Streptococcus Mutans Glucan-Binding Protein-A AffectsStreptococcus Gordonii Biofilm Architecture

Jeffrey A. Banas*,1, Tracey L. Fountain1, Joseph. E. Mazurkiewicz2, Keer Sun1, and M.Margaret Vickerman31Center for Immunology and Microbial Disease and Neuropharmacology, Albany Medical College,47 New Scotland Avenue, Albany, New York 12208

2Center for Neuroscience and Neuropharmacology, Albany Medical College, 47 New ScotlandAvenue, Albany, New York 12208,

3Department of Periodontics and Endodontics, State University of New York at Buffalo, 223 FosterHall, South Campus, Buffalo, New York 14214

AbstractThe glucan-binding protein-A (GbpA) of Streptococcus mutans has been shown to contribute to thearchitecture of glucan-dependent biofilms formed by this species and influence virulence in a ratmodel. Since S. mutans synthesizes multiple glucosyltransferases (GTF) and non-GTF glucan-binding proteins (GBPs), it’s possible that there is functional redundancy that overshadows the fullextent of GbpA contributions to S. mutans biology. Glucan-associated properties such as adhesion,aggregation, and biofilm formation were examined independently of other S. mutans GBPs bycloning the gbpA gene into a heterologous host, Streptococcus gordonii, and derivatives with alteredor diminished GTF activity. The presence of GbpA did not alter dextran-dependent aggregation northe initial sucrose-dependent adhesion of S. gordonii. However, expression of GbpA altered thebiofilm formed by wild-type S. gordonii as well as the biofilm formed by strain CH107 that producedprimarily α-1,6-linked glucan. Expression of gbpA did not alter the biofilm formed by strain DS512that produced significantly lower quantities of parental glucan. These data are consistent with a rolefor GbpA in facilitating the development of biofilms that harbor taller microcolonies via binding toα-1,6-linkages within glucan. The magnitude of the GbpA effect appears dependent on the quantityand linkage of available glucan.

IntroductionIt is well established that glucan, synthesized from the glucose moiety of sucrose, plays aprominent role in the cariogenicity of the dental pathogen Streptococcus mutans. The loss ofany of the three S. mutans glucosyltranferase (GTF) enzymes, which synthesize and bindglucans, results in decreased virulence under at least some conditions in animal models (Munroet al., 1991; Yamashita et al., 1993). The roles for non-GTF cell-surface or secreted proteinsthat bind glucan have also been the subject of investigation. Four of these glucan-bindingproteins (GBPs) have been described in S. mutans: GbpA (Russell, 1979), GbpB (Smith et al.,1994), GbpC (Sato et al., 1997), and GbpD (Deepan et al., 2004). Comprising a functionallyheterogenous group, they have been associated with altered biofilm formation (GbpA; Hazlettet al., 1999), cell wall stability and peptidoglycan hydrolase activity (GbpB; Chia et al.,2001), dextran-dependent aggregation (GbpC; Sato et al., 1997), and lipase activity (GbpD;

*Corresponding author. Current address: University of Iowa College of Dentistry Dows Institute for Research Dental Science N 436Iowa City, IA 52242 Tel.: 319-335-9911 Fax: 319-335-8895 E-mail: Jeffrey-Banas@uiowa.edu

NIH Public AccessAuthor ManuscriptFEMS Microbiol Lett. Author manuscript; available in PMC 2007 February 1.

Published in final edited form as:FEMS Microbiol Lett. 2007 February ; 267(1): 80–88.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

Deepan et al., 2004). Contributions of GBPs to virulence in animal models have been variable(Hazlett et al., 1998; Matsumura et al., 2003).

It is uncertain whether the glucan binding affinity of any of the GBPs is influenced by theglucan products of specific GTFs, though GbpA has been shown to require α-1,6 linkages forbinding (Russell, 1979; Haas & Banas, 2000). The α-1,6 linkages predominate in water-solubleglucan but are also represented in water-insoluble glucan that is primarily composed of α-1,3linkages. The predominance of α-1,6 and α-1,3 linkages and their correlation with watersolubility is well conserved among GTFs and glucan from numerous oral streptococcal species.However, individual GTFs and their glucan products may differ in precise linkage proportions,the length of the polymer and the degree of branching.

In an effort to further investigate GbpA, the gbpA gene was cloned and expressed inStreptococcus gordonii. S. gordonii is a primary plaque colonizer that possesses a single GTFthat synthesizes glucans with both α-1,3 and α-1,6 linkages (Grahame & Mayer, 1985; Haisman& Jenkinson, 1991). Transcription of the structural gene, gtfG, is controlled by the positiveregulator rgg (Sulavik et al., 1992). Using this heterologous host, the contribution of GbpA toadhesion and biofilm properties could be evaluated independent of other S. mutans GBPs. Herewe report that the expression of plasmid-borne GbpA in S. gordonii did indeed affect the overallarchitecture of the sucrose-associated biofilms formed by this species. The changes wereconsistent with a role for GbpA in adding elevation to the biofilm by facilitating the formationof taller microcolonies. The magnitude of the change was the greatest when the proportion ofwater-soluble glucan was highest, consistent with an affinity of GbpA for α-1,6 glucan linkages(Russell, 1979; Haas & Banas, 2000).

Materials and methodsStrains and growth conditions

All cultures were stored at -80°C. Table 1 provides an overview and description of the strainsused in this study. Briefly, the gbpA mutant strain of S. mutans was described previously(Hazlett et al., 1998). The S. gordonii strain Challis, CH1, was the parent for all strains withaltered GTF expression. Strain DS512 (Sulavik et al., 1992) has an internal 12-bp deletion inthe rgg positive regulatory gene and only ca. 3% of the parental GtfG gene product. StrainCH107 has a 585-bp deletion within the carboxyl terminal glucan-binding domain of gtfG.Glucans synthesized by the encoded 152 kDa GtfG of this strain show only α-1,6-linkages byNMR analysis (Vickerman et al., 1996). Strain CHΔgtfG was constructed by transformationof strain CH1 with a ca. 2.8 kb linear DNA fragment that contained DNA flanking gtfG andreplaced the first ca. 4.7 kb of gtfG with a ca. 120-bp omega fragment (Frey & Krisch, 1985).Putative transformants resulting from allelic exchange were selected by their soft colonyphenotype on 3% sucrose agar plates. Southern blots and nucleotide sequence analysisconfirmed that strain CHΔgtfG has the rgg gene upstream intact up to the native stop codon,followed by an omega transcriptional and translational stop fragment and then 63 3′ nucleotidesof gtfG. This strain had no detectable GTF activity. All strains were propagated in Todd-Hewitt(TH) medium (Difco) or Chemically-Defined Medium (CDM; JRH Biosciences, Lenexa, KS)supplemented with 0.25M sodium biocarbonate and, when appropriate, 1% sucrose. Media forplasmid-containing strains included erythromycin at 5μg/ml.

Construction of plasmid-borne gbpAThe S. mutans gbpA gene and flanking region was amplified by PCR with S. mutans 3209chromosomal template and primers 5′TAGATATCCGACAATTTGCAAGTAATAGAAGT3′ and 5′TAGATATCCGTTATCATACGACGACATACAA3′ using Elongase enzyme (Invitrogen,

Banas et al. Page 2

FEMS Microbiol Lett. Author manuscript; available in PMC 2007 February 1.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

Carlsbad, CA) and an annealing temperature of 58°C. The resulting ca. 2.1-kb amplicon withengineered restriction sites contained the gbpA promoter and ribosomal binding site, thecomplete ORF and downstream transcriptional terminator region. The EcoRV-digestedfragment was cloned into the compatible HaeIII site in the erythromycin-resistant streptococcalplasmid pVA749 (Macrina et al., 1981), transformed into the recA-deficient S. gordonii Challisstrain CHR3 (Vickerman et al., 1993) to minimize the potential for recombination betweenchromosomal and cloned DNA, and the resulting plasmid, pVA749:gbpA, verified bynucleotide sequence analysis. The purified plasmid was then transformed into the S.gordonii strains made competent with serum as previously described (Vickerman et al.,1993). The corresponding strains harboring gbpA on the pVA749 plasmid were designatedCH1(gbpA), DS512(gbpA), CH107(gbpA), and CHΔgtfG(gbpA). Vector control strains weretransformed with pVA749.

Western immunoblottingStrains of interest were grown overnight to stationary phase in 25 ml TH broth. The bacteriawere pelleted by centrifugation and the pellet resuspended in 150μl of 2X cracking buffer(0.0375M Tris, 1% SDS, 2.5% 2-mercaptoethanol, 15% glycerol, and bromphenol blue) toextract surface protein. Although GbpA is a secreted protein there is a sufficient amount thatremains associated with the bacterial cells. The cracking buffer solutions were left to incubateat room temperature for 2 hrs and then the bacteria were pelleted by centrifugation. Proteinswere separated by SDS-polyacrylamide gel electrophoresis (10% gel) and blotted ontonitrocellulose. After blocking in 2% Tween 20 in PBS (pH 7.4) for 60 min at 37°C, anti-GbpAantibody was added at 1:5000 in PBS with 2% Tween 20 and left at 4°C overnight. Aftermultiple washes with PBS-Tween 20 the gel was incubated at room temperature for 1 hr withprotein-A conjugated to horse-radish peroxidase (Pierce, Rockford, IL). The GbpA bands werevisualized by enhanced chemiluminescence (ECL; Amersham, Piscataway, NJ).

Glucan activity assayProtein preparations and separation by SDS-PAGE were as above for western immunoblotting.Relative amounts of GTF activity for each strain were measured via glucan production inacrylamide gels, as previously described (Vickerman et al., 1996). Briefly, strains to becompared were grown to the same mid-to late-log stage (OD600 of ca. 1.6) and equal volumesof 1% (w/v) SDS-extracted cells and cell-free supernatants were run on 8.75% acrylamideSDS-PAGE. After electrophoresis, gels were incubated overnight in 3% sucrose, 0.5% TritonX-100 in 10mM sodium phosphate, pH 6.8, at 37°C, and the resulting glucan products werestained with paraosanaline. Band intensities reflect the relative amount of GTF activity and thewater solubility of the glucan products (Vickerman et al., 1996).

Adhesion assayStrains CHR3 and CHR3(gbpA) were grown overnight to late log phase in CDM and dilutedto OD600=0.05 in fresh CDM. One milliliter aliquots were added to vials containing equivalentamounts of saliva-coated hydroxyapatite beads (BDH Chemicals Ltd., Poole, England) and setin an anaerobic chamber at 37°C on a rotator (10 rpm). At 0, 2, 3.5, and 5 hrs post-inoculationthe beads were softly pelleted and the supernatant sampled for the enumeration of colonyforming units (CFU). Following washing the pellets were similarly enumerated for CFU bysonication plating on Todd-Hewitt agar.

Dextran-dependent aggregationThe procedure for measuring dextran-dependent aggregation was based on that used to measurethe activity of the S. sobrinus glucan-binding lectin (GBL) (Ma et al., 1996). Briefly, the panelof S. gordonii strains was grown overnight in TH broth to late log phase, pelleted by

Banas et al. Page 3

FEMS Microbiol Lett. Author manuscript; available in PMC 2007 February 1.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

centrifugation, washed in phosphate-buffered saline (PBS), and resuspended in PBS atapproximately one-tenth the volume. Dextran T2000 (Fisher Scientific, Fair Lawn, NJ) wasadded to a concentration of 100μg/ml. The suspensions were incubated at 37°C for up to 2 hrsand the absorbance read at wavelength 600.

Generation of biofilmsBiofilms for confocal microscopy were generated by inoculating wells of a two-well Lab-TekBorosilicate Coverglass System (Nalge Nunc International, Rochester, NY) with 75μl of anovernight culture normalized to an equivalent optical density (OD). Each well held 1.5 ml ofCDM with 5% sucrose. The biofilms were allowed to develop over two days at 37°C whilerotating at 10 rpm. The medium was changed at 24 hrs.

Early biofilm deposition of strains CH1 and CH1(gbpA) was tested in the presence of a S.mutans GbpA-negative strain in a transwell system that presumably allowed the cell-free flowof GTFs and glucan to diffuse through the filter. An equivalent OD of each S. gordonii strainwas inoculated into wells of a Falcon 24-well tissue culture plate (Becton Dickinson, FranklinLakes, NJ) in CDM plus 5% sucrose. A circular, glass coverslip was added to each well. A 0.4μm Falcon transwell cell culture insert (Becton Dickinson) was placed into the inoculated wellsand inoculated with an equivalent OD of S. mutans (GbpA-) in CDM plus 5% sucrose. Thebiofilms were allowed to develop for six hours at 37°C with constant rotation at 10rpm. Theglass coverslips were then collected, stained with crystal violet, and photographs of fiveindependent, random fields were imaged. A grid was overlaid onto the photographic imagesto estimate coverage. When less than 40% of the boxes in the grid were empty the biofilm wasdesignated as having “heavy” coverage. If greater than 40% of the grid boxes were empty thebiofilm coverage was designated as “light.” A total of 115 images each for strains CH1 andCH1(gbpA) were analyzed by this semi-quantitative protocol.

Confocal MicroscopyFor confocal microscopy the planktonic phase was aspirated from the biofilm wells, the biofilmwashed once with PBS, and then stained with SYTO 9 (Molecular Probes, Eugene, OR) for15 min. The stain was aspirated, the biofilm washed in PBS, and then 1.5 ml of PBS added toretain hydration. The stained biofilms were imaged directly using a Zeiss 510 META NLO-confocal microscope system on an Axiomat 200 M inverted microscope equipped with a 25 x0.8 NA multi immersion DIC lens (Zeiss, USA, Thornwood, NY). The SYTO 9 fluorescentdye was excited using two-photon excitation with the 800 nm line from a Coherent ChameleonTi:Sa pulsed laser and fluorescence emission detected using a 500-550 IR band pass filter.Images were collected at 1024 x 1024 pixel resolution with scaling of 0.36 μm (X) x 0.36 μm(Y) x 1.0 μm (Z). Images were processed using the native Zeiss LSM software and AdobePhotoshop.

Biofilm AnalysisBiomass, percent substratum coverage, average thickness, roughness coefficient and surfaceto volume ratio were determined using COMSTAT image-processing software (Heydorn etal., 2000) written as a script in Matlab 5.1 (The MathWorks) equipped with the ImageProcessing Toolbox. These scripts also functioned perfectly using our current version of Matlab7.0.1. Z-stacks were collected from five randomly selected regions from each independentbiofilm in a single well and were processed and analyzed by COMSTAT. The five image stackscovered a total area of ∼7.41×10-5 μm2, an area that more than satisfies the recommendedminimum surface area that should be investigated in order to obtain representative data (Korberet al., 1993).

Banas et al. Page 4

FEMS Microbiol Lett. Author manuscript; available in PMC 2007 February 1.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

ResultsThe panel of S. gordonii strains represented an opportunity to examine the influence of GbpAon adhesion, aggregation, and biofilm formation by CH1 strains with quantitative andqualitative differences in glucan synthesis. These glucan variations also served as implicitcontrols in these analyses since it was expected that GbpA should not influence the propertiesof S. gordonii unless glucan was present.

In order to confirm that S. gordonii strains carrying plasmid-borne gbpA secreted the proteinin a manner analogous to its native S. mutans, western immunoblots were performed usingrabbit sera directed against the glucan-binding domain of GbpA. As seen in Figure 1A, intensebands representing GbpA were evident in extracts from each of the S. gordonii plasmid-bearingstrains. The band migration distances for the recombinant S. gordonii strains were the same asfrom S. mutans indicating that signal peptide cleavage of GbpA was occurring at or near thenative cleavage site. The blot also confirmed the lack of degradation of GbpA in therecombinant strains.

It was also important to confirm that the glucan synthesizing capacity of the strains wasmaintained in the presence of GbpA. An activity gel demonstrating similar glucan synthesis,for each strain pair (with and without GbpA), corresponding to the glucosyltransferase bandsis shown in Figure 1B. The DS512 strains have an interrupted rgg gene resulting in reducedtranscription of the downstream gtfG gene (Sulavik et al., 1992). The expected >90% decreasein glucan synthesis in the DS512 strains relative to the CH1 strains was evident. The CH107strains harbor a 585-bp internal deletion within the glucan binding domain of gtfG that encodesa GtfG that synthesizes α-1,6-linked water-soluble glucans and has reduced enzymatic activity(Vickerman et al., 1996). The faster migrating 152 kDa GTF band is noticeable on the gel asis the relative reduction in the intensity of the glucan band. However, the intensity of the CH107glucan bands was likely also diminished by the water solubility of the glucans formed makingit appear that the strain synthesized less glucan than it does. The amounts of glucan associatedwith CH107 biofilms were more similar to CH1 biofilms than DS512 biofilms. In all the S.gordonii strains the GTF activity was not affected by the presence of pVA749:gbpA.

In the absence of glucan S. gordonii is capable of efficient adhesion to hydroxyapatite that hasbeen coated with salivary proteins. The presence of GbpA did not enhance or inhibit adhesionto saliva-coated hydroxyapatite beads (data not shown).

Since some glucan-binding proteins, notably GbpC of S. mutans and the GBL of Streptococcussobrinus, facilitate dextran-dependent aggregation the GbpA-producing strains of S.gordonii were compared to the parental strains for this property. Neither the plasmid-freestrains nor those carrying plasmid-borne GbpA demonstrated significant dextran-dependentaggregation.

The lack of an effect by GbpA on sucrose-independent adhesion and dextran-dependentaggregation was not unexpected. In S. mutans, GbpA appears to make its most significantcontribution to biofilm architecture when grown in the presence of sucrose. Therefore, this wastested next by comparing two-day biofilms formed by the S. gordonii parental strains and thecognate strains secreting GbpA. Unlike S. mutans, where an obvious macroscopic differencein the biofilm was visible between wild-type and a GbpA- strain (Hazlett et al., 1999), therewere no macroscopic differences in the biofilms between S. gordonii strains with or withoutGbpA as evident in Figure 2. However, Figure 2 also shows that there were profounddifferences between the various parental strains that paralleled the differences in glucansynthesis noted above. Both the CH1 and CH107 strains formed rougher, more elevatedbiofilms compared to DS512. The planktonic bacteria in the CH107 wells formed largeaggregates while the DS512 strain appeared colloidal in the planktonic phase. A strain with a

Banas et al. Page 5

FEMS Microbiol Lett. Author manuscript; available in PMC 2007 February 1.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

deleted gtfG gene was also investigated as a control for pleiotropic effects on biofilm formationthat might accompany the inactivation of rgg in strain DS512. However, the biofilms formedby the DS512 and CHΔgtfG strains appeared macroscopically identical. The vector controlbiofilm was similar to the CH1 wild-type as expected. The blank control ensured the absenceof contamination in the media used to propagate the bacteria.

In order to determine if GbpA contributed differences to the biofilms at the microscopic levelthe biofilms were imaged by confocal scanning laser microscopy and analyzed using thebiofilm analysis program COMSTAT (Heydorn et al, 2000). The results, shown in Table 2 andFigure 3, indicate that GbpA does make a difference and it depends on the quality and quantityof glucan available. The strains capable of synthesizing significant quantities of glucan wereCH1 and CH107, though CH107 produces less than CH1. When GbpA was expressed in thosestrains there was an increase in biomass that was statistically significant for CH1(gbpA) andat the threshold of significance for CH107(gbpA). For CH107(gbpA) this increase was likelydue to the formation of significantly taller microcolonies. The surface to volume ratio decreasedsignificantly in the biofilm formed by the CH1(gbpA) strain. There was a similar trend forCH107(gbpA) but it did not reach statistical significance. The biofilm formed by the CH107(gbpA) strain had a significantly higher roughness coefficient. GbpA did not affect the biofilmformed by DS512. When examined microscopically the CHΔgtfG biofilm did not remaincompletely still. Perhaps the total absence of glucan resulted in enhanced Brownian motionthat blurred the images obtained by confocal microscopy which in turn negated the ability toperform COMSTAT analysis.

The rationale behind using a variety of parental strains was supported by the fact that forbiomass, percent coverage at the substratum, average thickness, and roughness coefficient, thestrains differed significantly from one another (except for CH1 vs. CH107 in average thicknessand CH1(gbpA) vs. CH107(gbpA) in roughness coefficient).

An attempt was made to ascertain the effect that exogenously supplied glucan from S.mutans would have on the initial stages of biofilm formation by S. gordonii CH1 or CH1(gbpA). Strains CH1 or CH1(gbpA) were grown in microtiter dish wells in which was placeda circular glass coverslip. A transwell chamber containing a GbpA- strain of S. mutans wasalso placed into the well presumably allowing diffusion of S. mutans glucosyltransferases.Controls using S. mutans in the transwell and sterile medium in the microtiter dish confirmedthe lack of diffusion of the bacterial cells. Analysis of the coverslips after six hours indicatedthat the CH1(gbpA) strain was almost twice as likely (66% of the time) to be heavily colonizedas the parental CH1 strain (38% of the time). This effect was not evident if the transwellcontained S. gordonii or sterile medium.

DiscussionThe GBPs of S. mutans display heterogeneous functions (Banas & Vickerman, 2003), but it isalso possible that they make overlapping contributions, particularly in the realm of sucrose-dependent biofilm formation. If overlapping, the full phenotypic significance of a particularGBP might not be evident upon inactivation of its corresponding gene within its native host.The rationale for expressing gbpA within S. gordonii was to isolate it from the other S.mutans GBPs. Though it is conceivable thatS. gordonii harbors endogenous GBPs none havebeen described in the literature.

Using this strategy it was hypothesized that the addition of GbpA would alter biofilms formedby S. gordonii to an extent that was at least comparable to that seen when comparing biofilmsformed by wild-type and GbpA- strains of S. mutans. However, this was not the case. The lossof GbpA in S. mutans led to both macroscopic and microscopic changes in biofilm architecture(Hazlett et al., 1999). The addition of GbpA to S. gordonii resulted in more subtle differences

Banas et al. Page 6

FEMS Microbiol Lett. Author manuscript; available in PMC 2007 February 1.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

that were evident only at the microscopic level. This difference in the magnitude of the biofilmchange may indicate that GbpA has another as yet unknown function. But a simpler, morelikely explanation is that the overall quantity of glucan is as important for visualizing the effectsof GbpA as isolating it from other GBPs.

The results also underscore the importance of the glucan profile produced by the host organism.The addition of GbpA increased the biomass of biofilms formed by either CH1(gbpA) orCH107(gbpA). In CH107(gbpA) the increase could be explained by a significant increase inthe average thickness of the biofilms. For CH1(gbpA) there were trends toward increases inboth substratum coverage and biofilm thickness but neither attained statistical significance. Inits native host, the loss of GbpA increases substratum coverage but reduces thickness (Hazlettet al., 1999). Since in its native host the mass of the biofilm is maintained, with or withoutGbpA, it follows that the loss of ability to elevate the biofilm will lead to an increase insubstratum coverage. When gbpA is expressed in S. gordonii it appears that it aids in elevatingthe biofilm but with a concomitant increase in biomass that may include modification ofsubstratum coverage depending on the proportion of water-soluble and -insoluble glucan.GbpA has the highest affinity for α-1,6-linked glucose that predominates in water-solubleglucan (Russell, 1979; Haas & Banas, 2000). Since sticking to smooth surfaces is primarilyattributed to water-insoluble glucan, the binding of GbpA to α-1,6-linkages within the mostlyα-1,3-linked water-insoluble glucan molecules may promote the accumulation of CH1(gbpA)biomass via proportional increases in biofilm height and coverage. For CH107(gbpA), whichsynthesized only α-1,6-linked glucan, the binding of GbpA appeared to preferentially promotebiofilm elevation. The ability of GbpA to contribute to biofilm elevation has now beensupported by two studies; the addition of GbpA to S. gordonii led to an increase in elevation(this study) and its loss in S. mutans led to a reduction in biofilm height (Hazlett et al., 1999).

It can also be speculated that water-soluble or -insoluble glucan synthesized by different GTFsmay not function equivalently when interacting with glucan-binding proteins due to differencesin minor linkage configurations, length of the polymer, or distribution of branch points. In thisstudy glucan synthesized by native host enzymes more profoundly enhanced the initialadhesion and accumulation of S. gordonii in the presence of GbpA than in its absence. It ispossible that this effect was mediated by increased glucan quantity, the ratio of water-solubleand -insoluble glucan, or subtle differences that conferred unique specificity to the S. mutansglucans.

The surface to volume ratio was significantly reduced in the CH1(gbpA) strain. The trend whencomparing all the strains was that increased glucan, particularly water-soluble glucan,correlated with the lowest surface to volume ratios. The lower ratios are consistent withincreased elevation of microcolonies within the biofilm. The lower ratios are also associatedwith nutrient-rich environments that are likely to exist when sucrose is present.

Strains DS512 and CHΔgtfG, which synthesize little or no glucan respectively, were unaffectedby the presence of GbpA. These results were consistent with the expectation that any effectdue to GbpA would require the presence of a glucan ligand. The total lack of glucan in strainCHΔgtfG appeared to affect biofilm architecture making it susceptible to slight movement thatinterfered with the ability to obtain precise confocal microscopic images. The remaining GTFactivity in DS512, approximately 3% of the parental CH1 level, seemed to be sufficient toovercome this difficulty. This observation may highlight the stabilizing effect that glucan hason a streptococcal biofilm. Nevertheless, since rgg regulators have been implicated as playingglobal roles in Streptococcus pyogenes gene expression (Chaussee et al., 2002), and microarrayanalysis suggests that gtfG-independent genes are differentially expressed in strains DS512and CHΔgtfG (Gill et al., 2005), we cannot rule out the possibility that the biofilm integrityseen in strain DS512 is due to an effect of rgg on a gene other than gtfG.

Banas et al. Page 7

FEMS Microbiol Lett. Author manuscript; available in PMC 2007 February 1.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

In summary, the expression of GbpA in a heterologous host, S. gordonii, led to changes inbiofilm synthesis that mimicked those found in its native host, S. mutans. The magnitudes ofthe changes were less in S. gordonii suggesting that the maximal contribution of GbpA requireslarger amounts of exogenous glucan or host-specific glucan properties. It is recognized thatthese are monospecies biofilms and caution must be exercised in drawing conclusionsregarding the role of GbpA in dental plaque. However, it is conceivable that localizedaggregates of predominantly S. mutans exist within carious lesions and rely on GBPs tooptimally shape the biofilm architecture.

Acknowledgements

This work was supported by grants DE10058 (J.A.B.) and DE11090 (M.M.V.) from the National Institute of Dentaland Craniofacial Sciences and RR017926 (J.E.M.). We thank Dr. Lisa Petti (Albany Medical College) for assistancewith ECL.

ReferencesBanas JA, Vickerman MM. Glucan-binding proteins of the oral streptococci. Crit. Rev. Oral Biol. Med

2003;14:89–99. [PubMed: 12764072]Banas JA, Russell RRB, Ferretti JJ. Sequence analysis of the gene for the glucan-binding protein of

Streptococcus mutans Ingbritt. Infect. Immun. 1990;58:667–673. [PubMed: 2307516]Chaussee MS, Sylva GL, Sturdevant DE, Smoot LM, Graham MR, Watson RO, Musser JM. Rgg

influences the expression of multiple regulatory loci to coregulate virulence factor expression inStreptococcus pyogenes. Infect. Immun 2002;70:762–770. [PubMed: 11796609]

Chia J-S, Chang LY, Shun C-T, Chang Y-Y, Chen J-Y. A 60-kilodalton immunodominant glycoproteinis essential for cell wall integrity and the maintenance of cell shape in Streptococcus mutans. Infect.Immun 2001;69:6987–6998. [PubMed: 11598074]

Deepan S, Shah H, Russell RRB. A novel glucan-binding protein with lipase activity from the oralpathogen Streptococcus mutans. Microbiology 2004;150:1947–1956. [PubMed: 15184580]

Frey J, Krisch HM. ω mutagenesis in gram-negative bacteria: a selectable interposon which is stronglypolar in a wide range of bacterial species. Gene 1985;36:143–150. [PubMed: 2998930]

Gill SR, Iobst S, Remortel B, Vickerman MM. Transciptome analysis of Streptococcus gordonii rgg andgtfG mutants. J. Dent. Res 2005;84(Spec Iss B)Abstract #325

Grahame DA, Mayer RM. Purification and comparison of two forms of dextransucrase fromStreptococcus sanguis. Carbohydr. Res 1985;142:285–298. [PubMed: 2934131]

Haas W, Banas JA. Ligand-binding properties of the carboxyl terminal repeat domain of the Streptococcusmutans glucan-binding protein-A. J. Bacteriol 2000;182:728–733. [PubMed: 10633107]

Haisman RJ, Jenkinson HF. Mutants of Streptococcus gordonii Challis overproducingglucosyltransferase. J. Gen. Microbiol 1991;137:483–489. [PubMed: 1851801]

Hazlett KRO, Michalek SM, Banas JA. Inactivation of the gbpA gene of Streptococcus mutans increasesvirulence and promotes in vivo accumulation of recombinations between the glucosyltransferase Band C genes. Infect. Immun 1998;66:2180–2185. [PubMed: 9573105]

Hazlett KRO, Mazurkiewicz JE, Banas JA. Inactivation of the gbpA gene of Streptococcus mutans altersstructural and functional aspects of plaque biofilm which are compensated by recombination of thegtfB and gtfC genes. Infect. Immun 1999;67:3909–3914. [PubMed: 10417155]

Heydorn A, Nielsen AT, Hentzer M, Sternberg C, Givskov M, Ersboll BK, Molin S. Quantification ofbiofilm structures by the novel computer program COMSTAT. Microbiology 2000;146:2395–2407.[PubMed: 11021916]

Korber DR, Lawrence JR, Hendry MJ, Caldwell DE. Analysis of spatial variability within Mot+ andMot-Pseudomonas fluorescens bioflms using representative elements. Biofouling 1993;7:339–358.

Ma Y, Lassiter MO, Banas JA, Galperin MY, Taylor KG, Doyle RJ. Multiple glucan-binding proteinsof Streptococcus sobrinus. J. Bacteriol 1996;178:1572–1577. [PubMed: 8626283]

Macrina, FL.; Tobian, JA.; Jones, KR.; Evans, RP. Molecular cloning in streptococci. In: Hollaender, A.;DeMoss, R.; Kaplan, S.; Konisky, J.; Savage, D.; Wolfe, R., editors. Genetic engineering ofmicroorganisms for chemicals.. Plenum Publishing Corp.; New York, NY: 1981. p. 195-210.

Banas et al. Page 8

FEMS Microbiol Lett. Author manuscript; available in PMC 2007 February 1.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

Matsumura M, Izumi T, Matsumoto M, Tsuji M, Fujiwara T, Ooshima T. The role of glucan-bindingproteins in the cariogenicity of Streptococcus mutans. Microbiol. Immunol 2003;47:213–215.[PubMed: 12725291]

Munro C, Michalek SM, Macrina FL. Cariogenicity of Streptococcus mutans V403 glucosyltransferaseand fructosyltransferase mutants constructed by allelic exchange. Infect. Immun 1991;59:2316–2323. [PubMed: 1828790]

Russell RRB. Glucan-binding proteins of Streptococcus mutans serotype c. J. Gen. Microbiol1979;112:197–201. [PubMed: 479834]

Sato Y, Yamamoto Y, Kizaki H. Cloning and sequence analysis of the gbpC gene encoding a novelglucan-binding protein of Streptococcus mutans. Infect. Immun 1997;65:668–675. [PubMed:9009329]

Smith DJ, Akita H, King WF, Taubman MA. Purification and antigenicity of a novel glucan-bindingprotein of Streptococcus mutans. Infect. Immun 1994;62:245–2552.

Sulavik MC, Tardiff G, Clewell DB. Identification of a gene, rgg, which regulates expression ofglucosyltransferase and influences the Spp phenotype of Streptococcus gordonii Challis. J. Bacteriol1992;174:3577–3586. [PubMed: 1534326]

Vickerman MM, Heath DG, Clewell DB. Construction of recombination-deficient strains ofStreptococcus gordonii by disruption of the recA gene. J. Bacteriol 1993;175:6354–6357. [PubMed:8407809]

Vickerman MM, Sulavik MC, Minick PE, Clewell DB. Changes in the carboxyl-terminal repeat regionaffect extracellular activity and glucan products of Streptococcus gordonii glucosyltransferase.Infect. Immun 1996;64:5117–5128. [PubMed: 8945555]

Yamashita Y, Bowen WH, Burne RA, Kuramitsu HK. Role of the Streptococcus mutans gtf genes incaries induction in the specific-pathogen-free rat model. Infect. Immun 1993;61:3811–3817.[PubMed: 8359902]

Banas et al. Page 9

FEMS Microbiol Lett. Author manuscript; available in PMC 2007 February 1.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

Fig 1.(A) Western immunoblot using anti-GbpA sera. Proteins were separated by SDS-PAGE. GbpAwas detected migrating just below the 84 kDa molecular weight band. GbpA routinely runs ata higher molecular weight than that calculated from its amino acid sequence (Russell, 1979;Banas et al., 1990). The band from S. mutans was run as a control; the single band representedthe mature form of GbpA in which the signal peptide has been cleaved. CH1, DS512, andCH107 are strains of S. gordonii as described in the Materials and Methods, and strains CH1(gbpA), DS512(gbpA), and CH107(gbpA) are the corresponding derivatives that express GbpA.(B) Activity gel depicting glucan bands from the panel of S. gordonii strains. Proteins from S.gordonii were separated by SDS-PAGE, washed, incubated in sucrose to allow in situ synthesisof glucan, and stained with Schiff’s reagent. CH1, DS512, and CH107 are the parental S.gordonii strains and CH1(gbpA), DS512(gbpA), and CH107(gbpA) are the correspondingderivatives that express GbpA. The faster migrating bands for strains CH107 and CH107(gbpA) are due to an internal deletion within the glucosyltransferase enzyme that results in asmaller molecular weight protein that synthesizes water-soluble glucan. Relative levels ofactivity between the strains were similar for supernatant and cell activities (data not shown).

Banas et al. Page 10

FEMS Microbiol Lett. Author manuscript; available in PMC 2007 February 1.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

Fig 2.Macroscopic views of the microtiter dish wells containing planktonic phase bacteria andbiofilms formed by the panel of S. gordonii strains. The wells display two days growth in CDMwith 1% sucrose. The medium was changed after 24 hrs. CH1, DS512, CH107 and CHΔgtfGwere the parental S. gordonii strains and CH1(gbpA), DS512(gbpA), CH107(gbpA), andCHΔgtfG(gbpA) were the corresponding derivatives that expressed GbpA. The vector controlwas CH1 with the plasmid pVA749 without the gbpA. The blank well was a negative controlto monitor potential contamination of the medium.

Banas et al. Page 11

FEMS Microbiol Lett. Author manuscript; available in PMC 2007 February 1.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

Fig 3.Representative confocal microscopic views of the respective biofilms at 1μm above thesubstratum. The bacteria have been stained with the fluorescent dye SYTO9 and appear green.The lines through the images represent the planes for the x-z and y-z cross-sectional views thatappear at the top and right hand margins of the images respectively. CH1, CH107, and DS512are the parental S. gordonii strains and CH1(gbpA), CH107(gbpA), and DS512(gbpA) are thecorresponding derivatives that express GbpA. The scale bar is 100 μm.

Banas et al. Page 12

FEMS Microbiol Lett. Author manuscript; available in PMC 2007 February 1.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

Banas et al. Page 13

Table 1Strain Descriptions

Strain Reference Genotype Relevant Phenotype/Use in This Study

S. mutans 3209 (GbpA ) (Hazlett et al.,1998)

Chromosomal gbpA deleted. Does not make GbpA. Used to supply exogenousglucan to S. gordonii strains making GbpA intranswell experiments.

S. gordonii CHR3 (Vickerman et al.,1993)

recA-deficient via insertionalinactivation.

Minimizes recombination. Used in the originalcloning and propagation of gbpA in the plasmidpVA749.

S. gordonii CH1 (Macrina et al.,1981)

Wild-type (WT) parental. Used as the parental S. gordonii strain.

S. gordonii CH1(gbpA) This study. gbpA in plasmid pVA749 Used to test the effect of GbpA when total glucanproduction is reduced.

S. gordonii DS512 (Sulavik et al.,1992)

12-bp deletion in rgg resulting ina premature translational stop.

Only about 3% of WT levels of GtfG produced.

S. gordonii DS512(gbpA) This study. gbpA in plasmid pVA749. Used to test the effect of GbpA when total glucanproduction is reduced.

S. gordonii CH107 (Vickerman et al.,1996)

585-bp deletion within thecarboxyl terminal Glucanssynthesized by the altered gtfG.

Glucans synthesized by the altered GtfG showonly α-1,6-linkages by NMR analysis.

S. gordonii CH107(gbpA) This study. gbpA in plasmid pVA749. Used to test the effect of GbpA when the glucancontains solely α-1,6-linkages to which GbpA hashighest affinity.

S. gordonii CHΔgtfG This study. gtfG replaced with an omegafragment.

No glucan synthesized. This strain has an intactrgg and therefore controls for the effects ofinterrupting rgg in strain DS512.

S. gordonii CHΔgtfG(gbpA)

This study. gbpA in plasmid pVA749. Used to test the effect of GbpA when glucan is notpresent.

S. gordonii CH1(pVA749) (Macrina et al.,1981)

Parental strain containing theplasmid vector pVA749.

Used as a control strain for the effects of the vectorharboring gbpA.

FEMS Microbiol Lett. Author manuscript; available in PMC 2007 February 1.

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

NIH

-PA Author Manuscript

Banas et al. Page 14Ta

ble

2C

OM

STA

T A

naly

sis o

f Bio

film

s For

med

by

Stre

ptoc

occu

s gor

doni

i With

or W

ithou

t Gbp

A*

Stra

inB

iom

ass

%C

over

age

at S

ubst

ratu

mA

vera

ge T

hick

ness

Rou

ghne

ss C

oeffi

cien

t#Su

rfac

e/V

olum

e

CH

16.

7 +/

- 0.4

56.4

+/-

2.6

8.8

+/- 0

.60.

75 +

/- 0.

032.

2 +/

- 0.1

CH

1(gb

pA)

8.7

+/- 0

.967

.3 +

/- 5.

810

.5 +

/- 1.

00.

64 +

/- 0.

091.

8 +/

- 0.1

Stud

ent t

-test

resu

ltp<

0.05

NS

NS

NS

p<0.

05C

H10

711

.1 +

/- 0.

986

.9 +

/- 2.

011

.5 +

/- 0.

90.

40 +

/- 0.

021.

3 +/

- 0.1

CH

107(

gbpA

)13

.7 +

/- 0.

985

.6 +

/- 1.

914

.3 +

/- 0.

90.

49 +

/- 0.

031.

0 +/

- 0.1

Stud

ent t

-test

resu

ltp=

0.05

NS

p<0.

05p<

0.05

NS

DS5

121.

2 +/

- 0.2

20.7

+/-

1.8

1.5

+/- 0

.41.

31 +

/- 0.

063.

3 +/

- 0.3

DS5

12(g

bpA)

1.1

+/- 0

.421

.9 +

/- 5.

81.

1 +/

- 0.4

1.43

+/-

0.13

3.3

+/- 0

.2St

uden

t t-te

st re

sult

NS

NS

NS

NS

NS

NS

= N

ot si

gnifi

cant

* The

valu

es in

eac

h co

lum

n re

pres

ent t

he m

ean

plus

or m

inus

the

stan

dard

err

or o

f the

mea

n.

# The

roug

hnes

s coe

ffic

ient

is a

mea

sure

of t

he v

aria

tion

in b

iofil

m th

ickn

ess (

Hey

dorn

et a

l., 2

000)

.

FEMS Microbiol Lett. Author manuscript; available in PMC 2007 February 1.