The Glucocorticoid ReceptorInteracting Protein 1 (GRIP1)Localizes in Discrete Nuclear FociThat Associate with ND10 Bodiesand Are Enriched in Components ofthe 26S Proteasome

Christopher T. Baumann, Han Ma, Ronald Wolford,Jose C Reyes*, Padma Maruvada, Carol Lim†, Paul M. Yen,Michael R. Stallcup, and Gordon L. Hager

Laboratory of Receptor Biology and Gene Expression (C.T.B., R.W.,J.C.R., C.L., G.L.H.)National Cancer InstituteNational Institutes of HealthBethesda, Maryland 20892-5055

Molecular Regulation & Neuroendocrinology Section (P.M., P.M.Y.)Clinical Endocrinology BranchNational Institute of Diabetes, Digestive and Kidney DiseasesNational Institutes of HealthBethesda, Maryland 20892

Department of Pathology (H.M., M.R.S.)University of Southern CaliforniaLos Angeles, California 90033

The glucocorticoid receptor interacting protein-1(GRIP1) is a member of the steroid receptor coac-tivator (SRC) family of transcriptional regulators.Green fluorescent protein (GFP) fusions weremade to full-length GRIP1, and a series of GRIP1mutants lacking the defined regulatory regions andthe intracellular distribution of these proteins wasstudied in HeLa cells. The distribution of GRIP1was complex, ranging from diffuse nucleoplasmicto discrete intranuclear foci. Formation of thesefoci was dependent on the C-terminal region ofGRIP1, which contains the two characterized tran-scriptional activation domains, AD1 and AD2. Asubpopulation of GRIP1 foci associate with ND10s,small nuclear bodies that contain several proteinsincluding PML, SP100, DAXX, and CREB-bindingprotein (CBP). Association with the ND10s is de-pendent on the AD1 of GRIP1, a region of the pro-tein previously described as a CBP-interacting do-main. The GRIP1 foci are enriched in componentsof the 26S proteasome, including the core 20S pro-teasome, PA28a, and ubiquitin. In addition, the ir-reversible proteasome inhibitor lactacystin in-

duced an increase in the total fluorescenceintensity of the GFP-GRIP1 expressing cells, dem-onstrating that GRIP1 is degraded by the protea-some. These findings suggest the intriguing possi-bility that degradation of GRIP1 by the 26Sproteasome may be a key component of its regu-lation. (Molecular Endocrinology 15: 485–500, 2001)

INTRODUCTION

Nuclear hormone receptors (NHRs) are a large familyof ligand-activated transcriptional regulators that in-clude more than 50 distinct proteins (1). Typically,NHRs activate transcription of their target genes inresponse to specific ligand agonists. Ligand bindinginduces a conformational change within the receptor,facilitating binding of one or more nuclear receptorinteracting proteins (2). The steroid receptor coactiva-tors (SRCs) are a family of nuclear receptor interactingproteins and include SRC1 (3), GRIP1 (glucocorticoidreceptor interacting protein 1)/TIF2 (transcriptional in-termediary factor 2) (4, 5), and AIB1 (amplified in breastcancer 1)/ACTR (activator of thyroid and retinoic acidreceptors)/RAC3 (receptor-associated coactivator 3)(6–8). These proteins are highly homologous transcrip-

0888-8809/01/$3.00/0Molecular Endocrinology 15(4): 485–500Copyright © 2001 by The Endocrine SocietyPrinted in U.S.A.

485

tion factors with several conserved functional do-mains, including an N-terminal basic helix-loop-helix(bHLH)-PAS domain, a CREB-binding protein (CBP)interaction domain (AD1), a C-terminal activation do-main (AD2), a Q-rich region, and several LXXLL boxesthat are involved in nuclear receptor binding (9, 10).

The mechanism by which the SRCs potentiate tran-scription from the NHRs has been the focus of intensestudy (2, 7, 9, 11–14). The accepted model is that theSRCs act as bridging proteins. In this role, the ligand-bound NHRs bind to and recruit the SRCs to a targetpromoter (2, 4, 7, 15–17). The SRCs, in turn, interactwith and recruit additional proteins to the hormone-responsive promoter (7, 11, 18). To date, a number ofproteins have been found to interact with SRCs. Thehistone acetyltransferase CBP and its homolog p300interact with AD1 (19, 20). Additionally, recent studieshave found two proteins that interact with AD2,CARM1 (21) and mZac1 (22). CARM1 is a proteinmethyltransferase that can methylate histone H3 invitro. Therefore, the recruitment of proteins capable ofposttranslational modification appears to be a majorway in which the SRCs potentiate NHR transcription.In addition, several of the SRCs, including SRC-1 (23)and ACTR (7), have been shown to be histone acetyl-transferases themselves, allowing for yet anothermechanism by which the SRCs activate transcriptionthrough the NHRs.

The activities of NHRs are regulated at several lev-els, including ligand binding and posttranslationalmodifications (24–26). Recently, changes in the intra-cellular distribution of the NHRs has also been shownto be an important component of their regulation (27–35). In stark contrast, little is known about the regula-tion of the SRCs. As a starting point for the study ofSRC regulation, the intracellular distribution of GRIP1was studied in living cells by constructing green fluo-rescent protein (GFP)-fusions to full-length GRIP1 anda panel of GRIP1 deletion mutants. We have found thatin a subpopulation of cells, GFP-GRIP1 localizes indiscrete nuclear foci, the formation of which was de-pendent on the C-terminal AD2 region. A subset ofthese foci associated with the promyelocytic leukemiagene product (PML)- and CBP-containing ND10 do-mains in an AD1-dependent manner. Furthermore, allof the foci are enriched in components of the 26Sproteasome, and the addition of an inhibitor of the 26Sproteasome induced an increase in the total cellularfluorescence of the GFP-GRIP1 expressing cells.These observations have allowed us to speculate thatthe activity of GRIP1 may, in part, be modulated by theubiquitin-dependent proteasome pathway.

RESULTS

Intracellular Distribution of GRIP1

To study the intracellular distribution of GRIP1, theGFP was fused to the N terminus of full-length GRIP1

(GFP-GRIP1; Fig. 1A). GFP-GRIP1 was expressed inHeLa cells and found to be the predicted molecularmass of 190 kDa (160 kDa for GRIP1 1 30 kDa forGFP; Fig. 1B). In addition, GFP-GRIP1 was fully com-petent to activate GR-dependent transcription from amouse mammary tumor virus (MMTV)-luciferase re-porter (Fig. 1C). When expressed in HeLa cells, GFP-GRIP1 localized within the nucleus and was excludedfrom nucleoli (Fig. 2A). In the majority of cells, GFP-GRIP1 was found in a diffuse nucleoplasmic distribu-tion (Fig. 2A, left panel). However, in a fraction of cells(10–20%) GFP-GRIP1 localized in discrete intranu-clear foci, either with (Fig. 2A, center panel) or without(Fig. 2A, right panel) a diffuse nucleoplasmic back-ground. Within a given population of cells, the numberof these foci ranged from 10–15 to hundreds per cell.The percentage of cells in which GRIP1 accumulatedin foci remained unchanged when the amount of trans-fected GFP-GRIP1 expression vector varied from 10ng to 10 mg (data not shown). Additionally, no corre-lation was observed between the total fluorescenceintensity of an individual cell and the presence or ab-sence of foci, indicating that the focal accumulation ofGFP-GRIP1 was not simply an artifact of overexpres-sion. Treatment of cells with dexamethasone or 9-cis-retinoic acid, agonists for the glucocorticoid re-ceptor and retinoic X receptor, respectively (both ofwhich are expressed in HeLa cells), had no effect onthe intracellular distribution of GFP-GRIP1 (data notshown), suggesting that the distribution was indepen-dent of nuclear receptor binding. Similar foci wereseen when GFP-GRIP1 was expressed in mousemammary adenocarcinoma cell line 1471.1 (C. T. Bau-mann, and G. L. Hager, unpublished observations) andnormal human fibroblasts (A. Ishov and G. Maul, per-sonal communication), demonstrating that the ob-served distribution of GFP-GRIP1 was not unique toHeLa cells. To ensure that the GFP tag was not alteringthe distribution of GRIP1, an hemagglutinin (HA)-tagged GRIP1 was expressed in HeLa cells and local-ized by indirect immunofluorescence against the hem-agglutinin (HA) epitope (Fig. 2B). HA-GRIP1 was foundin both diffuse and focal distributions as was observedfor the GFP-tagged variant, demonstrating that theGFP moiety had no observable effect on the intracel-lular distribution of GRIP1. Analysis of the distributionof endogenous GRIP1 was hampered by the inabilityof the currently available GRIP1/TIF2 antibodies torecognize either the endogenous GRIP1 or a tran-siently expressed protein (data not shown).

To further characterize the intracellular distributionof GFP-GRIP1, cells were sequentially extracted withdetergent, high salt, and DNase I (Fig. 2C). The dif-fusely distributed GFP-GRIP1 was lost upon the firstCSK detergent extraction (Fig. 2C, top row), indicatingthat this pool of GFP-GRIP1 was freely soluble withinthe nucleoplasm. In contrast, the focal accumulationsof GRIP1 were resistant even to DNase I treatment(Fig. 2C, bottom row), demonstrating that the GFP-

MOL ENDO · 2001 Vol. 15 No. 4486

GRIP1 foci associate with an insoluble, nonchromatincomponent of the nucleus.

The C Terminus of GRIP1 Is Essential forFoci Formation

GRIP1 is a large protein with several defined functionaldomains (Fig. 1) (4). To determine which region ofGRIP1 was responsible for foci formation, GFP fusionswere made to a series of GRIP1 mutants (Fig. 3, A–E).The N-terminal bHLH-PAS region is the most highlyconserved region among members of the SRC family(36). However, deletion of this domain (DbHLH-PAS)had no observable effect on the intranuclear distribu-tion of the chimera (Fig. 3A). Similarly, the intranucleardistribution of nrbIIm1nrbIIIm, a GRIP1 mutation thatdoes not interact with GR (37), was also unchanged as

compared with the full-length protein (Fig. 3B). There-fore, interactions with GR do not appear to be essen-tial for GRIP1 to localize to foci, which is in agreementwith the lack of effect dexamethasone had on theintracellular distribution of the chimera (data notshown). The C-terminal region of GRIP1 contains twowell defined activation domains, AD1 and AD2 (20, 21).Deletion of AD1 (DAD1) had a dramatic effect on theintracellular distribution of GFP-GRIP1, with a loss ofnearly all foci (Fig. 3C). In a few cells (;10%), a smallnumber of foci were found, although always in thecontext of a diffuse nucleoplasmic background (Fig.3C, left panel). Deletion of the C-terminal region ofGRIP1 (DAD2), which deletes both AD2 and the Q-richdomain, resulted in a complete loss of foci formation(Fig. 3D), indicating that this region of the protein isessential for foci formation. Deletion of both AD1 and

Fig. 1. Schematic and Functional Activity of GFP-GRIP1A, Schematic representation of GFP-GRIP1 with the defined functional domains shown. bHLH-PAS is the basic helix-loop-helix

Per-ARNT-SIM domain; NID is the nuclear receptor interaction domain containing three LXXLL motifs; AD1 is the activationdomain 1 (also the CBP interaction domain); Q represents the Q-rich region; and AD2 is the activation domain 2. B, Western blotanalysis of GFP-GRIP1 and GFP-TRAM1. HeLa cells were mock transfected (lane 1) or transfected with pEGFP-GRIP1 (lane 2)or pEGFP-TRAM1 (lane 3). GFP fusions were detected with an anti-GFP antibody (CLONTECH Laboratories, Inc.) in both theGFP-GRIP1 and GFP-TRAM1 lanes (upper band at ;195 kDa). Lower band is a nonspecific band typically seen with this specificantibody under these conditions. C, Activity of GFP-GRIP1 fusion construct. pSG5-HA-GRIP1 or pEGFP-GRIP1 was transfectedinto HeLa cells with the pLTRLuc plasmid, and the activity of the endogenous glucocorticoid receptor was monitored (seeMaterials and Methods). Results are plotted as the fold induction induced by ligand agonists with and without GRIP1. Data shownare representative of at least three independent experiments.

Association of GRIP1 Foci and the 26S Proteasome 487

Fig. 2. Intranuclear Distribution and Nuclear Retention of GFP-GRIP1A, Confocal images of the representative distributions of GFP-GRIP1 in living cells. GFP-GRIP1 localizes in a diffuse

intranuclear distribution in approximately 80% of cells (left panel) and in discrete intranuclear foci in the remaining 20% (middle

MOL ENDO · 2001 Vol. 15 No. 4488

AD2 (DAD1 1 DAD2) also resulted in a complete lossof foci (Fig. 3E). However, in many cells expressingGRIP1 DAD1 1 DAD2, the fusion was found to localizewithin the nucleoli (Fig. 3E, right panel), although thesignificance of this observation is unclear. Together,these results demonstrate that the C-terminal regionof GRIP1 plays an important role in foci formation.

A Subset of GFP-GRIP1 Foci Associates with theND10 Domains

Based on the size and number of the GFP-GRIP1 foci,we hypothesized that they may be associated withND10s (reviewed in Refs. 38 and 39), small nuclearsubstructures containing at least 10 proteins. To de-

Fig. 3. Intranuclear Distribution of GFP-GRIP1 Mutants in HeLa CellsRepresentative images of the five GFP-GRIP1 mutants (A–E) used in this study. A schematic of each mutant is located directly

above each set of images. bHLH-PAS is the basic helix-loop-helix Per-ARNT-SIM domain, NID is the nuclear receptor interactiondomain containing three LXXLL motifs, AD1 is the activation domain 1 (also the CBP interaction domain), Q represents the Q-richregion and AD2 is the activation domain 2.

and right panels). B, Intranuclear distribution of HA-tagged GRIP1 determined by indirect immunofluorescence. HA-GRIP1 wasfound in both diffuse (left panel) and focal (right panel) distributions. C, Association of the GFP-GRIP1 foci with an insolublenuclear fraction. GFP-GRIP1 expressing cells were sequentially extracted with detergent (CSK, top panel), high salt (Extraction,middle panel), and DNase I (DNase I, lower panel). Left column shows the localization of GFP-GRIP1 and right column shows thestaining pattern of chromatin (DAPI). Note the loss of chromatin after DNase I treatment.

Association of GRIP1 Foci and the 26S Proteasome 489

Fig. 4. Association of GFP-GRIP1 with ND10 DomainsGFP-GRIP1-expressing HeLa cells were fixed in paraformaldehyde and the intranuclear localization of the ND10s was

determined by indirect immunofluorescence against PML. For A and C, the left panel (green) is the GFP-GRIP1 vector, the center

MOL ENDO · 2001 Vol. 15 No. 4490

termine whether the observed GFP-GRIP1 foci wereassociated with ND10s, GFP-GRIP1 expressing HeLacells were fixed and the intranuclear localization of theND10s was determined by indirect immunofluores-cence against PML; a clear correlation was observed(Fig. 4A). Each ND10 was associated with a GFP-GRIP1 focus, although not every GFP-GRIP1 focusassociated with an ND10 (i.e. there were more GRIP1foci than ND10s). Careful analysis of the two struc-tures revealed that they do not completely colocalize;rather they lie adjacent to each other (Fig. 4B). How-ever, due to the resolution limits of light microscopy, itis not possible to determine whether the two foci arephysically associated by this technique and is beyondthe scope of this study.

Next, the ability of the GRIP1 mutants describedabove to localize with the ND10s was investigated.Both DbHLH-PAS and nrbIIm1nrbIIIm localize withthe ND10s in a manner similar to that of wild-typeGFP-GRIP1 (Fig. 4C; DbHLH PAS and nrbIIm 1nrbIIIm). GFP-GRIP1DAD1, which formed fewer fociper cell than full-length GRIP1, did not localize with the

ND10s (Fig. 4C; DAD1). Finally, GFP-GRIP1DAD2 andGFP-GRIP1DAD11DAD2 were studied. Although nei-ther of these GRIP1 mutants form foci, the ND10s ofthese cells were still intact (Fig. 4C; DAD2 and DAD1 1D AD2), demonstrating that the nuclear architecturewas still intact in these cells. Together, these resultssuggest that there are two classes of GRIP1 foci: thosethat localize with the ND10 and those that do not.Furthermore, AD2 is necessary for formation of allGRIP1 foci, and the AD1 region of GRIP1 appears tobe necessary for the formation of the ND10-localizedfoci but may be at least partially dispensable for theother class of foci.

The results with DAD1 suggested that AD1 mayinteract with some components of the ND10. Previ-ously, LaMorte et al. (40) showed that CBP is a com-ponent of the ND10. Furthermore, we have demon-strated that AD1 is a CBP interaction domain (20).Therefore, CBP may recruit the GRIP1 foci to theND10s through AD1. To confirm that, in our system,CBP localized within the ND10s, the distribution ofCBP was followed by indirect immunofluorescence

Fig. 5. CBP Localizes with the GFP-GRIP1 FociA, Nontransfected HeLa cells were fixed with paraformaldehyde and the distribution of PML (left panel) and CBP (middle panel)

was detected by indirect immunofluorescence as described in Materials and Methods. The overlay of the two images is shownin the right panel. B, GFP-GRIP1 localizes adjacent to CBP. GFP-GRIP1 (left panel) and endogenous CBP (middle panel) wereidentified. The overlay is shown on the right.

panel (red) shows PML, and the right panel is the overlay of the two. In the overlays, yellow indicates regions of overlap betweenGRIP1 and PML. A, Wild-type GRIP1. B, Expanded view of region indicated in overlay of A. C, The five GFP-GRIP1 mutants usedin this study.

Association of GRIP1 Foci and the 26S Proteasome 491

Fig. 6. GRIP1 Foci Are Enriched in Ubiquitin and Components of the ProteasomeA, GFP-GRIP1 (left column) expressing HeLa cells were fixed in paraformaldehyde, and the intranuclear localization of several

components of the proteasome was detected by indirect immunofluorescence (middle column). Antibodies used were: PA28a,

MOL ENDO · 2001 Vol. 15 No. 4492

(Fig. 5). As expected, CBP localized to the ND10s (Fig.5A) and associated with the GRIP1 foci (Fig. 5B). To-gether, these results support the hypothesis that CBPis involved in the recruitment of the GRIP1 foci to theND10s.

The GRIP1 Foci Contain Ubiquitin and Colocalizewith Components of the Proteasome

Recently, O’Malley and co-workers (41) have shownthat several members of the SRC family, includingGRIP1, is degraded by the 26S proteasome. Addition-ally, several groups have suggested that the ND10sare sites of proteolytic degradation and associate withcomponents of the proteasome (42–46). Therefore, weinvestigated whether the GRIP1 foci also containedcomponents of the proteasome. Indirect immunofluo-rescence against several components of the protea-some found that the core 20S proteasome, PA28a (asubunit of the 11S regulator) and ubiquitin all accu-mulate within the GRIP1 foci (Fig. 6A). However, theselarge accumulations of proteasomes were not ob-served in cells where GRIP1 localized in a diffuse distri-bution or in nontransfected cells (data not shown). There-fore, it appears that the proteasome may be recruited tothe GRIP1 foci. In addition, the DAD1 foci also associ-ated with components of the proteasome (Fig. 6B).Therefore, recruitment of the proteasome to the GRIP1foci does not require the GRIP1 foci to be in associationwith ND10s.

To determine whether GRIP1 is being degraded bythe proteasome, GFP-GRIP1 or GFP-GRIP1 DAD2was expressed in cells treated with the irreversibleproteasome inhibitor lactacystin or vehicle for 24 h.The cells were then fixed and the area-corrected flu-orescence intensity of several hundred cells was de-termined as described in Materials and Methods. Theresults of these analyses are shown in Fig. 6, C and D,as the percentage of GFP-expressing cells that oc-cupy a defined intensity range (bin). In cells expressingGFP-GRIP1 without lactacystin (Fig. 6C, gray bars) themajority of cells (;80%) have an area-corrected inten-sity between 40–60. However, in the presence of lac-tacystin (Fig. 6C, black bars), this value falls to approx-imately 55%. In contrast, cells expressing GFP-GRIP1DAD2 displayed a broader range of distributions withthe 40–60 and 60–80 intensity ranges each containingbetween 30% and 40% of the cells in both the pres-ence and absence of lactacystin (Fig. 6D). This sug-gests that the AD2 region of the protein is essential forproteasome degradation. Additional support for theimportance of the AD2 region in proteasome-mediated

degradation was found in an analysis of the higherintensity ranges. In the GFP-GRIP1 expressing cells,the percentage of cells with an area-corrected inten-sity above 80 doubles in the presence of lactacystin(Fig. 6C). In contrast, lactacystin had no effect on theintensity distribution of GFP-GRIP1 DAD2 with 27% ofcells expressing this chimera having an area-correctedintensity of more than 80 in both the presence andabsence of the inhibitor (Fig. 6D). Combined with theprevious results, our observations demonstrate thatGRIP1 is actively degraded by the proteasome andthat the AD2 region of the coactivator is essential forthis degradation to occur.

Intracellular Distribution ofTRAM1/RAC3/AIB1/ACTR

Finally, we were interested in ascertaining whether theintracellular distribution observed with GRIP1 wasunique to GRIP1 or common among the other SRCs.For this, we fused GFP to TRAM1 (47), another mem-ber of the SRC family. As with GFP-GRIP1, whenGFP-TRAM1 was expressed in HeLa cells, a protein ofthe predicted molecular mass (190 kDa) was produced(160 kDa for TRAM1 and 30 kDa for GFP; Fig. 1B). Inaddition, GFP-TRAM1 was fully competent to poten-tiate GR-dependent transcription from a MMTV-lucif-erase reporter (data not shown). The pattern of intra-cellular distribution of GFP-TRAM1 was quite similar tothat seen with GFP-GRIP1 (Fig. 7A) with both diffuseand focal accumulation of TRAM1 being present.However, the association of GFP-TRAM1 with theND10s was somewhat different as expression of GFP-TRAM1 appeared to induce a partial disruption of theND10s. This resulted in both fewer ND10s within thenucleus and significant numbers of ND10s accumu-lating within the cytoplasm (Fig. 7B, compare PML,upper row, and PML, lower row). This disruption oc-curred regardless of whether GFP-TRAM1 was in adiffuse distribution or in the focal accumulation (datanot shown). However, most (but not all) of the remain-ing ND10s were found to associate with the TRAM1foci (Fig. 7B, insets). Therefore, it seems that the for-mation of foci is not a characteristic unique to GRIP1and may, in fact, be a general feature of the SRCfamily.

DISCUSSION

In this report, the intracellular distribution of GRIP1was studied using fusions to the GFP (GFP-GRIP1).

top row; ubiquitin, middle row; core 20S proteasome, bottom row. The overlay for each is shown in the right column. B,GFP-GRIP1DAD1 (left panel) expressing HeLa cells were fixed in paraformaldehyde, and the intranuclear localization of PA28awas detected by indirect immunofluorescence (middle panel). The overlay is shown in the right panel. C and D, Histogram showingthe distribution of area-corrected intensities of a population of GFP-GRIP1 (C) and GFP-GRIP1DAD1 (D) expressing cells eitherwith (black bars) or without (gray bars) the irreversible proteasome inhibitor lactacystin. Percentage of total cell is plotted on they-axis and the intensity ranges are binned on the x-axis.

Association of GRIP1 Foci and the 26S Proteasome 493

GFP-GRIP1 has a complex distribution with the chi-mera localizing in a diffuse intranuclear distribution inapproximately 80–90% of the cells (Fig. 2A, left panel)whereas in the remaining 10–20% of cells, GFP-GRIP1was found in discrete intranuclear foci (Fig. 2A, centerand right panels). Formation of these foci was depen-dent on the AD2 region of the protein that was alsoessential for degradation by the proteasome. Similarfocal accumulations were seen previously for TIF2, thehuman ortholog of GRIP1 (5, 48). The GFP-GRIP1 focicontained components of the 26S proteasome andwere found in association with the PML-containingND10s.

GRIP1 is a large protein with several characterizedfunctional domains (Fig. 1) (4). Deletion studies ofGFP-GRIP1 identified the C-terminal region (AD1 andAD2) as being critical for foci formation. Interestingly,it appears AD1 and AD2 may play distinct roles in fociformation. As compared with the full-length protein,GFP-GRIP1DAD1 formed very few foci (Fig. 3C) thatdid not associate with the ND10s (Fig. 4C). Since AD1is the CBP interaction domain (20) and CBP has beenshown to colocalize with the ND10s (Fig. 5A) (40), apossible explanation for the requirement of the AD1 forND10 association is its direct association with CBP. Incontrast to GFP-GRIP1DAD1, GFP-GRIP1DAD2 was

Fig. 7. TRAM1 Associates in Intranuclear Foci Analogous to GRIP1A, Live cell imaging of GFP-TRAM1-expressing HeLa cells showing the three types of distributions observed with TRAM1. B,

GFP-TRAM1 (left column) expressing HeLa cells were fixed in paraformaldehyde, and the intranuclear localization of the ND10swas determined by indirect immunofluorescence against PML (middle panel). The overlay of each image pair is shown (rightpanel). The top row shows a GFP-TRAM1 expressing cell where the bottom row shows a control cell that is not expressingGFP-TRAM1 (green is the pseudo coloring of the background fluorescence) where GFP-TRAM1 is not expressed. Insets in thetop overlays show an expanded view of the GFP-TRAM1-ND10 association.

MOL ENDO · 2001 Vol. 15 No. 4494

unable to form foci in any cell (Fig. 3D). A possibleexplanation of this observation is that an AD2-associ-ated protein may directly recruit GRIP1 to the foci. Todate though, only two AD2 interacting proteins havebeen described, CARM1 (21) and mZac1 (22). Prelim-inary immunofluorescence studies found CARM1 tolocalize in a diffuse nucleoplasmic distribution with noevidence of focal accumulations (C. T. Baumann,M. R. Stallcup, and G. L. Hager, unpublished obser-vations). In addition, immunofluorescent experimentsagainst hZac1 have shown it to localize in a uniformnuclear distribution as well (49). Therefore, neitherhZac1 nor CARM1 is a likely candidate to directlyrecruit GRIP1 to the foci, although at this point, wecannot say whether other, unidentified proteins recruitGRIP1 to the foci. A second possibility is that modifi-cation (i.e. phosphorylation, methylation, or acetyla-tion) of residues within AD2 triggers the recruitment ofGRIP1 to the foci. This will be discussed more fullylater in the paper.

A number of studies have found mammalian cells tocontain multiple subnuclear structures (50, 51). One ofthe most intensely studied of these are the ND10s (39).ND10s are small nuclear structures consisting of atleast 10 proteins including PML, a growth suppresserimplicated in a wide variety of cellular function (52),SP100, first identified as a target for autoimmune an-tibodies in primary biliary cirrhosis (53), DAXX, identi-fied as a Fas-interacting protein that links the receptorto the JNK kinase pathway (54, 55), and CBP, a his-tone acetyltransferase important for transcription ac-tivation in a variety of systems (40). Here, we haveshown that a subset of the GRIP1 foci localize adja-cent to the ND10s. Previously, it has been shown thatseveral double-stranded DNA viruses deposit their ge-nomes at sites adjacent to the ND10s as well (56).These deposition sites are similar in size and orienta-tion to the GRIP1 foci we have observed, suggestingthat there may be an underlying structure with whichboth the viral deposition sites and the GRIP1 foci mayassociate.

The ND10s have been implicated in several intracel-lular processes, including apoptosis (57, 58) and tran-scription (59, 60), and have been found to be bothspatially and functionally associated with the ubiquitin-dependent proteasome (42, 44–46). Everett et al. (45)found a ubiquitin-specific protease (HAUSP) that isdynamically associated with the ND10s. HAUSP inter-acts with Vmw110 (ICP0), an immediate early geneproduct from herpes simplex virus (HSV), which influ-ences the latent/lytic decision of infecting HSV. Duringviral infection, Vmw110 associates with the ND10sand subsequently disrupts them. A recent study hasalso shown that misfolded forms of the influenza virusnucleoprotein can recruit the proteasome to theND10s (46). In our studies, we have shown that com-ponents of the proteasome are enriched in the GRIP1foci (Fig. 6A), whereas when GRIP1 is distributed in adiffuse pattern, few, if any, discrete structures are seen

with the same proteasome antibodies (data notshown). In cells expressing DAD1, the few foci that didform were also enriched in components of the protea-some although they were not associated with theND10s. It is noteworthy that the number and size of thestructures identified by the antiproteasome antibodiescorrespond quite well with the number and size of theGRIP1 foci. Therefore, it is likely that the proteasome isrecruited to the GRIP1 foci in a manner similar to thatseen by Anton et al. (46) with the influenza virus nu-cleoprotein. In addition, recruitment of the proteasometo GFP-GRIP1AAD1, which does not associate withthe ND10s, indicates that the proteasome can be re-cruited to intranuclear structures other than theND10s.

The intracellular levels of several members of theNHR family, including the estrogen (61, 62), retinoicacid (63, 64) retinoic X (64), peroxisome proliferator-activated receptor (PPAR) (65), and progesterone re-ceptors (66), are regulated by the ubiquitin-dependentproteasome. In these cases, the addition of the ap-propriate ligand agonist results in down-regulation ofreceptor levels by ubiquitin-mediated proteasomedegradation. Degradation of the ligand-bound nuclearreceptor is believed to play an important role in “turn-ing off” the hormone response and therefore function-ing as an additional level of regulation of the NHRs.Lazar and co-workers have demonstrated that the in-tracellular levels of the nuclear corepressor (N-CoR)are also mediated by the proteasome (67). In thisstudy, a mammalian homolog of the Drosophila Sevenin absentia (mSiah2) protein targets N-CoR for protea-some-mediated degradation in cells expressing highlevels of mSiah2 but not in cells limited in mSiah2. Thisresult begins to explain the cell type specificity ob-served for nuclear receptor-mediated repression. Ourobservations that GRIP1 can associate with protea-somes suggest that the intracellular levels of the SRCsmay also be regulated in a proteasome-dependentmanner. This is supported by the ability of lactacystinto increase the levels of GFP-GRIP1 in treated cells(Fig. 6C). Additionally, a recent paper has shown thatseveral members of the SRC family, including GRIP1,are degraded by the 26S proteasome (41). Taken as awhole, these results clearly implicate the 26S protea-some in the degradation of GRIP1 and suggest theprotein turnover/stability may be an important regula-tory feature of GRIP1.

To be degraded by the 26S proteasome, GRIP1would need to be ubiquitinated. Ubiquitination of pro-teins generally requires a so-called PEST sequence; astretch of amino acids enriched in proline, serine, thre-onine, and glutamic acid (68). Analysis of the GRIP1protein by the PEST-FIND program (http://bioweb.pasteur.fr/seqanal/interfaces/pestfind.html) has identi-fied four potential PEST sequences: one in the bHLH-PAS domain [amino acid (a.a.) 205–215], one betweennrb boxes i and ii (a.a. 648–679), one between nrbboxes ii and iii (a.a. 713–731), and one encompassinga.a. 788–826 (Fig. 8). Since the entire bHLH-PAS re-

Association of GRIP1 Foci and the 26S Proteasome 495

gion can be deleted with no observable effect on thedistribution of GRIP1 or the ability of the protein topotentiate GR-dependent transcription (C. T. Bau-mann and G. L. Hager, unpublished observations), thePEST between a.a. 205 and 215 does not appear to beimportant in GRIP1 activity. Several transcription fac-tors, other than the NHRs, have been found to bedegraded by the 26S proteasome (69–72). Compari-son of the PEST sites and the activation domains fromthese proteins has found that the two are inseparablefrom one another (73). Therefore, it has been sug-gested that these proteins may have evolved a tightcoupling of the activation potentials and degradationas a mechanism to carefully regulate their activity (73).Since the nuclear receptor interaction domain (NID) isessential for nuclear receptor-mediated transactiva-tion, it is possible that a similar regulatory mechanismhas evolved for GRIP1 as well. Analysis of the threepotential PEST sequences within the nuclear receptorinteracting domain is currently underway.

Of note, none of the predicted PEST sequences islocated within the AD2 region. However, we haveshown that the AD2 region of GRIP1 is essential forboth foci formation and proteasome degradation. Whythen is the AD2 region absolutely necessary for thesefunctions? It is possible that posttranslational modifi-cations within the AD2 region may target GRIP1 fordegradation. For example, phosphorylation can serveas a signal to target proteins for ubiquitination andsubsequent degradation (74–78). Analysis of theamino acid sequence of AD2 has identified three con-sensus cdc2 phosphorylation sites and a consensusmitogen-activated protein (MAP) kinase site. cdc2 is acell cycle-regulated protein kinase involved in regulat-ing cell cycle progression (79). Phosphorylation of pro-teins by cdc2 has been shown to target them for

ubiquitin-dependent degradation (80). As the kinaseactivity of cdc2 is cell cycle regulated and the GRIP1foci are found in only 20% of the cells, it is intriguing tospeculate that formation of these foci may be cellcycle regulated through the cdc2 kinase. MAP kinasehas also been shown to target proteins for degradation(81, 81). Specifically, phosphorylation of the ligand-bound human progesterone receptor at serine 194 byMAP kinase targets it for degradation. Analysis ofthese and other potential kinase sites within AD2 is anarea we are actively pursuing.

Recently TIF2, the human ortholog of GRIP1, wasshown to be associated with acute myeloid leukemia(AML) (82). In AML, a chromosomal translocation re-sults in the C-terminal region of TIF2 being fused to theN terminus of a myeloid-specific histone acetyltrans-ferase (MOZ). The region of TIF2 contained within theMOZ-TIF2 fusion contains AD1 and AD2, both ofwhich play a role in the ability of GFP-GRIP1 to formfoci. In a second subtype of AML, CBP was fused toMOZ (83). Although the region of CBP responsible forND10 association is unknown, one can speculate thatthe MOZ-TIF2 fusion may by mislocalized through theAD2 of TIF2, resulting in an altered gene expressionprofile compared with wild-type cells.

MATERIALS AND METHODS

Plasmids

pLTRLuc, pCMVIL2, and pRSVbGal were described pre-viously (31). pEGFP-GRIP1 was constructed as follows.An EcoRI fragment containing the GRIP1 cDNA was excisedfrom pSG5-HA-GRIP1 (21) and cloned into similarly cutpEGFP-C2 (CLONTECH Laboratories, Inc. Palo Alto,CA). pEGFP-GRIP1DAD1, pEGFP-GRIP1DAD2, pEGFP-

Fig. 8. The Potential PEST Sites within the NID of GRIP1Top, Schematic of the NID of GRIP1. The three nrb boxes are indicated (black boxes) and are numbered i–iii. The potential PEST

sites (black lines) are also indicated below. Bottom, Amino acid sequence of the three potential PEST sites found with the NID.

MOL ENDO · 2001 Vol. 15 No. 4496

GRIP1DAD1 1AD2, and pEGFP-GRIP1 nrbIIm1nrbIIIm wereconstructed as described for pEGFP-GRIP1 except pSG5-HA-GRIP1D105721109 (20), pSG5-HA-GRIP1521121 (21),pSG5-HA-GRIP1DAD11AD2 (H. Ma and M. R.Stallcup, un-published results), and pSG5-HA-GRIP1 nrbIIm1nrbIIIm (20),respectively, were used. pEGFP-GRIP1-DbHLH-PAS wasconstructed as follows. Site-directed mutagenesis using theQuikChange mutagenesis kit (Stratagene, La Jolla, CA) wasused to introduce an AflII site at positions 231–236 and anEcoRV site at 1,212–1,217 in pEGFP-GRIP1 (numberingbased on nucleotide sequence from the GenBank entryU39060). The following oligonucleotides were used in themutagenesis. GGGATGGGAGAAAACACCTCTCTTAAGTCCA-GGGCAGAGACCAG- AAAACGC and GCGTTTTCTGGTCTCT-GCCCTGGACTTA- AGAGAGGTGTTTTCTCCCATCCC wereused to introduce the AflII site and GGGTTGGCGTTCAGTCA-GATCGAT ATCTTTT- CT TTGTCTGATGGCACTCTCG andCGAGAGTGCCATCAGACAAAGAAAAGATATCGATCTGA-CTACGCCAACCC were used to introduce the EcoRV site. Boldletters represent the bases changed to introduce the appropri-ate restriction enzyme site. The resulting vector was digestedwith EcoRV and AflII and closed with a linker to reintroduce thenuclear localization signal that was lost in the original EcoRV/AflII fragment (GAGACTTAAGTCCAGGGCAGAGACCAGAA-AACGCAAGGATATCGAGA and TCTCGATATCCTTGCGTTT-TCTGGTCTCTGCCCTGGAC- TTAAGTCTC).

To construct pEGFP-TRAM1, the TRAM1 cDNA was am-plified by PCR from pBKCMV-TRAM1 (47) with oligonucleo-tides that added a XhoI site at the 59-end of the gene and aKpnI site at the 39-end. The resulting PCR product was cutwith XhoI and KpnI and cloned into similarly cut pEGFP-C1.

Cell Culture and Transfections

HeLa cells were routinely maintained in DMEM 1 10% FBS 1100 U/ml penicillin and streptomycin 1 2 mM L-glutamine at37 C and 5% CO2 in a water-jacketed incubator. Cells weretypically split 1:4 every other day. Where indicated, cells weretreated with 1 uM lactacystin (Alexis Chemicals, San Diego,CA) in EtOH for 24 h. Transfections were done by the calciumphosphate procedure (Invitrogen, Carlsbad, CA).

Transactivations and Western Blot Analyses

For transactivation assays, 5 3 106 HeLa cells were plated ina 100-mm dish in DMEM 1 10% charcoal-stripped FBS andtransfected with 5 mg pLTRLuc and 0.5 mg pRSVbGal withand without 5 mg of the indicated GRIP1 expression vector.The following day, cells were washed with PBS and treatedwith 100 nM dexamethasone for 6 h. Cells were harvested byscraping, and luciferase and b-galactosidase assays weredone as described (31). For Western blots, 5 3 106 cells weretransfected with 20 mg pEGFP-GRIP1 and 20 mg pCMVIL2 asdescribed above. The next day, the transfected population ofcells was enriched by sorting with anti-IL2-coated magnetbeads, and whole cell extracts were made as describedpreviously (31). Extract (20 mg) was run on a 7.5% SDS-PAGE and electrotransferred to Immobilon-P (Millipore Corp.,Bedford, MA) in 192 mM glycine, 25 mM Tris, 20% methanol,and 0.1% SDS for 18 h at 100 mA. GFP-fusion proteins weredetected by a polyclonal anti-GFP (CLONTECH Laboratories,Inc.) at a 1:500 dilution and a horseradish peroxidase (HRP)-conjugated goat antirabbit at 1:10,000 (Jackson ImmunoRe-search Laboratories, Inc., West Grove, PA).

Immunofluorescence

Cells (2 3 105) were plated onto coverslips in a six-well dishand transfected with 0.5 mg of the indicated GFP-fusionvector. The following day, cells were washed two times withPBS (without Ca21 and Mg21), fixed for 20 min in freshly

prepared 3.5% paraformaldehyde in PBS (without Ca21 andMg21), washed two times with PBS (without Ca21 and Mg21),and permeabilized with 0.5% Triton-X 100 in PBS (withoutCa21 and Mg21). Primary antibodies were incubated withcells on coverslips at the dilutions suggested by the manu-facturer overnight at 4 C in PBS (without Ca21 and Mg21) 110% normal calf serum. The next day, the coverslips werewashed three times in PBS (without Ca21 and Mg21) 1 10%normal calf serum and incubated with the fluorescently con-jugated secondary antibody for 1 h at room temperature inPBS 1 10% normal calf serum. Coverslips were then washedthree times with PBS (without Ca21 and Mg21) 1 10% normalcalf serum, once in PBS (without Ca21 and Mg21), once inPBS (without Ca21 and Mg21) 1 0.5 mg/ml Hoechst 33342(to visualize DNA), and once in dH2O (to remove residualsalts). Coverslips were then mounted on quartz microscopeslides in Vectashield (Vector Laboratories, Inc., Burlingame,CA). The following antibodies were used for these studies.Primary antibodies: PML, mouse anti-PML (Santa Cruz Bio-technology, Inc., Santa Cruz, CA); CBP, rabbit anti-CBP NT(Upstate Biotechnology, Inc. Lake Placid, NY); ubiquitin, rab-bit antiubiquitin (Affiniti Research Products, Ltd, Exeter, UK);PA28a, rabbit anti-PA28a (Affiniti Research Products, Ltd,Exeter, UK); and 20S core proteasome, rabbit, anti-core (Af-finiti Research Products, Ltd, Exeter, UK). Secondary anti-bodies: to visualize PML, ubiquitin, PA28a, and the core 20Sproteasome, Texas Red-conjugated secondary antibodieswere used of the appropriate species specificity (Calbio-chem- Novabiochem Corp, La Jolla, CA). To visualize CBP,Cy5-conjugated goat-antirabbit antibodies were used (Am-ersham Pharmacia Biotech, Inc, Piscataway, NJ). All second-ary antibodies were used at a 1:250 dilution.

Cell Extractions

Cell extractions were done as follows. HeLa cells (2 3 105)were transfected with 0.5 mg pEGFP-GRIP1 as describedabove. The next day, cells were washed with ice-cold PBSand sequentially extracted with CSK buffer (100 mM NaCl,300 mM sucrose, 10 mM piperazine-N,N9-bis(2-ethanesul-fonic acid) (PIPES), pH 6.8, 3 mM MgCl2, 0.5% Triton-X 100,and protease inhibitor cocktail (Calbiochem-NovabiochemCorp.) for 10 min at 4 C followed by extraction buffer (250 mM

ammonium sulfate, 300 mM sucrose, 10 mM PIPES, pH 6.8, 3mM MgCl2, 0.5 Triton-X 100, and protease inhibitor cocktail(Calbiochem-Novabiochem Corp.) for 5 min at 4 C followedby 10 mg/ml DNase I in CSK (with 50 mM NaCl instead of 100mM) for 1 h at room temperature. The process was stoppedby fixation in 3.5% paraformaldehyde for 20 min at roomtemperature, washed, and mounted as described above.

Fluorescence Imaging

Live-cell microscopy of GFP-fusion proteins was performedon a Leica Corp. TCS-SP confocal microscope mounted ona DMIRBE inverted microscope (Leica Corp. Microsystems,Exton, PA). GFP was excited with the 488-nm laser line of anair-cooled Ar laser (20 mW nominal output, Coherent Inc.,Santa Clara, CA). GFP emission was monitored between 505nm and 590 nm, and the cells were maintained at 37 C witha Nevtek ASI 400 Air Stream Incubator (Nevtek, Burnsville,VA). For immunofluorescent studies, images were acquiredwith either a Eclipse E800 (Nikon, Melville, NY) equipped witha Micromax cooled CCD (Roper Scientific, Trenton, NJ) or aIE80 (Olympus Corp., Lake Success, NY) equipped with aDeltavision image acquisition and analysis package (AppliedPrecision, Inc., Issaquah, WA). Standard filter sets were usedfor all imaging (Chroma Technology Corp., Brattleboro, VT)All images were processed as tiffs on Corel Photo-Paint(Corel Corp., Ontario, Canada) using standard image pro-cessing techniques.

Association of GRIP1 Foci and the 26S Proteasome 497

Quantitative Analysis

The area-corrected intensity of the GFP-GRIP1 expressingcells was determined using the MetaMorph image analysissoftware package (Universal Imaging Corp, West Chester,PA). First, the nucleus was encircled (using the polygon tool)and the total fluorescence intensity and total area of thenucleus were determined. Background fluorescence was de-termined by measuring the total fluorescence of a randomregion within the field of view and dividing that value by thetotal area of that region to give the total background per unitarea (BA) within the field of view. The BA was then multipliedby the total area of the nucleus to give the total backgroundwithin the nucleus (BN). This value was then subtracted fromthe total fluorescence intensity of the nucleus to give thebackground-corrected intensity of the nucleus (FN). For eachexperiment, the area-corrected intensity of several hundredcells was determined.

Acknowledgments

Received May 30, 2000. Revision received November 22,2000. Accepted December 19, 2000.

Address requests for reprints to: Dr. Gordon Hager, Lab-oratory of Receptor Biology & Gene Expression, NationalCancer Institute, NIH Building 41, Room B602, Bethesda,Maryland 20892-5055. E-mail: hagerg@exchange.nih.gov.

*Current Address: Instituto de Bioquimica Vegetal y Foto-sintesis, Centro de Investigaciones Isla de la Cartuja, Av.Americo Vespucio s/n, 41092 Sevilla Spain.

†Current Address: Department of Pharmaceutics andPharmaceutical Chemistry, University of Utah, Salt Lake City,Utah 84108.

REFERENCES

1. Giguere V 1999 Orphan nuclear receptors: from gene tofunction. Endocr Rev 20:689–725

2. Feng W, Ribiero RCJ, Wagner RL, Nguyen H, AprilettiJW, Fletterick RJ, Baxter JD, Kushner PJ, West BL 1998Hormone-dependent coactivator binding to a hydropho-bic cleft on nuclear receptors. Science 280:1747–1749

3. Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1995 Se-quence and characterization of a coactivator for thesteroid hormone receptor superfamily. Science 270:1354–1357

4. Hong H, Kohli K, Garabedian MJ, Stallcup MR 1997GRIP1, a transcriptional coactivator for the AF-2 trans-activation domain of steroid, thyroid, retinoid, and vita-min D receptors. Mol Cell Biol 17:2735–2744

5. Voegel JJ, Heine MJ, Zechel C, Chambon P, GronemeyerH 1996 TIF2, a 160 kDa transcriptional mediator for theligand-dependent activation function AF-2 of nuclear re-ceptors. EMBO J 15:3667–3675

6. Anzick SL, Kononen J, Walker RL, Azorsa DO, TannerMM, Guan XY, Sauter G, Kallioniemi OP, Trent JM, Melt-zer PS 1997 AIB1, a steroid receptor coactivator ampli-fied in breast and ovarian cancer. Science 277:965–968

7. Chen H, Lin RJ, Schiltz RL, Chakravarti D, Nash A, NagyL, Privalsky ML, Nakatani Y, Evans RM 1997 Nuclearreceptor coactivator ACTR is a novel histone acetyltrans-ferase and forms a multimeric activation complex withP/CAF and CBP/p300. Cell 90:569–580

8. Li H, Gomes PJ, Chen JD 1997 RAC3, a steroid/nuclearreceptor-associated coactivator that is related to SRC-1and TIF2. Proc Natl Acad Sci USA 94:8479–8484

9. Westin S, Rosenfeld MG, Glass CK 2000 Nuclear recep-tor coactivators. Adv Pharmacol 47:89–112

10. Glass CK, Rose DW, Rosenfeld MG 1997 Nuclear recep-tor coactivators. Curr Opin Cell Biol 9:222–232

11. Yao TP, Ku G, Zhou N, Scully R, Livingston DM 1996 Thenuclear hormone receptor coactivator SRC-1 is a spe-cific target of p300. Proc Natl Acad Sci USA 93:10626–10631

12. Suen CS, Berrodin TJ, Mastroeni R, Cheskis BJ, LyttleCR, Frail DE 1998 A transcriptional coactivator, steroidreceptor coactivator-3, selectively augments steroidreceptor transcriptional activity. J Biol Chem 273:27645–27653

13. Xu L, Glass CK, Rosenfeld MG 1999 Coactivator andcorepressor complexes in nuclear receptor function.Curr Opin Genet Dev 9:140–147

14. Szapary D, Huang Y, Simons Jr SS 1999 Opposing ef-fects of corepressor and coactivators in determining thedose-response curve of agonists, and residual agonistactivity of antagonists, for glucocorticoid receptor-regu-lated gene expression. Mol Endocrinol 13:2108–2121

15. Pugh BF, Tjian R 1990 Mechanism of transcriptionalactivation by Sp1: evidence for coactivators. Cell 61:1187–1197

16. Henttu PM, Kalkhoven E, Parker MG 1997 AF-2 activityand recruitment of steroid receptor coactivator 1 to theestrogen receptor depend on a lysine residue conservedin nuclear receptors. Mol Cell Biol 17:1832–1839

17. DiRenzo J, Soderstrom M, Kurokawa R, Ogliastro MH,Ricote M, Ingrey S, Horlein A, Rosenfeld MG, Glass CK1997 Peroxisome proliferator-activated receptors andretinoic acid receptors differentially control the interac-tions of retinoid X receptor heterodimers with ligands,coactivators, and corepressors. Mol Cell Biol 17:2166–2176

18. Goldman PS, Tran VK, Goodman RH 1997 The multi-functional role of the co-activator CBP in transcriptionalregulation. Recent Prog Horm Res 52:103–119

19. Ogryzko VV, Schiltz RL, Russanova V, Howard BH, Na-katani Y 1996 The transcriptional coactivators p300 andCBP are histone acetyltransferases. Cell 87:953–959

20. Ma H, Hong H, Huang SM, Irvine RA, Webb P, KushnerPJ, Coetzee GA, Stallcup MR 1999 Multiple signal inputand output domains of the 160-kilodalton nuclear recep-tor coactivator proteins. Mol Cell Biol 19:6164–6173

21. Chen D, Ma H, Hong H, Koh SS, Huang SM, Schurter BT,Aswad DW, Stallcup MR 1999 Regulation of transcriptionby a protein methyltransferase. Science 284:2174–2177

22. Huang SM, Stallcup MR 2000 Mouse Zac1, a transcrip-tional coactivator and repressor for nuclear receptors.Mol Cell Biol 20:1855–1867

23. Spencer TE, Jenster G, Burcin MM, Allis CD, Zhou J,Mizzen CA, McKenna NJ, Onate SA, Tsai SY, Tsai MJ,O’Malley BW 1997 Steroid receptor coactivator-1 is ahistone acetyltransferase. Nature 389:194–198

24. Munck A, Naray-Fejes-Toth A 1992 The ups and downsof glucocorticoid physiology. Permissive and suppres-sive effects revisited. Mol Cell Endocrinol 90:C1–C4

25. Hu JM, Bodwell JE, Munck A 1994 Cell cycle-dependentglucocorticoid receptor phosphorylation and activity.Mol Endocrinol 8:1709–1713

26. Munck A, Naray-Fejes-Toth A 1994 Glucocorticoids andstress: permissive and suppressive actions. Ann NYAcad Sci 746:115–130; discussion 131–133

27. van Steensel B, Jenster G, Damm K, Brinkmann AO, vanDriel R 1995 Domains of the human androgen receptorand glucocorticoid receptor involved in binding to thenuclear matrix. J Cell Biochem 57:465–478

28. van Steensel B, Brink M, van der Meulen K, van Bin-nendijk EP, Wansink DG, de Jong L, de Kloet ER, vanDriel R 1995 Localization of the glucocorticoid receptor indiscrete clusters in the cell nucleus. J Cell Sci 108:3003–3011

29. Htun H, Barsony J, Renyi I, Gould DJ, Hager GL 1996Visualization of glucocorticoid receptor translocation and

MOL ENDO · 2001 Vol. 15 No. 4498

intranuclear organization in living cells with a green flu-orescent protein chimera. Proc Natl Acad Sci USA 93:4845–4850

30. Smith CL, Wolford RG, O’Neill TB, Hager GL 2000 Char-acterization of transiently- and constitutively-expressedprogesterone receptors: evidence for two functionalstates. Mol Endocrinol 14:956–971

31. Lim CS, Baumann CT, Htun H, Xian W, Irie M, Smith CL,Hager GL 1999 Differential localization and activity of theA and B forms of the human progesterone receptor usinggreen fluorescent protein chimeras. Mol Endocrinol 13:366–375

32. Htun H, Holth LT, Walker D, Davie JR, Hager GL 1999Direct visualization of ligand occupied and unoccupiedhuman estrogen receptor a reveals a role for ligand in thenuclear distribution of the receptor. Mol Biol Cell 10:471–486

33. Hager GL, Lim CS, Elbi C, Baumann CT 2000 Traffickingof nuclear receptors in living cells. In: Estrogens andWomen’s Health: Benefit or Threat. J Steroid BiochemMol Biol 74:249–254

34. Baumann CT, Lim CS, Hager GL 1999 Intracellular local-ization and trafficking of steroid receptors. Cell BiochemBiophys 31:119–127

35. Baumann CT, Maruvada P, Hager GL, Yen PM 2001Nuclear-cytoplasmic shuttling by thyroid hormonereceptors: multiple protein interactions are required fornuclear retention. J Biol Chem, in press

36. Mckenna NJ, Lanz RB, O’Malley BW 1999 Nuclear re-ceptor coregulators: cellular and molecular biology. En-docr Rev 20:321–344

37. Ding XF, Anderson CM, Ma H, Hong H, Uht RM, KushnerPJ, Stallcup MR 1998 Nuclear receptor-binding sites ofcoactivators glucocorticoid receptor interacting protein 1(GRIP1) and steroid receptor coactivator 1 (SRC-1): mul-tiple motifs with different binding specificities. Mol En-docrinol 12:302–313

38. Maul GG, Negorev D, Bell P, Ishov AM 2000 Review:properties and assembly mechanisms of ND10, PMLbodies, or PODs. J Struct Biol 129:278–287

39. Sternsdorf T, Grotzinger T, Jensen K, Will H 1997 Nucleardots: actors on many stages. Immunobiology 198:307–331

40. LaMorte VJ, Dyck JA, Ochs RL, Evans RM 1998 Local-ization of nascent RNA and CREB binding protein withthe PML-containing nuclear body. Proc Natl Acad SciUSA 95:4991–4996

41. Lonard DM, Nawaz Z, Smith CL, O’Malley BW 2000 The26S proteasome is required for estrogen receptor-a andcoactivator turnover and for efficient estrogen receptor-atransactivation. Mol Cell 5:939–948

42. Everett RD, Maul GG 1994 HSV-1 IE protein Vmw110causes redistribution of PML. EMBO J 13:5062–5069

43. Everett RD, Earnshaw WC, Pluta AF, Sternsdorf T, Ain-sztein AM, Carmena M, Ruchaud S, Hsu WL, Orr A 1999A dynamic connection between centromeres and ND10proteins. J Cell Sci 112:3443–3454

44. Chelbi-Alix MK, de The H 1999 Herpes virus inducedproteasome-dependent degradation of the nuclear bod-ies-associated PML and Sp100 proteins. Oncogene 18:935–941

45. Everett RD, Freemont P, Saitoh H, Dasso M, Orr A,Kathoria M, Parkinson J 1998 The disruption of ND10during herpes simplex virus infection correlates with theVmw110- and proteasome-dependent loss of severalPML isoforms. J Virol 72:6581–6591

46. Anton LC, Schubert U, Bacik I, Princiotta MF, WearschPA, Gibbs J, Day PM, Realini C, Rechsteiner MC, Ben-nink JR, Yewdell JW 1999 Intracellular localization ofproteasomal degradation of a viral antigen. J Cell Biol146:113–124

47. Takeshita A, Cardona GR, Koibuchi N, Suen CS, ChinWW 1997 TRAM-1, A novel 160-kDa thyroid hormone

receptor activator molecule, exhibits distinct propertiesfrom steroid receptor coactivator-1. J Biol Chem 272:27629–27634

48. Carrero P, Okamoto K, Coumailleau P, O’Brien S, TanakaH, Poellinger L Redox-regulated recruitment of the tran-scriptional coactivators CREB-binding protein andSRC-1 to hypoxia-inducible factor 1a. Mol Cell Biol 20:402–415

49. Varrault A, Ciani E, Apiou F, Bilanges B, Hoffmann A,Pantaloni C, Bockaert J, Spengler D, Journot L 1998hZAC encodes a zinc finger protein with antiproliferativeproperties and maps to a chromosomal region frequentlylost in cancer. Proc Natl Acad Sci USA 95:8835–8840

50. Gall JG, Tsvetkov A, Wu Z, Murphy C 1995 Is the sphereorganelle/coiled body a universal nuclear component?Dev Genet 16:25–35

51. Misteli T, Caceres JF, Spector DL 1997 The dynamics ofa pre-mRNA splicing factor in living cells. Nature 387:523–527

52. Weis K, Rambaud S, Lavau C, Jansen J, Carvalho T,Carmo-Fonseca M, Lamond A, Dejean A 1994 Retinoicacid regulates aberrant nuclear localization of PML-RARa in acute promyelocytic leukemia cells. Cell 76:345–356

53. Sternsdorf T, Jensen K, Reich B, Will H 1999 The nucleardot protein sp100, characterization of domains neces-sary for dimerization, subcellular localization, and modi-fication by small ubiquitin-like modifiers. J Biol Chem274:12555–12566

54. Torii S, Egan DA, Evans RA, Reed JC 1999 Human Daxxregulates Fas-induced apoptosis from nuclear PML on-cogenic domains (PODs). EMBO J 18:6037–6049

55. Ishov AM, Sotnikov AG, Negorev D, Vladimirova OV, NeffN, Kamitani T, Yeh ET, Strauss JF, III, Maul GG 1999 PMLis critical for ND10 formation and recruits the PML-inter-acting protein daxx to this nuclear structure when mod-ified by SUMO-1. J Cell Biol 147:221–234

56. Maul GG 1998 Nuclear domain 10, the site of DNA virustranscription and replication. Bioessays 20:660–667

57. Wang ZG, Ruggero D, Ronchetti S, Zhong S, Gaboli M,Rivi R, Pandolfi PP 1998 PML is essential for multipleapoptotic pathways. Nat Genet 20:266–272

58. Quignon F, De Bels F, Koken M, Feunteun J, AmeisenJC, de The H 1998 PML induces a novel caspase-inde-pendent death process. Nat Genet 20:259–265

59. Vallian S, Gaken JA, Trayner ID, Gingold EB, KouzaridesT, Chang KS, Farzaneh F 1997 Transcriptional repressionby the promyelocytic leukemia protein, PML. Exp CellRes 237:371–382

60. Alcalay M, Tomassoni L, Colombo E, Stoldt S, GrignaniF, Fagioli M, Szekely L, Helin K, Pelicci PG 1998 Thepromyelocytic leukemia gene product (PML) forms stablecomplexes with the retinoblastoma protein. Mol Cell Biol18:1084–1093

61. Nawaz Z, Lonard DM, Dennis AP, Smith CL, O’MalleyBW 1999 Proteasome-dependent degradation of the hu-man estrogen receptor. Proc Natl Acad Sci USA 96:1858–1862

62. Alarid ET, Bakopoulos N, Solodin N 1999 Proteasome-mediated proteolysis of estrogen receptor: a novel com-ponent in autologous down-regulation. Mol Endocrinol13:1522–1534

63. Zhu J, Gianni M, Kopf E, Honore N, Chelbi-Alix M, KokenM, Quignon F, Rochette-Egly C, de The H 1999 Retinoicacid induces proteasome-dependent degradation of reti-noic acid receptor a (RARa) and oncogenic RARa fusionproteins. Proc Natl Acad Sci USA 96:14807–14812

64. Boudjelal M, Wang Z, Voorhees JJ, Fisher GJ Ubiquitin/proteasome pathway regulates levels of retinoic acidreceptor g and retinoid X receptor a in human keratino-cytes. Cancer Res 60:2247–2252

65. Hauser S, Adelmant G, Sarraf P, Wright HM, Mueller E,Spiegelman BM 2000 Degradation of the peroxisome pro-

Association of GRIP1 Foci and the 26S Proteasome 499

liferator-activated receptor (PPAR) g is linked to ligand-dependent activation. J Biol Chem 275:18527–18533

66. Syvala H, Vienonen A, Zhuang YH, Kivineva M, Ylikomi T,Tuohimaa P 1998 Evidence for enhanced ubiquitin-mediated proteolysis of the chicken progesterone recep-tor by progesterone. Life Sci 63:1505–1512

67. Zhang J, Guenther MG, Carthew RW, Lazar MA 1998Proteasomal regulation of nuclear receptor corepressor-mediated repression. Genes Dev 12:1775–1780

68. Rechsteiner M 1989 PEST regions, proteolysis and cellcycle progression. Rev Biol Cell 20:235–253

69. Salghetti SE, Kim SY, Tansey WP 1999 Destruction ofMyc by ubiquitin-mediated proteolysis: cancer-associ-ated and transforming mutations stabilize Myc. EMBO J18:717–726

70. Treier M, Staszewski LM, Bohmann D 1994 Ubiquitin-dependent c-Jun degradation in vivo is mediated by thed domain. Cell 78:787–798

71. Chowdary DR, Dermody JJ, Jha KK, Ozer HL 1994 Ac-cumulation of p53 in a mutant cell line defective in theubiquitin pathway. Mol Cell Biol 14:1997–2003

72. Campanero MR, Flemington EK 1997 Regulation of E2Fthrough ubiquitin-proteasome-dependent degradation:stabilization by the pRB tumor suppressor protein. ProcNatl Acad Sci USA 94:2221–2226

73. Salghetti SE, Muratani M, Wijnen H, Futcher B, TanseyWP Functional overlap of sequences that activate tran-scription and signal ubiquitin-mediated proteolysis. ProcNatl Acad Sci USA 97:3118–3123

74. Ku NO, Omary MB Keratins turn over by ubiquitination ina phosphorylation-modulated fashion. J Cell Biol 149:547–552

75. Breitschopf K, Haendeler J, Malchow P, Zeiher AM, Dim-meler S Posttranslational modification of Bcl-2 facilitatesits proteasome-dependent degradation: molecular char-

acterization of the involved signaling pathway. Mol CellBiol 20:1886–1896

76. Mitsui A, Sharp PA 1999 Ubiquitination of RNA polymer-ase II large subunit signaled by phosphorylation of car-boxyl-terminal domain. Proc Natl Acad Sci USA 96:6054–6059

77. Montagnoli A, Fiore F, Eytan E, Carrano AC, Draetta GF,Hershko A, Pagano M 1999 Ubiquitination of p27 is reg-ulated by Cdk-dependent phosphorylation and trimericcomplex formation. Genes Dev 13:1181–1189

78. Alessandrini A, Chiaur DS, Pagano M 1997 Regulation ofthe cyclin-dependent kinase inhibitor p27 by degradationand phosphorylation. Leukemia 11:342–345

79. Krek W, Nigg EA 1991 Differential phosphorylation ofvertebrate p34cdc2 kinase at the G1/S and G2/M tran-sitions of the cell cycle: identification of major phosphor-ylation sites. EMBO J 10:305–316

80. Benito J, Martin-Castellanos C, Moreno S 1998 Regula-tion of the G1 phase of the cell cycle by periodic stabi-lization and degradation of the p25rum1 CDK inhibitor.EMBO J 17:482–497

81. Lange CA, Shen T, Horwitz KB 2000 Phosphorylation ofhuman progesterone receptors at serine-294 by mito-gen-activated protein kinase signals their degradation bythe 26S proteasome. Proc Natl Acad Sci USA 97:1032–1037

82. Carapeti M, Aguiar RC, Goldman JM, Cross NC 1998 Anovel fusion between MOZ and the nuclear receptorcoactivator TIF2 in acute myeloid leukemia. Blood 91:3127–3133

83. Giles RH, Dauwerse JG, Higgins C, Petrij F, Wessels JW,Beverstock GC, Dohner H, Jotterand-Bellomo M, Falk-enburg JH, Slater RM, van Ommen GJ, Hagemeijer A,van der Reijden BA, Breuning MH 1997 Detection of CBPrearrangements in acute myelogenous leukemia with t(8;16). Leukemia 11:2087–2096

Molecular Endocrinology Launches E-Review

The Endocrine Society is pleased to announce the launch of E-Review, an online manu-script submission and review system. Molecular Endocrinology will be the first of TheEndocrine Society journals to use E-Review, beginning in April 2001, and will be followedby Endocrinology later this year.

With the advent of E-Review, the entire submission and review process will be managedelectronically. Abstracts and requests to review will be sent by e-mail to reviewers, who willlog on to the Rapid Review site from any computer with an internet connection, and retrievethe manuscript as a PDF. Reviewers can then complete their reviews online.

Beginning on April 2, authors will be able to submit their manuscripts electronically toMolecular Endocrinology. Look for links to E-Review on The Endocrine Society home pageat http://www.endo-society.org/, or go directly to http://www.rapidreview.com/TES/author.html. Click on “New to Rapid Review?” to create an account and submit a manu-script.

The Endocrine Society has long and eagerly anticipated the launch of E-Review, and theeditors and staff of Molecular Endocrinology look forward to working with our authors andreviewers in the new system. We are hopeful that it will expedite the review and publicationprocess, ensuring that your findings are published rapidly.

MOL ENDO · 2001 Vol. 15 No. 4500