosa

Fig. 2. Enzymatic activity of PilS±LacZ and PilS±PhoA hybrids. The assays were performed as described in Experimental procedures, and thevalues illustrated represent the mean of at least four separate experiments ^ standard deviation. A schematic representation of the constructsand their names are indicated on the left. TM, transmembrane domain; L, linker; T, transmitter; R, reporter, either b-galactosidase or alkalinephosphatase. A clear circle symbolizes the negative control (reporter gene without start codon). Black rectangles represent the TM helicesand/or domains still present in the various deletions, whereas the clear rectangles represent TM helices and/or domains that have beendeleted in a particular construct. (A) PAK; (B) PAK-DS2.

Fig. 3. Enzymatic activity of the PilS±LacZ and PilS±PhoA 529 deletion hybrids. The assays were performed as described in Experimentalprocedures, and the values illustrated represent the mean of at least four separate experiments ^ standard deviation. A schematicrepresentation of the constructs and their names are indicated on the left. The legend is as for Fig. 2.



bacterial cell. This work also showed that the TM domain

is necessary to anchor the protein to the membrane, but

not sufficient to target the protein to the poles; the linker

domain is required for this event. Furthermore, as long as

the linker domain is present, a heterologous TM domain

can substitute for the PilS TM domain and target the

protein to the poles. Using this same reporter system, we

investigated the role of individual PilS helices in the

anchoring and polar targeting events.

We created a series of PilS±GFP fusions in which

different combinations of helices were removed. These

PilS derivatives carry deletions within the TM domain only,

their linker and transmitter regions are intact and the GFP

is fused to the C-terminus of PilS. The PilS±GFP hybrid

proteins were expressed in P. aeruginosa, and their

cellular location was assessed by fluorescence micro-

scopy (Fig. 6). Four control constructs are shown as well:

pJB712 has all six helices and is polar; pJB733 has no

helices and is soluble; pJB742 has the PilS TM domain

replaced by the MalG protein and is polar; and pJB708

has GFP alone and is soluble (Boyd, 2000). No

differences in cellular location of the protein or fluor-

escence intensity were observed between PAK and

PAK-DS2; therefore, only images of PAK are shown.

Polar localization of PilS was not affected by removal

of TM1 (pJE675), TMs 1 and 2 (pJE673) or TMs 1±4

(pJE672), suggesting that the first helix is not required for

initiation of the membrane insertion process or polar

targeting. This observation also suggests that the last two

TMs of PilS are sufficient for anchoring the protein in the

membrane as well as polar retention. Plasmids pJE674

pJE6713 and pJE671 carry deletions of TM4, TMs 4 and 6

and TMs 3 and 4 respectively; these three PilS derivatives

also retain polar localization. Another mutant, pJE678,

carrying a deletion of TMs 5 and 6 is also polar, but GFP

also diffusely labels the inside of the cell. This suggests

that the removal of the last two helices of the TM domain

causes unstable insertion into the membrane.

The cellular localization of the remaining PilS±GFP

fusions was not as easily evaluated. Six mutants, pJE676,

677, 679, 6710, 6711 and 6712, clearly lose their ability to

drive PilS to the poles and, in fact, appear soluble. Cells

expressing these constructs are diffusely labelled with

GFP throughout the whole cell and are indistinguishable

from cells carrying pJB733. To determine the cellular

Fig. 5. Cell fractionation of the enzymatically active PilS±LacZhybrid proteins. The membrane and soluble fractions of PAKexpressing the various hybrid proteins were separated as describedin Experimental procedures. Western immunoblots of themembrane (A) and soluble (B) fractions were probed with an anti-LacZ antibody. Molecular weight standards are shown on the left,and the stars indicate the position of the hybrid proteins.

Fig. 4. Enzymatic activity of the PilS±LacZ and PilS±PhoA 154 deletion hybrids. The assays were performed as described in Experimentalprocedures, and the values illustrated represent the mean of at least four separate experiments ^ standard deviation. A schematicrepresentation of the constructs and their names are indicated on the left. The legend is as for Fig. 2.



Fig. 6. Epifluorescence microscopy images ofP. aeruginosa PAK expressing the PilS±GFPhybrids. Names and schematic representationof each construct are shown to the right ofeach image. Black rectangles represent theTM helices still present in the variousdeletions, whereas the clear rectanglesrepresent deleted TM segments. Hatchedrectangles represent the MalG protein. Thelinker and transmitter domains, shown asblack perpendicular lines, are maintained inevery construct. The black oval representsGFP. Scale bar � 2 mm.



location of these PilS derivatives, cell fractionation experi-

ments were performed, which clearly show that pJE679,

6710, 6711 and 6712 are completely soluble (Fig. 7).

Fusions pJE676 and 677, although mostly soluble, did

have a small portion in the membrane fraction. Therefore,

removal of TM2, TMs 2±4, TMs 2±6, TMs 4±6 and TM6

greatly affects the membrane insertion processes of PilS.

Discussion

The N-terminal 180 residues of PilS are hydrophobic and

are likely to be involved in recognition of the activation

signal. In order to understand PilS±PilR signal transduc-

tion, it is important to know the membrane topology of this

portion of the molecule. The computer programs TOPPREDII

(Claros and von Heijne, 1994) and TMPRED (Hofmann and

Stoffel, 1993) predict that this region forms six TM

segments with the N- and C-termini in the cytoplasm. In

order to confirm this predicted topology, three series of

translational gene fusions were engineered.

In the first series of fusions, the reporter genes lacZ and

phoA were fused to sites in pilS corresponding to each of

the predicted loops as well as to the junction between the

linker and transmitter domains and to the next to last

amino acid of the mature protein. Data from these fusions

(Fig. 2) confirms the model of PilS predicted by theoretical

computer analysis. Thus, the topology of PilS consists of

a cytoplasmic N-terminus followed by six TM helices

joined by very short connecting loops, followed by a large

cytoplasmic domain comprising the linker and transmitter

domains (Fig. 1). Our model also complies with the

positive-inside rule, which states that the positively

charged residues arginine and lysine are more prevalent

in cytoplasmic than in periplasmic segments (von Heijne,

1986). Indeed, a total of eight Arg and Lys are found in the

cytoplasmic loops (excluding the linker and transmitter

regions), whereas only one Lys is present among the

three periplasmic loops. Our fusions do not allow us to

determine the exact beginning and end of each helix but,

based on an average helix length of 20 amino acids and

the hydrophobic characteristic of individual amino acids,

we believe our model to be accurate.

The implications of this topology to PilS function are

profound. The TM domain is fully contained within the

inner membrane, and the cytosolic and periplasmic loops

are very short, which suggests that the signal with which it

interacts may also be membrane bound. There are of

course other possibilities: the signal may be soluble and

may bind to a deep cleft formed by the TM helices, or

perhaps the first and third periplasmic loops that we

predict to be 13 and eight residues long, respectively, may

be able to bind to a periplasmic protein and initiate the

signal cascade.

This same topology of six TM helices in the N-terminus

followed by a linker and a transmitter is also likely for a

small family of other bacterial sensor kinases including:

PilS of Myxococcus xanthus (Wu and Kaiser, 1995), LytS

of Staphylococcus aureus (Brunskill and Bayles, 1996),

PehS of Ralstonia solanacearum (Allen et al., 1997) and

DivJ of Caulobacter crescentus (Ohta et al., 1992).

Interestingly, DivJ has recently been shown to be a

polar protein (Wheeler and Shapiro, 1999).

The second and third series of fusions were con-

structed with the purpose of confirming the orientation of

the helices and to determine the effects of helix deletions

on membrane insertion. Typically, if a protein has an even

number of TM helices, its N- and C-termini are on the

same side of the membrane, whereas an uneven number

dictates that the N- and C-termini are on opposite sides.

We deleted various combination of PilS TM helices and

asked whether the fusions were still membrane bound

and whether the positions of the reporters had changed.

In the 529 series, the LacZ and PhoA reporters were

fused to the C-terminus of PilS. With all four of these

deletions, their reporters were cytoplasmic no matter how

many helices remained. In contrast, the orientation of the

reporters of the 154 series could be reversed (Fig. 4). In

this series, the reporters were fused after TM5, which is

normally periplasmic but, if an uneven number of helices

proximal to TM5 are deleted, the locations of the reporters

are reversed. Of the six 154 series fusions tested, the

only exception was DTM1, which was periplasmic despite

having four helices. This construct is missing the

Fig. 7. Cell fractionation of the non-polar PilS±GFP hybrid proteins.The membrane and soluble fractions of PAK expressing the varioushybrid proteins were separated as described in Experimentalprocedures. Western immunoblots of the membrane (A) andsoluble (B) fractions were probed with an anti-GFP antibody.Molecular weight standards are shown on the left, the stars indicatethe position of the hybrid proteins and the arrow indicates theposition of the GFP degradation product.



N-terminal leader sequence as well as the first TM helix,

and TOPPREDII predicts that its new N-terminus is

periplasmic. Therefore, its N- and C-termini are both on

the same side of the membrane.

The reason that the 529 fusion series cannot move the

reporters to the periplasm is probably that the hydrophilic

linker and transmitter domains, absent in the 154 deletion

hybrids, serve as translocation blockers. Lee et al. (1989)

have reported that multiple sequences in the b-galacto-

sidase protein act together to block translocation of the

protein across the inner membrane. Although we have not

attempted to identify the specific stop transfer sequence,

PilS does have a strong hydrophilic sequence just distal to

the last TM helix, and there are other shorter stretches of

hydrophilic amino acids throughout the linker and trans-

mitter domains. As noted elsewhere (Bibi et al., 1991;

Ehrmann and Beckwith, 1991; Calamia and Manoil, 1992;

Gafvelin and von Heijne, 1994), the native topology of a

protein is fairly resistant to sequence modifications. This

is supported by our results with PilS whose topology is

dependent on more than just the easily identifiable

transmembrane helices and includes other more subtle

determinants.

All these gene fusions were analysed in wild-type P.

aeruginosa PAK, the pilS deletion mutant PAK-DS2, as

well as in E. coli CC118 (lacZ2phoA2). Only the P.

aeruginosa results are shown. pilS is not well expressed

in E. coli, and the enzymatic activities of the fusion

proteins reflect this reduced expression and are lower in

this species. Despite this, in all cases, the phenotypes

from the two species were identical, which indicates that

the mechanism of PilS insertion into the membranes of

E. coli and P. aeruginosa are identical and there are no

insertion processes specific to P. aeruginosa. Further-

more, the number and orientation of the helices and polar

localization were identical in the two P. aeruginosa

strains, indicating that the chromosomally encoded wild-

type PilS did not affect the topology of heterologous

fusions.

The only differences between the two P. aeruginosa

strains was that PhoA enzymatic activity was consistently

elevated in PAK compared with PAK-DS2 (Figs 2±4).

Expression levels are not the cause of this difference, as

Western immunoblots do not show variations in hybrid

protein expression between the two P. aeruginosa strains.

Therefore, it seems that PhoA is more efficiently

translocated into the periplasm or is more stable in the

wild-type strain than in a pilS knock-out. It is unlikely that

PilS itself directly affects PhoA translocation, but it may

regulate the expression of other genes involved in protein

translocation or protein stability. These gene products

would of course be absent in a pilS knock-out. In support

of this, PilS and PilR have recently been implicated in the

regulation of a gene encoding a protein that may have a

similar role to DsbA in the formation of disulphide bonds

in periplasmic proteins (P. D. Free, C. B. Whitchurch and

J. S. Mattick, personal communication; Free, 2000). The

lack of this protein could have a detrimental effect on the

stability of periplasmic proteins with disulphide bonds

such as PhoA.

We have shown previously that PilS was localized to

the poles of P. aeruginosa and that the TM and linker

domains were required for this localization (Boyd, 2000).

In this work, we investigated whether individual helices

were more important for polar localization than others.

Using a fluorescent microscope, we examined a series of

GFP-tagged constructs with intact linker and transmitter

domains but missing various TM helices (Fig. 6). Half the

constructs showed discrete polar labelling, whereas the

other half showed diffuse soluble labelling. None showed

the lateral labelling indicative of membrane insertion with

non-polar targeting.

The intact TM domain is therefore not required for polar

localization, and any combination of helices that allows

proper membrane insertion will also allow the protein to be

targeted to the poles. This result is not unexpected, as we

had shown previously that we could replace the six TM

helices of PilS with a heterologous membrane protein

(MalG) and still retain polar localization (pJB742; Boyd,

2000).

The fact that the removal of the first, the first two or

the first four TMs does not affect membrane integration of

the protein suggests that PilS insertion into the membrane

is a non-sequential event and that each signal peptide

segment (TM1, TM3 or TM5) can initiate membrane

insertion independently (Ehrmann and Beckwith, 1991;

Calamia and Manoil, 1992).

It is not clear why some PilS±GFP fusions are

membrane bound, whereas others are soluble; however,

we can make a few generalizations. First, an even

number of helices favours efficient membrane insertion

and polar retention; secondly, TM1 and TM2 are not as

important for membrane insertion as TM5 and TM6. TM1

is not as strong a topological determinant as the others,

because it contains an arginine residue that interferes

with membrane insertion (Calamia and Manoil, 1992),

whereas TM5 is ranked as the strongest candidate for a

membrane-spanning segment by TOPPREDII.

For reasons that are not clear, GFP tends to reduce

membrane insertion efficiency. This is best demonstrated

by fusions to the first TM helix. By itself the poorly

hydrophobic first helix is able to direct the PhoA and LacZ

fusions to the membrane and to translocate the reporters

across the membrane into the periplasm (fusions TM1;

Fig. 2). When the linker and transmitter are included

(DTM2±6C), the fusions are still membrane bound, but

the reporters are not as efficiently transported into the

periplasm, as shown by lower alkaline phosphatase and



higher b-galactosidase activities (Fig. 3.). Interestingly,

when GFP is the reporter, DTM2±6C is mostly soluble

(pJE676; Figs 6 and 7). This disparity also holds for other

fusions, most notably the DTM2±4C LacZ and PhoA

fusions, which are mostly membrane bound with their

reporters in the cytosol (Figs 3 and 5) but, as a GFP

fusion (pJE6710), it is soluble (Figs 6 and 7). We did not

separate the soluble fractions further, so we do not know

whether the soluble GFP fusions are periplasmic or

cytoplasmic but, because of the stop-transfer sequences

in the linker and transmitter, it is unlikely that they could

cross the inner membrane. We can only speculate that

some aspect of b-galactosidase, perhaps tetramer for-

mation, stabilizes these fusions and helps to maintain

them in the membrane. GFP is monomeric and would not

form these large complexes.

To conclude, the membrane topology of the P.

aeruginosa transcriptional regulator PilS was determined

using LacZ and PhoA translational fusions. Six transmem-

brane helices anchor the protein into the inner membrane

with both the N- and C-termini remaining in the cytoplasm.

The topology is identical in both P. aeruginosa and E. coli.

The cytoplasmic localization of the C-terminus of PilS is

very stable and is not affected by TM helix deletions.

Analysis of internal helix deletions suggests that two TMs

are sufficient for anchoring PilS into the inner membrane.

Any PilS±GFP construct that is stably inserted into the

membrane is also retained to poles; therefore, polar

localization depends on proper and efficient membrane

insertion and not on specific individual helices.

Experimental procedures

Bacterial strains and plasmids

The bacterial strains and plasmids used in this study aredescribed in Tables 1 and 2 and Figs 2±4 and 6. Bacteriawere grown in Luria broth (LB). The following antibioticswere used: ampicillin (100 mg ml21) for E. coli; carbenicillin(150 mg ml21) and streptomycin (200 mg ml21) for P. aeru-ginosa. IPTG was also added when required.

DNA manipulations

Standard recombinant DNA techniques were used (Sambrooket al., 1989). Plasmid DNA was isolated by the alkaline lysismethod using the QIAprep Spin miniprep kit (Qiagen).Enzymes were purchased from Gibco BRL.

Mutagenesis of pilS

Mutations were introduced by a polymerase chain reaction(PCR)-based method or using the QuikChange site-directedmutagenesis kit from Stratagene. Plasmid pJB315 was usedas the DNA template for PCR mutagenesis. Using thismethod, BamHI restriction sites were introduced separately

at five different locations within the pilS gene (after aminoacids 99, 154, 177, 304 and 529). PCR amplification wasperformed using a primer that binds to the vector backbone(no. 27: TAATACGACTCACTATAGGG) and a custommutagenesis primer (sequence available upon request).The amplification products were then digested with EcoRIand BamHI, and the resulting truncated pilS fragments wereligated into the cloning vector pUCP22. A KpnRBS linkercontaining the KpnI restriction site (underlined) and aribosome binding site (in bold) (no. 13: AATTGACCTCTGG-TACCAGAGGTC) was introduced into the EcoRI site ofthese five constructs in order to change the EcoRI site to aKpnI site and introduce a more favourable ribosome bindingsite upstream of the PilS start.

The KpnI±BamHI pilS fragment from pJE621, correspond-ing to amino acids 1±529, was then subcloned into pBlue-script SKII1 to create pJE640, the template for theQuikChange site-directed mutagenesis protocol. Using theQuikChange method, BglII restriction sites were introducedwithin the pilS gene at five locations (amino acids 49, 75, 123,177 and 304). This technique was performed as described inthe instruction manual provided by the manufacturer. AnEcoRIATG linker containing the EcoRI restriction site (under-lined) and an ATG start codon (in bold) (no. 19: GATCCAT-GAATTCATG) was then introduced into the newly createdBglII restriction site in three of the five constructs to introducean ATG start codon at amino acids 49, 75 and 123 of thenative protein.

Construction of the pilS internal deletions

The entire series of deletions was created by replacing afragment of pilS corresponding to a particular number of TMhelices with a shorter fragment from another plasmid. Forexample, to create the deletion DTM2±4C (deletion of aminoacids 50±123), the KpnI±BglII fragment was removed from aconstruct with the BglII site after helix 1 and inserted usingthe same sites into a plasmid with the BglII site after helix 4.This removed the existing 386 bp KpnI±BglII fragment(corresponding to residues 1±123, TMs 1±4) and replacedit with a164 bp fragment corresponding to residues 1±49(TM1). The resulting plasmid now carries a deletion ofresidues 50±123 or TMs 2, 3 and 4.

Using the PCR-based mutagenesis method describedpreviously, a BamHI site was introduced at the locationcorresponding to amino acid 154 of the native protein in sixdeletion mutants of pilS to create the 154 deletion hybrids.The PCR amplification products obtained were digested withKpnI and BamHI or EcoRI and BamHI, and the digestedproducts were inserted into pBluescript. The KpnRBS linkerwas introduced into the EcoRI site of these plasmids.

Construction of the reporter vectors and fusion proteins

The reporter vectors pJE608, pJE609 and pJE670 arederivatives of the low-copy, broad-host-range vectorpMMB67EH (FuÈrste et al., 1986). This vector contains lacIq,the lac repressor, to allow transcriptional control from its tacpromoter. Plasmid pJE608 contains the promoterless lacZgene missing its first eight amino acids from pMC1871



Table 1. Strains and plasmids used in this study.

Strain or plasmid Relevant traitsa Source or reference

E. coliCC118 araD139 D(ara-leu)7697 DlacX74 phoA20 galE galK rspE rpoB argEam recA1 C. ManoilJM109 recA1 supE44 endA1 hsdR17 gyrA96 relA1 thi D(lac-proAB) F 0[traD36 proAB1 lacIq lacZDM15] Stratagene

P. aeruginosaPAK Wild type D. BradleyPAK DS2 In frame deletion of pilS, StR Boyd and Lory (1996)

PlasmidspMMB67EH ApR, broad-host-range cloning vector, IncQ, lacIq, ptac FuÈrste et al. (1986)pBluescript SKII1 ApR, phagemid cloning vector StratagenepUCP22 ApR, GmR, broad-host-range cloning vector H. SchweizerpSL1180 ApR, superlinker phagemid Pharmacia BiotechpMS501 phoA lacking its export signal sequence Strom (1992)pMC1871 Promoterless lacZ Pharmacia BiotechpJB315 pilS and pilR in pBluescript SKII1 Boyd (2000)pJB713 gfp mutant 2 in pCR2.1 with BamHI site upstream of ATG start J. BoydpJB712 Full-length pilS fused to gfp at C-terminus in pMMB67EH Boyd (2000)pJB733 pilS linker and transmitter domains fused to gfp in pMMB67EH Boyd (2000)pJB742 malG replaces transmembrane domain in pJB712 Boyd (2000)pJB708 gfp mutant 2 in pMMB67EH Boyd (2000)pJE621 Full-length pilS in pUCP22, KpnRBS linker inserted in the EcoRI site This studypJE640 Same as pJE621 in pBluescript SKII1 This studypJE608 lacZ lacking its first 8 amino acids with ptac in pMMB67EH This studypJE609 phoA without its signal sequence with ptac in pMMB67EH This studypJE670 gfp mutant 2 in pMMB67EH with in frame BamHI site, used for cloning PilS±GFP fusions This study

a. ApR, GmR and StR, resistance to ampicillin, gentamicin and streptomycin respectively.

900

J.

Eth

ier

and

J.

M.

Boyd

Q2000

Bla

ckw

ell

Scie

nce

Ltd

,M

ole

cula

rM

icro

bio

log

y,

38,

891

±903

(Pharmacia Biotech). The gene was removed from pMC1871as a BamHI fragment and ligated into the BamHI and BglIIrestriction sites of pSL1180 (Pharmacia Biotech). The genewas then removed from this intermediate construct andligated into pMMB67EH with BamHI and XbaI. PlasmidpMS501 (Strom, 1992) was used as the source of phoA tocreate pJE609. First, a 1.4 kb fragment was removed frompMS501 by digestion with BstEII and NheI, blunting bothends and religating. Then, the 1.7 kb fragment containingPhoA lacking its export signal sequence was removed andinserted in pMMB67EH with BamHI and HindIII. Similarly, gfpwas removed from pJB713 and inserted in pMMB67EH withBamHI and HindIII to create pJE670. These three reportervectors possess a unique BamHI site at the N-terminus of thereporter gene that allows us to fuse pilS and its derivatives tothe reporter using either KpnI or EcoRI at the 5 0 end andeither BamHI or BglII at the 3 0 end of the pilS fragment.

Alkaline phosphatase and b -galactosidase assays

Alkaline phosphatase and b-galactosidase enzymatic assayswere performed according to the methods of Miller (1972)and Manoil (1991) respectively. Bacterial cells (either P.aeruginosa or E. coli) were grown overnight in LB with theappropriate antibiotic without IPTG. The next day, thecultures were diluted 1:50 in fresh media containing IPTG(0.1 mM for P. aeruginosa and 1 mM for E. coli) and allowedto grow until the cultures reached a cell density (OD600) of

0.4±0.6. The enzyme assays were then performed on 1 mlof these cultures. Results are reported as Miller units (LacZ)or PhoA units and are the average of at least fourexperiments ^ standard deviation.

Cell fractionation

LB broth supplemented with carbenicillin was diluted 1:100from an overnight bacterial culture grown in LB withcarbenicillin. After 1 h of growth at 378C, IPTG was addedto 0.1 mM, and incubation at 378C was resumed and allowedto proceed overnight. The 200 ml overnight cultures wereharvested, and the cell pellet was washed in 50 mM Tris-HCl(pH 8.0), 10 mM MgCl2. The washed cells were resuspendedin 4 ml of the same buffer. DNase I and RNase I were addedto a final concentration of 50 mg ml21 each; lysozyme wasalso added to 500 mg ml21. Cells were sonicated at 30±50%intensity for six cycles of 15 s each and then incubated atroom temperature for 30 min. A low-speed centrifugation(10 min at 10 000 g) was performed to remove unlysed cellsand cell debris. The supernatant was then centrifuged at100 000 g for 1 h. The supernatant (soluble fraction) wastransferred to a clean tube, and the pellet (membranefraction) was resuspended in 4 ml of Tris-HCl (pH 8.0),10 mM MgCl2. Both fractions were centrifuged again at100 000 g for 1 h. The supernatant of the soluble fractionwas kept as the S fraction, and the pellet of the membranefraction was resuspended in 4 ml of the same buffer and kept

Table 2. Amino acid sequence modificationsa in PilS caused by the deletions and fusions.

Fusion name N-terminal modifications Internal modifications C-terminal modifications

TM 1 None None L V H P49 D P V V/LTM 2 None None P S R Q75 D P V V/LTM 3 None None A G G G99 D P V V/LTM 4 None None R G R I123 D P V V/LTM 5 None None N H Y V154 D P V V/LDTM 1 M D L F52 H V None Same as TM5DTM 1±2 M D L P78 I F None Same as TM5DTM 2 None L V H P49 D L P78 I F Same as TM5DTM 2±4 None L V H P49 D L V126 I A Same as TM5DTM 3±4 None P S R Q75 D L V126 I A Same as TM5DTM 4 None A G G G99 D L V126 I A Same as TM5TM6 None None L R R Q177 D P V V/LLinker None None Q A Q Q304 D P V V/LC-term None None P R K L529 D P V/MDTM2±6C None L V H P49 D L T180 E T Same as C-termDTM5±6C None R G R I123 D L T180 E T Same as C-termDTM2±4C None L V H P49 D L V126 I A Same as C-termDTM4C None A G G G99 D L V126 I A Same as C-termDTM3±6C None P S R Q75 D L T180 E T P R K L529 D P M SDTM4±6C None A G G G99 D L T180 E T Same as TM 2CDTM6C None N H Y V154 D L T180 E T Same as TM 2CDTM2C None L V H P49 D L P78 I F Same as TM 2CDTM3±4C None P S R Q75 D L V126 I A Same as TM 2CDTM4/6C None A G G G99 D L V126 I A ¼ Same as TM 2C

N H Y V154 D L T180 E TDTM1C M D L F52 H V None Same as TM 2CDTM1±2C M D L P78 I F None Same as TM 2CDTM1±4C M D L V126 I A None Same as TM 2CDTM1±6C M Q177 E Q None Same as TM 2CMalG M A M V Q P S I Q G D L T180 E T Same as C-term

a. The residues in bold result from the introduction of BamHI (G GAT CC) and BglII (A GAT CT) restriction sites. Residues from MalG are markedby a double underline. The first two amino acids of the reporter enzymes are underlined (LacZ, Val Val; PhoA, Val Leu; GFP, Met Ser).



as the M fraction. Ten microlitres of each fraction was dilutedin 15 ml of the same buffer and 25 ml of 2 � reducing dye (3%SDS, 20% glycerol, 5% b-mercaptoethanol, 100 mM Tris-HCl, pH 8.0, 0.01% bromophenol blue) and boiled for 10 min.Ten microlitres of the samples was loaded on SDS±polyacrylamide gels for electrophoresis. Proteins wereelectroblotted onto a nitrocellulose membrane. The mem-brane was incubated overnight with the appropriate primaryantibody. Anti-b-lactamase, anti-b-galactosidase and anti-alkaline phosphatase antibodies were purchased from 5 0 to3 0, anti-OprF antibodies were a kind gift from R. E. W.Hancock at the University of British Columbia, and anti-GFPantibodies were from L. Berthiaume at the University ofAlberta. After sufficient washing in Tris-buffered saline (TBS),the membrane was incubated with the appropriate secondaryantibody for 1 h and washed in TBS before detection with theLumiGLO chemiluminescent substrate kit (Kirkegaard andPerry Laboratories).

Microscopy

Bacteria were grown and prepared for microscopy asdescribed previously (Boyd, 2000) with minor modifications.Briefly, an overnight culture grown in LB with 150 mg ml21

carbenicillin was diluted 1:50 into fresh media with 0.1 mMIPTG and grown for 3 h. After the cultures had beenincubated overnight at 48C, they were mounted and imaged.One millilitre of culture was resuspended in 100 ml of PBS,20 mM MgCl2. Washed cells (35 ml) were applied topolylysine-coated coverslips for 5±10 min and the excessrinsed off. The coverslips were mounted on microscopeslides with Mowiol (Calbiochem).

Acknowledgements

We would like to thank W. Hutchins and M. Surette for criticalreading of this manuscript. This work was supported by aUniversity of Calgary Endowment Award and a MedicalResearch Council of Canada Operating Grant. J.E. wassupported by a University of Calgary GRS and GTA.

References

Allen, C., Gay, J., and Simon, B.L. (1997) A regulatory locus,pehSR, controls polygalacturonase production and othervirulence functions in Ralstonia solanacearum. Mol Plant±Microbe Interact 10: 1054±1064.

Bibi, E., Verner, G., Chang, C.-Y., and Kaback, H.R. (1991)Organization and stability of a polytopic membrane protein:deletion analysis of the lactose permease of Escherichiacoli. Proc Natl Acad Sci USA 88: 7271±7275.

Boyd, D., Traxler, B., Jander, G., Prinz, W., and Beckwith, J.(1993) Gene fusion approaches to membrane proteintopology. Soc Gen Physiol Ser 48: 23±37.

Boyd, J.M. (2000) Localization of the histidine kinase PilS tothe poles of Pseudomonas aeruginosa and identification ofa localization domain. Mol Microbiol 36: 153±162.

Boyd, J.M., and Lory, S. (1996) Dual function of PilS duringtranscriptional activation of the Pseudomonas aeruginosapilin subunit gene. J Bacteriol 178: 831±839.

Brunskill, E.W., and Bayles, K.W. (1996) Identification andmolecular characterization of a putative regulatory locusthat affects autolysis in Staphylococcus aureus. J Bacteriol178: 611±618.

Calamia, J., and Manoil, C. (1992) Membrane proteinspanning segments as export signals. J Mol Biol 224:539±543.

Claros, M.G., and von Heijne, G. (1994) TopPred II: animproved software for membrane protein structure predic-tions. Comput Appl Biosci 10: 685±686.

Ehrmann, M., and Beckwith, J. (1991) Proper insertion of acomplex membrane protein in the absence of its amino-terminal export signal. J Biol Chem 266: 16530±16533.

Free, P.D. (2000) An investigation of the PilS and PilR signaltransduction regulatory system in P. aeruginosa. DoctoralThesis, The University of Queensland.

FuÈrste, J.P., Pansegrau, W., Frank, R., Bloecker, H., Scholz,P., Bagdasarian, M., and Lanka, E. (1986) Molecularcloning of the plasmid RP4 primase region in a multi-host-range tacP expression vector. Gene 48: 119±131.

Gafvelin, G., and von Heijne, G. (1994) Topological `frustra-tion' in multispanning E. coli inner membrane proteins. Cell77: 401±412.

Gilligan, P.H. (1991) Microbiology of airway disease inpatients with cystic fibrosis. Clin Microbiol Rev 4: 35±51.

von Heijne, G. (1986) The distribution of positively chargedresidues in bacterial inner membrane proteins correlateswith the trans-membrane topology. EMBO J 5: 3021±3027.

Hobbs, M., Collie, E.S., Free, P.D., Livingston, S.P., andMattick, J.S. (1993) PilS and PilR, a two-componenttranscriptional regulatory system controlling expression oftype 4 fimbriae in Pseudomonas aeruginosa. Mol Microbiol7: 669±682.

Hoffman, C.S., and Wright, A. (1985) Fusions of secretedproteins to alkaline phosphatase: an approach for studyingprotein secretion. Proc Natl Acad Sci USA 82: 5107±5111.

Hofman, K., and Stoffel, W. (1993) TM pred±Prediction ofTransmembrane Regions and Orientation. [WWW docu-ment]. URL http://www.ch.embnet.org/software/TMPRED_form.html

Ishimoto, K.S., and Lory, S. (1989) Formation of pilin inPseudomonas aeruginosa requires the alternative sigmafactor (RpoN) of RNA polymerase. Proc Natl Acad Sci USA86: 1954±1957.

Ishimoto, K.S., and Lory, S. (1992) Identification of pilR whichencodes a transcriptional activator of the pilin gene inPseudomonas aeruginosa. J Bacteriol 174: 3514±3521.

Jin, S., Ishimoto, K.S., and Lory, S. (1994) PilR, a transcriptionalregulator of piliation in Pseudomonas aeruginosa, binds toa cis-acting sequence upstream of the pilin gene promoter.Mol Microbiol 14: 1049±1057.

Kyte, J., and Doolittle, R.F. (1982) A simple method fordisplaying the hydropathic character of a protein. J Mol Biol157: 105±132.

Lee, C., Li, P., Inouye, H., Brickman, E.R., and Beckwith, J.(1989) Genetic studies on the inability of beta-galactosidaseto be translocated across the Escherichia coli cytoplasmicmembrane. J Bacteriol 171: 4609±4616.

Manoil, C. (1991) Analysis of membrane protein topologyusing alkaline phosphatase and beta-galactosidase genefusions. Methods Cell Biol 34: 61±75.



Manoil, C., and Beckwith, J. (1986) A genetic approach toanalyzing membrane protein topology. Science 233: 1403±1408.

Manoil, C., Boyd, D., and Beckwith, J. (1988) Moleculargenetic analysis of membrane protein topology. TrendsGenet 4: 223±226.

Miller, J.H. (1972) Experiments in Molecular Genetics. ColdSpring Harbor, NY: Cold Spring Harbor Laboratory Press.

Ohta, N., Lane, T., Ninfa, E.G., Sommer, J.M., and Newton,A. (1992) A histidine protein kinase homologue required forregulation of bacterial cell division and differentiation. ProcNatl Acad Sci USA 89: 10297±10301.

Ponting, C.P., and Aravind, L. (1997) PAS: a multifunctionaldomain family comes to light (letter). Curr Biol 7: R674±R677.

Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989)Molecular Cloning, a Laboratory Manual. Cold SpringHarbor, NY: Cold Spring Harbor Laboratory Press.

Strom, M.S. (1992) Analysis of determinants of pilusbiogenesis in Pseudomonas aeruginosa. Doctoral Thesis,University of Washington.

Totten, P.A., Lara, J.C., and Lory, S. (1990) The rpoN geneproduct of Pseudomonas aeruginosa is required for

expression of diverse genes, including the flagellin gene.J Bacteriol 172: 389±396.

Traxler, B., Boyd, D., and Beckwith, J. (1993) The topologicalanalysis of integral cytoplasmic membrane proteins. JMembr Biol 132: 1±11.

Van Delden, C., and Iglewski, B.H. (1998) Cell-to-cellsignaling and Pseudomonas aeruginosa infections.Emerg Infect Dis 4: 551±560.

Wheeler, R.T., and Shapiro, L. (1999) Differential localizationof two histidine kinases controlling bacterial cell differentia-tion. Mol Cell 4: 683±694.

Woods, D.E., Straus, D.C., Johanson, W.J., Berry, V.K., andBass, J.A. (1980) Role of pili in adherence of Pseudomo-nas aeruginosa to mammalian buccal epithelial cells. InfectImmun 29: 1146±1151.

Wu, S.S., and Kaiser, D. (1995) Genetic and functionalevidence that Type IV pili are required for social glidingmotility in Myxococcus xanthus. Mol Microbiol 18: 547±558.

Zhulin, I.B., Taylor, B.L., and Dixon, R. (1997) PAS domainS-boxes in Archaea, Bacteria and sensors for oxygen andredox. Trends Biochem Sci 22: 331±333.



Documents

Topological analysis and role of the transmembrane domain in polar targeting of PilS, a Pseudomonas aeruginosa sensor kinase