Statins stimulate RGS-regulated ERK 1/2 activation in human calcified and stenotic aortic valves

Experimental and Molecular Pathology 85 (2008) 101–111

Contents lists available at ScienceDirect

Experimental and Molecular Pathology

j ourna l homepage: www.e lsev ie r.com/ locate /yexmp

Statins stimulate RGS-regulated ERK 1/2 activation in human calcified andstenotic aortic valves

Thomas Anger a,c,⁎, Jamal El-Chafchak c, Anissa Habib c, Christian Stumpf a, Michael Weyand b,Werner G. Daniel a, Vinzenz Hombach d, Martin Hoeher c,1 and Christoph D. Garlichs a,1

a Department of Cardiology, Friedrich-Alexander University of Erlangen, Germanyb Center of Cardiac Surgery, Friedrich-Alexander University of Erlangen, Germanyc Department of Cardiology, Center of Medicine II, Klinikum Bayreuth, Germanyd Department of Cardiology, Center of Medicine II, University of Ulm, Germany

⁎ Corresponding author. Medizinische Klinik II, KlinStraße 101, 95445 Bayreuth, Germany. Fax: +49 921 400

E-mail address: [email protected] (T. Anger).1 With equal contribution.

0014-4800/$ – see front matter © 2008 Elsevier Inc. Aldoi:10.1016/j.yexmp.2008.06.002

a b s t r a c t
a r t i c l e i n f o
Article history:
The signal transduction act Received 2 June 2008Available online 11 July 2008
Keywords:Aortic valve diseaseStatinsRGS proteinsERK 1/2 activation

ivating extracellular-regulated kinases (ERK) is triggered by G protein-coupledreceptors (GPCR). In turn, the GPCR are mediated by Gq and Gi/o proteins subjected to regulation of regulatorsof G protein-mediated signaling (RGS) proteins. This network compiles extracellular growth signals tointracellular targets of sclerosis on calcified and stenotic human aortic valves (CSAV). Statins are known aspartial inhibitors of atherosclerotic inflammation on CSAV. This study identifies descriptively the role ofstatins on RGS subjected ERK activation on CSAV.We collected human CSAV with (n=10, CSAV+) or without (n= 10, CSAV−) at least 4 weeks of statin pre-treatment and investigated gene-profiling of RGS proteins, intermediaries and ERK using microarraytechnique, real-time and semi-quantitative PCR. Human non-calcified aortic valves were controls (n= 6, C).Immunohistochemical stainings defined activation of expressed ERK 1/2 on CSAV (+/−) or C.As compared to C, in CSAV− several cardiac expressed RGS proteins were translationally upregulated: RGS1(2.6 compared C), RGS3 (3.1), RGS5 (2.1) and RGS8 (2.5). In CSAV+, statins neutralized observed RGSexpression. ERK expression was found unchanged in all valves: CSAV−, CSAV+ or C. In contrast, immuno-histochemically we found enhanced activation of phosphorylated ERK in CSAV+ as compared to CSAV− orcontrol.This study shows reduced RGS protein expression through statins leading to increased activation of ERK onhuman CSAV. In regard to known studies, the partial therapeutical failure of statins on severe end-stage CSAVis due to the induction of ERK activation which offers the need for more investigation.

© 2008 Elsevier Inc. All rights reserved.

Introduction

Calcified aortic valve stenosis is the most frequently acquiredvalvular disease in the western population (Otto et al., 1997).Whereas symptomatic aortic valve stenosis is associated with apoor prognosis, the natural course of calcified but non-stenotic aorticvalves shows high variability (Roger et al., 1990). Common patho-mechanisms of aortic valve stenosis and atherosclerosis have beendiscussed and the influence of established cardiovascular risk factorson the progression of aortic valve stenosis has been demonstratedrepeatedly (Bellamy et al., 2002; Ghazvini-Boroujerdi et al., 2004;Kawaguchi et al., 2003; Lindroos et al., 1994; Otto, 2004a; Otto et al.,1997; Palta et al., 2000; Pohle et al., 2004; Roger et al., 1990; Shavelle

ikum Bayreuth, Preuschwitzer6509.

l rights reserved.

et al., 2002; Yasuda et al., 2000). Further evidence exists that theprogressive calcified aortic stenosis is an “active” biological process(Freeman et al., 2004; Kaden et al., 2003; Kaden et al., 2004b; Otto,2004b), sustained by atherosclerotic inflammation and associatedwith the synthesis of extracellular matrix proteins (Kaden et al.,2003), tenascin-C (Satta et al., 2002), osteopontin (Kennedy et al.,2000; O'Brien et al., 1995) and bone sialoprotein (Kaden et al., 2004a;Rajamannan et al., 2003). Histopathologic studies of aortic stenosisshow similarities to atherosclerosis, with prominent accumulation oflipoproteins, including LDL and lipoprotein(a), presence of LDLoxidation, and inflammatory cell infiltrate (Bellamy et al., 2002;Otto, 2004a). Consequently, several small retrospective studiessuggested that treatment with statins – as established in patientswith atherosclerosis – reduces the progression of aortic valve stenosis(Bellamy et al., 2002; Otto, 2004a; Rajamannan et al., 2002; Shavelleet al., 2002). However, the recently published SALTIRE trial revealedno significant effect of high-dose HMG-CoA reductase inhibitortreatment on the progression of aortic stenosis in patients lacking

mailto:[email protected]

http://dx.doi.org/10.1016/j.yexmp.2008.06.002

http://www.sciencedirect.com/science/journal/00144800

102 T. Anger et al. / Experimental and Molecular Pathology 85 (2008) 101–111

specifically hyperlipidemia (Cowell et al., 2005) which was partiallyconfirmed (Mohler et al., 2007).

Focusing on atherosclerosis as one of the leading epidemic plaqueof the human beings, the initiation of atherosclerotic inflammationstarts on the cardial monolayer of the aortic valves (Libby, 2002).Specific signal transduction of this monolayer of aortic valves supportsthe maintenance of atherosclerotic inflammation on aortic valve cellsleading signal transduction further to the myofiroblast cells (Raja-mannan, 2007) by chemo-attracting macrophages (Topper andGimbrone, 1999), mast cells (Haley et al., 2000), T lymphocytes(Mach et al., 1999) and dendritic cells (Yilmaz et al., 2004) activatingchemokines [i.e. MCP-1 (Boring et al., 1998; Gu et al., 1998)], cytokines(i.e. IL-8 (Boisvert et al., 1998)) and adhesion molecules (i.e. VCAM-1(Cybulsky et al., 2001)) to sustain proliferative process of athero-sclerosis — even, when the process is in the end-stage of the disease(Anger et al., 2006, 2007b).

Cell signal transduction appears to be one of the most acquiredtarget signaling in this process maintained by G protein-coupledreceptors (GPCRs) or/and receptor tyrosine kinases, regulator of Gprotein-mediated signaling proteins (RGS proteins), small G proteinsRho (Calo et al., 2006), RAS (George et al., 2002;Minamino et al., 2003)and mitogen-activated protein kinases (MAP)/extracellular-regulatedkinases (ERK 1/2). The kinases are regulating signal information forapoptosis (Franke et al., 2003), cell stress (Tibbles and Woodgett,1999), cell growth and proliferation (Chang et al., 2003c), cell survival,migration and differentiation (Matsui et al., 2003; Neri et al., 2002;Steelman et al., 2004), and neoplastic transformation (Chang et al.,2003b; Smalley, 2003), are point of interest in the discussion forhuman cancer treatment (Lee and McCubrey, 2002; Reddy et al.,2003), and are presumably responsible for angiogenesis (Shiojima andWalsh, 2002) and gene expression changes in acute and/or chronicinflammatory responses (Gerthoffer and Singer, 2003).

On cells, there are two different types of receptors transferringregulatory information from the surface to the MAP kinases totransmit information to the nucleus: (i) seven-transmembranereceptors that are coupled to heterotrimeric G proteins comprised ofα and βγ subunits bound to either Gi/o or Gq signaling (Gilman, 1995;Neer, 1995): G protein-coupled receptors and (ii) receptor tyrosinekinases (Bommakanti et al., 2000; Chang et al., 2003b). Ligand-dependent activation of these receptors ultimately leads to phosphor-ylation of MAP kinases and thereby stimulation of downstreameffectors in the nucleus for further activations (Vazquez-Prado et al.,2003). Stimulation of MAP kinase divers into three separately differentsignaling downstream pathways: activation of extracellular-regulatedkinases subtype 1 and 2 (ERK 1/2) which are subject of thisinvestigation, c-Jun NH(2)-terminal kinases regulating cytokineexpression and p38 effecting mostly apoptosis (Chang et al., 2003c).

Regulators of G protein signaling (RGS) proteins belong to a familyof more than 20 proteins with a conserved RGS core domain of 120amino acids that is necessary and sufficient for binding to Gα subunits(Hollinger and Hepler, 2002). RGS proteins exert an inhibitory effecton both Gα- and Gβγ-mediated downstream effects by eitherdiminishing signal production generated by GPCR defined as effectorantagonistic function of RGS proteins (Anger et al., 2004; Hepler et al.,1997; Yan et al., 1997) or by terminating of GPCR coupled signalsthrough activation of the Gα-GTPase: GTPase-activating proteinfunction of RGS (GAPs) (Anger et al., 2004; Ross and Wilkie, 2000;Wieland and Mittmann, 2003).

Activation of ERK 1/2 subjected to GPCR-mediated signaling isregulated through RGS proteins, i.e. Leone et al. (2000) ";; Anger et al.(2007a). Many efforts were taken to characterize specific suscept-ibilities of divers cardiac expressed RGS proteins towards phosphor-ylation of ERK 1/2 in different cell systems in regard to G protein-coupled receptors and endogenously expressed Gq and/or Gi/o, i.e. inrat smooth muscle cells (Blanc et al., 2003), in neuroblastoma cells(Leone et al., 2000), in rat cardiomyocytes (Nishida et al., 2005), in

human cancer cells (Ogier-Denis et al., 2000) and in baby hamsterkidney cells (Chatterjee et al., 1997) — or towards Gq-mediated PLCβactivation (Anger et al., 2004; Hepler et al., 1997; Kardestuncer et al.,1998; Shi et al., 2001; Yan et al., 1997; Zhang et al., 2006) in regard to Gprotein-mediated cardiac hypertrophy.

In context of atherosclerosis leading to calcified and stenotic aorticvalves none is known about the specific role of the G protein-mediatedactivation of ERK1/2 subjected to RGS proteins under influence ofstatins as new therapeutic approach in the inhibition of progressiveaortic valve disease.

This study was designed to primarily descriptively define specificrole of RGS proteins in regard to the atherosclerotic inflammation onaortic valves focusing secondly on G protein-coupled receptors,receptor tyrosine kinases and expression of G protein-mediated targetgenes, here ERK 1/2 and third to compare found data to circumstanceswhere statins were given at least for 4 weeks. Human calcified andstenotic aortic valves were collected in regard to presence (CSAV+) orabsence (CSAV−) of at least 4 weeks of statin pre-treatment, gene chip(microarray) analysis, real-time and semi-quantitative GAPDH-adjusted PCR analysis for confirmationwere performed and comparedto specific immunohistochemical stainings of aortic valves for theactivated fraction of expressed G protein-mediated target genes: ERK1/2. We found suppression of initially activated RGS proteins andcorrespondent further activation of phosphorylated ERK on humanaortic valves with end-stage stenosis and calcifications through statinpre-treatment.

Methods

Study design and methods

20 consecutive patients with symptomatic isolated severe calcifiedaortic valve stenosis were included in the study. All patients werescheduled for single aortic valve replacement. Patients with knowncoronary artery disease or any systemic signs of inflammation, renalinsufficiency, hyperparathyroidism, or aortic valve stenosis caused bybicuspid aortic valves, Marfan's disease or rheumatic disease in thehistory were excluded from the study. Non-stenotic and non-calcifiedhealthy aortic valves from patients suffering final heart failureprocessed to heart transplantation (n= 6) were chosen as controls.The institutional review board approved the study protocol and allpatients had given written informed consent. Valves were obtainedduring aortic valve replacement and stenotic valves were separated in2 groups according to the presence (CSAV+, n= 10) or absence (CSAV−,n= 10) of pre-treatment with HMG-CoA reductase inhibitors (statins)for at least 4 weeks prior to valve replacement. A single small piece ofeach valve got incubated for microbiological culturing to excludebacterial contamination as trigger of inflammation.

Microarray technique

To overall screen for significant alterations in gene expression oncalcified and stenotic aortic valves, we used microarray analysis andpooled samples as templates. Therefore, RNA integrity from all collectedvalves got stabilized during the valve acquisition process using RNALater ICE (Ambion®). Total RNA isolation was carried out usingAmbion's RiboPur Kit according to the manufacturer's instructions.From each isolated total RNA, mRNA got linearly amplified using Mes-sageAmp-aRNA Kit (Ambion®). We pooled the mRNA accordingly (C:n= 3, CSAV−: n= 6, CSAV+: n= 6) and used MWG's two-step aminoal-lyl-labeling of single-stranded cDNA coupling on two fluorescent dyes(Cy3 or Cy5) to mark different groups. Pair wise hybridization of twoarrays (MWG HUMAN 40 K array A, MWG, Ebersberg, Germany) for20.000 human genes of known function: (i) C and CSAV− or (ii) C andCSAV+ on single glass plates were carried out in duplicates withswitching of Cy3/5 labeling to see direct gene expression changes under

103T. Anger et al. / Experimental and Molecular Pathology 85 (2008) 101–111

similar hybridization conditions. Microarray scanning and data analysiswas performed through MWG Biotech (Ebersberg, Germany) using anAffymetrix 428 Array Scanner (Affymetrix, Bedford, USA) and ImageAnalysis software (BioDiscovery, Inc., Los Angeles, USA) providing filesper microarray with simplified direct data analysis.

Semi-quantitative PCR

For confirmation of findings with significant differences comparedto normal valves, we reverse transcribed individually each amplifiedmRNA into complementary cDNA using ThermoScript™ ReverseTranscriptase System (Invitrogen, Heidelberg, Germany). We collectedn= 10 samples for CSAV− and CSAV+. As controls we collected n= 6non-calcified, non-stenotic aortic valves from patients suffering finalheart failure due to dilated cardiomyopathy processed with hearttransplantation. n= 4 GAPDH-adjusted semi-quantitative PCR ana-lyses were performed in duplicates using Platinum® SYBRGreen qPCRSuperMix-UDG Kit (Invitrogen, Heidelberg, Germany) according to themanufacturer's instructions, gene specific primers and the iCycler IQSystem (BioRad, Heidelberg, Germany). PCR products got sizefractioned on 1.2% agarose gel and expression intensities of specificgenes in ratio to GAPDH were acquired using BioRad's XRS geldocumentation system and Quantity One analysis software (BioRad,Heidelberg, Germany). All DNA-Primer for conventional 3-step PCRassays were obtained from MWG (Ebersberg, Germany) with thesequences according to published known mRNA sequences forinvestigated human RGS proteins (see Table 1, first row).

RGS2:

Table 1Demographic data for all patients i

Aortic valves were grouped accordprior to valve replacement of severegrey shadow, n=10, CSAV−) and for agrey, n=10, CSAV+). Non-calcified, hefailure and indication for heart transof the table (n= 6, Control). Listed htions used are: high blood pressure (rheumatic disease in the history (RDdisease (MD) and treatment with anI). Remarkably, the overall age of thCSAV− or CSAV+.

(5′-3′) GTCAGAATTCTACCAGGACTTGTGT,(3′-5′) TAGGGAAAGATGTACAACCAGCTAC;

RGS3:
(5′-3′) AGAAGCTGCTGGTTCACAAATAC,(3′-5′) TTCTGGTTAATAAGGTCCAGGTAGA;
RGS4:
(5′-3′) CTAACTGCCATGTAGGCTAAGAAAG,(3′-5′) AACCTTTAACTTCTATGCCCTCACT;
RGS5:
(5′-3′) GGCCAAGGAGATTAAGATCAAGTT,(3′-5′) ATTGTGATGTCCTTAGTGAAGTGGT,
GAPDH:
(5′-3′) ATGGGGAAGGTGAAGGTCGGAGTCAACGGA,(3′-5′) GAGCTTGACAAAGTGGTCGTTGAGGG CAAT
The length of investigated RGS protein PCR products was chosen to450 base pairs. GAPDH PCR product was chosen to 950 bp and used asloading adjustment.

A cDNA sample of human umbilical venous endothelial cells(HUVEC) was chosen as positive control as we could demonstrateelsewhere significant gene expressions of RGS2, RGS3, RGS4 and RGS5in HUVEC.

Real-time PCR

For further confirmation of findings we took the pooled abovedescribed cDNA samples after reverse transcription of single aortic

ncluded to this study

ingly to previously analyzed statin pre-treatmentcalcified and stenotic aortic valves: no statins (lightt least 4weeks of statins ahead of replacement (darkalthy control valves frompatientswith severe heartplantationwere set non-shadowed at the beginningere are additional concomitant diseases. Abbrevia-HBP), diabetesmellitus (DM), hyperlipidemia (HLP),), abuse of nicotine: smoking (N), known Marfan'sgiotensinogen-converting enzyme inhibitors (ACE-e control group was not significantly younger than

valve RNA samples (ThermoScript™ Reverse Transcriptase System,Invitrogen, Heidelberg, Germany) and performed n= 3 GAPDH-adjusted real-time PCR analyses in duplicates with 50 cycles usingPlatinum® SYBR Green qPCR SuperMix-UDG Kit (Invitrogen, Heidel-berg, Germany) according to the manufacturer's instructions abovedescribed gene specific primers (identifying RGS2, RGS3, RGS4, RGS5and GAPDH) and the iCycler IQ System (BioRad, Heidelberg, Germany).

Immunohistochemical staining

Translational gene expression for total ERK 1/2 as well as activatedERK 1/2 was assessed using above mentioned aortic valves (see semi-quantitative PCR analysis), grouped accordingly into CSAV−, CSAV+(with statin pre-treatment for at least 4 weeks) and control valves (C)for immunohistochemical staining. Dako ChemMate™ Detection Kit(DAKO, Denmark) was used according to the manufacturer's instruc-tions. Briefly: tissue was collected and directly stored in liquidnitrogen. Decalcification and embedding into paraffin prior to cuttingto multiples tissue sections longitudinal to the complete valve tookplace before the tissue got deparaffined and hydrolyzed to specificbuffer as preparation for antibody binding. Antigen retrieval wasperformed in microwave oven for 5 min. Diaminobenzidine substratesolution was used to enhance the brown-coloring of the target-antigen recognized by primary antibody. Primary antibodies in 1:1000dilution according to the manufacturer's recommendations werechosen to detect specifically phosphorylated (activated) and non-phosphorylated (total) ERK expression (antibodies from Cell SignalingBiotech). After further washing steps, second antibodies were used onvalid as well as on control-tissue slides to confirm quality and validityof primary antibody binding as quantitative method to investigateprotein expression. The lack of positive stains by secondary antibodyalone and the negative staining by primary antibody alone confirmedonce the lack of unspecific background staining even when specificprotein expression was expected low. In total, two different immu-nochemical stains were performed on n= 3 different valves (CSAV− orCSAV+) to confirm determined pattern of gene expression for somespecific genes of inflammation and were contrasted to healthy non-stenotic and non-calcified aortic valves (control) from subjects withdilated cardiomyopathy and indication for heart transplantation. Wedid not attempt statistical analysis due to the low number ofinvestigated aortic valves.

Statistical analysis

Data represent mean±SEM as indicated. When appropriate,statistical differences were assessed by Student's unpaired t-test. Ap-value b0.05 was considered statistically significant and marked as⁎ (i.e. semi-quantitative GAPDH-adjusted PCR, i.e. Fig. 2).

Results

Patient population

The clinical and demographic data of the included 20 patients withisolated severe calcified and stenotic aortic valves and of 6 controlsinvestigated in themicroarray analysis, the specific real-time aswell asthe semi-quantitative GAPDH-adjusted PCR analysis and the immu-nohistochemical staining are shown in Table 1. In patients withcalcified aortic valve stenosis, 13/20 patients presented with hyperli-pidemia,10/20 total with diabetes, 8/20 with abuse of nicotine and 10/20 with history of high blood pressure. 10 patients had aortic valvestenosis but no control patient was pre-treated with statins.Angiotensin-converting enzyme inhibitors were given to 8/20 patientswith CSAV (− and +). None of the patients had coronary artery diseaseor any atherosclerosis peripheral disease as ruled out clinically prior tovalve replacement.We excluded patientswith knownMarfan's disease

Fig.1. The graph demonstrates corresponding and representative semi-quantitative PCRresults adjusted to GAPDH gene expression as loading adjustment (Aki et al., 1997) after30 cycles of conventional 3-step PCR analysis on 1.2% agarose gel for control valves (C),CSAV− and CSAV+ using specific primers for human GAPDH (lowest line, 950 bp) andspecific primers for investigated mainly cardiac expressed RGS proteins (RGS2, RGS3,RGS4, and RGS5). PCR products were chosen with almost 450 bp length. Demonstratedhere are representative PCR products for each investigated gene of interest. At least n= 4experiments were performed and statistical analysis was assessed using duplicates ineach experiment. Remarkable: translational gene expression of RGS5 was overallincomparably high. A cDNA sample of human umbilical venous endothelial cells(HUVEC) was chosen as positive control. Where we found comparable expression ofinvestigated RGS proteins upon GAPDH-adjusted semi-quantitative PCR, we were ableto demonstrate here significant different expression changes in aortic valves of sameinvestigated RGS proteins.


or rheumatic disease in the history. Culturing of small single parts ofthe collected valves excluded bacterial contamination in terms ofinfective endocarditis as trigger of valve sclerosis. Due to the nature ofperforming heart transplantation in respect to severe heart failurecaused through dilated cardiomyopathy, the age of the patients for thecontrol valves (non-calcified and non-stenotic aortic valves) wasyounger compared to CSAV (+ or −) with no impact to this study as wecollected and set relative expression alterations of above mentioned Gprotein related genes on CSAV+ versus CSAV− according to the statinpre-treatment.

RGS protein expression

Descriptive microarray analysis, real-time and semi-quantitativeGAPDH-adjusted PCR results

We used a small set of pooled aortic valves per group (C: n= 3,CSAV−: n= 6, CSAV+: n= 6) and focused our gene expression analysison divers RGS proteins using initially microarray technique. Geneexpression changes were considered statistically significant whengene expression ratio between stenotic aortic valves in both groups(CSAC+ or CSAV−) and control (C) was above 2.0 or below 0.5 relativelyin regard to fluorescence intensities above 100 counts per channel aslowest cutoff absolutely.

We were able to demonstrate significant gene expression changesfor cardiac expressed RGS proteins (see Table 2, 2nd row): RGS1, RGS3,RGS5, and RGS8 were significantly upregulated in CSAV− over Control.RGS4 and RGS20 demonstrated significant downregulated expressionlevels in CSAV− over Control. Interestingly, the most potent cardiacexpressed RGS protein, RGS2 (Zhang et al., 2006) was in its expressionlevel unchanged in CSAV− or CSAV+ over C.

Statins given for at least 4 weeks prior to valve replacementchanged expression levels significantly: CSAV+ (see Table 2, 3rd row).Except for RGS20, demonstrating significant increase of relative

Table 2Shown are selective data of the microarray analysis (human 20.000 K slide A, MWG,Ebersberg, Germany) in relative expression focused to regulators of G protein signalingproteins (RGS) as indicated

Significant relative gene expression changes in CSAV− adjusted to gene expression of thesame gene in control valves (C): CSAV−/C (2nd row) are demonstrated for investigated RGSproteins and compared in this table to valves with at least 4 weeks of statin pre-treatment(CSAV+/C: 3rd row). Numbers above 2.0 (bold) or below 0.5 (grey) are consideredstatistically significant. Corresponding accession codes (1st row)wereplaced toorientate inNCBI gene-bank. The correct gene descriptionwas placed on row 4. Remarkably, all knownmainly cardiac expressed RGS proteins (here: RGS1, RGS3, RGS4 [significantly reduced],RGS5, exceptionally RGS8 and RGS20 [also significantly reduced]) are in their expressionsignificantly upregulated in comparison to C in the absence of statins (CSAV−/C: in bold). Incontrast, a “statin effect” was assumed comparing again aortic valves in the presence ofstatins (CSAV+) over control valves (C) with now comparable expression levels, when theratio was set above 0.5 and below 2.0.

expression level in CSAV+ compared to C, all investigated RGS proteinsshowed comparable relative expression levels in CSAV+ over C. Welabeled it “statin effect” and mentioned the reduction of initiallyupregulated RGS1, RGS3, RGS5 and RGS8 through statin pre-treatmenton human severely calcified and stenotic aortic valves: in thecomparison of CSAV−/C with CSAV+/C.

As confirmation, we used semi-quantitative GAPDH-adjusted PCRanalysis and performed n= 4 experiments in duplicates for eachsample: n= 10 for CSAV−, n= 10 for CSAV+ and n= 10 for Control asmentioned in Table 1 (see Figs. 1 and 2). Overall, in the PCR analysis,the relative translational gene expression for specific cardiacexpressed RGS proteins was comparable to a different extent to themicroarray data.

The gene specific expression of the investigated RGS protein wasset to 100% in the control group. As positive controls, we took isolatedcDNA samples from human umbilical venous endothelial cells(HUVEC) as we could demonstrate specific investigated translationalRGS expression in these cells and performed the same 3-stepconventional PCR analysis using 35 cycles.

Thereby, RGS2, RGS3, RGS4 and RGS5 were identified (see Fig. 1)and analyzed using semi-quantitative densitometry in ratio to GAPDHexpression as adjustment. It showedRGS2 significantly (p-valueb0.05)downregulated, when statins were given for at least 4 weeksprior to valve replacement (CSAV+, see Fig. 2, A). RGS5 was extremelydominantly expressed in aortic valves; the expression levels werecomparable among all investigated groups, no significant changeswere determined in CSAV+, CSAV− or HUVEC in semi-quantitativedensitometric comparison to Control (C). In contrast, both RGS3 andRGS4 showed significant reduced expression in CSAV− and CSAV+withthe exception, that RGS4 has a significant further decrease oftranslational expression, when statins were given. Summarized,RGS2 and RGS4 were significantly inhibited through statins in CSAV+where in context of CSAV indifferently to statins (+ or −) RGS3 wasalmost abolished.

Table 3Shown are selective data of the microarray analysis (human 20.000K slide A, MWG,Ebersberg, Germany) in relative expression focused to G-protein coupled receptors asindicated

Significant relative gene expression changes in CSAV− adjusted to gene expression of thesame gene in control valves (C): CSAV−/C (2nd row) are demonstrated for investigatedreceptors and compared in this table to valves with at least 4 weeks of statin pre-treatment (CSAV+/C: 3rd row). Numbers above 2.0 (bold) or below 0.5 (grey) areconsidered statistically significant. Corresponding accession codes (1st row)were placedto orientate in NCBI gene-bank. The correct gene description was placed on row 4. Asexclusively demonstrated here, except for the ryanodine receptor 1, all investigated Gprotein-coupled receptors were significantly changed in their expressions upon statinpre-treatment. Specific receptor expression on valves (CSAV−, 2nd row) without statinpre-treatment (bold: significant upregulation over control whereas grey indicatessignificant downregulation) showed significantly different expression behaviour ofinvestigated receptor when statin pre-treatment occurred for at least 4 weeks prior tovalve replacement CSAV+ (3rd row).

Fig. 2. (A) The graph summarizes investigated semi-quantitative GAPDH-adjusted PCRresults for investigated, mainly cardiac expressed RGS proteins: RGS2, RGS3, RGS4,and RGS5. mRNA for n= 10 calcified and stenotic aortic valves per group (CSAV− andCSAV+) as well as n= 6 non-calcified, non-stenotic aortic valves from patients withsevere heart failure due to dilated cardiomyopathy and indication for hearttransplantation (control) were reverse transcribed into cDNA and 4 times used forsemi-quantitative GAPDH-adjusted PCR analysis in duplicates. Demonstrated here arethe GAPDH-adjusted relative expression numbers set as percent of expression [± errorbars (Standard Error of the Mean: SEM)] for specific investigated RGS proteinsgrouped together as CSAV− (black bar), CSAV+ (grey bar), control (square-lined bar)and positive control, here HUVEC as indicated above (see Fig. 1: light grey bar).⁎ indicates a p-value below 0.05 as statistically significant difference between theinvestigated sample (CSAV−, CSAV+ or HUVEC) according to the control, set here as100%. Overall, RGS6, heavenly expressed in all groups doesn't show any differentexpression changes among the different groups. In contrast, RGS2 (CSAV−), RGS3(both: CSAV− and CSAV+) as well as RGS4 (also both: CSAV− and CSAV+) aredifferentially influenced upon (i) statin pre-treatment and (ii) upon the differentsample: CSAV− or CSAV+. (B) The table demonstrates the original numbers [in percentto control, set as 100%±SEM] obtained through semi-quantitative GAPDH-adjustedPCR for investigated RGS proteins (RGS2, RGS3, RGS4, and RGS5) in n= 4 experimentsusing duplicates.


A second confirmatory analysis was performed using real-timePCR and pooled samples according to CSAV−, CSAV+ and C. The resultwas placed in ratio of cycles more or less than the cycle numbers inthe control group C. n= 3 experiments were performed in duplicatesand statistical analysis was assessed using Student's t-test (seeTable 6).The results clearly followed the previously described semi-quantitative PCR results. More sensitively, expression alterationsseemed to verify. RGS2 showed 2.5 less cycles numbered needed toreach the threshold where linear amplification was observed in theCSAV− group. Statins reduced the RGS2 expression significantly (p-valueb0.05). RGS3 was unchanged among both groups, CSAV− orCSAV+ in comparison to C. RGS5 was highly expressed in CSAV− andsignificantly reduced in its translational expression through statins(CSAV+). In contrast, RGS4 was significantly reduced expressed inCSAV− and seemed to get significantly upregulated through statins(CSAV+).

G protein-coupled receptors and receptor tyrosine kinases

Descriptive microarray analysis resultsAgain, we used a small set of pooled aortic valves per group (C:

n= 3, CSAV−: n= 6, CSAV+: n= 6) and focused our gene expressionanalysis on G protein-coupled receptors and receptor tyrosinekinases using exclusively for this approach known microarray

Table 4Shown are data of the microarray analysis (human 20.000 K slide A, MWG, Ebersberg,Germany) in relative expression focused to selective receptor tyrosine kinases as secondimportant group of cellular receptor types among G protein-coupled receptors asindicated

Significant relative gene expression changes in CSAV− adjusted to gene expression ofthe same gene in control valves (C): CSAV−/C (2nd row) are demonstrated forinvestigated receptors and compared in this table to valves with at least 4 weeks ofstatin pre-treatment (CSAV+/C: 3rd row). Numbers above 2.0 (bold) or below 0.5(grey) are considered statistically significant. Corresponding accession codes (1st row)were placed to orientate in NCBI gene-bank. The correct gene description was placedon row 4. As exclusively demonstrated here, except for the protein tyrosinephosphatases receptor type o which is completely significantly upregulated overcontrol indifferent of statin pre-treatment, all investigated receptor tyrosine kinaseswere significantly changed in their expressions upon statin pre-treatment. Specificreceptor expression on valves (CSAV−, 2nd row) without statin pre-treatment (bold:significant up regulation over control whereas grey indicates significant downregulation) showed significantly different expression behaviour of investigatedreceptor when statin pre-treatment occurred for at least 4 weeks prior to valvereplacement CSAV+ (3rd row).

Table 5Shown are selective data of the microarray analysis (human 20.000K slide A, MWG,Ebersberg, Germany) in relative expression focused to G protein-coupled signaling targetgenes subjected toRGS regulation (Anger et al., 2007a): differentmitogen-activatedproteinkinases, protein kinase B (Akt) or extracellular-regulated kinases (ERK) as indicated

Significant relative gene expression changes in CSAV− adjusted to gene expression of thesame gene in control valves (C): CSAV−/C (2nd row) are demonstrated for investigatedreceptors and compared in this table to valveswith at least 4weeks of statinpre-treatment(CSAV+/C: 3rd row). Numbers above 2.0 (bold) or below 0.5 (grey) are consideredstatistically significant. Correspondingaccession codes (1st row)wereplaced toorientate inNCBI gene-bank. The correct gene descriptionwasplacedon row4. Remarkablehere is thatas the demonstration of translational gene expression changes, only a few genes areconsidered significantly changed in mRNA expression in aortic valves (indifferent of statinpre-treatment: CSAV− or CSAV+) compared to control valves.


technique.Demonstrated are selective data from the microarrayresult in Table 3 for the G protein-coupled receptors and in Table 4for the receptor tyrosine kinases. Using pair wise hybridization,positive as well as negative probes and duplicates of microarrayanalysis (by switching Cy3 and Cy5 as labeling per group) we wereable to demonstrate significant gene expression changes of bothinvestigated groups of receptors. Except for the ryanodine receptor1 comparably expressed in both, CSAV− and C (see Table 3, 2ndrow) transcriptional expression changes could be observed in bothdirections: significant downregulation as well as significant upre-gulation of investigated receptors in CSAV− over C. Except for theryanodine receptor type 1, all investigated and here demonstratedreceptors showed significant transcriptional expression changeswhen statins were given for at least 4 weeks prior to valvereplacement: CSAV+/C. Again, all direction of changes could beobserved: significant downregulation as well as significant upre-gulation of investigated receptors or none of both in CSAV+ over C(see Tables 3 and 4, 3rd row respectively). This indicates the “statineffect” on aortic valves with statin pre-treatment prior to valvereplacement as one of the optional trigger for significant changes oftranscriptional gene expression of investigated G protein-coupledreceptors (see Table 3, 3rd row) and receptor tyrosine kinases (seeTable 4, 3rd row).

G protein-mediated signaling targets: ERK

Descriptive microarray analysis and immunohistochemical stainingresults

Table 5 demonstrates transcriptional gene expression changesdetermined through microarray analysis using the pooled mRNA fromdifferent aortic valves as above described, here: C: n= 3, CSAV−: n= 6,CSAV+: n= 6 and focusing on G protein-mediated signaling targets:mitogen-activated protein kinases (MAPK), extracellular-regulatedkinases (ERK) and protein kinases B (Akt) subjected through signalingvia G protein-coupled receptors or receptor tyrosine kinases andfunctional regulated via RGS proteins (Zhang et al., 2006) (Anger et al.,2007a).

As these proteins are overall comparably expressed in CSAV−, CSAV+and C (see Table 5, 2nd and 3rd row) and as these proteins gotphosphorylated upon activation, we focused on immunohistochemicalstaining of longitudinal section cuts of investigated aortic valves usingspecific antibodies recognizing the phosphorylated fraction as well asthe total protein of expressed ERK as demonstrated in Fig. 3. Primarilyfocusing on total ERK protein expression, we found comparable levels in

Fig. 3. Demonstrated are representative slides of human CSAV+ with at least 4 weeks statins prior to valve replacement or without statins (CSAV− and non-calcified, non-stenotichealthy control valves (Control) from patients with severe heart failure and indication for heart transplantation immunohistochemically stained for total gene expression of ERK 1/2(ERK) and the activated/phosphorylated fraction of ERK 1/2 (P-ERK) as indicated. The valves were cut longitudinally as demonstrated. Shown is the 20-fold magnification as overviewof the stained tissue with inserted 200-focused magnification to demonstrate (i) localization and (ii) increased or decreased staining for the indicated proteins (square). Due to lownumber of stainings, we passed to perform statistical analysis. Transcriptionally expression of total ERK was similar among each group. Overall, expression of P-ERK was remarkablyincreased in CSAV+ in comparison to CSAV− or Control (no P-ERK expression at all).


the immunohistochemical stainings of C (Fig. 3, upper panel), CSAV−without any statins as pre-treatment (Fig. 3, middle panel) and CSAV+(Fig. 3, lowest panel) with at least 4 weeks of statin pre-treatment priorto valve replacement. Now, the phosphorylated fraction of ERK (P-ERK)as the activated part of the ERK protein varied among the differentgroups: almost no P-ERK was found on control valves (Fig. 3, upperpanel). In contrast, on calcified and stenotic aortic valves without statinpre-treatment (CSAV−), we demonstrated a tremendous increase of P-ERKexpression as continuing ERKactivation (Fig. 3,middle panel)whichwas clearly and considerably further increased on CSAV+ with given

statinpre-treatment (Fig. 3, lowest panel). Thisdata indicates an increaseof ERK activation through statin pre-treatment as a further “statineffect”.

Discussion

As atherosclerotic inflammation is thought to be themajor trigger fordegeneration of human aortic valves (Anger et al., 2006, 2007b; Otto,2004b), we investigated signal transduction changes in respect to Gprotein-coupled signaling under the influence of anti-atherosclerotic

Table 6Real-time PCR analysis of linearly amplified and pooled aRNA samples reverselytranscribed into cDNA and used as templates for 50 cycles in an iCycler IQ system(BioRad, Heidelberg, Germany) and Platinum® SYBR Green qPCR SuperMix-UDG Kit(Invitrogen, Heidelberg, Germany)

Threshold Ct adjusted to GAPDH[control Ct set to basal=0]

SEM mRNA t-testto C

t-testto CSAV+

Gene ofinterest

+0.5 ±0.08 CSAV+ RGS2−2.5 ±0.09 CSAV− ⁎ ⁎

Basal ±0.04 C−0.6 ±0.18 CSAV+ RGS3−0.9 ±0.14 CSAV−Basal ±0.22 C−1.3 ±0.03 CSAV+ ⁎ RGS4+2.3 ±0.05 CSAV− ⁎ ⁎

Basal ±0.06 C−1.1 ±0.44 CSAV+ RGS5−6.2 ±0.42 CSAV− ⁎ ⁎

Basal ±0.15 C

Non-calcified human aortic valves were used as controls (C) and the cycle number whenspecific linear amplification occurred was set to basal (0). Numbers of cycles for specificgenes of human calcified and stenotic aortic valveswithout (CSAV−) or with (CSAV+) statinpre-treatmentprior tovalve replacementwereordered inreflection to the control group [incycle number above or below thecontrol-cycle number, set as cycle number±SEM].GAPDHadjustment was assessed prior to the description of specific translational gene expressionof investigated RGSproteins (RGS2, RGS3, RGS4 andRGS5). * p-valueb 0.05was consideredstatisticaly significant.


treatment through statins in advanced severe calcified and stenoticaortic valves (CSAV+ and CSAV−).

In regard to general human atherosclerotic alterations maintainingcoronary artery disease (CAD) or peripheral artery disease (PAD),valves were collected specifically from patients without known CADor PAD. In order to exclude infective endocarditis as trigger of valvesclerosis, valves culturing obtained no bacterial contamination at all.Additionally, Marfan's disease or rheumatic diseases in the historywere parameters to exclude patients' aortic valves.

Based on these parameters we established in end-stage aorticvalve disease and presence of clinical indication for valve replacementa gene expression profile reproducible demonstrating altered Gprotein-coupled signaling with (i) induced RGS protein expression,(ii) activated ERK phosphorylation and (iii) changed receptor expres-sion for G protein-coupled receptors or receptor tyrosine kinases inCSAV−.

In the early phase of aortic valve degeneration an inflammatorycellular infiltrate was present predominantly associated with therelease of cytokines within the subendothelium and fibrosa, such asTGFβ1 (Jian et al., 2003; Narine et al., 2004) as well as IL-1β (Kirii et al.,2003), a pro-inflammatory cytokine and associated with upregulationof endothelial adhesion molecules (Muller et al., 2000) resulting inincreased extracellular matrix production, remodelling, and focalcalcification (Narine et al., 2004).

During the advanced phase of valve degeneration, active calcifica-tion (Freeman and Otto, 2005) promotes the progression of aorticvalve stenosis in an atherosclerotic inflammatorymanner (Anger et al.,2007b): (I) presence of vascular adhesion protein 1 (VAP-1) guidinginflammatory cells into atherosclerotic lesions (Salmi and Jalkane,2002), (II) induction of eotaxin3 (CCL11) via chemokine CCR3 receptor,an eosinophil-specific chemoattractant which has been found to behighly expressed at sites of vascular pathology, particularly inatherosclerotic lesions participating in atherosclerotic inflammation(Haley et al., 2000), and (III) induction of monokine induced byinterferon-γ (MIG) via the chemokine receptor CXCR3 on activated Tlymphocytes providing further recruitment and retention of activatedT lymphocytes (Mach et al., 1999; Sheikh et al., 2005). Theseobservations were manifested by the expression of tenascin-C (Sattaet al., 2002), a stimulation factor of bone formation and mineraliza-tion, that in calcified aortic leaflets was found to be co-expressed withmatrix metalloproteinases (Kaden et al., 2003, 2004a).

About the components of the signaling within the degenerativealtered aortic valves or within the degenerative process, nothing isspecifically known. Mitogen-activated protein kinases (MAP)/extra-cellular-regulated kinases (ERK 1/2) are regulating signal informationfor apoptosis (Franke et al., 2003), cell stress (Tibbles and Woodgett,1999), cell growth and proliferation (Chang et al., 2003c), cell survival,migration and differentiation (Matsui et al., 2003; Neri et al., 2002;Steelman et al., 2004), and neoplastic transformation (Chang et al.,2003b; Smalley, 2003), are point of interest in the discussion forhuman cancer treatment (Lee and McCubrey, 2002; Reddy et al.,2003), and are presumably responsible for angiogenesis (Shiojima andWalsh, 2002) and gene expression changes in acute and/or chronicinflammatory responses (Gerthoffer and Singer, 2003).

So, we focused our analyses on these kinases subjected to RGSprotein regulation (Anger et al., 2007a; Anger et al., 2004; Zhang et al.,2006) in G protein-coupled signaling network using pooled mRNA formicroarray analysis as screening and real-time as well as semi-quantitative GAPDH-adjusted PCR technique as confirmation. RGSproteins exert an inhibitory effect on both Gα- and Gβγ-mediateddownstream effects by either diminishing signal production gener-ated by GPCR defined as effector antagonistic function of RGS proteins(Anger et al., 2004; Hepler et al., 1997; Yan et al., 1997) or byterminating of GPCR coupled signals through activation of the Gα-GTPase: GTPase-activating protein function of RGS (GAPs) (Anger etal., 2004; Ross and Wilkie, 2000; Wieland and Mittmann, 2003).

Our data demonstrated significant sensitive transcriptional upre-gulation of cardiac expressed RGS proteins (RGS1, RGS3, RGS5, andRGS8) in the microarray analysis (Table 2) with identification ofadditionally expressed RGS2 in the PCR analyses (Table 6, Figs. 1 and2). Translational gene expression was not assessed for investigatedRGS proteins due to the lack of available antibodies recognizinghuman aortic valve type RGS proteins (data not shown). Statins givenfor 4 weeks as pre-treatment prior to valve replacement have changedsignificantly measured transcriptional gene expression: in thesensitive microarray analysis (Table 1) all investigated RGS proteinsshowed comparable relative expression levels in CSAV+ over C asmentioned “statin effect” through reduction of initially upregulatedRGS1, RGS3, RGS5 and RGS8. In contrast, transcriptional geneexpression levels for investigated RGS proteins were comparablylower in CSAV−/+ (RGS2, RGS3, and RGS4) or unchanged (RGS5) thanin C using the more specific semi-quantitative GAPDH-adjusted PCRanalysis (Figs. 1 and 2) with specific primers for investigated RGSproteins. Reproducible (n= 4 experiments in duplicates), RGS2 andRGS4 were significantly inhibited through statins in CSAV+ where incontext of CSAV indifferently to statins (+ or −) RGS3 was almostabolished. The real-time PCR analysis verified these results (Table 6).

Selected G protein-coupled receptors and receptor tyrosine kinases(Bommakanti et al., 2000; Chang et al., 2003b; Gilman, 1995; Neer,1995) were transcriptionally altered in CSAV− with significant changeof gene expression, when statins were given as pre-treatment, CSAV+.Due to the tremendous number of receptors given in the microarrayanalysis, we resigned neither on PCR data as confirmation nor onimmunohistochemical staining for translational analysis.

Investigation of transcriptional total gene expression of ERK 1/2revealed comparable expression levels among all collected groups(microarray analysis, Table 5): C, CSAV− and CSAV+. The receptors,responsible for signal alterations were changed due to presence/absence of statins in calcified and stenotic aortic valve (see above).This could not be seen as direct trigger for the expression levelalterations of G protein-coupled target genes, here: ERK 1/2 since (i)the gene expression alterations for the receptors do not follow anyobvious pattern and (ii) controversially, we determined comparableexpression levels for total ERK 1/2 among all investigated groups ofaortic valves (see Fig. 3 as well as Tables 3 and 4). As thephosphorylated fraction of ERK 1/2 was not identified throughmicroarray analysis (only total ERK 1/2 expression determined),


activation statuswas assessed through immunohistochemical stainingof longitudinal cross sections of specific aortic valves: C, CSAV− andCSAV+ (Fig. 5). These observations (no statistical analysis due to lownumbers of investigated aortic valves) demonstrated clearly activatedERK 1/2 in CSAV−with increase of phosphorylationwhen statins weregiven, CSAV+. Surprisingly, translationally specific phosphorylatedprotein kinase B (Akt) could not be identified through immunohisto-chemical staining (data not shown).

Our study clearly demonstrates alterations of cardiac expressedRGS proteins (RGS2, RGS3, RGS4, RGS5, and RGS8) in calcified andstenotic aortic valves (CSAV−). In these valves (CSAV−), G protein-mediated signaling subjected to RGS protein regulation was differen-tially significantly altered: the phosphorylated fraction of ERK 1/2 wasfound upregulated in CSAV− over C whereas the inactive total ERK 1/2expressionwas comparable among all groups either in the microarrayanalysis (gene transcription) or in the immunohistochemical staining(gene translation). This supports further proliferation throughactivated G protein signaling even in end-stage aortic valve diseaseas trigger for degenerative processing and further calcification of thevalves.

Statins given at least for 4 weeks prior to valve replacement alteredsignificantly G protein-mediated RGS protein regulated proliferativephosphorylation of ERK 1/2 in aortic valves. Primarily, in our study,statins neutralized transcriptionally RGS expression in aortic valves(CSAV+) with correspondent increase in the activation of phosphory-lated ERK 1/2 as previously described in different cell models, in-vitro(Blanc et al., 2003; Chatterjee et al., 1997; Leone et al., 2000; Nishida etal., 2005; Ogier-Denis et al., 2000). Inhibition of selected cardiac RGSproteins, mainly RGS2, RGS3, and RGS4 through statins is a newmolecular biological unknown effect of HMG-CoA reductase inhibi-tors. This RGS protein inhibition leads ultimately to enhancedactivation of G protein-mediated signaling targets, here phosphory-lated ERK 1/2 in human aortic valves which in turn trigger theproliferative degeneration and calcification process on finally end-stage aortic valve disease with severe stenosis. In context of coronaryatherosclerosis, statins deliver a variety of further known effects aheadof cholesterol lowering: plaque stabilization, reduction of macrophagenumbers, matrix metalloproteinase expression (MMP-1, -2, -3, and -9)as well as adhesion molecules (VACM-1, MCP-1) or tissue expressionfactor (Libby and Aikawa, 2003). These pleiotropic effects of statinswere observed as well in the atherosclerotic inflammation of severelycalcified and stenotic aortic valves (Anger et al., 2007b).

In the controversy from epidemiological studies as to whetherstatins delay or alter the development of aortic valve stenosis (Cowellet al., 2005) or (Mohler et al., 2007; Moura et al., 2007; Rajamannan,2007) due to the association of calcified aortic valve disease with anincreased risk of cardiovascular events, mechanistic insights into howthe aortic valve sclerosis/calcification develops and may be altered isof considerable scientific and therapeutic interest (Goldbarg et al.,2007). Further clinical studies on this will follow (Chan et al., 2007;Rossebo et al., 2007).

Our previous findings revealed statins given for at least 4 weeks asparticular inhibitors of upregulated parameters of atheroscleroticinflammation (eotaxin3 and MIG) even on severe end-stage CSAVwithout any effect on TGFβ1 and VAP-1 (Anger et al., 2007b). Our newdata further supports the clinical and scientific observation of the onlypartial effect of statin pre-treatment as inhibition of continuing aorticvalve calcification in end-stage disease (Cowell et al., 2005): the use ofstatins as inhibitors of valve degeneration enhances the phosphoryla-tion of activated ERK 1/2 stimulating further proliferative processes.

Further studies are describing myofibroblasts as valve localizationof the representative inflammation in human end-stage calcified andstenotic aortic valves processing to severe valve calcification (Li et al.,2007; Liu et al., 2007). Less is known about the proliferative role ofERK 1/2 in myofibroblasts. These interstitial cells are able to transforminto osteoblasts in-vitrowhen given in an osteogenicmilieu (Osman et

al., 2006) with inhibitory effects of statins. But this “statin effect” isagain only a fractional effect.

There is further considerable interest into the molecular mechanismof the valve proliferation triggered through ERK 1/2 probably activatedthrough statins given in reflection to diminish valve calcification.

In conclusion, our study suggests altered G protein-mediatedsignalingwith enhanced RGS expression (RGS2, RGS3, and RGS4), withactivated ERK 1/2 phosphorylation and with changed G protein-coupled receptor expression as proliferative process in humanseverely calcified and stenotic aortic valves in end-stage disease.Statin pre-treatment significantly inhibited RGS expression which inturn leads to increased activation of phosphorylated ERK 1/2 andtherefore stimulates differentially further proliferative processesprobably on myofibroblasts where the osteogenic bone transforma-tion occurs. Our findings provide further evidence, that an inflamma-tory reaction similar to the one seen in atherosclerosis may initiallylead to calcification on the aortic valve and is then followed by adifferential proliferative process in end-stage disease. Further inves-tigations are needed to clarify the effects of statins on theinflammatory process in the early stages of this disease and to definenew therapeutical approaches in order to reduce and potentiallyprevent the progression of aortic valve calcification.

Acknowledgment

This work was supported by Grant ELAN, # M2-06.08.28.1,Friedrich-Alexander University of Erlangen to Dr. Thomas Anger andProf. Dr. Christoph D. Garlichs.

References

Aki, T., Yanagisawa, S., Akanuma, H., 1997. Identification and characterization of positiveregulatory elements in the human glyceraldehyde 3-phosphate dehydrogenasegene promoter. J. Biochem. 122, 271–278.

Anger, T., Zhang, W., Mende, U., 2004. Differential contribution of GTPase activation andeffector antagonism to the inhibitory effect of RGS proteins on Gq-mediatedsignaling in vivo. J. Biol. Chem. 279, 3906–3915.

Anger, T., Ekici, A.B., Daniel, W.G., Garlichs, C.D., 2006. [Gene polymorphisms leading tocalcified and stenotic aortic valves]. Herz 31, 635–643.

Anger, T., Klintworth, N., Stumpf, C., Daniel, W.G., Mende, U., Garlichs, C.D., 2007a. RGSprotein specificity towards G(q)- and G(i/o)-mediated ERK 1/2 and Akt activation, invitro. J. Biochem. Mol. Biol. 40, 899–910.

Anger, T., Pohle, F.K., Kandler, L., Barthel, T., Ensminger, S.M., Fischlein, T., Weyand, M.,Stumpf, C., Daniel, W.G., Garlichs, C.D., 2007b. VAP-1, Eotaxin3 and MIG as potentialatherosclerotic triggers of severe calcified and stenotic human aortic valves: effectsof statins. Exp. Mol. Pathol.

Bellamy, M.F., Pellikka, P.A., Klarich, K.W., Tajik, A.J., Enriquez-Sarano, M., 2002.Association of cholesterol levels, hydroxymethylglutaryl coenzyme-A reductaseinhibitor treatment, and progression of aortic stenosis in the community. J. Am.Coll. Cardiol. 40, 1723–1730.

Blanc, A., Pandey, N.R., Srivastava, A.K., 2003. Synchronous activation of ERK 1/2,p38mapk and PKB/Akt signaling by H2O2 in vascular smooth muscle cells:potential involvement in vascular disease (review). Int. J. Mol. Med. 11, 229–234.

Boisvert, W.A., Santiago, R., Curtiss, L.K., Terkeltaub, R.A., 1998. A leukocytehomologue of the IL-8 receptor CXCR-2 mediates the accumulation of macro-phages in atherosclerotic lesions of LDL receptor-deficient mice. J. Clin. Invest.101, 353–363.

Bommakanti, R.K., Vinayak, S., Simonds, W.F., 2000. Dual regulation of Akt/proteinkinase B by heterotrimeric G protein subunits. J. Biol. Chem. 275, 38870–38876.

Boring, L., Gosling, J., Cleary, M., Charo, I.F., 1998. Decreased lesion formation in CCR2−/−mice reveals a role for chemokines in the initiation of atherosclerosis. Nature 394,894–897.

Calo, L.A., Pagnin, E., Mussap, M., Davis, P.A., Semplicini, A., 2006. Rho/Rho-kinase and C-reactive protein relationship in hypertension and atherosclerosis. Nephrol. Dial.Transplant. 21, 1131–1132.

Chan, K.L., Teo, K., Tam, J., Dumesnil, J.G., 2007. Rationale, design, and baselinecharacteristics of a randomized trial to assess the effect of cholesterol loweringon the progression of aortic stenosis: the Aortic Stenosis Progression Observa-tion: Measuring Effects of Rosuvastatin (ASTRONOMER) trial. Am. Heart. J. 153,925–931.

Chang, F., Steelman, L.S., Lee, J.T., Shelton, J.G., Navolanic, P.M., Blalock, W.L., Franklin,R.A., McCubrey, J.A., 2003a. Signal transduction mediated by the Ras/Raf/MEK/ERK pathway from cytokine receptors to transcription factors: potential targetingfor therapeutic intervention. Leukemia 17, 1263–1293.

Chang, F., Steelman, L.S., Shelton, J.G., Lee, J.T., Navolanic, P.M., Blalock, W.L., Franklin, R.,McCubrey, J.A., 2003b. Regulation of cell cycle progression and apoptosis by the Ras/Raf/MEK/ERK pathway (review). Int. J. Oncol. 22, 469–480.


Chatterjee, T.K., Eapen, A.K., Fisher, R.A.,1997. A truncated formofRGS3negatively regulatesG protein-coupled receptor stimulation of adenylyl cyclase and phosphoinositidephospholipase C. J. Biol. Chem. 272, 15481–15487.

Cowell, S.J., Newby, D.E., Prescott, R.J., Bloomfield, P., Reid, J., Northridge, D.B., Boon, N.A.,2005. A randomized trial of intensive lipid-lowering therapy in calcific aorticstenosis. N. Engl. J. Med. 352, 2389–2397.

Cybulsky, M.I., Iiyama, K., Li, H., Zhu, S., Chen, M., Iiyama, M., Davis, V., Gutierrez-Ramos,J.C., Connelly, P.W., Milstone, D.S., 2001. A major role for VCAM-1, but not ICAM-1, inearly atherosclerosis. J. Clin. Invest. 107, 1255–1262.

Franke, T.F., Hornik, C.P., Segev, L., Shostak, G.A., Sugimoto, C., 2003. PI3 K/Akt andapoptosis: size matters. Oncogene 22, 8983–8998.

Freeman, R.V., Otto, C.M., 2005. Spectrum of calcific aortic valve disease: pathogenesis,disease progression, and treatment strategies. Circulation 111, 3316–3326.

Freeman, R.V., Crittenden, G., Otto, C., 2004. Acquired aortic stenosis. Expert. Rev.Cardiovasc. Ther. 2, 107–116.

George, J., Afek, A., Keren, P., Herz, I., Goldberg, I., Haklai, R., Kloog, Y., Keren, G., 2002.Functional inhibition of Ras by S-trans,trans-farnesyl thiosalicylic acid attenuatesatherosclerosis in apolipoprotein E knockout mice. Circulation 105, 2416–2422.

Gerthoffer, W.T., Singer, C.A., 2003. MAPK regulation of gene expression in airwaysmooth muscle. Respir. Physiol. Neurobiol. 137, 237–250.

Ghazvini-Boroujerdi, M., Clark, J., Narula, N., Palmatory, E., Connolly, J.M., DeFelice, S.,Xu, J., Jian, B., Hazelwood, S., Levy, R.J., 2004. Transcription factor Egr-1 in calcificaortic valve disease. J. Heart. Valve. Dis. 13, 894–903.

Gilman, A.G., 1995. Nobel lecture. G proteins and regulation of adenylyl cyclase. Biosci.Rep. 15, 65–97.

Goldbarg, S.H., Elmariah, S., Miller, M.A., Fuster, V., 2007. Insights into degenerativeaortic valve disease. J. Am. Coll. Cardiol. 50, 1205–1213.

Gu, L., Okada, Y., Clinton, S.K., Gerard, C., Sukhova, G.K., Libby, P., Rollins, B.J., 1998.Absence of monocyte chemoattractant protein-1 reduces atherosclerosis in lowdensity lipoprotein receptor-deficient mice. Mol. Cell 2, 275–281.

Haley, K.J., Lilly, C.M., Yang, J.H., Feng, Y., Kennedy, S.P., Turi, T.G., Thompson, J.F.,Sukhova, G.H., Libby, P., Lee, R.T., 2000. Overexpression of eotaxin and the CCR3receptor in human atherosclerosis: using genomic technology to identify apotential novel pathway of vascular inflammation. Circulation 102, 2185–2189.

Hepler, J.R., Berman, D.M., Gilman, A.G., Kozasa, T., 1997. RGS4 and GAIP are GTPase-activating proteins for Gq alpha and block activation of phospholipase C beta bygamma-thio-GTP-Gq alpha. Proc. Natl. Acad. Sci. U. S. A. 94, 428–432.

Hollinger, S., Hepler, J.R., 2002. Cellular regulation of RGS proteins: modulators andintegrators of G protein signaling. Pharmacol. Rev. 54, 527–559.

Jian, B., Narula, N., Li, Q.Y., Mohler 3rd, E.R., Levy, R.J., 2003. Progression of aortic valvestenosis: TGF-beta1 is present in calcified aortic valve cusps and promotes aorticvalve interstitial cell calcification via apoptosis. Ann. Thorac. Surg. 75, 457–465discussion 65–6.

Kaden, J.J., Dempfle, C.E., Grobholz, R., Tran, H.T., Kilic, R., Sarikoc, A., Brueckmann, M.,Vahl, C., Hagl, S., Haase, K.K., Borggrefe, M., 2003. Interleukin-1 beta promotesmatrix metalloproteinase expression and cell proliferation in calcific aortic valvestenosis. Atherosclerosis 170, 205–211.

Kaden, J.J., Bickelhaupt, S., Grobholz, R., Vahl, C.F., Hagl, S., Brueckmann, M., Haase, K.K.,Dempfle, C.E., Borggrefe, M., 2004a. Expression of bone sialoprotein and bonemorphogenetic protein-2 in calcific aortic stenosis. J. Heart Valve Dis. 13, 560–566.

Kaden, J.J., Vocke, D.C., Fischer, C.S., Grobholz, R., Brueckmann, M., Vahl, C.F., Hagl, S.,Haase, K.K., Dempfle, C.E., Borggrefe, M., 2004b. Expression and activity of matrixmetalloproteinase-2 in calcific aortic stenosis. Z. Kardiol. 93, 124–130.

Kardestuncer, T., Wu, H., Lim, A.L., Neer, E.J., 1998. Cardiac myocytes express mRNA forten RGS proteins: changes in RGS mRNA expression in ventricular myocytes andcultured atria. FEBS Lett. 438, 285–288.

Kawaguchi, A., Yutani, C., Yamamoto, A., 2003. Hypercholesterolemic valvulopathy: anaspect of malignant atherosclerosis. Ther. Apher. Dial 7, 439–443.

Kennedy, J.H., Henrion, D., Wassef, M., Shanahan, C.M., Bloch, G., Tedgui, A., 2000.Osteopontin expression and calcium content in human aortic valves. J. Thorac.Cardiovasc. Surg. 120, 427.

Kirii, H., Niwa, T., Yamada, Y., Wada, H., Saito, K., Iwakura, Y., Asano, M., Moriwaki, H.,Seishima, M., 2003. Lack of interleukin-1beta decreases the severity ofatherosclerosis in ApoE-deficient mice. Arterioscler. Thromb. Vasc. Biol. 23,656–660.

Lee Jr., J.T., McCubrey, J.A., 2002. The Raf/MEK/ERK signal transduction cascade as atarget for chemotherapeutic intervention in leukemia. Leukemia 16, 486–507.

Leone, A.M., Errico, M., Lin, S.L., Cowen, D.S., 2000. Activation of extracellular signal-regulated kinase (ERK) and Akt by human serotonin 5-HT(1B) receptors intransfected BE(2)-C neuroblastoma cells is inhibited by RGS4. J. Neurochem. 75,934–938.

Li, Y.B., Hu, C.L., Liu, J., Tang, Q.Z., Huang, C.X., 2007. Calcific aortic valve disease shouldnot be considered as a degenerative disease anymore. Med. Hypotheses 68,1233–1235.

Libby, P., 2002. Inflammation in atherosclerosis. Nature 420, 868–874.Libby, P., Aikawa, M., 2003. Mechanisms of plaque stabilization with statins. Am. J.

Cardiol. 91, 4B–8B.Lindroos, M., Kupari, M., Valvanne, J., Strandberg, T., Heikkila, J., Tilvis, R., 1994. Factors

associated with calcific aortic valve degeneration in the elderly. Eur. Heart. J. 15,865–870.

Liu, Y., Kasyanov, V., Schoephoerster, R.T., 2007. Effect of fiber orientation on the stressdistribution within a leaflet of a polymer composite heart valve in the closedposition. J. Biomech. 40, 1099–1106.

Mach, F., Sauty, A., Iarossi, A.S., Sukhova, G.K., Neote, K., Libby, P., Luster, A.D., 1999.Differential expression of three T lymphocyte-activating CXC chemokines byhuman atheroma-associated cells. J. Clin. Invest. 104, 1041–1050.

Matsui, T., Nagoshi, T., Rosenzweig, A., 2003. Akt and PI 3-kinase signaling incardiomyocyte hypertrophy and survival. Cell Cycle 2, 220–223.

Minamino, T., Yoshida, T., Tateno, K., Miyauchi, H., Zou, Y., Toko, H., Komuro, I., 2003. Rasinduces vascular smooth muscle cell senescence and inflammation in humanatherosclerosis. Circulation 108, 2264–2269.

Mohler 3rd, E.R., Wang, H., Medenilla, E., Scott, C., 2007. Effect of statin treatment onaortic valve and coronary artery calcification. J. Heart Valve Dis. 16, 378–386.

Moura, L.M., Ramos, S.F., Zamorano, J.L., Barros, I.M., Azevedo, L.F., Rocha-Goncalves, F.,Rajamannan, N.M., 2007. Rosuvastatin affecting aortic valve endothelium to slowthe progression of aortic stenosis. J. Am. Coll. Cardiol. 49, 554–561.

Muller, A.M., Cronen, C., Kupferwasser, L.I., Oelert, H., Muller, K.M., Kirkpatrick, C.J.,2000. Expression of endothelial cell adhesion molecules on heart valves: up-regulation in degeneration as well as acute endocarditis. J. Pathol. 191, 54–60.

Narine, K., DeWever, O., Cathenis, K., Mareel, M., Van Belleghem, Y., Van Nooten, G.,2004. Transforming growth factor-beta-induced transition of fibroblasts: a modelfor myofibroblast procurement in tissue valve engineering. J. Heart Valve Dis. 13,281–289 discussion 9.

Neer, E.J., 1995. Heterotrimeric G proteins: organizers of transmembrane signals. Cell80, 249–257.

Neri, L.M., Borgatti, P., Capitani, S., Martelli, A.M., 2002. The nuclear phosphoinositide 3-kinase/AKT pathway: a new second messenger system. Biochim. Biophys. Acta1584, 73–80.

Nishida, M., Tanabe, S., Maruyama, Y., Mangmool, S., Urayama, K., Nagamatsu, Y.,Takagahara, S., Turner, J.H., Kozasa, T., Kobayashi, H., Sato, Y., Kawanishi, T., Inoue, R.,Nagao, T., Kurose, H., 2005. G alpha 12/13- and reactive oxygen species-dependentactivation of c-Jun NH2-terminal kinase and p38 mitogen-activated protein kinaseby angiotensin receptor stimulation in rat neonatal cardiomyocytes. J. Biol. Chem.280, 18434–18441.

O'Brien, K.D., Kuusisto, J., Reichenbach, D.D., Ferguson, M., Giachelli, C., Alpers, C.E.,Otto, C.M., 1995. Osteopontin is expressed in human aortic valvular lesions.Circulation 92, 2163–2168.

Ogier-Denis, E., Pattingre, S., El Benna, J., Codogno, P., 2000. Erk1/2-dependentphosphorylation of Galpha-interacting protein stimulates its GTPase acceleratingactivity and autophagy in human colon cancer cells. J. Biol. Chem. 275,39090–39095.

Osman, L., Yacoub, M.H., Latif, N., Amrani, M., Chester, A.H., 2006. Role of human valveinterstitial cells in valve calcification and their response to atorvastatin. Circulation114, I547–552.

Otto, C.M., 2004a. Aortic stenosis and hyperlipidemia: establishing a cause–effectrelationship. Am. Heart. J. 147, 761–763.

Otto, C.M., 2004b. Aortic stenosis: even mild disease is significant. Eur. Heart. J. 25,185–187.

Otto, C.M., Burwash, I.G., Legget, M.E., Munt, B.I., Fujioka, M., Healy, N.L., Kraft, C.D.,Miyake-Hull, C.Y., Schwaegler, R.G., 1997. Prospective study of asymptomaticvalvular aortic stenosis. Clinical, echocardiographic, and exercise predictors ofoutcome. Circulation 95, 2262–2270.

Palta, S., Pai, A.M., Gill, K.S., Pai, R.G., 2000. New insights into the progression of aorticstenosis: implications for secondary prevention. Circulation 101, 2497–2502.

Pohle, K., Otte, M., Maffert, R., Ropers, D., Schmid, M., Daniel, W.G., Achenbach, S., 2004.Association of cardiovascular risk factors to aortic valve calcification as quantifiedby electron beam computed tomography. Mayo Clin. Proc. 79, 1242–1246.

Rajamannan, N.M., 2007. Reassessment of statins to retard the progression of aorticstenosis. Curr. Cardiol. Rep. 9, 99–104.

Rajamannan, N.M., Subramaniam, M., Springett, M., Sebo, T.C., Niekrasz, M.,McConnell, J.P., Singh, R.J., Stone, N.J., Bonow, R.O., Spelsberg, T.C., 2002.Atorvastatin inhibits hypercholesterolemia-induced cellular proliferation andbone matrix production in the rabbit aortic valve. Circulation 105, 2660–2665.

Rajamannan, N.M., Subramaniam, M., Rickard, D., Stock, S.R., Donovan, J., Springett, M.,Orszulak, T., Fullerton, D.A., Tajik, A.J., Bonow, R.O., Spelsberg, T., 2003. Humanaortic valve calcification is associated with an osteoblast phenotype. Circulation107, 2181–2184.

Reddy, K.B., Nabha, S.M., Atanaskova, N., 2003. Role of MAP kinase in tumor progressionand invasion. Cancer Metastasis Rev. 22, 395–403.

Roger, V.L., Tajik, A.J., Bailey, K.R., Oh, J.K., Taylor, C.L., Seward, J.B., 1990. Progression ofaortic stenosis in adults: new appraisal using Doppler echocardiography. Am. Heart.J. 119, 331–338.

Ross, E.M., Wilkie, T.M., 2000. GTPase-activating proteins for heterotrimeric G proteins:regulators of G protein signaling (RGS) and RGS-like proteins. Annu. Rev. Biochem.69, 795–827.

Rossebo, A.B., Pedersen, T.R., Allen, C., Boman, K., Chambers, J., Egstrup, K., Gerdts, E.,Gohlke-Barwolf, C., Holme, I., Kesaniemi, V.A., Malbecq, W., Nienaber, C., Ray, S.,Skjaerpe, T., Wachtell, K., Willenheimer, R., 2007. Design and baseline character-istics of the simvastatin and ezetimibe in aortic stenosis (SEAS) study. Am. J. Cardiol.99, 970–973.

Salmi, M., Jalkane, S., 2002. Enzymatic control of leukocyte trafficking: role of VAP-1.Adv. Exp. Med. Biol. 512, 57–63.

Satta, J., Melkko, J., Pollanen, R., Tuukkanen, J., Paakko, P., Ohtonen, P., Mennander, A.,Soini, Y., 2002. Progression of human aortic valve stenosis is associated withtenascin-C expression. J. Am. Coll. Cardiol. 39, 96–101.

Shavelle, D.M., Takasu, J., Budoff, M.J., Mao, S., Zhao, X.Q., O'Brien, K.D., 2002. HMG CoAreductase inhibitor (statin) and aortic valve calcium. Lancet 359, 1125–1126.

Sheikh, A.M., Ochi, H., Manabe, A., Masuda, J., 2005. Lysophosphatidylcholineposttranscriptionally inhibits interferon-gamma-induced IP-10, Mig and I-Tacexpression in endothelial cells. Cardiovasc. Res. 65, 263–271.

Shi, C.S., Lee, S.B., Sinnarajah, S., Dessauer, C.W., Rhee, S.G., Kehrl, J.H., 2001. Regulator ofG-protein signaling 3 (RGS3) inhibits Gbeta1gamma 2-induced inositol phosphate


production, mitogen-activated protein kinase activation, and Akt activation. J. Biol.Chem. 276, 24293–24300.

Shiojima, I., Walsh, K., 2002. Role of Akt signaling in vascular homeostasis andangiogenesis. Circ. Res. 90, 1243–1250.

Smalley, K.S., 2003. A pivotal role for ERK in the oncogenic behaviour of malignantmelanoma? Int. J. Cancer 104, 527–532.

Steelman, L.S., Pohnert, S.C., Shelton, J.G., Franklin, R.A., Bertrand, F.E., McCubrey, J.A.,2004. JAK/STAT, Raf/MEK/ERK, PI3 K/Akt and BCR-ABL in cell cycle progression andleukemogenesis. Leukemia 18, 189–218.

Tibbles, L.A., Woodgett, J.R., 1999. The stress-activated protein kinase pathways. Cell.Mol. Life Sci. 55, 1230–1254.

Topper, J.N., Gimbrone Jr., M.A., 1999. Blood flow and vascular gene expression: fluidshear stress as a modulator of endothelial phenotype. Mol. Med. Today 5, 40–46.

Vazquez-Prado, J., Casas-Gonzalez, P., Garcia-Sainz, J.A., 2003. G protein-coupledreceptor cross-talk: pivotal roles of protein phosphorylation and protein–proteininteractions. Cell. Signal. 15, 549–557.

Wieland, T., Mittmann, C., 2003. Regulators of G-protein signalling: multifunctionalproteins with impact on signalling in the cardiovascular system. Pharmacol. Ther.97, 95–115.

Yan, Y., Chi, P.P., Bourne, H.R., 1997. RGS4 inhibits Gq-mediated activation of mitogen-activated protein kinase and phosphoinositide synthesis. J. Biol. Chem. 272,11924–11927.

Yasuda, T., Kawasuji, M., Sakakibara, N.,Watanabe, Y., 2000. Aortic valve replacement forthe calcified ascending aorta in homozygous familial hypercholesterolemia. Eur. J.Cardiothorac. Surg. 18, 249–250.

Yilmaz, A., Reiss, C., Tantawi, O., Weng, A., Stumpf, C., Raaz, D., Ludwig, J., Berger, T.,Steinkasserer, A., Daniel, W.G., Garlichs, C.D., 2004. HMG-CoA reductase inhibitorssuppressmaturation of human dendritic cells: new implications for atherosclerosis.Atherosclerosis 172, 85–93.

Zhang, W., Anger, T., Su, J., Hao, J., Xu, X., Zhu, M., Gach, A., Cui, L., Liao, R., Mende, U.,2006. Selective loss of fine tuning of Gq/11 signaling by RGS2 protein exacerbatescardiomyocyte hypertrophy. J. Biol. Chem. 281, 5811–5820.

Documents

Statins stimulate RGS-regulated ERK 1/2 activation in human calcified and stenotic aortic valves