The Cytoplasmic Domain of Human Immunodeficiency Virus Type 1 Transmembrane Protein gp41 Harbors Lipid Raft Association Determinants

JOURNAL OF VIROLOGY, Jan. 2010, p. 59–75 Vol. 84, No. 10022-538X/10/$12.00 doi:10.1128/JVI.00899-09Copyright © 2010, American Society for Microbiology. All Rights Reserved.

The Cytoplasmic Domain of Human Immunodeficiency VirusType 1 Transmembrane Protein gp41 Harbors Lipid Raft

Association Determinants�

Polung Yang,1† Li-Shuang Ai,2† Shu-Chen Huang,1 Hsiao-Fen Li,1 Woan-Eng Chan,1

Chih-Wei Chang,1 Chiung-Yuan Ko,1 and Steve S.-L. Chen1*Institute of Biomedical Sciences, Academia Sinica, Taipei 11529,1 and Graduate Institute of Life Sciences,

National Defense Medical Center, Taipei 11490,2 Taiwan, Republic of China

Received 5 May 2009/Accepted 24 September 2009

The molecular basis for localization of the human immunodeficiency virus type 1 envelope glycoprotein(Env) in detergent-resistant membranes (DRMs), also called lipid rafts, still remains unclear. The C-terminalcytoplasmic tail of gp41 contains three membrane-interacting, amphipathic �-helical sequences, termedlentivirus lytic peptide 2 (LLP-2), LLP-3, and LLP-1, in that order. Here we identify determinants in thecytoplasmic tail which are crucial for Env’s association with Triton X-100-resistant rafts. Truncations of LLP-1greatly reduced Env localization in lipid rafts, and the property of Gag-independent gp41 localization in raftswas conserved among different strains. Analyses of mutants containing single deletions or substitutions inLLP-1 showed that the �-helical structure of the LLP-1 hydrophobic face has a more-critical role in Env-raftassociations than that of the hydrophilic face. With the exception of a Pro substitution for Val-833, all Prosubstitution and charge-inverting mutants showed wild-type virus-like one-cycle viral infectivity, replicationkinetics, and Env incorporation into the virus. The intracellular localization and cell surface expression ofmutants not localized in lipid rafts, such as the TM844, TM813, 829P, and 843P mutants, were apparentlynormal compared to those of wild-type Env. Cytoplasmic subdomain targeting analyses revealed that thesequence spanning LLP-3 and LLP-1 could target a cytoplasmic reporter protein to DRMs. Mutations of LLP-1that affected Env association with lipid rafts also disrupted the DRM-targeting ability of the LLP-3/LLP-1sequence. Our results clearly demonstrate that LLP motifs located in the C-terminal cytoplasmic tail of gp41harbor Triton X-100-resistant raft association determinants.

Lentiviruses, including human immunodeficiency virus type1 (HIV-1), are unusual in possessing a long cytoplasmic do-main (�150 amino acids) in their envelope (Env) transmem-brane (TM) glycoprotein compared to those of other retrovi-ruses (20 to 50 amino acids). The cytoplasmic domain of HIV-1TM protein gp41, which encompasses residues 706 to 856, hasmultiple functions during the virus life cycle, including viralreplication, infectivity, transmission, and cytopathogenicity.Truncations of the HIV-1 cytoplasmic domains may modulatecell-cell fusion properties of the Env protein, presumably dueto alterations in the levels of cell surface Env expression andconformation of the Env ectodomain (23, 81). The cytoplasmicdomain is characterized by the presence of three structurallyconserved, amphipathic �-helical segments, located at residues828 to 856, 770 to 795, and 786 to 813 and referred to aslentivirus lytic peptide 1 (LLP-1), LLP-2, and LLP-3, respec-tively, at its C terminus (Fig. 1A). The LLP-1 and LLP-2sequences were shown to be inserted into viral membranes bya photoinduced chemical reaction (73). These LLP motifs havebeen implicated in a variety of functions, such as cell surfaceexpression (12), Env fusogenicity (30), and Env incorporation

into a virus (47, 56), as well as Env protein stability (33) andmultimerization (34).

Gag and Env carry specific intracellular localization signalsgoverning the site(s) of virus assembly/budding and releaseinto the extracellular milieu. Env trafficking to the plasmamembrane is regulated by the conserved C-terminal dileucinemotif and the endocytic, membrane-proximal, tyrosine-basedGY712SPL signal in the cytoplasmic tail of gp41 (Fig. 1A) andby their respective interactions with the clathrin adaptor pro-teins, AP1 and AP2 (4, 9, 21, 49, 65, 77). A diaromatic motif,Y802W803, was shown to bind to TIP47, a protein required forthe retrograde transport of mannose-6-phosphate receptorsfrom late endosomes to the trans-Golgi network, and this in-teraction was involved in the retrograde transport of Env to thetrans-Golgi network (8). Alterations of these intracellular lo-calization signals may affect viral infectivity, Env assembly intothe virus, and viral replication (8, 20). Likewise, Gag alsocontains important sequences required for its trafficking to andassembly at the plasma membrane. The matrix (MA) protein,p17, contains a myristoyl group and a cluster of basic aminoacids, while p6 contains a late domain which interacts with thecomponents of the endosomal sorting complex required fortransport (ESCRT) pathway to mediate Gag trafficking to thevirion assembly/budding site (for reviews, see references 25, 45,57, and 59). It is well documented that the specific interactionbetween the cytoplasmic domain of gp41 and the trimeric MAprotein in infected cells facilitates recruitment of the Env intovirus assembly/budding sites on target membranes (for reviews,

* Corresponding author. Mailing address: Institute of BiomedicalSciences, Academia Sinica, 128 Yen-Chiu-Yuan Road, Section 2, Nan-kang, Taipei 11529, Taiwan, Republic of China. Phone: 886-2-2652-3933. Fax: 886-2-2652-3073. E-mail: [email protected].

† Polung Yang and Li-Shuang Ai contributed equally to this work.� Published ahead of print on 30 September 2009.

59

see references 18, 24, and 46). TIP47 was demonstrated to actas an adaptor to bridge the gp41 cytoplasmic domain and Gag,which allows the physical encounter between Gag and Env,resulting in efficient Env incorporation into the virus duringthe viral assembly/budding process (39).

Lipid rafts, also called detergent-resistant membranes(DRMs), are highly specialized membrane microdomainspresent in both the plasma and endosomal membranes of eu-karyotic cells. These dynamic microdomains are characterizedby their detergent insolubility, light density on a sucrose gra-dient, and enrichment of cholesterol, glycosphingolipids, andglycosylphosphatidylinositol (GPI)-linked proteins that are an-chored in the membrane by their attached GPI moieties (1).HIV-1 utilizes lipid rafts to efficiently enter host cells (40, 74,80) and selectively assembles and buds from lipid rafts on thesurfaces of infected cells (27, 36, 48, 50, 54). Also, the HIV-1Env protein was detected in lipid raft membranes (48, 54, 64).Lipid rafts are thought to facilitate Env-Gag interactions, toconcentrate viral Env glycoproteins, and to promote multim-erization of intracellular viral components (for a review, seereference 51). However, what governs Env transport to andlocalization in lipid rafts is a long-standing question.

Although the mechanisms by which proteins associate withlipid rafts are not fully understood, determinants for targetingof signal proteins to DRMs have been identified. These includea GPI anchor (2, 61) and an N-terminal Met-Gly-Cys in whichGly is myristylated and Cys is palmitoylated (43, 71). The latterincludes certain dually acylated heterotrimeric guanine nucle-otide-binding protein (G protein) � subunits (44). In addition,acylation by palmitoylation also serves as a signal to target

signaling molecules to lipid rafts (for reviews, see references 11and 60). Some Env proteins of membrane-enveloped virusesare known to be associated with lipid rafts (35, 41, 54, 69, 79),and acylation of viral Env proteins, in particular, palmitoyl-ation, is important for targeting these Env proteins to lipidrafts (for reviews, see references 58 and 70).

It is generally believed that the association of HIV-1 Envwith lipid rafts requires a palmitoylation signal(s) located inthe cytoplasmic tail of gp41 (6, 64). Nevertheless, the twocytoplasmic palmitoylated Cys residues in the HXB2 strainEnv protein are not conserved among HIV-1 isolates, andsome isolates do not even contain cysteine residues in theircytoplasmic tail (32). In accordance with this notion, we pre-viously demonstrated that the two cytoplasmic palmitoylatedCys residues in T-cell (T)- and macrophage (M)-tropic Envproteins do not play an obvious role in the virus life cycle,including Env’s association with lipid rafts (13), suggesting thatother factors may substitute for cytoplasmic palmitoylation topromote Env localization in lipid rafts. Clapham’s groupshowed that mutations in MA or the cytoplasmic tail thatprevent Env from incorporating into the virus and impair virusinfectivity also interfere with Env’s association with lipid rafts(7), indicating that the Gag-Env interaction drives efficient Envassociation with lipid rafts, which in turn modulates Env bud-ding and assembly onto viral particles. In contrast to theirfindings, we previously also noted that the Env protein of theHXB2 strain expressed without Gag is still located in lipid rafts(13), providing compelling evidence for the proposal that theEnv per se contains sufficient information for its sequestrationinto lipid rafts.

FIG. 1. (A) Schematic representation of the gp41 cytoplasmic domain and truncation mutants examined in this study. The cytoplasmic tail ofgp41 contains a tyrosine-based endocytic YSPL signal located at residue 712, a hydrophilic region, a diaromatic YW motif, and three amphipathic�-helices, termed LLP-2, LLP-3, and LLP-1, at its C terminus. The amino acid sequence from residues 806 to 856 of the WT HXB2 Env ispresented in single amino acid code, and the C-terminal dileucine motif is underlined in the sequence. Truncation mutants (TMs) generating stopcodons immediately downstream of the indicated amino acids and their respective sequences are also shown. (B) pHXB2R3-based mutantproviruses used in this study. All mutants were generated by a PCR overlap cloning strategy, and the mutation sites are indicated. A dash or dotindicates that the residue in that position of the mutant provirus sequence is identical to or absent from that of the WT provirus sequence,respectively. The substituted amino acids in the mutant proviruses are also indicated.

60 YANG ET AL. J. VIROL.

To further understand the nature of Env’s association withlipid rafts, in the present study we show that sequestering Envin Triton X-100-resistant lipid rafts is an intrinsic property ofEnv and is independent of Gag-Env interactions. Additionally,the LLP motifs, in particular the �-helical structure of thehydrophobic face of LLP-1, play a crucial role in Env’s local-ization in lipid rafts. Except for the 833P mutant of Env, whichis unstable and degrades (33), all Pro-substituted mutants notlocated in lipid rafts exhibited wild-type (WT)-like phenotypesof intracellular localization, cell surface expression, incorpora-tion into virions, and viral replication capacity. Importantly,the �-helix of the hydrophobic face of LLP-1 is also critical forthe raft-targeting ability of the LLP-3/LLP-1 sequence. Ourstudy depicts, for the first time, the critical role of the �-helixof the gp41 cytoplasmic domain in mediating Env’s associationwith and targeting to Triton X-100-resistant lipid rafts.

MATERIALS AND METHODS

Cells, antibodies, and chemicals. The human embryonic kidney cell-derived293T cell line that expresses the simian virus 40 large T antigen was maintainedin Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetalbovine serum (FBS). The CD4� T-cell lines CEM-SS and SupT1 and the hy-bridomas 902, Chessie 8, and 183 (clone H12-5C), which secrete mouse mono-clonal antibodies (MAbs) specific for gp120, gp41, and capsid protein p24 ofGag, respectively, were maintained in RPMI 1640 supplemented with 10% FBSas previously described (16, 33). Rabbit anti-caveolin-1 antiserum and anti-flotillin-1 MAb were obtained commercially from BD Biosciences (San Jose,CA). Rabbit anti-placenta alkaline phosphatase (PLAP) was purchased fromSanta Cruz Biotechnology, Inc. (Santa Cruz, CA). Affinity-purified fluoresceinisothiocyanate (FITC)- and rhodamine-conjugated secondary antibodies were

purchased from Kirkegaard & Perry Laboratories (Gaithersburg, MD). An anti-�-galactosidase (anti-�-Gal) MAb was obtained from Promega (Madison, WI).Rabbit anti-calreticulin, �-actin MAb, methyl-�-cyclodextrin (�-MCD), and cho-lesterol were all purchased from Sigma (St. Louis, MO).

Plasmids. pHXB2R3-based cytoplasmic tail C-terminal truncation mutantproviral constructs (Fig. 1A) were as previously described (78). Proviruses whichencoded mutant Env proteins with single deletions at Thr-818, Ile-830, Val-833,Ala-836, Ile-840, Ile-843, Ile-847, and Ile-854 (Fig. 1B, first group) and mutantproviral constructs encoding Ala, Ser, and Pro substitutions for Val-832 andVal-833 in Env (Fig. 1B, second group) were as previously reported (33). TheHIV-1 long terminal repeat (LTR)-driven Tat-expressing plasmid pIIIextat wasas previously described (13). pcDNA3-based constructs that encoded cytoplas-mic tail subdomains 706 to 752, 760 to 856, 760 to 795, and 816 to 856 were aspreviously described (16).

Mutagenesis and construction of plasmids. pHXB2R3-derived TM836,TM828, and TM820 mutant proviruses, which encode Env proteins truncatedafter residues Ala-836, Arg-828, and Ile-820, respectively, were created (Fig. 1A),and mutant proviruses encoding Val829Pro, Ala839Pro, Ile843Pro, andLeu855Pro substitutions (Fig. 1B, third group) and Glu831Arg, Arg838Glu,Arg841Glu, Arg845Glu, Arg846Glu, Arg848Glu, and Arg853Glu substitutions(Fig. 1B, fourth group) were constructed by oligonucleotide-directed, site-spe-cific mutagenesis using a PCR overlap extension, as previously indicated (33).The paired internal primers used in the PCR to encode each mutation in thegp41 C-terminal cytoplasmic tail are shown in Table 1. Oligonucleotides 8423f(5�-GAAGAAGAAGGTGGAGAGAGA-3�) (sense; nucleotides 8423 to 8443of the HXB2 strain of the provirus) and 8933r (5�-GCTACTTGTGATTGCTCC-3�) (antisense; nucleotides 8933 to 8916) were used as the outer paired prim-ers. The BamHI- and XhoI-restricted PCR products were cloned into thepHXB2R3 provirus at the same sites to generate each mutant provirus. Togenerate HIV-1 LTR-controlled mutant Env expression plasmids, the KpnI-XhoI fragments isolated from mutant proviruses were substituted for the ho-mologous sequence in a version of WT pSVE7puro in which the XhoI sitelocated at the 5�-LTR was deleted. All mutant pHXB2R3 and pSVE7puroconstructs were autosequenced with the 8423f oligonucleotide to confirm the

TABLE 1. Paired internal primers used for construction of mutant proviruses by PCR overlap extension method

MutationSense (S) or

antisense(A)

Primer sequence (5�–3�)

V829P S GGGACAGATAGGCCTATAGAAGTAGTACAAGGA CTACTTCTATAGGCCTATCTGTCCCCTC

A839P S GGAGCTTGTAGACCTATTCGCCACATACCTAGA GTGGCGAATAGGTCTACAAGCTCCTTGTAC

I843P S GCTATTCGCCACCCACCTAGAAGAATAAGACAGGA CTTATTCTTCTAGGTGGGTGGCGAATAGCTCTACAAGC

L855P S CAGGGCTTGGAAAGGATTCCGCTATAAGATGGGTGGCA CCCATCTTATAGCGGAATCCTTTCCAAGCCCTGTC

E831R S GGGTTATACGAGTAGTACAAGGAGCA GTACTACTCGTATAACCCTATCTGTCC

R838E S GGAGCTTGTGAAGCTATTCGCCACATACCA GCGAATAGCTTCACAAGCTCCTTGTAC

R841E S GTAGAGCTATTGAGCACATACCTAGAAGAATAAGA GGTATGTGCTCAATAGCTCTACAAGC

R845E S CGCCACATACCTGAAAGAATAAGACAGGGCTTGA CTGTCTTATTCTTTCAGGTATGTGGCGAATAGC

R846E S CACATACCTAGAGAAATAAGACAGGGCTTGGAAA GCCCTGTCTTATTTCTCTAGGTATGTGGCG

R848E S CCTAGAAGAATAGAACAGGGCTTGGAAAGGATTA TTCCAAGCCCTGTTCTATTCTTCTAGGTATGTG

R853E S CAGGGCTTGGAAGAGATTTTGCTATAAGATGGGA ATCTTATAGCAAAATCTCTTCCAAGCCCTGTCTTAT

TM836f S GTAGTACAAGGAGCTRTGAAGAGGTATTCGCCACATTM836r A GTTTGGCGAATAGCTCTTCAAGCTCCTTGTACTACTTTM820f S AATGCCACAGCCATATAAGTAGCTGAGGGGACAGATTM820r A TGTCCCCTCAGCTACTTATATGGGGGCTGTGGCATTGATM828f S GACAGATAGGTAAATAGAAGTAGTACAAGGTM828r A TTGTACTACTTCTATTTACCTATCTGTCCCCTCAG786fEcoRI S CCGAATTCGGACGCAGGGGGTGGGAAGCC856r(�854)XbaI A GCTCTAGATTATAGCAACCTTTCCAAGCCCT

VOL. 84, 2010 ASSOCIATION OF HIV-1 Env WITH DRMs 61

mutations. The KpnI-XhoI fragments of the NL4-3 and ConB proviruses werealso used to replace the corresponding sequence in pSVE7puro to obtain theNL4-3 and ConB env expression plasmids, respectively.

To construct pcDNA3-based �-Gal fusion chimeras that encoded the 786-813and 786-856 regions attached at the C terminus of �-Gal, oligonucleotides786fEcoRI (Table 1) and 856rXbaI were used as primers with the TM813 andWT pSVE7puro plasmids, respectively, in a PCR. To construct the 760-813plasmid, 760fEcoRI and 856rXbaI were used as primers with TM813 pSVE7puroin a PCR. To construct �-Gal–786-856 fusion proteins with a deletion at Val-833or a Pro substitution for Val-832 or Val-833, oligonucleotides 786fEcoRI and856rXbaI were used as primers with their respective pHXB2R3 mutant provi-ruses in a PCR. To generate the �-Gal–786-856-based Ile-854 deletion, the DNAfragment was PCR amplified from the �854 mutant provirus, using 786fEcoRI asthe forward primer and oligonucleotide 856r(�854)XbaI (Table 1) as the reverseprimer. All constructs were cloned as previously described (16) and confirmed bysequencing.

Plasmid DNA transfection. Subconfluent 293T cells grown on 10-cm petridishes were transfected with 10 �g of provirus, 10 �g of the pcDNA3-�-galconstruct, or 10 �g of pSVE7puro together with 2 �g of pIIIextat, using astandard calcium phosphate coprecipitation method as previously described (53).To prepare vesicular stomatitis virus (VSV) glycoprotein G trans-complementedHIV-1 stocks, 293T cells were cotransfected with 7.5 �g each of the provirus andpHCMV-VSV G, a human cytomegalovirus (CMV) promoter-directed VSV Gprotein expression plasmid. At 6 hours posttransfection, excess DNA-calciumphosphate complexes were rinsed off with calcium-free phosphate-buffered sa-line (PBS), and fresh DMEM with 5% FBS was added to the culture. Cells wereharvested for further analysis at 48 h posttransfection.

Viral infection studies. Culture supernatants obtained from 293T cells trans-fected with WT or mutant proviruses or cotransfected with pHCMV-VSV G andeach of the WT and mutant proviruses were filtered through 0.45-�m membranediscs and normalized by reverse transcriptase (RT) activity as previously de-scribed (17). Cell-free viruses containing 2 � 104 cpm of RT activity were usedto challenge 106 CEM-SS cells, and culture supernatants collected from infectedcells were monitored at different times for RT activity. For VSV G trans-com-plemented viral infection, cell-free viruses containing 106 cpm of RT activitywere used to challenge 107 CEM-SS cells for lipid raft membrane flotation assayor 1.25 � 106 SupT1 cells for analysis of viral protein expression.

HIV-1 reporter assay. LuSIV cells were seeded at 3 � 104 cells per well in a96-well round-bottom plate, 100 �l of WT or mutant virus containing 1 � 105

cpm of RT activity was overlaid into each well, and the cultures were subjectedto spin inoculation. The cultures were then incubated at 37°C overnight, washedtwice with PBS, replenished with 100 �l of fresh medium per well, and allowedto recover for an additional 48 h. Cells were harvested and lysed, and fireflyluciferase activity was assayed in triplicate. Results from three separate experi-ments were quantified.

Sucrose gradient equilibrium ultracentrifugation. Three-layer membrane flo-tation analysis to assess Env localization in lipid rafts was performed accordingto a previously described procedure (13, 17). To separate light and heavy DRMsfrom detergent-soluble membrane (DSM) fractions, a 14-fraction sucrose densitygradient centrifugation method, as previously described (6, 7), was adopted forthe Beckman SW-41 rotor. Cell pellets were lysed with 500 �l of 0.5% TritonX-100 in NTE buffer (25 mM Tris-HCl, pH 7.5, containing 0.15 M NaCl and 5mM EDTA) supplemented with phenylmethylsulfonyl fluoride and a proteaseinhibitor cocktail (Roche Diagnostics, Mannheim, Germany), and 400 �l ofclarified lysates was mixed with 1 ml of 85% sucrose prepared in NTE buffer. Themixture was then overlaid on a layer containing 250 �l of 80% sucrose in NTEbuffer, which was placed in the bottom of an SW41 ultracentrifuge tube. Twomilliliters each of 50%, 40%, 35%, 10%, and 5% sucrose, all prepared in NTEbuffer, was then successively layered above the lysate-sucrose mix in the saidorder. Gradients were centrifuged at 100,000 � g and 4°C for 18 h. Uponcompletion, 850-�l fractions were collected from the top of the gradients bymanual micropipetting. For CEM-SS cells expressing Env proteins, a scaled-down version of the sucrose density gradient centrifugation procedure, as pre-viously described (17), was followed. For density gradient centrifugation of 293Tcells expressing �-Gal–gp41 cytoplasmic tail fusion proteins, the three-layersucrose density gradient centrifugation method described above was performed,and fractions were collected from the top of the gradients by manual micropi-petting.

SDS-PAGE and Western immunoblot analysis. For proviral DNA transfec-tion, the production, concentration, and analysis of cell- and virion-associatedviral proteins were performed as previously described (15). Equal volumes of celland virion lysates were then subjected to sodium dodecyl sulfate-polyacrylamidegel electrophoresis (SDS-PAGE) followed by Western blot analyses.

For sucrose gradient centrifugation, aliquots of samples in each fraction werediluted with an equal volume of NTE buffer, 20 �g of bovine serum albumin wasadded, and the mixture was concentrated by precipitation with 10% cold trichlo-roacetic acid prior to SDS-PAGE. For analysis of �-Gal–gp41 cytoplasmic tailfusion proteins, aliquots (200 �l) of each gradient fraction were added to 20 �gof bovine serum albumin, followed by the addition of 1 ml of ice-cold acetone.The acetone-precipitated samples were incubated at 20°C for 1 h and thencentrifuged at 18,000 � g for 15 min at 4°C. After removing the upper, acetonelayer, the lower, precipitated protein layer was mixed with 1 ml of ice-cold 80%(vol/vol) ethanol to remove excess sucrose. The protein pellets were then repre-cipitated by centrifugation, as indicated above, prior to SDS-PAGE.

In the Western blot analysis, membrane blots were incubated with MAbs 902,Chessie 8, and 183, to detect, respectively, gp160 and gp120, gp41, and the Pr55Gag precursor and its cleavage products (p41 and p24) or with the �-Gal MAbto detect �-Gal fusion proteins. After incubation with secondary antibodies, theimmune complexes were visualized by an enhanced chemiluminescence (ECL)detection method. For quantitation, ECL images of the blots within the linearrange of the film were scanned using a Microtek ScanMarker 8700 instrument(Carson, CA) and were quantitated using MetaMorph software (Universal Im-aging, Downingtown, PA). The relative percentages of the levels of mutantproteins associated with DRMs to that of the WT protein are expressed, unlessotherwise indicated.

Membrane cholesterol depletion and reconstitution analysis. Monolayers oftransfected 293T cells were cultured in serum-free DMEM at 37°C for 1 h priorto treatment with �-MCD in serum-free DMEM for 30 min to extract cholesterolfrom plasma membranes. For cholesterol reconstitution after �-MCD treatment,the cholesterol–�-MCD complex (30 mg cholesterol to 1 g �-MCD), prepared aspreviously described (31), was diluted in serum-free DMEM to a final cholesterolconcentration of 200 �g/ml. �-MCD-treated monolayers were then washed threetimes with PBS before being overlaid with the cholesterol–�-MCD solution fortreatment at 37°C for 30 min. �-MCD-treated cells not replenished with choles-terol were overlaid with serum-free DMEM in parallel. Both cholesterol-de-pleted and -replenished cells were lysed with 1% Triton X-100 and subjected tosucrose density gradient centrifugation as described above.

Confocal microscopy and FACS analysis. For Env intracellular localization,transfected HeLa cells were fixed with 4% paraformaldehyde and permeabilizedwith 0.25% Triton X-100. After being blocked, the slides were successivelyincubated with Chessie 8, FITC-conjugated anti-mouse immunoglobulin G(IgG), rabbit anti-calreticulin, and rhodamine-conjugated anti-rabbit IgG, andimmunostained cells were analyzed by confocal microscopy as previously de-scribed (14). To quantify Env expression, a previously described procedure (14)was followed. For total Env expression, proviral DNA-transfected 293T cellswere fixed with 4% paraformaldehyde, permeabilized with 0.25% Triton X-100,and then successively incubated with MAb 902 and FITC-conjugated anti-mouseIgG. For cell surface Env expression, transfected cells, after being blocked, wereincubated with MAb 902, fixed, and then incubated with FITC-conjugated anti-mouse IgG. Immunostained cells were quantitated by fluorescence-activated cellsorter (FACS) analysis using a FACSCalibur flow cytometer (Becton DickinsonImmunocytometry Systems, San Jose, CA).

RESULTS

The C-terminal cytoplasmic domain of gp41 is required forEnv localization in lipid rafts. We previously showed that gp41was associated with lipid rafts when Env was expressed fromthe HIV-1 LTR-driven env expression plasmid pSVE7purowithout other viral protein coexpression (13), suggesting thatgp41 itself contains information sufficient for Env associationwith lipid rafts. We thus further identified and characterizeddeterminants in Env that are crucial for Env-lipid raft associ-ation. Since the cytoplasmic domain of gp41 is characterized bythe three structurally conserved, membrane-interacting, am-phipathic �-helical LLP motifs located at its C terminus (Fig.1A), we thereby examined the involvement of these LLP se-quences in Env localization in lipid rafts.

We first studied the effects of progressive truncations of theC terminus of the cytoplasmic tail on Env’s association withlipid rafts in the context of proviral DNA transfection. A seriesof pHXB2R3-based cytoplasmic tail truncation mutants, i.e.,


TM844, TM836, TM828, TM820, and TM813 (Fig. 1A), alongwith the WT provirus, were used to transfect 293T cells. Cellswere extracted with 1% cold Triton X-100, and lysates wereanalyzed by sucrose gradient centrifugation as previously de-scribed (13, 17). To assess the reliability of this raft fraction-ation technique in separating raft proteins from soluble pro-teins, the raft association properties of three known raftmarkers, PLAP, flotillin-1, and caveolin-1, were analyzed. Asignificant fraction of PLAP was fractionated into DRMs, i.e.,fractions 7 and 8, which were positioned in the interface be-tween the 30% and 5% sucrose layers (Fig. 2A, top panel).Flotillin-1 and caveolin-1 were distributed predominantly inlipid raft membranes (Fig. 2A, middle and bottom panels,respectively). DRM-associated WT Env also floated to frac-tions 7 and 8, while detergent-soluble WT Env was located inthe bottom cytosolic fractions 1 to 3 (Fig. 2B, first panel). TheTM844 mutant, which has a truncation of the last 12 aminoacids of the C terminus of gp41, showed greatly reduced Envlocalization in lipid rafts compared to WT Env (Fig. 2B, panel2). Further truncations toward the N terminus of LLP-1 strik-ingly abolished Env distribution into lipid raft fractions (Fig.2B, panels 3 to 6). The quantitative results from three separatestudies are shown in the bottom graph of Fig. 2B.

Next, a set of pSVE7puro Env plasmids that encoded a seriesof truncations from the C terminus of the cytoplasmic tail wasexamined. The TM844 mutant showed greatly impaired Envassociation with lipid rafts when Env was expressed alone (Fig.2C, panel 2). Additional truncations toward the N terminus ofLLP-1 also strikingly reduced Env-lipid raft association (Fig.2C, panels 3 to 6). The results of quantification from threeindependent analyses are shown in the bottom graph of Fig.2C. Moreover, quantitative results showed that similar valuesfor the absolute raft association ability of Env, i.e., the per-centage of Env distributed into raft fractions relative to thetotal Env level, were obtained for expression from proviralDNA transfection and subgenomic expression (Fig. 2D), con-firming that Env is indeed efficiently associated with lipid raftseven in the absence of other viral protein expression.

We also examined the role of the gp41 cytoplasmic tail inEnv’s association with lipid rafts in HIV-1 natural target CD4�

T cells, using a previously reported high-level, transient HIV-1expression system based on trans-complementation with theVSV G protein (3, 38). The TM844 mutant strikingly reduceddetection of gp41 in lipid raft fractions (Fig. 2E). Similarly,deletion of the entire LLP-1, e.g., in mutants TM828 andTM813, abrogated Env-lipid raft association (Fig. 2E). Theseresults together indicate that the cytoplasmic tail of gp41, inparticular, LLP-1, plays a crucial role in Env localization inlipid rafts in epithelial cells as well as in CD4� T cells.

The Gag-Env interaction is not required for Env localizationin lipid rafts. Bhattacharya et al. (7) showed that HIV-1 LTR-driven Env proteins of the HXB2 and NL4-3 strains wereexcluded from DRMs when coexpressed with an env-deficientNL4-3 mutant 12LE provirus in which the Env-Gag interactionis disrupted, indicating that Env localization in lipid rafts isdriven by the Env-Gag interaction. To clarify the discrepancybetween their findings and ours, we reexamined whether Envproteins encoded by WT, 12LE, and 30LE NL4-3 provirusesare located in lipid rafts. First, we determined whether incor-poration of Env into the virus in CD4� T cells was impaired,

based on trans-complementation with the VSV G protein. Aspreviously reported (26), the two Gag mutants, 12LE and30LE, which contain Glu substitutions for Leu at residues 12and 30 in MA, respectively, inhibited Env incorporation intothe virus (Fig. 3A, compare lanes 5 and 6 to lane 4), presum-ably due to the lack of interaction between gp41 and mutantMA proteins. Env’s incorporation into the 12LE and 30LEmutant virions was also severely impaired when examined in293T cells (data not shown). Moreover, the Env proteins ex-pressed by WT, 12LE, and 30LE mutant NL4-3 proviruses aswell as the Env encoded by the HXB2 provirus were found tobe located in DRMs when subjected to conventional three-layer sucrose density gradient centrifugation (Fig. 3B).

To explore the possibility that the different sucrose gradientcentrifugation methods used by Bhattacharya et al. and us mayhave contributed to the differential properties of Env’s associ-ation with lipid rafts, we also employed multilayer sucrosegradient centrifugation as described by Clapham’s group toaddress the raft association property of Env. As controls, sig-nificant fractions of PLAP, flotillin-1, and caveolin-1 were frac-tionated into light-density DRM (DRM-L) as well as heavy-density DRM (DRM-H) (Fig. 3C). All of the Env proteinsencoded by WT, 12LE, and 30LE mutant NL4-3 provirusesand by the HXB2 provirus were found to be localized inDRM-L as well as in DRM-H, although a significant portion ofthese proteins was still located in the DSM fraction (Fig. 3D).Furthermore, Env proteins derived from HXB2 and NL4-3proviruses and from 12LE and 30LE mutant pNL4-3 provi-ruses were also detected in lipid raft fractions in CEM-SS cellsin a three-layer membrane flotation analysis (Fig. 3E). Theseresults together indicate that the Env-Gag interaction is notrequired for Env localization in DRMs in monolayer CD4

293T cells or in suspended CD4� T cells.Assessment of lipid raft localization of T- and M-tropic Env

proteins. We then confirmed that the HXB2 strain Env ex-pressed without Gag is also localized in lipid rafts by employingthe multilayer, stepwise sucrose gradient centrifugationmethod. Just like the Env encoded by the WT pHXB2R3provirus, which was found to be associated with DRM-L andDRM-H (Fig. 4A, top panel), the Env proteins encoded by apCAGGS promoter-driven Env plasmid (17), marked as pCX-Env, and by WT pSVE7puro were also found to be localized inDRM-L and DRM-H (Fig. 4A, middle and bottom panels,respectively). When the raft association property of Env wasassessed, the percentages of Env distributed into DRM-L,DRM-H, and DSM were 16.9%, 23.3%, and 59.8%, respec-tively, for the HXB2 proviral Env; 18.8%, 22.1%, and 59.1%,respectively, for the pCAGGS Env; and 17.6%, 26.7%, and55.7%, respectively, for the pSVE7puro Env. These observa-tions further indicate that Env without Gag coexpression is stilleffectively associated with raft membranes.

To understand whether localization in lipid rafts is a generalproperty of HIV-1 Env, the Env proteins of T-tropic NL4-3and M-tropic ConB (13) clones, encoded by the pSVE7purovector, were examined. As observed with the Env derived fromthe HXB2 strain, the NL4-3 and ConB Env proteins were alsolocalized to lipid rafts in the absence of Gag expression (Fig.4B). The percentage of Env located in lipid rafts relative to thetotal Env level was quantified to be 19.2%, 12.7%, and 24.9%,respectively, for Env proteins of HXB2, NL4-3, and ConB


strains without Gag coexpression. This observation further re-veals that association of gp41 with lipid rafts does not requireGag coexpression and is an intrinsic property of Env proteinsof different subtypes.

Requirement of cholesterol for Env partitioning into lipidraft membranes. When 293T cells transfected with the WT pro-virus were treated with different concentrations of �-MCD, whichdepletes cholesterol from the cell surface, at 37°C for 30 min

FIG. 2. Analyses of Env cytoplasmic tail truncation mutants for lipid raft localization. (A) Subconfluent 293T cell monolayers were transfected withpHXBn-PLAP-IRES-N� or mock transfected by a standard calcium phosphate coprecipitation method. Cells were lysed with 1% Triton X-100 in PBSon ice and subjected to sucrose density gradient ultracentrifugation followed by SDS-PAGE and Western blotting analysis with antibodies against PLAP,flotillin-1, and caveolin-1. (B) 293T cell monolayers were transfected with each of the WT or mutant proviral clones, and cold Triton X-100-extracted celllysates were subjected to sucrose density gradient ultracentrifugation followed by Western blotting analysis with the Chessie 8 MAb. (Top) Thedistribution patterns of gp41 from a representative set of data are shown. (Bottom) The percentages of the levels of WT and mutant gp41 proteinsfractionated into DRMs relative to the total gp41 levels were calculated by quantifying ECL images. The percentages of association with DRMs of mutantproteins relative to that of the WT protein were quantified from three independent studies, with the means standard deviations shown. (C) (Top) 293Tcells were cotransfected with pIIIextat together with each of the WT and mutant pSVE7puro plasmids, and the gp41 distribution profiles from a set ofrepresentative data are shown. (Bottom) The relative DRM association ability of the mutant proteins was expressed as a percentage of that of WT gp41.The diagram represents the results from three independent experiments (means standard deviations). (D) The absolute raft association ability of Envwas quantified from three separate raft flotation analyses, and the mean standard deviation is indicated. (E) CEM-SS cells were infected with VSVG trans-complemented WT and mutant viruses containing 106 cpm of RT activity. The cold Triton X-100-extracted cell lysates were analyzed by sucrosedensity gradient centrifugation, and the profiles of gp41 partitioning into the DRMs are shown.


before extraction with cold Triton X-100, �-MCD decreased Envlocalization in lipid rafts in a dose-dependent manner (Fig. 5A).In the context of Env expression alone, �-MCD treatment alsogreatly abolished the association of Env with lipid rafts (Fig. 5B,compare the top and middle panels). However, replenishment of�-MCD-treated cells with cholesterol restored the ability of Envto associate with lipid rafts (Fig. 5B, bottom panel). These resultstogether indicate that HIV-1 Env is specifically localized in lipidraft membranes and that its binding to lipid raft membranes ischolesterol dependent.

The amphipathic �-helical structure of the hydrophobicface of LLP-1 is critical for Env-lipid raft associations. TheLLP-1 motif is characterized by its amphipathic �-helical fea-ture. To examine the involvement of the �-helical structure ofthis motif in the Env-lipid raft association, a series of mutantproviruses encoding single point deletions in LLP-1 (Fig. 1B,first group) was examined. Deletions of single amino acids inthe N-terminal and central regions, such as in the �830, �833,�836, �840, �843, and �847 mutants, with deletions of Ile-830,Val-833, Ala-836, Ile-840, Ile-843, and Ile-847, respectively,

FIG. 3. Analyses of WT and mutant NL4-3 viruses. (A) 293T cells were transfected with WT, 12LE, or 30LE Gag mutant NL4-3 proviruses inthe presence of pHCMV-VSV G. Cell-free, VSV G trans-complemented WT and mutant viruses containing equal amounts of RT activity wereused to challenge the T-cell lymphoma SupT1 cell line, and cell and virion lysates were subjected to SDS-PAGE followed by Western immuno-blotting analyses using 902 and Chessie 8 MAbs (top and middle panels, respectively) and MAb 183 (bottom panel). (B) 293T cells transfectedwith pHXB2R3 or with WT, 12LE, or 30LE mutant pNL4-3 clones were subjected to a lipid raft flotation assay. The gp41 distribution profile foreach transfection is shown. (C) 293T cells were transfected with pHXBn-PLAP-IRES-N� or mock transfected, lysed with 0.5% Triton X-100 inPBS, and then subjected to Clapham’s multilayer step gradient centrifugation. Proteins in each fraction were then analyzed by Westernimmunoblotting with PLAP, flotillin-1, and caveolin-1 antibodies. (D) 293T cells transfected with the indicated proviral constructs were lysed withTriton X-100 and subjected to multilayer lipid raft flotation analysis. (E) CEM-SS cells were infected with VSV G trans-complemented HXB2 andNL4-3 viruses, and the cold Triton X-100-extracted cell lysates were analyzed by the conventional three-layer lipid raft flotation assay.


abrogated or greatly reduced Env-lipid raft interactions (Fig.6A). However, Env with a deletion of Ile-854, which is posi-tioned at the extreme C terminus of LLP-1, was still located inlipid rafts (Fig. 6A). Interestingly, deletion of Thr-818, which issituated between the LLP-3 and LLP-1 motifs, also greatlyreduced Env localization in lipid rafts (Fig. 6A).

To study the specificity of displacement of the amphipathic�-helix of LLP-1 in Env-lipid raft interactions, the effects ofPro substitutions for residues in this motif were examined. Prowas expected to disrupt the structure of the �-helix more se-verely than were other amino acids. Mutant proteins with Prosubstitutions for Val-829, Val-832, Val-833, Ala-839, Ile-843,and Leu-855 (Fig. 1B, second group) in Env were examined.Pro substitutions for residues in the hydrophobic face ofLLP-1, such as Val-829, Val-833, and Ile-843, all diminished orgreatly decreased gp41-raft associations compared to thosewith WT Env (Fig. 6B). However, substitutions of Pro forresidues in the hydrophilic face, such as Val-832, Ala-839, andLeu-855, did not greatly alter Env-lipid raft associations(Fig. 6B).

To further study the specificity of Pro substitution for resi-dues in the hydrophilic and hydrophobic faces of LLP-1 in Envlocalization in lipid rafts, the effects of Ala, Ser, and Pro sub-stitutions for Val-832 and Val-833 (Fig. 1B, third group) werecompared. Unlike the Pro substitution for Val-833, substitu-tions of Ala and Ser, respectively, for Val-833 did not greatlyaffect Env-raft associations (Fig. 6C), while Ala, Ser, and Pro

substitutions for Val-832 had no apparent effects on Env-lipidraft associations (Fig. 6C).

Charge switching in the hydrophilic face of LLP-1 does notaffect Env-lipid raft associations. There are multiple positivelycharged Arg and negatively charged Glu residues clustered inLLP-1 (Fig. 1A). To determine the involvement of thesecharged residues in Env localization in lipid rafts, mutant pro-teins with Glu substitutions for Arg-838, Arg-841, Arg-845,Arg-846, Arg-848, and Arg-853 and an Arg substitution forGlu-831 (Fig. 1B, fourth group) were analyzed. None of thesemutations greatly altered the raft association property of Env(Fig. 6D).

Analysis of replication kinetics of Pro substitution andcharge-reversing mutant viruses. To understand whether Envlocalization in lipid rafts may have a role in virus infection, thereplication kinetics of WT and Pro-substituted mutants wereassessed. As previously shown (33), the 833P mutant virus wasseverely impaired in its replication, and no RT activity wasdetected even up to 32 days after virus challenge (Fig. 7A).Despite a slight delay in viral replication kinetics, the 829Pmutant still replicated productively, whereas all other mutantsreplicated with kinetics similar to those of the WT virus (Fig.7A). Moreover, all charge-switching mutants replicated as pro-

FIG. 4. Analyses of lipid raft association ability of Env proteins.(A) 293T cells transfected with WT pHXB2R3 (top), the Tat-indepen-dent pCX-Env plasmid (middle), or the Tat-dependent pSVE7puroplasmid (bottom) were processed for multilayer lipid raft flotationanalysis. (B) 293T cells expressing each of the Env proteins derivedfrom HIV-1 LTR-directed HXB2, NL4-3, and ConB clones in theabsence of Gag coexpression were assessed by a three-layer densitygradient lipid raft flotation analysis. For both panels, two independentstudies were performed, with similar results obtained. The data from arepresentative set are thus shown.

FIG. 5. Effects of cholesterol on Env association with lipid rafts.(A) 293T cells transfected with WT pHXB2R3 were treated with�-MCD at the indicated concentrations in serum-free DMEM at 37°Cfor 30 min prior to being lysed with cold Triton X-100. The resultantcell extracts were then subjected to a lipid raft flotation assay. (B) 293Tcells cotransfected with WT pSVE7puro and pIIIextat were incubatedin serum-free DMEM (top), with 20 mM �-MCD in serum-freeDMEM (middle), or with 20 mM �-MCD followed by replenishmentwith 100 �g/ml of cholesterol prepared as a cholesterol–�-MCD com-plex (bottom) prior to cold detergent lysis. Cell lysates were thensubjected to sucrose gradient lipid raft flotation analysis.


ductively as the WT virus, although the R853E mutant showeda slight delay in its replication kinetics compared to the WTvirus (Fig. 7B).

We then examined the effects of these mutations on viralinfectivity, using LuSIV cells, a firefly luciferase gene-harbor-ing reporter cell line (62). This cell line allows assessment ofnearly one-cycle viral entry based on the ability of Tat, uponviral infection, to transactivate HIV-1 LTR-linked luciferasegene expression in CEMx174 cells. All Pro substitution mu-tants examined here, including the 833P mutant, exhibited viralinfectivities similar to or even greater than that of the WT virus(Fig. 7C). To provide evidence for the observation that the833P mutant possesses WT-like one-cycle viral entry in thisreporter gene activation assay, the infectivity of the �833 and�LWYIK mutants was also assessed. Due to its instable na-ture, the �833 mutant, just like the 833P mutant, showedseverely impaired replication kinetics compared to the WTvirus (33). The �LWYIK mutant, in which the LWYIK motiflocated immediately proximal to the TM region of gp41 isdeleted, had an impaired fusion ability, resulting in inhibitedone-cycle viral infectivity and delayed replication kinetics com-pared to those of the WT virus (17). The �LWYIK and �833mutants showed inhibited one-cycle viral infectivities com-pared to the WT virus (Fig. 7C). These results together indi-cate that despite the phenotype of reduced Env assembly in thevirions, the level of Env present on the 833P mutant may stillexceed the threshold Env level required to initiate successfulCD4 and coreceptor binding events, resulting in reporter geneexpression following viral entry. Nevertheless, the effect of thismutation on Env destabilization may be augmented further inlater rounds of viral replication, resulting in detrimental con-sequences in viral replication kinetic assays (Fig. 7A). As tocharge-reversing mutants, the E831R mutant still possessed75% of the one-round viral infectivity of the WT virus, while

other mutants did not affect one-cycle viral infectivity com-pared to that of the WT virus (Fig. 7D). These results collec-tively indicate that all mutants, but not the 833P mutant, ex-hibit WT virus-like replication capacities.

Analyses of viral protein expression of mutants. To deter-mine whether Pro-substituted mutants can impair the Env mat-uration process and/or incorporation of Env into the virus,viral protein expression of these mutants was assessed in 293Tcells, which supported one-round viral assembly/budding. Allof the WT and mutant viruses produced comparable amountsof intracellular and virion-associated Gag Pr55 precursors andits cleaved products, p41 and p24 (Fig. 7E). As shown previ-ously (33), the 833P mutant produced smaller amounts ofintracellular gp160, gp120, and gp41 and virion-associatedgp120 and gp41 than those produced by WT virus expression(Fig. 7E, compare lanes 4 and 11 to lanes 1 and 8). None of theother mutants had a notable effect on gp160 synthesis, precur-sor processing, or incorporation of gp120 and gp41 into thevirus (Fig. 7E). When charge-switching mutants were assessed,synthesis, precursor processing, and assembly/budding of Gagand Env and their maturation and incorporation into mutantviruses were apparently normal compared to those observedwith the WT virus (Fig. 7F).

Next, viral protein expression in SupT1 cells, which are nat-ural host cells permissive for HIV-1 infection, was assessed bythe HIV-1 expression system based on trans-complementationwith the VSV G protein. Again, none of the Pro substitutionsin LLP-1, except for that in the 833P mutant, affected Envsynthesis, precursor processing, or Env incorporation into thevirus (Fig. 7G). Similarly, none of the charge-switching mu-tants showed obviously altered Env phenotypes compared tothose of WT Env (Fig. 7H). These results together indicatethat whether the Env is localized in Triton X-100-resistant

FIG. 6. Site-directed mutational analysis of LLP-1 for Env localization in lipid rafts. 293T cells transfected with WT or mutant pHXB2R3proviruses with point deletions (A), Pro substitutions (B), Ala, Ser, or Pro substitutions for Val-832 and Val-833 (C), or charge-switching residues(D), as indicated, were analyzed for gp41 association with lipid rafts. In each case, the relative raft association properties of mutant proteins wereexpressed as percentages of that of the WT Env, and diagrams representing the results from three independent experiments (means standarddeviations) are shown.



DRMs does not necessarily have a consequential effect on theviral replication capacity or on Env assembly in the virus.

Intracellular localization of mutant viruses. To examinewhether exclusion of mutants from Triton X-100-resistant raftsmay possibly be due to their aberrant intracellular transport tothe cell surface, the intracellular localization of the 829P, 833P,843P, TM844, and TM813 mutants was examined by confocalmicroscopy, along with the raft-associated WT and 832P mu-tant proteins. Since Env is known to be retained largely in theendoplasmic reticulum (ER) or in a cis-Golgi compartment (5,19, 76), colocalization with calreticulin, an ER marker, wasexamined. A significant fraction of the WT Env was colocalizedwith calreticulin in the perinuclear area, and it was also colo-calized as peripheric dots in the cytoplasm and as speckles nearor on the surface (Fig. 8A). Also, a fraction of WT Env locatedin the cytoplasm was not colocalized with calreticulin (Fig. 8A).All mutant proteins also exhibited intracellular distributionpatterns similar to that of WT Env (Fig. 8A).

Next, the total and cell surface expression levels of WT andmutant proteins were examined by FACS analysis (Fig. 8B).Consist with its destabilized nature, the 833P mutant exhibitedreduced levels of total and cell surface expression compared tothe WT and other mutants (Fig. 8B). Although total levels ofthe TM813 and 843P mutants were slightly lower than thoseof the WT and the other mutants, which could have been dueto variations in transfection efficiencies of these two mutants inthis particular analysis, these two mutants still showed similarlevels of Env on the cell surface compared to the WT and othermutants (Fig. 8B). Quantitative results from three independentexperiments showed that with the exception of the 833P mu-tant, all mutants showed similar levels of total and cell surfaceexpression to those of WT Env (Fig. 8C). These studies to-gether indicate that these mutants are synthesized and trans-ported to and expressed on the plasma membrane as effectivelyas WT Env.

The C-terminal two-thirds of the cytoplasmic tail containslipid raft-targeting signals. We showed that the C-terminaltwo-thirds, but not the N-terminal one-third, of the cytoplas-mic tail contains membrane-associated sequences (16). To fur-ther understand the molecular basis of Env localization in lipidrafts, an Escherichia coli cytosolic reporter protein, �-Gal, wasindividually tagged with various subdomains of the gp41 cyto-plasmic tail, and the ability of these cytoplasmic segments totarget �-Gal to DRMs was examined. As a control, �-Gal byitself was distributed in the soluble fraction (Fig. 9A, panel 1).The 760-856 segment, but not the 706-752 segment, was able to

target �-Gal to lipid rafts (Fig. 9A, panels 3 and 2, respec-tively). Next, the ability of each LLP sequence, spanning resi-dues 816 to 856, 760 to 795, or 786 to 813, was assessed.Intriguingly, this motif by itself did not possess lipid raft-tar-geting ability (Fig. 9A, panels 4 to 6). We then determinedwhether two contiguous LLP sequences possessed raft-target-ing ability. Unlike the 760-856 segment, the 760-813 segment,which contains LLP-2 and LLP-3, did not confer raft-targetingability (Fig. 9A, panel 7). Interestingly, the region spanningboth the LLP-3 and LLP-1 motifs, i.e., the 786-856 sequence,was able to target �-Gal to lipid rafts despite its lower raft-targeting efficiency, i.e., 38% of that of the 760-856 segment(Fig. 9A, compare panel 8 to panel 3 and also see the graph).Nevertheless, deletion of the last 12 amino acid residues fromLLP-1, i.e., the 786-844 sequence, greatly reduced the raft-targeting ability of the 786-856 segment (Fig. 9A, panel 9).

The �-helical structure of the hydrophobic face of LLP-1 iscritical for the lipid raft-targeting ability of the 786-856 se-quence. We showed that the �-helix of the hydrophobic face ofLLP-1 is critical for Env association with lipid rafts. We thendetermined whether the hydrophobic face of the LLP-1 �-helixcontaining the 786-856 sequence also plays a pivotal role intargeting �-Gal to lipid rafts. Deletion of Val-833 but notIle-854 disrupted the lipid raft-targeting ability of the 786-856segment (Fig. 9B, compare panels 3 and 4, respectively, topanel 2). Moreover, a mutant with Pro substituted for Val-832still possessed 72% of the raft-targeting ability of the 786-856segment, whereas a mutant with Pro substituted for Val-833greatly abolished the raft-targeting ability (Fig. 9B, comparepanels 6 and 5, respectively, to panel 2 and also see the graph).

DISCUSSION

In the present study, we extend our previous efforts (17) tounravel the molecular basis of HIV-1 Env localization in lipidrafts. We show that LLP motifs located in the C-terminalcytoplasmic tail of gp41 play a crucial role in Env localizationin Triton X-100-resistant lipid rafts and that Env is capable oflocalizing in lipid rafts without functional Gag-Env interaction.

A deletion in the �-helix is expected to skew the structure ina way that residues originally aligned on either the hydropho-bic or hydrophilic face of the helix become displaced. Pointdeletions in the N-terminal and central regions of the LLP-1motif, e.g., in the �830 and �843 mutants, resulted in disper-sion of the positively and negatively charged residues into thehydrophobic face (Fig. 10A). However, deletion at the extreme

FIG. 7. Characterization of mutant viruses. (A and B) Viral replication analyses. Cell-free viruses obtained from 293T cells transfected with theWT and Pro-substituted mutants (A) or charge-reversing mutants (B) were normalized by RT activity prior to challenge with CEM-SS cells, andculture supernatants were measured for RT activity at different days postinfection. The studies were performed at least three times, with similarresults obtained. Thus, a representative set of data for each group of infection is shown. (C and D) One-cycle viral infectivity assay. LuSIV cellswere infected with WT or mutant viruses, and infected cells were lysed and assayed for luciferase activity as indicated in Materials and Methods.The background luciferase activity detected in cells mock infected or challenged with virus produced from env-defective pHXBCAT�Bgl, markedas Env, was used as a negative control. The diagrams represent the results of luciferase activities of WT and mutant viruses from threeindependent experiments (means standard deviations). (E and F) Viral protein expression in 293T cells. 293T cells were transfected with WTor mutant proviruses as indicated. Two days after transfection, equal volumes of cell and virion lysates were subjected to SDS-PAGE followed byWestern blotting analysis using 902, Chessie 8, and 183 MAbs. (G and H) Viral protein expression in SupT1 cells. VSV G trans-complementedWT and mutant viruses were normalized by their RT activity and then used to challenge SupT1 cells. Two days after infection, cell cultures wereharvested, and cell and virion lysates were resolved by Western blotting as indicated in panels E and F.


FIG. 8. Analysis of subcellular localization of mutant viruses. (A) Intracellular localization of Env proteins. HeLa cells grown oncoverslips coated with gelatin were transfected with WT or mutant proviruses, as indicated. Two days after transfection, cells were processedfor immunostaining, followed by confocal microscopy. (B and C) Analyses of total and cell surface expression of Env proteins. (B) 293T cellswere transfected with WT or mutant proviruses, and 2 days after transfection, cells were harvested and examined for total and cell surfaceexpression of Env by flow cytometry. Transfection with pHXBCAT�Bgl, marked as Env, was used as a negative control. The study wasperformed three times, with similar results obtained. Data from a representative set are shown. (C) The specific levels of total and surfaceEnv of the WT and mutant viruses were obtained by subtracting the background level from each value obtained by flow cytometry. Therelative total and surface levels of mutants, which were expressed as percentages of those of WT Env, were quantitated from three separateanalyses, with the means standard deviations shown.


C terminus of LLP-1, such as in the �854 mutant, did not affectthe amphipathic �-helical feature of LLP-1 (Fig. 10A). Thus,the observation that displacement of the amphipathic �-helixof LLP-1 by a single deletion alters Env association withDRMs (Fig. 6A) suggests that the �-helical feature of LLP-1 isimportant for Env localization in these raft microdomains. Prois expected to disrupt the local �-helical structure more se-verely than do other amino acids. Pro substitutions for residuesin the hydrophobic face, such as Val-829, Val-833, and Ile-843,had a greater impact on gp41-raft association than did substi-tutions of those in the hydrophilic face, such as Val-832, Ala-839, and Leu-855 (Fig. 6B and 10B). Moreover, Pro, Ser, andAla are expected to alter the local or neighboring �-helicalconformation in an increasingly severe order of Pro � Ser �Ala, as shown by previous peptide modeling studies on theleucine zipper-like motif of HIV-1 gp41 (75). The differentialeffects of these substitutions on Val-832 and Val-833 (Fig. 6C)further confirm that the �-helical structure of the hydrophobicface of LLP-1 has a more critical role in Env-raft associationsthan does the hydrophilic face. This notion is in accordancewith the results showing that charge-switching mutations in thehydrophilic face did not greatly alter gp41 association withlipid rafts (Fig. 6D and 10C).

The critical involvement of LLP sequences in Env-raft asso-ciation was further supported by the ability of the C-terminaltwo-thirds, but not the N-terminal one-third, of the cytoplas-mic domain to target a cytoplasmic reporter protein, e.g.,�-Gal, to DRMs (Fig. 9A). Nevertheless, each of the LLPmotifs by itself was insufficient to target �-Gal to DRMs. Re-markably, the intact LLP-3 and LLP-1 motifs, but not theLLP-2 or LLP-3 motif, acted in tandem as a raft-targetingsignal. The observation that the 786-856 segment possessedonly about 38% of the lipid raft-targeting ability of the 760-856segment (Fig. 9A) implies that LLP-2, although insufficient forlipid raft targeting, is still required for the maximal raft-target-ing capacity of the LLP-3 and LLP-1 motifs.

We previously showed that LLP motifs possess self-assemblyand membrane-interacting abilities and that these motifs cantarget a cytosolic protein to the ER (16, 34). This observationtogether with the present study reveals that a long, contiguous,membrane-interacting sequence encompassing intact LLP-3and LLP-1 motifs is necessary to direct a cytosolic reporterprotein to Triton X-100-resistant raft-like microdomains in theER membrane (10, 55, 67). The mutagenesis and subdomaintargeting studies pointed out that the long stretch of LLP-3 andLLP-1, particularly the �-helical structure of the hydrophobicface in LLP-1, not only is involved in but also mediates Envbinding to Triton X-100-resistant lipid rafts (Fig. 2, 6, and 9).Also, the presence of LLP-2 may increase the interface ofLLP-3 and LLP-1 with lipid rafts or stabilize the association ofLLP-3 and LLP-1 sequences with lipid rafts. Alternatively, it islikely that the hydrophobic residues of LLP-3 and LLP-1, byvirtue of being buried within the hydrophobic core of lipidFIG. 9. Analyses of lipid raft-targeting ability of cytoplasmic sub-

domains. (A) 293T cells were transfected with pcDNA3-�-gal chimerasencoding �-Gal or the indicated gp41 cytoplasmic tail fragments fusedto the C terminus of �-Gal. Cold 1% Triton X-100-extracted celllysates were subjected to lipid raft sucrose density gradient centrifu-gation followed by Western blotting analysis with a �-Gal MAb. A setof data from a representative experiment is shown in panels 1 to 9,whereas the average values from two separate analyses are shown inthe bottom graph. (B) 293T cells were transfected with either �-Gal orWT or mutant �-Gal–786-856 chimeras, as indicated. Cell lysates were

subjected to a lipid raft flotation analysis followed by Western blottingusing a �-Gal MAb. Results from a representative set are shown inpanels 1 to 6. Also, the average values from two independent analysesare shown in the bottom graph.


raft-associated cellular proteins, may directly interact with thelipid portions of Triton X-100-resistant raft membranes. Dis-ruption of the lipid raft integrity or structure by cholesteroldepletion thereby hinders Env’s association with lipid raftmembranes (Fig. 5).

Given the known Env phenotypes of the mutants describedhere and those which were previously characterized, we cannotsimply attribute the property of Env localization in TritonX-100-resistant lipid rafts to viral replication or Env assemblyin the virus. For instance, truncations of the last 12 and 43amino acids from the C terminus of the cytoplasmic tail, i.e.,the TM844 and TM813 mutants, respectively, greatly disruptedEnv localization in lipid rafts (Fig. 2), but the incorporation ofgp120 into the virus for these two mutants was normal despitethe drastically reduced or lacking infectivity of these two mu-tants compared to that of the WT virus (78). All single-deletionmutants in LLP-1, but not the �854 mutant, abrogated thelipid raft association property of Env (Fig. 6A); nonetheless,only N-terminal LLP-1 deletion mutants, such as the �830 and�833 mutants, exhibited severely impaired viral replication,which was attributable to the instability of their Env proteins.The �843 and �847 mutants still displayed WT-like viral rep-lication kinetics and Env incorporation into the virus, whereas

the �836 and �840 mutants were also replication competent(33). Furthermore, Pro substitutions for residues located in thehydrophobic face, e.g., in the 829P and 843P mutants, showedgreatly decreased Env localization to lipid rafts (Fig. 6B); how-ever, these mutations did not have significant impacts on one-cycle viral infectivity, virus replication kinetics, or Env incor-poration (Fig. 7). On the other hand, Env localization in lipidrafts does not ensure viral infectivity. We recently showed thatthe highly conserved putative cholesterol-binding LWYIK mo-tif, located at residues 679 to 683, does not have an apparentrole in Env’s association with lipid rafts, despite its role in thegp41-mediated fusion process (17).

Of note, exclusion of mutant proteins, such as those of the829P, 843P, and TM mutants, from Triton X-100-resistant lipidrafts cannot be attributed to their abnormal intracellular traf-ficking to the plasma membrane. The observation that all Pro-substituted mutants, with the exception of the 833P mutant,were efficiently processed to yield gp120 and gp41 (Fig. 7E andG) implies that they are normally transported to the trans-Golgi network, where the Env precursor is cleaved to producegp120 and gp41. Protein folding and oligomerization play anessential role in targeting viral Env glycoproteins to the plasmamembrane (for reviews, see references 29 and 63). The fact

FIG. 10. Heptagonal representation of the LLP-1 �-helix. (A) The amino acid sequence of LLP-1 (amino acids 828 to 856) was plotted in aseven-point wheel format to represent the helical configuration of selected point deletions. Blue, positively charged residue; red, negatively chargedresidue; purple, glutamine; green, histidine. The WT sequence maintains an amphipathic helical arrangement with segregated hydrophilic(charged) and hydrophobic residues. In all deletion mutants, all but the �854 mutant altered the hydrophilic/hydrophobic orientation of the �-helix.(B) Positions of residues replaced by Pro are mapped in the heptagonal representation of the LLP-1 helix. Red, mutations that disrupted Env-raftassociations; green, mutations that did not disrupt Env-raft associations. (C) Positions of Arg/Glu mutations in the LLP-1 �-helix. None of thecharge conversion mutations in the hydrophilic face affected the lipid raft localization ability of the Env protein, and they are therefore markedin green.


that those Pro-substituted mutants (but not the 833P mutant)that were not localized in Triton X-100-resistant lipid raftswere still incorporated effectively into the virus (Fig. 7E and G)suggests that they are normally assembled and folded into anoligomeric structure, which is subsequently transported to theplasma membrane. This proposition was further supported bytheir similar intracellular localization and cell surface expres-sion patterns compared to the WT Env (Fig. 8). Moreover, thenormal Env incorporation phenotype of the TM844 andTM813 mutants (78) is in accordance with their normal ex-pression on the cell surface (Fig. 8). Similarly, the observationthat all LLP-1 deletion mutants, but not the �830 and �833mutants, exhibited WT-like phenotypes of viral replication ki-netics and Env incorporation into the virus (33) also impliesthat they are normally transported to and expressed on the cellsurface. The findings that comparable amounts of gp41 andgp120 were associated with the 829P, 843P, TM844, andTM813 mutant virions also imply that these mutations neitheraffected the effectiveness of the TM region in anchoring themutant Env into membranes nor altered gp120-gp41 interac-tions, despite these mutants being sequestered in non-TritonX-100-resistant membranes.

The recruitment of Env into lipid rafts without participa-tion of Gag should have biological implications. Gag target-ing to raft-like domains on the plasma membrane requiresMA myristylation and protein oligomerization (22, 36). Nev-ertheless, in a model system, myristylated green fluorescentproteins containing palmitoylated or polybasic sequencescolocalize with cholesterol and ganglioside GM1-enrichedmembrane domains, but not in lipid rafts/caveolae (42). Thisraises the possibility that the membrane targeting signal, i.e.,myristylation and the basic residues, in MA might not besufficient to target Gag to lipid rafts, and other factors mayalso contribute to HIV-1’s localization to lipid rafts. HIV-1MA targeting to lipid rafts may occur via its binding tophosphatidylinositol diphosphate [PI(4,5)P2] (66, 72), whichis enriched in lipid rafts (28). Our results raise the interest-ing possibility that under certain circumstances, Gag target-ing to lipid rafts may proceed via its interaction with Env,which is integrated into lipid raft membranes regardless ofwhether or not Gag is expressed. In support of the hypoth-esis that MA interacting with Env plays an active role duringviral assembly at lipid rafts, coexpression with Env can re-direct Gag assembly and budding in polarized epithelialcells, and mutations in MA and truncations in the gp41cytoplasmic tail can abrogate this polarized budding (37,52). Moreover, it is likely that accumulation of Env at lipidrafts may increase the affinity of Gag to bind to lipid rafts,thus promoting constant recruitment of Gag into these spe-cialized membrane microdomains (68).

In sum, our results show that association with Triton X-100-resistant lipid rafts is an intrinsic property of HIV-1 Env andthat gp41 harbors sequences and/or structural determinantsmediating Env’s association with and targeting to TritonX-100-resistant lipid rafts. To the best of our knowledge, this isthe first report demonstrating that the amphipathic �-helixlocated in the cytoplasmic tail of a TM protein confers theability to target the protein to lipid rafts.

ACKNOWLEDGMENTS

We are grateful to Tun-Hou Lee for providing the pHXB2R3-basedgp41 cytoplasmic tail truncation mutants and to Eric O. Freed forproviding the pNL4-3-derived 12LE and 30LE Gag mutants. pNL4-3was obtained from Malcolm Martin, pHXBn-PLAP-IRES-N� fromBenjamin K. Chen and David Baltimore, and LuSIV from Jason W.Roos and Janice E. Clements, through the AIDS Research and Ref-erence Reagent Program, Division of AIDS, NIAID, NIH.

This work was supported by grants from the National Health Re-search Institute (NHRI-EX95-9431SI and NHRI-EX96-9431SI), Mia-oli, Taiwan, and the National Science Council (NSC98-2320-B-001-012-MY3) and by Theme Program Project grants (5202401023-23-4m)from Academia Sinica, Taipei, Taiwan, Republic of China.

REFERENCES

1. Anderson, R. G. 1998. The caveolae membrane system. Annu. Rev. Bio-chem. 67:199–225.

2. Arreaza, G., and D. A. Brown. 1995. Sorting and intracellular trafficking of aglycosylphosphatidylinositol-anchored protein and two hybrid transmem-brane proteins with the same ectodomain in Madin-Darby canine kidneyepithelial cells. J. Biol. Chem. 270:23641–23647.

3. Bartz, S. R., M. E. Rogel, and M. Emerman. 1996. Human immunodeficiencyvirus type 1 cell cycle control: Vpr is cytostatic and mediates G2 accumula-tion by a mechanism which differs from DNA damage checkpoint control.J. Virol. 70:2324–2331.

4. Berlioz-Torrent, C., B. L. Shacklett, L. Erdtmann, L. Delamarre, I.Bouchaert, P. Sonigo, M. C. Dokhelar, and R. Benarous. 1999. Interactionsof the cytoplasmic domains of human and simian retroviral transmembraneproteins with components of the clathrin adaptor complexes modulate in-tracellular and cell surface expression of envelope glycoproteins. J. Virol.73:1350–1361.

5. Berman, P. W., W. M. Nunes, and O. K. Haffar. 1988. Expression of mem-brane-associated and secreted variants of gp160 of human immunodeficiencyvirus type 1 in vitro and in continuous cell lines. J. Virol. 62:3135–3142.

6. Bhattacharya, J., P. J. Peters, and P. R. Clapham. 2004. Human immuno-deficiency virus type 1 envelope glycoproteins that lack cytoplasmic domaincysteines: impact on association with membrane lipid rafts and incorporationonto budding virus particles. J. Virol. 78:5500–5506.

7. Bhattacharya, J., A. Repik, and P. R. Clapham. 2006. Gag regulates associ-ation of human immunodeficiency virus type 1 envelope with detergent-resistant membranes. J. Virol. 80:5292–5300.

8. Blot, G., K. Janvier, S. Le Panse, R. Benarous, and C. Berlioz-Torrent. 2003.Targeting of the human immunodeficiency virus type 1 envelope to thetrans-Golgi network through binding to TIP47 is required for env incorpo-ration into virions and infectivity. J. Virol. 77:6931–6945.

9. Boge, M., S. Wyss, J. S. Bonifacino, and M. Thali. 1998. A membrane-proximal tyrosine-based signal mediates internalization of the HIV-1 enve-lope glycoprotein via interaction with the AP-2 clathrin adaptor. J. Biol.Chem. 273:15773–15778.

10. Browman, D. T., M. E. Resek, L. D. Zajchowski, and S. M. Robbins. 2006.Erlin-1 and erlin-2 are novel members of the prohibitin family of proteinsthat define lipid-raft-like domains of the ER. J. Cell Sci. 119:3149–3160.

11. Brown, D. A. 2006. Lipid rafts, detergent-resistant membranes, and rafttargeting signals. Physiology (Bethesda, MD) 21:430–439.

12. Bultmann, A., W. Muranyi, B. Seed, and J. Haas. 2001. Identification of twosequences in the cytoplasmic tail of the human immunodeficiency virus type1 envelope glycoprotein that inhibit cell surface expression. J. Virol. 75:5263–5276.

13. Chan, W. E., H. H. Lin, and S. S. Chen. 2005. Wild-type-like viral replicationpotential of human immunodeficiency virus type 1 envelope mutants lackingpalmitoylation signals. J. Virol. 79:8374–8387.

14. Chan, W. E., Y. L. Wang, H. H. Lin, and S. S. Chen. 2004. Effect of extensionof the cytoplasmic domain of human immunodeficiency type 1 virus trans-membrane protein gp41 on virus replication. J. Virol. 78:5157–5169.

15. Chen, S. S., A. A. Ferrante, and E. F. Terwilliger. 1996. Characterization ofan envelope mutant of HIV-1 that interferes with viral infectivity. Virology226:260–268.

16. Chen, S. S., S. F. Lee, and C. T. Wang. 2001. Cellular membrane-bindingability of the C-terminal cytoplasmic domain of human immunodeficiencyvirus type 1 envelope transmembrane protein gp41. J. Virol. 75:9925–9938.

17. Chen, S. S., P. Yang, P. Y. Ke, H. F. Li, W. E. Chan, D. K. Chang, C. K.Chuang, Y. Tsai, and S. C. Huang. 2009. Identification of the LWYIK motiflocated in the human immunodeficiency virus type 1 transmembrane gp41protein as a distinct determinant for viral infection. J. Virol. 83:870–883.

18. Cimarelli, A., and J. L. Darlix. 2002. Assembling the human immunodefi-ciency virus type 1. Cell Mol. Life Sci. 59:1166–1184.

19. Crise, B., L. Buonocore, and J. K. Rose. 1990. CD4 is retained in theendoplasmic reticulum by the human immunodeficiency virus type 1 glyco-protein precursor. J. Virol. 64:5585–5593.

20. Day, J. R., C. Munk, and J. C. Guatelli. 2004. The membrane-proximal


tyrosine-based sorting signal of human immunodeficiency virus type 1 gp41is required for optimal viral infectivity. J. Virol. 78:1069–1079.

21. Deschambeault, J., J. P. Lalonde, G. Cervantes-Acosta, R. Lodge, E. A.Cohen, and G. Lemay. 1999. Polarized human immunodeficiency virus bud-ding in lymphocytes involves a tyrosine-based signal and favors cell-to-cellviral transmission. J. Virol. 73:5010–5017.

22. Ding, L., A. Derdowski, J. J. Wang, and P. Spearman. 2003. Independentsegregation of human immunodeficiency virus type 1 Gag protein complexesand lipid rafts. J. Virol. 77:1916–1926.

23. Edwards, T. G., S. Wyss, J. D. Reeves, S. Zolla-Pazner, J. A. Hoxie, R. W.Doms, and F. Baribaud. 2002. Truncation of the cytoplasmic domain inducesexposure of conserved regions in the ectodomain of human immunodefi-ciency virus type 1 envelope protein. J. Virol. 76:2683–2691.

24. Freed, E. O. 1998. HIV-1 gag proteins: diverse functions in the virus lifecycle. Virology 251:1–15.

25. Freed, E. O. 2002. Viral late domains. J. Virol. 76:4679–4687.26. Freed, E. O., and M. A. Martin. 1995. Virion incorporation of envelope

glycoproteins with long but not short cytoplasmic tails is blocked by specific,single amino acid substitutions in the human immunodeficiency virus type 1matrix. J. Virol. 69:1984–1989.

27. Holm, K., K. Weclewicz, R. Hewson, and M. Suomalainen. 2003. Humanimmunodeficiency virus type 1 assembly and lipid rafts: Pr55(gag) associateswith membrane domains that are largely resistant to Brij98 but sensitive toTriton X-100. J. Virol. 77:4805–4817.

28. Hope, H. R., and L. J. Pike. 1996. Phosphoinositides and phosphoinositide-utilizing enzymes in detergent-insoluble lipid domains. Mol. Biol. Cell 7:843–851.

29. Hurtley, S. M., and A. Helenius. 1989. Protein oligomerization in the endo-plasmic reticulum. Annu. Rev. Cell Biol. 5:277–307.

30. Kalia, V., S. Sarkar, P. Gupta, and R. C. Montelaro. 2003. Rational site-directed mutations of the LLP-1 and LLP-2 lentivirus lytic peptide domainsin the intracytoplasmic tail of human immunodeficiency virus type 1 gp41indicate common functions in cell-cell fusion but distinct roles in virionenvelope incorporation. J. Virol. 77:3634–3646.

31. Klein, U., G. Gimpl, and F. Fahrenholz. 1995. Alteration of the myometrialplasma membrane cholesterol content with beta-cyclodextrin modulates thebinding affinity of the oxytocin receptor. Biochemistry 34:13784–13793.

32. Korber, B., C. Kuiken, B. Foley, B. Hahn, F. McCutchan, J. Mellors, and J.Sodroski. 1998. Amino acid alignment, p. IIA-1–IIA-77. In B. Korber, C.Kuiken, B. Foley, B. Hahn, F. McCutchan, J. Mellors, and J. Sodroski (ed.),Human retroviruses and AIDS 1998: a compilation and analysis of nucleicacid and amino acid sequences. Los Alamos National Laboratory, LosAlamos, NM.

33. Lee, S. F., C. Y. Ko, C. T. Wang, and S. S. Chen. 2002. Effect of pointmutations in the N terminus of the lentivirus lytic peptide-1 sequence ofhuman immunodeficiency virus type 1 transmembrane glycoprotein gp41 onEnv stability. J. Biol. Chem. 277:15363–15375.

34. Lee, S. F., C. T. Wang, J. Y. Liang, S. L. Hong, C. C. Huang, and S. S. Chen.2000. Multimerization potential of the cytoplasmic domain of the humanimmunodeficiency virus type 1 transmembrane glycoprotein gp41. J. Biol.Chem. 275:15809–15819.

35. Li, M., C. Yang, S. Tong, A. Weidmann, and R. W. Compans. 2002. Palmi-toylation of the murine leukemia virus envelope protein is critical for lipidraft association and surface expression. J. Virol. 76:11845–11852.

36. Lindwasser, O. W., and M. D. Resh. 2001. Multimerization of human im-munodeficiency virus type 1 Gag promotes its localization to barges, raft-likemembrane microdomains. J. Virol. 75:7913–7924.

37. Lodge, R., H. G. Gottlinger, D. Gabuzda, E. A. Cohen, and G. Lemay. 1994.The intracytoplasmic domain of gp41 mediates polarized budding of humanimmunodeficiency virus type 1 in MDCK cells. J. Virol. 68:4857–4861.

38. Lodge, R., J.-P. Lalonde, G. Lemay, and E. A. Cohen. 1997. The membrane-proximal intracytoplasmic tyrosine residue of HIV-1 envelope glycoprotein iscritical for basolateral targeting of viral budding in MDCK cells. EMBO J.16:695–705.

39. Lopez-Verges, S., G. Camus, G. Blot, R. Beauvoir, R. Benarous, and C.Berlioz-Torrent. 2006. Tail-interacting protein TIP47 is a connector betweenGag and Env and is required for Env incorporation into HIV-1 virions. Proc.Natl. Acad. Sci. USA 103:14947–14952.

40. Manes, S., G. del Real, R. A. Lacalle, P. Lucas, C. Gomez-Mouton, S.Sanchez-Palomino, R. Delgado, J. Alcami, E. Mira, and A. C. Martinez.2000. Membrane raft microdomains mediate lateral assemblies required forHIV-1 infection. EMBO Rep. 1:190–196.

41. Manie, S. N., S. Debreyne, S. Vincent, and D. Gerlier. 2000. Measles virusstructural components are enriched into lipid raft microdomains: a potentialcellular location for virus assembly. J. Virol. 74:305–311.

42. McCabe, J. B., and L. G. Berthiaume. 2001. N-terminal protein acylationconfers localization to cholesterol, sphingolipid-enriched membranes but notto lipid rafts/caveolae. Mol. Biol. Cell 12:3601–3617.

43. Milligan, G., M. Parenti, and A. I. Magee. 1995. The dynamic role ofpalmitoylation in signal transduction. Trends Biochem. Sci. 20:181–187.

44. Moffett, S., D. A. Brown, and M. E. Linder. 2000. Lipid-dependent targetingof G proteins into rafts. J. Biol. Chem. 275:2191–2198.

45. Morita, E., and W. I. Sundquist. 2004. Retrovirus budding. Annu. Rev. CellDev. Biol. 20:395–425.

46. Murakami, T. 2008. Roles of the interactions between Env and Gag proteinsin the HIV-1 replication cycle. Microbiol. Immunol. 52:287–295.

47. Murakami, T., and E. O. Freed. 2000. The long cytoplasmic tail of gp41 isrequired in a cell type-dependent manner for HIV-1 envelope glycoproteinincorporation into virions. Proc. Natl. Acad. Sci. USA 97:343–348.

48. Nguyen, D. H., and J. E. Hildreth. 2000. Evidence for budding of humanimmunodeficiency virus type 1 selectively from glycolipid-enriched mem-brane lipid rafts. J. Virol. 74:3264–3272.

49. Ohno, H., R. C. Aguilar, M. C. Fournier, S. Hennecke, P. Cosson, and J. S.Bonifacino. 1997. Interaction of endocytic signals from the HIV-1 envelopeglycoprotein complex with members of the adaptor medium chain family.Virology 238:305–315.

50. Ono, A., and E. O. Freed. 2001. Plasma membrane rafts play a critical role inHIV-1 assembly and release. Proc. Natl. Acad. Sci. USA 98:13925–13930.

51. Ono, A., and E. O. Freed. 2005. Role of lipid rafts in virus replication. Adv.Virus Res. 64:311–358.

52. Owens, R. J., J. W. Dubay, E. Hunter, and R. W. Compans. 1991. Humanimmunodeficiency virus envelope protein determines the site of virus releasein polarized epithelial cells. Proc. Natl. Acad. Sci. USA 88:3987–3991.

53. Pear, W. S., G. P. Nolan, M. L. Scott, and D. Baltimore. 1993. Production ofhigh-titer helper-free retroviruses by transient transfection. Proc. Natl. Acad.Sci. USA 90:8392–8396.

54. Pickl, W. F., F. X. Pimentel-Muinos, and B. Seed. 2001. Lipid rafts andpseudotyping. J. Virol. 75:7175–7183.

55. Pielsticker, L. K., K. J. Mann, W. L. Lin, and D. Sevlever. 2005. Raft-likemembrane domains contain enzymatic activities involved in the synthesis ofmammalian glycosylphosphatidylinositol anchor intermediates. Biochem.Biophys. Res. Commun. 330:163–171.

56. Piller, S. C., J. W. Dubay, C. A. Derdeyn, and E. Hunter. 2000. Mutationalanalysis of conserved domains within the cytoplasmic tail of gp41 fromhuman immunodeficiency virus type 1: effects on glycoprotein incorporationand infectivity. J. Virol. 74:11717–11723.

57. Pornillos, O., J. E. Garrus, and W. I. Sundquist. 2002. Mechanisms ofenveloped RNA virus budding. Trends Cell Biol. 12:569–579.

58. Resh, M. D. 1999. Fatty acylation of proteins: new insights into membranetargeting of myristoylated and palmitoylated proteins. Biochim. Biophys.Acta 1451:1–16.

59. Resh, M. D. 2005. Intracellular trafficking of HIV-1 Gag: how Gag interactswith cell membranes and makes viral particles. AIDS Rev. 7:84–91.

60. Resh, M. D. 2006. Trafficking and signaling by fatty-acylated and prenylatedproteins. Nat. Chem. Biol. 2:584–590.

61. Rodgers, W., B. Crise, and J. K. Rose. 1994. Signals determining proteintyrosine kinase and glycosylphosphatidylinositol-anchored protein targetingto a glycolipid-enriched membrane fraction. Mol. Cell. Biol. 14:5384–5391.

62. Roos, J. W., M. F. Maughan, Z. Liao, J. E. Hildreth, and J. E. Clements.2000. LuSIV cells: a reporter cell line for the detection and quantitation ofa single cycle of HIV and SIV replication. Virology 273:307–315.

63. Rose, J. K., and R. W. Doms. 1988. Regulation of protein export from theendoplasmic reticulum. Annu. Rev. Cell Biol. 4:257–288.

64. Rousso, I., M. B. Mixon, B. K. Chen, and P. S. Kim. 2000. Palmitoylation ofthe HIV-1 envelope glycoprotein is critical for viral infectivity. Proc. Natl.Acad. Sci. USA 97:13523–13525.

65. Rowell, J. F., P. E. Stanhope, and R. F. Siliciano. 1995. Endocytosis ofendogenously synthesized HIV-1 envelope protein: mechanism and role inprocessing for association with class II MHC. J. Immunol. 155:473–488.

66. Saad, J. S., J. Miller, J. Tai, A. Kim, R. H. Ghanam, and M. F. Summers.2006. Structural basis for targeting HIV-1 Gag proteins to the plasma mem-brane for virus assembly. Proc. Natl. Acad. Sci. USA 103:11364–11369.

67. Sarnataro, D., V. Campana, S. Paladino, M. Stornaiuolo, L. Nitsch, and C.Zurzolo. 2004. PrPC association with lipid rafts in the early secretory pathwaystabilizes its cellular conformation. Mol. Biol. Cell 15:4031–4042.

68. Scarlata, S., and C. Carter. 2003. Role of HIV-1 Gag domains in viralassembly. Biochim. Biophys. Acta 1614:62–72.

69. Scheiffele, P., M. G. Roth, and K. Simons. 1997. Interaction of influenzavirus haemagglutinin with sphingolipid-cholesterol membrane domains viaits transmembrane domain. EMBO J. 16:5501–5508.

70. Schmidt, M. F. 1989. Fatty acylation of proteins. Biochim. Biophys. Acta988:411–426.

71. Shenoy-Scaria, A. M., D. J. Dietzen, J. Kwong, D. C. Link, and D. M. Lublin.1994. Cysteine3 of Src family protein tyrosine kinase determines palmitoyl-ation and localization in caveolae. J. Cell Biol. 126:353–363.

72. Shkriabai, N., S. A. Datta, Z. Zhao, S. Hess, A. Rein, and M. Kvaratskhelia.2006. Interactions of HIV-1 Gag with assembly cofactors. Biochemistry 45:4077–4083.

73. Viard, M., S. D. Ablan, M. Zhou, T. D. Veenstra, E. O. Freed, Y. Raviv, andR. Blumenthal. 2008. Photoinduced reactivity of the HIV-1 envelope glyco-protein with a membrane-embedded probe reveals insertion of portions ofthe HIV-1 gp41 cytoplasmic tail into the viral membrane. Biochemistry47:1977–1983.

74. Wang, J. K., E. Kiyokawa, E. Verdin, and D. Trono. 2000. The Nef protein


of HIV-1 associates with rafts and primes T cells for activation. Proc. Natl.Acad. Sci. USA 97:394–399.

75. Wild, C., D. C. Shugars, T. K. Greenwell, C. B. McDonal, and T. J. Mat-thews. 1994. Peptides corresponding to a predictive �-helical domain ofhuman immunodeficiency virus type 1 gp41 are potent inhibitors of virusinfection. Proc. Natl. Acad. Sci. USA 91:9770–9774.

76. Willey, R. L., J. S. Bonifacino, B. J. Potts, M. A. Martin, and R. D. Klausner.1988. Biosynthesis, cleavage, and degradation of the human immunodefi-ciency virus 1 envelope glycoprotein gp160. Proc. Natl. Acad. Sci. USA85:9580–9584.

77. Wyss, S., C. Berlioz-Torrent, M. Boge, G. Blot, S. Honing, R. Benarous, andM. Thali. 2001. The highly conserved C-terminal dileucine motif in thecytosolic domain of the human immunodeficiency virus type 1 envelopeglycoprotein is critical for its association with the AP-1 clathrin adaptor.J. Virol. 75:2982–2992.

78. Yu, X., X. Yuan, M. F. McLane, T.-H. Lee, and M. Essex. 1993. Mutations inthe cytoplasmic domain of human immunodeficiency virus type 1 transmem-brane protein impair the incorporation of Env proteins into mature virions.J. Virol. 67:213–221.

79. Zhang, J., A. Pekosz, and R. A. Lamb. 2000. Influenza virus assembly andlipid raft microdomains: a role for the cytoplasmic tails of the spike glyco-proteins. J. Virol. 74:4634–4644.

80. Zheng, Y. H., A. Plemenitas, T. Linnemann, O. T. Fackler, and B. M.Peterlin. 2001. Nef increases infectivity of HIV via lipid rafts. Curr. Biol.11:875–879.

81. Zwick, M. B., A. F. Labrijn, M. Wang, C. Spenlehauer, E. O. Saphire, J. M.Binley, J. P. Moore, G. Stiegler, H. Katinger, D. R. Burton, and P. W.Parren. 2001. Broadly neutralizing antibodies targeted to the membrane-proximal external region of human immunodeficiency virus type 1 glycopro-tein gp41. J. Virol. 75:10892–10905.


Documents

The Cytoplasmic Domain of Human Immunodeficiency Virus Type 1 Transmembrane Protein gp41 Harbors Lipid Raft Association Determinants