JOURNAL OF BACTERIOLOGY, June 2004, p. 3561–3569 Vol. 186, No. 110021-9193/04/$08.00�0 DOI: 10.1128/JB.186.11.3561–3569.2004Copyright © 2004, American Society for Microbiology. All Rights Reserved.

The Essential Nature of the Ubiquitous 26-Kilobase Circular Repliconof Borrelia burgdorferi

Rebecca Byram,1,2 Philip E. Stewart,1 and Patricia Rosa1*Laboratory of Human Bacterial Pathogenesis, Rocky Mountain Laboratories, National Institute of Allergy and Infectious

Diseases, National Institutes of Health, Hamilton, Montana 59840,1 and Department of Molecular Biology,University of Wyoming, Laramie, Wyoming 820712

Received 22 December 2003/Accepted 9 February 2004

The genome of the type strain (B31) of Borrelia burgdorferi, the causative agent of Lyme disease, is composedof 12 linear and 9 circular plasmids and a linear chromosome. Plasmid content can vary among strains, butone 26-kb circular plasmid (cp26) is always present. The ubiquitous nature of cp26 suggests that it providesfunctions required for bacterial viability. We tested this hypothesis by attempting to selectively displace cp26with an incompatible but replication-proficient vector, pBSV26. While pBSV26 transformants contained thisincompatible vector, the vector coexisted with cp26, which is consistent with the hypothesis that cp26 carriesessential genes. Several cp26 genes with ascribed or predicted functions may be essential. These include theBBB29 gene, which has sequence homology to a gene encoding a glucose-specific phosphotransferase systemcomponent, and the resT gene, which encodes a telomere resolvase involved in resolution of the replicatedtelomeres of the linear chromosome and plasmids. The BBB29 gene was successfully inactivated by allelicexchange, but attempted inactivation of resT resulted in merodiploid transformants, suggesting that resT isrequired for B. burgdorferi growth. To determine if resT is the only cp26 gene essential for growth, we introducedresT into B. burgdorferi on pBSV26. This did not result in displacement of cp26, suggesting that additional cp26genes encode vital functions. We concluded that B. burgdorferi plasmid cp26 encodes functions critical forsurvival and thus shares some features with the chromosome.

The spirochete Borrelia burgdorferi is the causative agent ofLyme disease, the most common vector-borne disease in theUnited States. B. burgdorferi is maintained in its natural settingthrough a complex enzootic cycle between mammals and anixodid tick vector. In order to persist in the mouse-tick infec-tious cycle, B. burgdorferi has adapted for survival under verydifferent conditions, the tick vector and the mammal host.

B. burgdorferi has a segmented genome consisting of onelinear chromosome that is �911 kb long and 12 linear and 9circular plasmids (3–5, 11, 16). The ends of the linear DNAmolecules are composed of covalently closed hairpin invertedrepeats or telomeres (4, 9, 10, 19, 21, 22). The functions ofmany of the plasmid-encoded genes have not been determined,but increasing evidence suggests that plasmid-derived func-tions are important for spirochete infectivity and transmission(27, 34, 41). For example, the 25-kb linear plasmid lp25 carriesthe pncA gene, which encodes a nicotinamidase that is re-quired for spirochete survival in mice (33). In addition, strainslacking lp28-1, which contains the vmp-like sequence (VlsE)involved in antigenic variation, show reduced infectivity inmice (27, 34). Outer surface protein A (OspA), encoded bylp54, is upregulated in the tick midgut and is thought to play animportant role in bacterial persistence in the vector (42–44).Finally, OspC is carried by the circular plasmid cp26. Spiro-chetes present in the midgut of an unfed tick express OspA.During tick feeding, the spirochetes begin downregulatingOspA and expressing OspC (44), suggesting that OspC is im-

portant for vector-to-host transmission (13, 17, 18, 32, 42, 44,45).

Although B. burgdorferi plasmid-encoded functions are re-quired for survival in the infectious cycle, loss of individualplasmids can be observed after limited in vitro propagation,and loss of most circular plasmids and all linear plasmids hasbeen described for high-passage B. burgdorferi (39, 41).However, the loss of cp26 has never been observed, and thisplasmid is present in all isolates that have been examined(11, 20, 29, 48), suggesting that it carries essential genes. Alikely candidate for an essential gene present on cp26 isresT, which encodes a telomere resolvase involved in reso-lution of the replicated telomeres of the linear chromosomeand plasmids (Fig. 1) (12, 24, 52). Another cp26 gene,BBB29, shows homology to a glucose-specific phosphotrans-ferase system component (Fig. 1). Borrelia can obtain energyfrom the fermentation of glucose to lactic acid (16, 23), andthe product of the BBB29 gene is presumably involved intransport of glucose into the cell. In this study we examinedwhether cp26 is required for cell viability by attempting toselectively displace this plasmid with an incompatible vec-tor. Transformation with a presumably incompatible, butreplication-proficient vector did not result in displacementof the endogenous cp26 plasmid, which is consistent with thehypothesis that cp26 carries essential genes. Subsequently,we attempted to inactivate the constituent BBB29 and resTgenes to determine if the gene products are required forspirochete survival. Our findings suggest that resT is physi-ologically essential and that cp26, as previously proposed,encodes functions generally associated with a stablegenomic element, like the chromosome (2, 24).

* Corresponding author. Mailing address: 903 S. 4th St., Hamilton,MT 59840. Phone: (406) 363-9209. Fax: (406) 363-9394. E-mail:prosa@niaid.nih.gov.

3561

MATERIALS AND METHODS

B. burgdorferi strains and growth conditions. All B. burgdorferi strains werecultivated in liquid BSK-H complete medium (Sigma) at 35°C with 1% CO2 (37).B31 clone A (B31-A) is a noninfectious derivative of type strain B31 (� ATCC35210), which was isolated from a tick collected on Shelter Island in New York(8).

Construction of plasmids pBSV26, pBSV26G, and pBSV26resT2. The primersequences used in this study were based on the previously described B31 genomesequence (16) and are shown in Table 1. A 3.4-kb region of cp26 homologous tothe previously identified sequences required for plasmid autonomy (BBB10 toBBB13) (14, 46, 47) was amplified with primers 1 and 2 and cloned into thepCR-XL-TOPO vector (Invitrogen) by using the Expand Long Template PCRsystem (Roche Molecular Biochemicals). A fragment encompassing the BBB10-BBB13 region was removed from pCR-XL-TOPO by SpeI digestion and ligatedinto the pOZK vector (47) digested with SpeI to obtain pBSV26. Briefly, thepOZK vector contains a kanamycin resistance cassette fused to the B. burgdorferi

flgB promoter that confers resistance in Borrelia and Escherichia coli, a zeocinresistance cassette, an E. coli origin of replication, and a multiple cloning site.

The flgBP::aacC1 cassette conferring gentamicin resistance (15) was amplifiedwith primers 8 and 13 and cloned into the pCR-XL-TOPO vector (Invitrogen) byusing Taq DNA polymerase (New England Biolabs). The flgBP::aacC1 cassettewas removed from pCR-XL-TOPO by XhoI digestion and ligated into pBSV26digested with SalI to obtain pBSV26G.

To create pBSV26resT, the resT gene was amplified with primers 3 and 4 andcloned into the TOPO-XL vector (Invitrogen) with a 347-bp 5� flanking sequenceby using the Expand Long Template PCR system (Roche). The resT fragmentwas subsequently removed from the TOPO-XL vector by SalI digestion andligated into the multiple cloning site of the pBSV26 plasmid digested with SalI toobtain plasmid pBSV26resT.

Construction of a resT inactivation plasmid. A 1.5-kb region of cp26 spanningthe resT gene was amplified from B31-A genomic DNA with primers 3 and 4 andcloned into the pCR-XL-TOPO vector (Invitrogen) by using Taq polymerase

FIG. 1. Graphic representation of the B. burgdorferi strain B31 cp26 plasmid. The approximate sizes and orientations of the 29 ORFs carriedby cp26 are indicated. Genes on cp26 that exhibit homology to genes whose functions are known or that are of significant interest are labeled andindicated by arrows having different colors. Genes on cp26 whose functions are unknown are indicated by gray arrows. PTS, phosphotransferasesystem.

3562 BYRAM ET AL. J. BACTERIOL.

(Perkin-Elmer). A 375-bp deletion in the resT gene from nucleotide 627 tonucleotide 1002 was constructed by using primers 5 and 6 in an inverse PCRperformed with the Expand Long Template PCR system (Roche) to createplasmid XL-resT�627-1002. The flgBP::aacC1 (15) gene cassette was amplified withprimers 7 and 8 and cloned into the TOPO-pCR2.1 vector (Invitrogen) with Taqpolymerase (New England Biolabs). The flgBP::aacC1 gene cassette was removedfrom the TOPO-pCR2.1 vector by ClaI digestion and ligated into XL-resT�627-1002digested with ClaI to create plasmid XL-resT�627-1002::flgBP::aacC1.

Construction of a BBB29 inactivation plasmid. A 2.4-kb region of cp26 thatincluded the full-length BBB29 gene was amplified from B31-A genomic DNAwith primers 9 and 10 and cloned into the pCR-XL-TOPO vector (Invitrogen) byusing Taq polymerase (Perkin-Elmer). A 469-bp deletion in the BBB29 genefrom nucleotide 631 to nucleotide 1100 was constructed by an inverse PCR byusing the Expand Long Template PCR system (Roche) and primers 11 and 12 tocreate plasmid XL-BBB29�631-1100. The flgBP::kan (6) gene cassette was am-plified with primers 13 and 14 and cloned into the TOPO-pCR2.1 vector (In-vitrogen) with Taq polymerase (New England Biolabs). The flgBP::kan genecassette was removed from the TOPO-pCR2.1 vector by XhoI restriction enzymedigestion and ligated into XL-BBB29�631-1100 digested with SalI to createplasmid XL-BBB29�631-1002::flgBP::kan.

Transformation of B. burgdorferi. Transformation of B. burgdorferi by electro-poration was performed as described by Elias et al. (15). Briefly, 10 �g of plasmidDNA was resuspended in 10 �l of H2O and electroporated into B. burgdorferi.Following electroporation, the cells were resuspended in 5 ml of BSK-H com-plete medium (Sigma) and allowed to recover for 20 to 24 h at 35°C. Thespirochetes were then plated onto solid BSKII medium supplemented with either200 �g of kanamycin ml�1 or 40 �g of gentamicin ml�1 (40).

Screening of B. burgdorferi transformants. B. burgdorferi colonies that arose onselective media containing antibiotics were inoculated into 20-�l PCR mixtureswith sterile toothpicks. PCR performed with primers specific for the kanamycincassette (primers 15 and 16) was used to identify shuttle vector transformants.Allelic exchange transformants were first screened for the presence of the kana-mycin resistance cassette (BBB29 inactivation) by using primers 15 and 16 or forthe presence of the gentamicin resistance cassette (resT inactivation) by usingprimers 7 and 8. Transformants bearing the kanamycin resistance cassette werescreened for inactivation of the BBB29 gene with primers 9 and 10. Transfor-mants containing the gentamicin antibiotic resistance cassette were screened forinactivation of the resT gene with primers 3 and 4. The PCR conditions were94°C for 2 min, followed by 30 cycles of 94°C for 45 s, 55°C for 45 s, and 68°C for3 min in a GeneAmp PCR system 9700 thermal cycler (Perkin-Elmer). PCRproducts were separated by agarose gel electrophoresis and were visualized byethidium bromide staining. Colonies of candidate transformants were aspiratedwith a sterile Pasteur pipette, placed in 5 ml of liquid BSK-H medium (Sigma),and allowed to grow to the mid-log to late log phase. Total genomic DNA wasthen isolated from these cultures with a Wizard genomic DNA purification kit(Promega). PCR performed with total genomic DNA by using primers specificfor the shuttle vectors or cp26 genes was used to further confirm the presence offoreign DNA or the structure of targeted loci in transformants.

Southern hybridization analysis. Total genomic DNA of B. burgdorferi wasisolated from 5-ml cultures by using a Wizard genomic DNA purification kit(Promega). In addition, B. burgdorferi plasmid DNA was isolated from 100-mlcultures by using a Qiagen Plasmid Hi-Speed maxi kit (Qiagen). Approximately600 ng of genomic DNA or 500 ng of plasmid DNA was separated by gelelectrophoresis on a 0.3% agarose gel and visualized by ethidium bromidestaining. Alternatively, approximately 500 ng of DNA was digested for 12 to 20 hwith selected restriction enzymes and subsequently separated by field inversiongel electrophoresis on a 0.8% agarose gel. The gels were electrophoresed at 80V for 40 min, and then program 3 (reverse, 0.05 to 1.601; forward, 0.15 to 4.803;one cycle, 2 min 3.9 s) was begun with an MJ Research PPI-200 programmablepower inverter at 80 V for 22 h. Genomic or plasmid DNA was depurinated,denatured, and neutralized, and then it was blotted onto a Biotrans nylon mem-brane (ICN). A UV Stratalinker 1800 (Stratagene) was used to cross-link theDNA to the membrane.

The kan-, aacC1-, and cp26-specific probes were labeled with 32P by using theRandom Primers DNA labeling system (Invitrogen) according to the manufac-turer’s recommendations. Prehybridization was done at 65°C for 2 h in 50 ml ofBlotto solution (6� SSC, 0.1% sodium dodecyl sulfate [SDS], 0.5% nonfat drymilk, 1 mM sodium pyrophosphate [1� SSC is 0.15 M NaCl plus 0.015 M sodiumcitrate]). Hybridization was performed at 65°C in 30 ml of Blotto solution for 32to 48 h. The washes, all of which were at 65°C for 10 to 12 min, consisted of onewash in 2� SSC–0.1% SDS, followed by three washes in 0.2� SSC–0.1% SDS.The membrane was then placed in an X-ray film cassette and exposed to X-rayfilm with an intensifier screen for various amounts of time. Probes were strippedfrom membranes by boiling the membranes in 0.1% SDS for 45 min.

Stability assays. B. burgdorferi transformants were grown in the presence orabsence of the antibiotic for which they carried a resistance cassette. Transfor-mants were grown to the mid-log phase (5 � 107 to 9 � 107 bacteria ml�1) in 5ml of BSK-H medium (Sigma) at 35°C. At each passage, cultures were inoculatedat a starting concentration of �1.0 � 104 spirochetes ml�1 and grown to themid-log phase. Each passage represented �13 generations (8 � 10�3 dilution).Cells were counted by dark-field microscopy with a Petroff-Hauser countingchamber before each passage. Cultures were plated at different points during invitro passage, and 20 colonies from each culture were screened by PCR todetermine the presence of the relevant antibiotic resistance cassettes.

RESULTS

Attempted displacement of cp26 through introduction of anincompatible plasmid. The circular plasmid cp26 is present inall isolates of B. burgdorferi that have been examined, and therehave been no reports of loss of this plasmid during in vitrogrowth. Because spontaneous loss of cp26 has not been ob-served, we hypothesized that an incompatible plasmid couldcoexist with, rather than displace, endogenous cp26. Plasmid

TABLE 1. Primers used in this study

Primer Designation Sequence Purpose

1 BBB10-13SpeI ACTAGTCTTACGGAGAAAAGGG Construction of pBSV262 BBB10-13RCSpeI ACTAGTGGATTAGAAGATTTAAGC Construction of pBSV263 BBB03-5SalI GTCGACCCCAAATATATTGATAATGCC Construction of pBSV26resT4 BBB03-3BSalI GTCGACGTATTTACCTTTATTAAAGCG Construction of pBSV26resT5 ResT627-ClaI-RC CCATCGATTGGAGCAGACTGAGAATCTTACTAAA resT inactivation construct6 ResT1002-ClaI-F CCATCGATTTGAAAATAGGACTTCTCATCATTC resT inactivation construct7 FlgP-ClaI ATCGATGAACTAATACCCGAGCTTCAAGGAG Amplification of flgBP::aacC18 3Gent-ClaI ATCGATGCGGATCTCGGCTTGAACG Amplification of flgBP::aacC19 BBB29-5-2-Bam GGATCCCTGTGAAAAATCTAAAACCAACACCTTGC BBB29 inactivation construct10 BBB29-3Bam GGATCCGCAATGCTTTATAACAAATGCCATG BBB29 inactivation construct11 BBB29-631SalIR GTCGACCAGTTGCAGCTGTTTCAGGC BBB29 inactivation construct12 BBB29-1100SalF GTCGACGCAGATCCCAATACTG BBB29 inactivation construct13 flgBPo-XhoI TAATACTCGAGCTTCAAGGAAGATTT Amplification of flgBP::kan14 KanTerm-Xho ATCTCGAGCTAGCGCCGTCCCGTCAA Amplification of flgBP::kan15 flgPo.Not GCGGCCGCTACCCGAGCTTCAAGGAAGATT Examination of B. burgdorferi

transformants16 RC.Tkan GCGCCGTCCCGTCAAGTC Examination of B. burgdorferi

transformants

VOL. 186, 2004 ESSENTIAL NATURE OF B. BURGDORFERI cp26 PLASMID 3563

incompatibility occurs when two plasmid species with identicalreplication and/or partitioning functions compete, culminatingin loss of one of the plasmids (1). Similarly, a 3.3-kb region ofthe cp9 plasmid of B. burgdorferi sufficient for autonomousreplication has been identified and used to create Borreliashuttle vector pBSV2 (47). This shuttle vector displaces cp9due to plasmid incompatibility. In addition, vectors carryingparalogous regions of other B. burgdorferi plasmids have beendemonstrated to be sufficient for autonomous replication andto displace the endogenous plasmids from which they werederived, demonstrating that incompatibility functions are alsoconferred by these open reading frames (ORFs) (14, 46, 47).Therefore, we constructed a vector, designated pBSV26, com-posed of a 3.4-kb region of cp26 encoding four tandem ORFsthat exhibit homology with the previously identified sequencesrequired for plasmid replication and incompatibility (14, 46,47) (Fig. 2A).

Displacement of the endogenous cp26 plasmid was at-tempted by transforming clone B31-A with pBSV26; multiplepBSV26 transformants were confirmed by PCR screening ofcolonies for the kanamycin resistance cassette. The transfor-

mation frequency of pBSV26 in high-passage B31-A was 6.8 �10�6, which is similar to the transformation frequency ob-tained when the previously characterized shuttle vector pBSV2was transformed into the same B. burgdorferi strain (1.4 �10�6) (Table 2). In order to determine if pBSV26 had dis-placed the endogenous cp26 plasmid or coexisted with it, thesame pBSV26 transformants were screened by PCR for se-quences unique to cp26. A cp26 PCR product was obtainedfrom all pBSV26 transformants (data not shown), suggestingthat pBSV26 coexisted with the endogenous cp26 plasmid.

Southern blot analysis of undigested genomic DNA was per-formed to confirm the presence of cp26 in pBSV26 transfor-mants (Fig. 3A). DNA species consistent with a supercoiled,autonomously replicating plasmid hybridized with the kanprobe in three of six pBSV26 transformants examined (Fig. 3A,lanes 6 to 8). In the remaining three transformants, the kan

FIG. 2. (A) Shuttle vector derived from cp26 (pBSV26). (B) cp26-derived shuttle vector carrying the resT gene (pBSV26resT). Relevantrestriction sites are indicated. ColE1, E. coli origin and replication;ZEO, zeocin resistance marker; flgBp::kan, kanamycin resistancemarker fused to the flgB promoter (6).

FIG. 3. Southern blot analysis of B. burgdorferi pBSV26 transfor-mants. Wild-type B. burgdorferi DNA (lane 1), pBSV26 plasmid DNAisolated from E. coli (lane 2), and pBSV26 B. burgdorferi transformantDNA (lanes 3 to 8) were used. (A) Southern blot of genomic DNA wasfirst probed with the kanamycin resistance gene. (B) Southern blot ofgenomic DNA was stripped and then probed with the cp26 gene ospC.An asterisk indicates the position of the endogenous, supercoiled formof cp26, while a solid square indicates the position of the supercoiled,extrachromosomal shuttle vector. A solid circle indicates the positionof the supercoiled cp26 with the pBSV26 integrant, and a solid triangleindicates the position of the supercoiled cp26 dimer with the pBSV26integrant. Unmarked higher-molecular-weight bands are linear formsof the circular plasmid that were a result of plasmid DNA preparation.The positions of DNA size standards (in kilobases) are indicated onthe left.

TABLE 2. Transformation frequencies of B. burgdorferi strains

PlasmidTransformation frequencya

B31-A (naıve) B31-A (cured of pBSV26)

pBSV2 1.4 � 10�6 1.2 � 10�3

pBSV26 6.8 � 10�6 8.4 � 10�5 9.5 � 10�5

pBSV26 rescued DNA 8.1 � 10�6 NDb

a The transformation frequency was calculated by determining the ratio of thenumber of transformants to the number of CFU as determined by growth of theelectroporated culture on selective and nonselective media.

b ND, not determined.

3564 BYRAM ET AL. J. BACTERIOL.

probe hybridized to larger DNA species, which is consistentwith integration of pBSV26 into a cp26 monomer (Fig. 3A,lanes 3 and 4) or dimer (Fig. 3A, lane 5). The blot was thenstripped and probed with ospC in order to visualize cp26 (Fig.3B). A band that comigrated with the endogenous cp26 plas-mid of B31-A (Fig. 3B, lane 1) was present in three of sixtransformants examined (Fig. 3B, lanes 6 to 8), whereas aslightly larger band, which also hybridized to the kan probe,was present in the remaining transformants (Fig. 3B, lanes 3 to5). These results suggest that pBSV26 either autonomouslyreplicates within borreliae (Fig. 3B, lane 6 to 8) or integratesinto a cp26 monomer (Fig. 3B, lanes 3 and 4) or dimer (Fig.3B, lane 5). Two of six transformants examined represented amixed cp26 population (Fig. 3B, lanes 6 and 7), in whichpBSV26 both replicated autonomously and integrated into theendogenous cp26 plasmid. Thus, in all cases pBSV26 coexistedwith the endogenous cp26 plasmid, suggesting that cp26 cannotbe displaced by an incompatible plasmid.

Stability of the pBSV26 vector. Due to plasmid incompati-bility, we speculated that an autonomously replicating form ofpBSV26 would be lost within a population if selection wereremoved. In order to determine the stability of pBSV26 in B.burgdorferi, transformants with autonomously replicating (Fig.3, lanes 8) and integrated (Fig. 3, lanes 3) forms of pBSV26were serially passaged with or without kanamycin selection.The cultures were plated after 35 and 70 generations, and theresulting colonies were examined by PCR screening for thepresence of pBSV26. All 20 colonies of B. burgdorferi carryingthe integrated form of pBSV26 retained the plasmid sequencesafter 70 generations, both with and without kanamycin selec-tion. With kanamycin selection, all 20 colonies derived fromthe autonomously replicating form of pBSV26 retained thevector after 35 generations, whereas when kanamycin selectionwas not present, none of the 20 colonies derived from the sameclone contained pBSV26 sequences.

Southern blot analysis was performed with uncut genomicDNA from pBSV26 transformants after in vitro passage withkanamycin to determine if pBSV26 was still replicating auton-omously after 35 generations of growth (data not shown). Boththe kan and ospC probes hybridized to a large DNA speciesconsistent with a pBSV26 integrant. Thus, after 35 generationsof growth with selection, pBSV26 was stably maintained in thegenome by integration into the cp26 plasmid.

We conducted the following experiments to determine ifmutations arose in either cp26 or pBSV26 that permitted co-existence of the two plasmids in the same cell. A B. burgdorfericlone that had been cured of pBSV26 (by passage withoutantibiotic selection) was retransformed with pBSV26. In addi-tion, pBSV26 rescued from B. burgdorferi was retransformedinto naıve spirochetes. The transformation frequencies weredifferent in different experiments, but they were similar tothose obtained previously with pBSV26 (Table 2). We con-cluded that cp26 and pBSV26 are incompatible plasmids thatcoexist within transformants because of inherent (cp26) andimposed (pBSV26) selective pressures and that mutations thatenhanced compatibility did not arise in either plasmid. Sur-prisingly, transformation with control plasmid pBSV2 intocured B31-A was �1,000-fold higher than transformation withcontrol plasmid pBSV2 into naıve B31-A (Table 2). The basisfor this stimulation of transformation is unknown, but the data

do not suggest that a mutation arose in cp26 because pBSV2was derived from an unrelated plasmid, cp9, and transforma-tion with pBSV26 was not stimulated to a similar extent.

Since pBSV26 did not displace cp26, we asked whether thecp26 sequences present on the shuttle vector actually causeincompatibility. To examine this question, we constructed aclosely related shuttle vector, pBSV26G, which carried thesame cp26 sequences as pBSV26 but a different selectablemarker (a gentamicin resistance cassette). Electroporation ofpBSV26G into a B. burgdorferi clone that contained an auton-omously replicating pBSV26 plasmid (kanamycin resistant) re-sulted in multiple gentamicin-resistant transformants. In orderto determine if pBSV26G had displaced pBSV26, transfor-mants were screened by using a primer internal to the B.burgdorferi cp26 sequences together with a primer for the gen-tamicin resistance cassette (pBSV26G) or the kanamycin re-sistance cassette (pBSV26). With all transformants, we ob-tained a PCR product that was consistent with the solepresence of gentamicin-resistant pBSV26G (data not shown).In addition, only gentamicin-resistant E. coli colonies contain-ing pBSV26G arose when plasmids were rescued from B. burg-dorferi transformants (data not shown). We concluded thatpBSV26G displaces pBSV26, demonstrating that incompatibil-ity features are present in the cp26 sequences carried by theseplasmids.

Putative essential elements of cp26. The finding that cp26 isnot displaced by an incompatible plasmid is consistent with thehypothesis that cp26 encodes essential functions. To examineparticular cp26 genes required for in vitro growth, genes en-coding a telomere resolvase, resT (24), and a homolog of aglucose transporter component, BBB29 (16), were targeted forinactivation by allelic exchange. Recovery of mutants in whichthese genes were inactivated would demonstrate that they arenot essential for in vitro growth, whereas inactivation of essen-tial genes would result in a lethal phenotype.

Inactivation of BBB29 by allelic exchange was attempted bytransformation of B31-A with plasmid XL-BBB29� (Fig. 4A).PCR products consistent with an allelic exchange event wereobtained when transformants were screened with primers spe-cific for the BBB29 gene (data not shown). Southern blotanalysis of transformants digested with selected restriction en-zymes was performed to confirm gene inactivation. DNA spe-cies consistent with an inactivated BBB29 gene were observedwhen the blot was probed with the kan cassette (data notshown). BBB29 mutants were viable in vitro, although thedoubling time was slightly longer than that of the wild type.Thus, inactivation of BBB29 by allelic exchange demonstratedthat the gene product is not required for B. burgdorferi growthin vitro.

Inactivation of the resT gene by allelic exchange was at-tempted in B31-A with plasmid XL-resT� (Fig. 4B). Whentransformants were screened by PCR with primers specific forthe resT gene, products consistent with both wild-type andmutant resT were obtained (data not shown). These resultssuggested that the XL-resT� transformants contained two al-leles of resT, wild-type and mutant, and were diploid at thislocus (referred to as merodiploid below). Southern blot anal-ysis of plasmid DNA from an XL-resT� transformant digestedwith BglI (which linearized cp26) or NcoI and SpeI (which cutwithin resT flanking sequences) was performed to confirm the

VOL. 186, 2004 ESSENTIAL NATURE OF B. BURGDORFERI cp26 PLASMID 3565

merodiploid nature of the resT mutants (Fig. 5). An inactivatedcopy of resT was observed in transformant DNA digested withNcoI and SpeI and probed with the gentamicin resistancecassette (aacC1) (Fig. 5A, lane tx-NcoI/SpeI). Additionally, aDNA species consistent with a wild-type copy of resT wasobserved in both the parent (Fig. 5B, lane wt-NcoI/SpeI) andthe transformant (Fig. 5B, lane tx-NcoI/SpeI) DNA digestedwith NcoI and SpeI when the blot was stripped and reprobedwith resT. No noticeable difference in the size of linearizedcp26 was observed between the transformant and wild type,suggesting that the plasmid carrying the allelic exchange con-struct had not integrated into cp26 (Fig. 5B, lanes wt-BglI andtx-BglI3). Thus, the XL-resT� transformants were merodip-loid, carrying both a wild-type copy and a mutant copy of resT.Therefore, inactivation of resT did occur via allelic exchange,but a wild-type copy of resT was always present, supporting thehypothesis that telomere resolvase is essential for B. burgdorferigrowth.

Stability of mutant resT plasmid. Because XL-resT� trans-formants were merodiploid for resT, we speculated that thestability of a cp26 monomer carrying an inactivated copy ofresT would be compromised. In contrast, dimers of cp26 havealso been described previously and are stable during in vitropassage (51). We hypothesized that if allelic exchange occurredat one of two resT loci on a cp26 dimer, a B31-A resT� trans-formant would maintain the inactivated copy of resT through-out many generations. To test this hypothesis, two B31-A

resT� transformants (clones A and B) were serially passagedwith or without gentamicin selection. The cultures were platedafter 26 and 52 generations, and the resulting colonies werescreened for the presence of the aacC1 cassette. All 20 colo-nies derived from both B31-A resT� transformants retainedthe mutant copy of resT when they were passaged with genta-micin selection. Southern blot analysis was performed withuncut and NcoI/SpeI-digested genomic DNA from B31-AresT� clones A and B before serial passage, with and withoutantibiotic selection. In transformant clone A, cp26 was presentin the monomer form, whereas cp26 of transformant clone Bwas present as a dimer (data not shown). When B31-A resT�clone A was passaged without selection, only 3 of 20 (15%) ofthe colonies after 26 generations and none of the 20 coloniesafter 52 generations contained the mutant copy of resT. Incontrast, all 20 of the colonies derived from B31-A resT� cloneB contained the mutant copy of resT after 52 generations.Thus, the merodiploid nature of XL-resT� transformants canbe explained by recombination of resT� into one copy of resTon a cp26 dimer or by allelic exchange at the resT locus of oneof several coexisting cp26 monomers.

FIG. 4. Targeted inactivation of BBB29 and resT. (A) Organizationof BBB29 and flanking genes on cp26. Also shown are the deletion of469 bp of BBB29 and insertion of the kanamycin resistance cassette.The small arrows indicate the cp26 fragment used in the allelic ex-change construct for inactivation of BBB29. (B) Organization of resTand flanking genes on cp26. Also shown are the deletion of 375 bp ofresT and the insertion of the gentamicin resistance cassette(flgBP::aacC1). Relevant restriction sites are indicated. The small ar-rows indicate the cp26 fragment used in the allelic exchange constructfor inactivation of resT.

FIG. 5. Southern blot analysis of transformants with a resT inacti-vation construct. Wild-type B. burgdorferi (wt) and XL-resT� transfor-mant (tx) plasmid DNA were digested with BglI, which cut once withincp26 and linearized the plasmid, and with NcoI and SpeI, whoserestriction sites flanked the resT gene. (A) The blot was first probedwith the gene that confers gentamicin resistance, aacC1. (B) The sameblot was stripped and then probed with the resT gene. The positions ofNcoI and SpeI fragments corresponding to the mutant and wild-typecopies of resT are indicated. The positions of DNA size standards (inkilobases) are indicated on the left.

3566 BYRAM ET AL. J. BACTERIOL.

Attempted displacement of cp26 through introduction of aplasmid carrying resT. We were not able to eliminate resT byallelic exchange, which is consistent with the hypothesis thattelomere resolution is required for B. burgdorferi growth. Todetermine if resT is the sole cp26 gene that encodes a criticalfunction, we cloned resT in pBSV26 and examined whether theconstruct was sufficient to displace cp26. The resT gene with347 bp of 5� flanking sequence was cloned into the multiplecloning site of pBSV26 to create plasmid pBSV26resT (Fig.2B). Displacement of the endogenous cp26 plasmid was at-tempted by transforming clone B31-A with pBSV26resT; 67transformants were confirmed by PCR screening of coloniesfor the presence of the kanamycin resistance cassette. To in-vestigate if pBSV26resT had displaced the endogenous cp26plasmid or coexisted with cp26, the transformants werescreened by PCR for the presence of the ospC gene, which iscarried by cp26. PCR products of the predicted size wereobtained for all 67 pBSV26resT transformants (data notshown), suggesting that endogenous cp26 was still present aftertransformation with pBSV26resT. A Southern blot ofpBSV26resT transformants was probed for the kan gene (Fig.6A), stripped, and then probed for ospC (Fig. 6B), and theresults were similar to those seen with pBSV26 transformants.The pBSV26resT plasmid either autonomously replicated withcp26 or had integrated into cp26 (Fig. 6). Thus, pBSV26resTcoexisted with, but was not sufficient to displace, cp26, which

further suggests that cp26 encodes crucial functions in additionto resT.

DISCUSSION

The B. burgdorferi circular plasmid cp26 is present in allnatural isolates; it has never been observed to be lost during invitro growth, and it cannot be displaced by an incompatibleplasmid. These findings argue that cp26 encodes gene productsrequired for spirochete survival, such as the telomere re-solvase, ResT. The ResT enzyme resolves the replicated telo-meres of both the linear chromosome and the linear plasmidDNA molecules (24). As demonstrated in this study, cp26genes other than resT also may be required for in vitro growth,because a cp26-based shuttle vector carrying the resT gene wasnot sufficient to displace the endogenous plasmid. However,the identities of additional cp26 genes crucial for in vitrogrowth remain to be determined. Alternatively, the resT geneon pBSV26 may not be adequately expressed and thus may beincapable of displacing the endogenous resT gene on cp26.

Of the 29 ORFs present on cp26, 14 exhibit sequence ho-mology with genes whose functions are known. The proportionof recognizable genes carried by cp26 is quite large comparedto the proportion of recognizable genes carried by other plas-mids in the B. burgdorferi plasmid genome. By comparison,linear plasmid lp25, which is approximately the same size ascp26, carries only two genes (in addition to the genes requiredfor plasmid maintenance) that have been characterized andexhibit sequence homology with genes whose functions areknown (16, 33). The pncA gene (BBE22) encodes a nicotinami-dase, and the BBE02 gene exhibits sequence homology to agene encoding a restriction-modification system (16, 28, 33).Of the 14 cp26 genes with proposed functions, the BBB10(paralogous family [pf] 62), BBB11 (pf 50), BBB12 (pf 32), andBBB13 (pf 49) genes belong to paralogous gene families in-volved in plasmid replication and partitioning (11) (Fig. 1).Shuttle vectors containing these sequences from other B. burg-dorferi plasmids replicate autonomously in borreliae and dis-place the plasmid from which they were derived, suggestingthat both replication and partitioning functions, as well asincompatibility, are conferred by these gene families (14, 46,47). Additionally, shuttle vectors composed of these cp26genes but carrying different antibiotic resistance markers dis-place each other, which is consistent with plasmid incompati-bility functions. Based on frequencies of transformation into acured strain or with a rescued plasmid, we concluded that nomutations had arisen in cp26 or pBSV26 that enhanced thecompatibility of the two plasmids in the same cell. Interest-ingly, we observed that transformation with the control plas-mid, pBSV2, was �1,000-fold higher into a B31-A strain curedof pBSV26 than into naıve B31-A. Transformation of B. burg-dorferi is influenced by many factors and can vary with eachexperiment (28, 49), and although the data are intriguing, thebasis for this stimulation of transformation is not understood.

Proposed or known functions have also been determined forchbC (50), oppAIV (7), and guaB (30, 51, 53) (Fig. 1), all ofwhich have been successfully inactivated without inhibition ofin vitro growth. The BBB29 gene exhibits significant sequencehomology to a glucose-specific phosphotransferase systemcomponent and thus is hypothesized to be important for B.

FIG. 6. Southern blot analysis of pBSV26resT transformants. Wild-type B. burgdorferi DNA (lane 1), pBSV26resT plasmid DNA isolatedfrom E. coli (lane 2), and pBSV26resT transformant DNA (lanes 3 to8) were used. (A) Southern blot of genomic DNA was first probed withthe kanamycin resistance gene. (B) The same Southern blot wasstripped and then probed with the cp26 gene ospC. An asterisk indi-cates the position of the endogenous, supercoiled form of cp26, whilea solid square indicates the position of the supercoiled, extrachromo-somal shuttle vector pBSV26resT. A solid circle indicates the positionof the supercoiled cp26 monomer with a pBSV26resT integrant, and asolid triangle indicates the position of a cp26 dimer with a pBSV26resTintegrant. Unmarked higher-molecular-weight bands are linear formsof the circular plasmid that were a result of plasmid DNA preparation.The positions of DNA size standards (in kilobases) are indicated onthe left.

VOL. 186, 2004 ESSENTIAL NATURE OF B. BURGDORFERI cp26 PLASMID 3567

burgdorferi survival. However, inactivation of the BBB29 geneby allelic exchange occurred, and BBB29 mutants displayedonly a slight growth defect during in vitro cultivation. Thefunction of the BBB29 gene product is most likely redundantsince this gene product exhibits significant amino acid similar-ity (53%) with the product of the BB0645 gene present on thechromosome, which is also homologous to a glucose-specificphosphotransferase system component (16). It is also possiblethat B. burgdorferi can utilize other carbohydrates as alterna-tives to glucose, since genes with homology to fructose, mal-tose, glucosamine, and glycerol transporter components havebeen identified in the genome (16). Although not previouslyrecognized (16), the products of the BBB22 and BBB23 genespresent on cp26 exhibit amino acid homology to a family ofguanine-xanthine transporters. The BBB22 and BBB23 genesare quite similar and may represent a gene duplication event.The remaining 13 genes present on cp26 do not exhibit signif-icant sequence homology with genes whose functions areknown and are uncharacterized. The B. burgdorferi cloneB31-A used in this study is a noninfectious derivative of typestrain B31. Although clones that are mutated at a cp26 locus donot display a noticeable growth phenotype when they are cul-tivated in vitro, the effect that such mutations would have onspirochete viability in vivo cannot be examined until mutationsare introduced into an infectious clone.

A cp26 gene that encodes a putatively critical function isresT, which encodes the telomere resolvase. ResT catalyzesresolution of the replicated telomeres and generates the hair-pin ends on the linear chromosome and plasmids of B. burg-dorferi in the absence of any accessory proteins or cofactors(24, 52). There are no other candidates for a telomere re-solvase gene in the B. burgdorferi genome (16, 24). Hence,ResT is presumably required for effective replication of linearDNA molecules, which include the chromosome. The resTgene exhibits sequence homology to the gene encoding TelN,which resolves the replicated telomeres of the linear coliphageN15 (12, 24, 35, 36, 38). An N15 derivative in which the telNgene had been inactivated was not maintained in daughter cellsunless a functional telN gene was provided in trans (36). Similarto the situation in N15, inactivation of the B. burgdorferi resTgene was not possible and resulted in merodiploid transfor-mants carrying both a mutant and wild-type copy of resT. Theinability to recover a resT mutant was probably due to therequirement for the gene product to resolve linear chromo-somal and plasmid replication intermediates. This provides alimited explanation for why cp26, which carries resT, cannot belost. A caveat to this conclusion, however, is that the data arecircumstantial, albeit convincing. More definitive proof of theessential nature of cp26 and the function of ResT awaits theability to create a conditional ResT mutant, a genetic tool notcurrently available for B. burgdorferi.

The copy number of B. burgdorferi plasmids is not clearlydefined; however, Hinnebusch and Barbour (20) concludedthat the copy number of cp26 in the cell is equivalent to thecopy number of the chromosome. Morrison et al. (31), usingquantitative PCR, concluded that the copy number of the B.burgdorferi chromosome is approximately one copy per cell.Thus, the copy number of cp26 is presumably also approxi-mately one copy per cell. We demonstrated that antibioticselection, coupled with the pressure to maintain a functional

copy of an important gene (resT), results in a B. burgdorferimerodiploid, whose copy number may deviate slightly from thenormal copy number. This genotype was maintained in differ-ent forms. In some transformants, it appeared that two distinctcp26 monomers were present in individual bacteria, whereas inother transformants, cp26 was present as a heterozygousdimer. The occurrence of cp26 dimers has been describedpreviously by Tilly et al. (51), and the dimers were shown to be�90% stable for up to 120 generations. Thus, B. burgdorferinaturally has at least two copies of every cp26 gene, includingresT, when cp26 exists as a dimer in the cell.

The cp26 plasmid likely encodes at least one essential func-tion, so has it been misrepresented as a plasmid when it is trulya minichromosome? A plasmid is defined as an autonomouslyreplicating DNA molecule that encodes nonessential functions(26). In contrast, a bacterial chromosome is a genetic elementthat is necessary, as well as sufficient, to support bacterialgrowth (25). Telomere resolution encoded by cp26 is no doubtrequired for replication of both the linear chromosome andlinear plasmids, and therefore cp26 is necessary, but not suf-ficient, for growth of the organism. Conversely, the B. burgdor-feri plasmids presumably require chromosomally encoded rep-lication proteins, such as DNA polymerase. Thus, the B.burgdorferi linear chromosome and cp26 are both required formaintenance of the bacterial genome. Therefore, it appearsthat the B. burgdorferi genome does not have a single geneticelement that entirely fits the definition of a chromosome, but itcontains multiple genomic segments that together are neces-sary and sufficient for bacterial growth.

The fact that cp26 is absolutely required for bacterial growthdifferentiates this circular genetic element from at least most ofthe remaining B. burgdorferi plasmids. B. burgdorferi variantsthat contain cp26 but lack all linear plasmids have been de-scribed previously (39). It has been demonstrated that somelinear plasmids are required for B. burgdorferi survival duringat least part of the in vivo spirochete life cycle. For instance,the lp25 plasmid is essential for growth within a mammal host(33, 34), yet it is rapidly lost during in vitro growth (41). Thus,although it is required in a defined niche during the B. burg-dorferi life cycle, lp25 is an expendable genetic element and fitsthe definition of a plasmid in vitro, whereas cp26 is never lostand encodes essential biochemical functions.

We concluded that cp26 encodes functions critical to bacte-rial viability, including telomere resolution, and thus is a ubiq-uitous and stable component of the B. burgdorferi genome.Future studies will be directed at investigating which additionalgenes on cp26 are important for bacterial survival and thecontributions of these genes to basic cellular processes. Thefunctions of genes carried by cp26 and the universal presenceof cp26 in the segmented B. burgdorferi genome argue that thiselement is more analogous to a chromosomal fragment than toa plasmid.

ACKNOWLEDGMENTS

We thank Anita Mora and Gary Hettrick for graphic assistance, GailSylva and Sandra Raffel for technical assistance, and Greg Somerville,Izabela Sitkiewicz, and Robert Heinzen for critical evaluation of themanuscript. We also thank Kit Tilly for helpful comments and sugges-tions regarding this study.

3568 BYRAM ET AL. J. BACTERIOL.

REFERENCES

1. Austin, S., and K. Nordstrom. 1990. Partition-mediated incompatibility ofbacterial plasmids. Cell 60:351–354.

2. Barbour, A. G. 1993. Linear DNA of Borrelia species and antigenic variation.Trends Microbiol. 1:236–239.

3. Barbour, A. G. 1988. Plasmid analysis of Borrelia burgdorferi, the Lymedisease agent. J. Clin. Microbiol. 26:475–478.

4. Barbour, A. G., and C. F. Garon. 1987. Linear plasmids of the bacteriumBorrelia burgdorferi have covalently closed ends. Science 237:409–411.

5. Baril, C., C. Richaud, G. Baranton, and I. Saint Girons. 1989. Linear chro-mosome of Borrelia burgdorferi. Res. Microbiol. 140:507–516.

6. Bono, J. L., A. F. Elias, J. J. Kupko III, B. Stevenson, K. Tilly, and P. Rosa.2000. Efficient targeted mutagenesis in Borrelia burgdorferi. J. Bacteriol.182:2445–2452.

7. Bono, J. L., K. Tilly, B. Stevenson, D. Hogan, and P. Rosa. 1998. Oligopep-tide permease in Borrelia burgdorferi: putative peptide-binding componentsencoded by both chromosomal and plasmid loci. Microbiology 144:1033–1044.

8. Burgdorfer, W., A. G. Barbour, S. F. Hayes, J. L. Benach, E. Grunwaldt, andJ. P. Davis. 1982. Lyme disease—a tick-borne spirochetosis? Science 216:1317–1319.

9. Casjens, S. 1999. Evolution of the linear DNA replicons of the Borreliaspirochetes. Curr. Opin. Microbiol. 2:529–534.

10. Casjens, S., M. Murphy, M. DeLange, L. Sampson, R. van Vugt, and W. M.Huang. 1997. Telomeres of the linear chromosomes of Lyme disease spiro-chetes: nucleotide sequence and possible exchange with linear plasmid telo-meres. Mol. Microbiol. 26:581–596.

11. Casjens, S., N. Palmer, R. van Vugt, W. M. Huang, B. Stevenson, P. Rosa, R.Lathigra, G. Sutton, J. Peterson, R. J. Dodson, D. Haft, E. Hickey, M.Gwinn, O. White, and C. Fraser. 2000. A bacterial genome in flux: the twelvelinear and nine circular extrachromosomal DNAs in an infectious isolate ofthe Lyme disease spirochete Borrelia burgdorferi. Mol. Microbiol. 35:490–516.

12. Chaconas, G., P. E. Stewart, K. Tilly, J. L. Bono, and P. Rosa. 2001. Telo-mere resolution in the Lyme disease spirochete. EMBO J. 20:3229–3237.

13. de Silva, A. M., and E. Fikrig. 1995. Growth and migration of Borreliaburgdorferi in Ixodes ticks during blood feeding. Am. J. Trop. Med. Hyg.53:397–404.

14. Eggers, C. H., M. J. Caimano, M. L. Clawson, W. G. Miller, D. S. Samuels,and J. D. Radolf. 2002. Identification of loci critical for replication andcompatibility of a Borrelia burgdorferi cp32 plasmid and use of a cp32-basedshuttle vector for expression of fluorescent reporters in the Lyme diseasespirochaete. Mol. Microbiol. 43:281–295.

15. Elias, A. F., P. E. Stewart, D. Grimm, M. J. Caimano, C. H. Eggers, K. Tilly,J. L. Bono, D. R. Akins, J. D. Radolf, T. G. Schwan, and P. Rosa. 2002.Clonal polymorphism of Borrelia burgdorferi strain B31 MI: implications formutagenesis in an infectious strain background. Infect. Immun. 70:2139–2150.

16. Fraser, C. M., S. Casjens, W. M. Huang, G. G. Sutton, R. Clayton, R.Lathigra, O. White, K. A. Ketchum, R. Dodson, E. K. Hickey, M. Gwinn, B.Dougherty, J.-F. Tomb, R. D. Fleischmann, D. Richardson, J. Peterson, A. R.Kerlavage, J. Quackenbush, S. Salzberg, M. Hanson, R. van Vugt, N.Palmer, M. D. Adams, J. Gocayne, J. Weidmann, T. Utterback, L. Watthey,L. McDonald, P. Artiach, C. Bowman, S. Garland, C. Fujii, M. D. Cotton, K.Horst, K. Roberts, B. Hatch, H. O. Smith, and J. C. Venter. 1997. Genomicsequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390:580–586.

17. Gilmore, R. D., and J. Piesman. 2000. Inhibition of Borrelia burgdorferimigration from the midgut to the salivary glands following feeding by ticks onOspC-immunized mice. Infect. Immun. 68:411–414.

18. Grimm, D., K. Tilly, R. Byram, P. E. Stewart, J. G. Krum, D. M. Bueschel,T. G. Schwan, P. F. Policastro, A. F. Elias, and P. A. Rosa. 2004. Outer-surface protein C of the Lyme disease spirochete: a protein induced in ticksfor infection of mammals. Proc. Natl. Acad. Sci. USA 101:3142–3147.

19. Hinnebusch, B. J., Jr. 1991. Structure and replication of Borrelia burgdorferilinear plasmids. Ph.D. dissertation. University of Texas Graduate School ofBiomedical Sciences at San Antonio, San Antonio.

20. Hinnebusch, J., and A. G. Barbour. 1992. Linear- and circular-plasmid copynumbers in Borrelia burgdorferi. J. Bacteriol. 174:5251–5257.

21. Hinnebusch, J., S. Bergstrom, and A. G. Barbour. 1990. Cloning and se-quence analysis of linear plasmid telomeres of the bacterium Borrelia burg-dorferi. Mol. Microbiol. 4:811–820.

22. Hinnebusch, J., and K. Tilly. 1993. Linear plasmids and chromosomes inbacteria. Mol. Microbiol. 10:917–922.

23. Johnson, R. C. 1977. The spirochetes. Annu. Rev. Microbiol. 31:89–106.24. Kobryn, K., and G. Chaconas. 2002. ResT, a telomere resolvase encoded by

the Lyme disease spirochete. Mol. Cell 9:195–201.25. Kolstø, A. 1997. Dynamic bacterial genome organization. Mol. Microbiol.

24:241–248.

26. Krawiec, S., and M. Riley. 1990. Organization of the bacterial chromosome.Microbiol. Rev. 54:502–539.

27. Labandeira-Rey, M., and J. T. Skare. 2001. Decreased infectivity in Borreliaburgdorferi strain B31 is associated with loss of linear plasmid 25 or 28–1.Infect. Immun. 69:446–455.

28. Lawrenz, M. B., H. Kawabata, J. E. Purser, and S. J. Norris. 2002. De-creased electroporation efficiency in Borrelia burgdorferi containing linearplasmids lp25 and lp56: impact on transformation of infectious Borrelia.Infect. Immun. 70:4851–4858.

29. Marconi, R. T., M. E. Konkel, and C. F. Garon. 1993. Variability of osp genesand gene products among species of Lyme disease spirochetes. Infect. Im-mun. 61:2611–2617.

30. Margolis, N., D. Hogan, K. Tilly, and P. A. Rosa. 1994. Plasmid location ofBorrelia purine biosynthesis gene homologs. J. Bacteriol. 176:6427–6432.

31. Morrison, T. B., Y. Ma, J. H. Weis, and J. J. Weis. 1999. Rapid and sensitivequantification of Borrelia burgdorferi-infected mouse tissues by continuousfluorescent monitoring of PCR. J. Clin. Microbiol. 37:987–992.

32. Ohnishi, J., J. Piesman, and A. M. de Silva. 2001. Antigenic and geneticheterogeneity of Borrelia burgdorferi populations transmitted by ticks. Proc.Natl. Acad. Sci. USA 98:670–675.

33. Purser, J. E., M. B. Lawrenz, M. J. Caimano, J. D. Radolf, and S. J. Norris.2003. A plasmid-encoded nicotinamidase (PncA) is essential for infectivity ofBorrelia burgdorferi in a mammalian host. Mol. Microbiol. 48:753–764.

34. Purser, J. E., and S. J. Norris. 2000. Correlation between plasmid contentand infectivity in Borrelia burgdorferi. Proc. Natl. Acad. Sci. USA 97:13865–13870.

35. Ravin, N. V. 2003. Mechanisms of replication and telomere resolution of thelinear plasmid prophage N15. FEMS Microbiol. Lett. 221:1–6.

36. Ravin, N. V., T. S. Strakhova, and V. V. Kuprianov. 2001. The protelomeraseof the phage-plasmid N15 is responsible for its maintenance in linear form.J. Mol. Biol. 312:899–906.

37. Rosa, P., D. S. Samuels, D. Hogan, B. Stevenson, S. Casjens, and K. Tilly.1996. Directed insertion of a selectable marker into a circular plasmid ofBorrelia burgdorferi. J. Bacteriol. 178:5946–5953.

38. Rybchin, V. N., and A. N. Svarchevsky. 1999. The plasmid prophage N15: alinear DNA with covalently closed ends. Mol. Microbiol. 33:895–903.

39. Sadziene, A., B. Wilske, M. S. Ferdows, and A. G. Barbour. 1993. The crypticospC gene of Borrelia burgdorferi B31 is located on a circular plasmid. Infect.Immun. 61:2192–2195.

40. Samuels, D. S. 1995. Electrotransformation of the spirochete Borrelia burg-dorferi. Methods Mol. Biol. 47:253–259.

41. Schwan, T. G., W. Burgdorfer, and C. F. Garon. 1988. Changes in infectivityand plasmid profile of the Lyme disease spirochete, Borrelia burgdorferi, as aresult of in vitro cultivation. Infect. Immun. 56:1831–1836.

42. Schwan, T. G., and J. Piesman. 2000. Temporal changes in outer surfaceproteins A and C of the Lyme disease-associated spirochete, Borrelia burg-dorferi, during the chain of infection in ticks and mice. J. Clin. Microbiol.38:382–388.

43. Schwan, T. G., and J. Piesman. 2002. Vector interactions and molecularadaptations of Lyme disease and relapsing fever spirochetes associated withtransmission by ticks. Emerg. Infect. Dis. 8:115–121.

44. Schwan, T. G., J. Piesman, W. T. Golde, M. C. Dolan, and P. A. Rosa. 1995.Induction of an outer surface protein on Borrelia burgdorferi during tickfeeding. Proc. Natl. Acad. Sci. USA 92:2909–2913.

45. Stevenson, B., T. G. Schwan, and P. A. Rosa. 1995. Temperature-relateddifferential expression of antigens in the Lyme disease spirochete, Borreliaburgdorferi. Infect. Immun. 63:4535–4539.

46. Stewart, P., G. Chaconas, and P. Rosa. 2003. Conservation of plasmid main-tenance functions between linear and circular plasmids in Borrelia burgdor-feri. J. Bacteriol. 185:3202–3209.

47. Stewart, P. E., R. Thalken, J. L. Bono, and P. Rosa. 2001. Isolation of acircular plasmid region sufficient for autonomous replication and transfor-mation of infectious Borrelia burgdorferi. Mol. Microbiol. 39:714–721.

48. Tilly, K., S. Casjens, B. Stevenson, J. L. Bono, D. S. Samuels, D. Hogan, andP. Rosa. 1997. The Borrelia burgdorferi circular plasmid cp26: conservation ofplasmid structure and targeted inactivation of the ospC gene. Mol. Micro-biol. 25:361–373.

49. Tilly, K., A. F. Elias, J. L. Bono, P. Stewart, and P. Rosa. 2000. DNAexchange and insertional inactivation in spirochetes. J. Mol. Microbiol. Bio-technol. 2:433–442.

50. Tilly, K., A. F. Elias, J. Errett, E. Fischer, R. Iyer, I. Schwartz, J. L. Bono,and P. Rosa. 2001. Genetics and regulation of chitobiose utilization inBorrelia burgdorferi. J. Bacteriol. 183:5544–5553.

51. Tilly, K., L. Lubke, and P. Rosa. 1998. Characterization of circular plasmiddimers in Borrelia burgdorferi. J. Bacteriol. 180:5676–5681.

52. Tourand, Y., K. Kobryn, and G. Chaconas. 2003. Sequence-specific recog-nition but position-dependent cleavage of two distinct telomeres by theBorrelia burgdorferi telomere resolvase, ResT. Mol. Microbiol. 48:901–911.

53. Zhou, X., M. Cahoon, P. Rosa, and L. Hedstrom. 1997. Expression, purifi-cation, and characterization of inosine 5�-monophosphate dehydrogenasefrom Borrelia burgdorferi. J. Biol. Chem. 272:21977–21981.

VOL. 186, 2004 ESSENTIAL NATURE OF B. BURGDORFERI cp26 PLASMID 3569