Journal of General Virology (2000), 81, 2741–2750. Printed in Great Britain. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Simian immunodeficiency virus resistance of macaques infusedwith interferon β-engineered lymphocytes

Franck Matheux,1 Evelyne Lauret,2 Ve! ronique Rousseau,2 Je! ro# me Larghero,1 Bertrand Boson,1

Bruno Vaslin,1 Arnaud Cheret,1 Edward De Maeyer,2† Dominique Dormont1 and Roger LeGrand1

1 CEA, Service de Neurovirologie (DSV/DRM), CRSSA, Institut Paris-Sud sur les Cytokines, BP 6, 92265 Fontenay aux Roses, Cedex,France2 Equipe de l’Interfe! ron et des Cytokines, UMR 146 CNRS, Institut Curie, Ba# timent 110, Centre Universitaire, 91405 Orsay, France

To test the in vivo anti-simian immunodeficiency virus (SIV) efficacy of interferon (IFN)-β-engineeredlymphocytes, peripheral blood lymphocytes harvested from two uninfected macaques weretransduced with a retroviral vector carrying a constitutively expressed IFN-β gene and reinfused,resulting in approximately 1 IFN-β-transduced cell out of 1000 circulating cells. The gene-modifiedcells were well tolerated and could be detected for at least 74 days without causing any apparentside effects. These two animals together with three untreated control macaques were then infectedwith SIVmac251. The two IFN-β-infused macaques are in good health, 478 days after infection,with a reduced plasma virus load and sustained numbers of CD4M and CD8M cells. Throughout thestudy, the proportion of IFN-β-transduced cells has been maintained. Of the three controlmacaques, two were characterized by a high plasma virus load and a decrease in CD4M cells. Onewas moribund and was sacrificed 350 days after infection and the other now has fewer than 100circulating CD4M cells/ml. Unexpectedly, the third control macaque, which, like the two IFN-β-infused animals, had a low plasma virus load and a maintenance of CD4M and CD8M cell number,was characterized by a permanent level of serum IFN-β, of unknown origin, already present beforeSIV infection. Although no definite conclusion can be made in view of the limited number of animals,these data indicate that further exploration is warranted of an IFN-β-based anti-humanimmunodeficiency virus gene therapy.

IntroductionAlthough antiviral therapy with inhibitors of protease and

reverse transcriptase is quite effective in suppressing thereplication of human immunodeficiency virus (HIV), itscombined use with immune-based strategies able to boost theimmune system has been proposed to contribute to the long-term control of HIV infection (Piscitelli et al., 1996 ; Pantaleo,1997). Anti-HIV gene therapy strategies are currently basedon the direct enhancement of the resistance of HIV target cellsby intracellular immunization (Baltimore, 1988), but could also

Author for correspondence: Evelyne Lauret. Present address : U362

INSERM, Institut Gustave Roussy, PR1, 39 rue Camille Desmoulins,

94800 Villejuif, France. Fax ­33 1 42 11 52 40.

e-mail elauret!igr.fr

† Present address: Les Genie' vres, Augerville la Rivie' re, 45330

Malesherbes, France.

be designed to improve immune responses. In this respect,interferon (IFN)-β is an attractive candidate : it is a naturalantiviral protein that inhibits HIV at various stages of the viruscycle, from uptake to release of viral particles (Vieillard et al.,1994 ; Baca-Regen et al., 1994 ; Kornbluth et al., 1990 ; Shirazi &Pitha, 1993 ; Coccia et al., 1994 ; Poli et al., 1989 ; Hansen et al.,1992), and also displays immunomodulatory properties, whichcould be an important component in controlling HIV rep-lication (Belardelli, 1995).

For the reasons outlined above, a gene therapy strategybased on the constitutive expression of IFN-β is beingdeveloped (Lauret et al., 1994). Transduction with a retroviralvector, resulting in a low and continuous expression of IFN-β,causes inhibition of HIV replication and increased cell survivalof CD4+ cells in peripheral blood from HIV-infected donors(Vieillard et al., 1995, 1997). In addition to its direct antiviralactivity, IFN-β also contributes to the restoration of normalimmune cell functions. Transduction of peripheral blood

0001-7078 # 2000 SGM CHEB

F. Matheux and othersF. Matheux and others

lymphocytes (PBL) from HIV-infected donors with our IFN-βconstruct increases IFN-γ and interleukin (IL)-12 productionand brings IL-4, IL-6, IL-10 and TNF-α production back tonormal levels. It also increases the cytotoxic responses ofCD8+ cells against cells expressing HIV proteins and improvesthe proliferative response to recall antigens (Vieillard et al.,1997 ; Hadida et al., 1999). These results in vitro have beenconfirmed in a Hu–PBL–SCID mouse model (Vieillard et al.,1999). Furthermore, anti-HIV resistance has been obtained inmacrophages transduced with the IFN-β construct (Cremer etal., 2000).

As a relevant in vivo model of anti-HIV IFN-β gene therapy,we have resorted to macaques infected with a pathogenicisolate of simian immunodeficiency virus (SIV), SIVmac251(Matheux et al., 1999). SIV is a non-human primate lentivirusthat shares similar genomic organization and biologicalproperties with HIV-1 and HIV-2 (Desrosiers, 1990) andcauses a disease in macaques similar to HIV-induced AIDS inhumans (Daniel et al., 1985). We have previously described aretroviral vector in which the macaque (Ma) IFN-β codingsequence has been placed under the control of a 0±6 kbfragment of the murine H-2Kb gene promoter (Matheux et al.,1999). PBL obtained from seronegative animals transducedwith this construct develop enhanced resistance to SIVmac251in vitro. We therefore sought to determine whether IFN-β-transduced PBL could survive in vivo without inducing any sideeffects and exert anti-SIV activity in macaques.

Methods+ Animals. Five male cynomolgus macaques (Macaca fascicularis),weighing 4±5–6 kg and negative for herpesvirus B, filovirus, simian T-lymphotropic virus-1, simian retrovirus-1 and -2, SIV and hepatitis Bvirus, were used in the study. Two individuals, J813 and J816,subsequently referred to as IFN1 and IFN2, were subjected to a singleinfusion of IFN-β-transduced lymphocytes. The three others, S62A, S73Band S72C, subsequently referred to as C1, C2 and C3, did not receivetransduced lymphocytes and served as controls. Animals were housed insingle cages in biosafety level 3 facilities and all experimental procedureswere conducted according to the institutional guidelines for animal care(Journal officiel des CommunauteU s EuropeU ennes, L538, 18 December 1986).

+ IFN-β transduction of PBL. Approximately 100 ml blood wascollected in heparin–lithium dry tubes. Buffy coats were obtained bycentrifugation (170 g for 15 min). White cells were collected andcentrifuged (400 g for 30 min) over a Ficoll density gradient (Eurobio).Plasma and erythrocytes, diluted with an equal volume of PBS, wereimmediately readministered to the corresponding macaque. PBMC wereactivated at 10' cells per ml for 3 days in RPMI-1640, 20% FCS, 2 mM-glutamine (Boehringer Mannheim), 0±2 µM antibiotics (penicillin}streptomycin}neomycin ; PSN, Life Technologies) and 10 µg}ml con-canavalin A (Sigma). After these 3 days, the activated PBL weretransduced with the retroviral vector MFG-Kb-MaIFN-β by a subsequent3 day co-culture on ψ-CRIP packaging cells, as described previously(Matheux et al., 1999). At the end of the co-culture, the different cellpopulations were transferred two or three times to other plates in orderto eliminate by adherence any remaining packaging cells and non-adherent cells were infused into the respective animal. Transduction

efficacy was estimated, as described hereafter, on PBL maintained inculture for 10 days.

+ In vivo follow-up of infused macaques. Both infused animalswere followed for 21 days before cytapheresis, for 74 days afterautologous infusion and for 478 days after SIV infection for weight,haematological analysis, presence of IFN-β-transduced lymphocytes andSIV infection parameters. Axillary lymph nodes were removed underketamine anaesthesia and disrupted in PBS by using a Potter homo-genizer. Peripheral blood was collected in heparin–lithium dry tubes.Mononuclear cells, from blood or lymph nodes, were isolated bystandard Ficoll density gradient centrifugation. For each collection, anuninfused animal underwent identical procedures and served as a negativecontrol for DNA extraction and PCR amplification.

+ SIV challenge. Seventy-four days after infusion, the two macaquesthat received IFN-β-transduced lymphocytes (IFN1, IFN2) and the threeuntreated control macaques (C1, C2, C3) were infected intravenouslywith 4 animal infectious doses (AID

&!) of a pathogenic SIVmac251 isolate

(provided by A. M. Aubertin, Universite! Louis Pasteur, Strasbourg,France). In our hands, all but one of 62 inoculated monkeys becameinfected at this dose. All animals were then followed for at least 478 daysafter SIV inoculation.

+ Haematological follow-up. Haematological values and enumer-ation of blood cells (leukocytes, lymphocytes, polynuclear cells, mono-cytes, erythrocytes, haematocrit, haemoglobinaemia, platelets) weredetermined by using anAutomat haemocytometer (Coulter Corporation).Estimates of absolute numbers of CD2+, CD4+ and CD8+ cells in thecirculation were obtained by using direct immunofluorescence assays(CD4–leu3a–PE and CD8–leu2a–FITC, Becton Dickinson ; CD2–MT910–PE, Dako) and flow cytometry (FACScan, Becton Dickinson) asdescribed previously (Cheret et al., 1996).

+ Cell sorting. Mononuclear cells were positively separated by usingCD4-specific or CD8-specific immunomagnetic microbeads (MiniMACS,Miltenyi) according to the manufacturer’s instructions. Subset purity wasevaluated by using second anti-CD4 (OKT4–PE, Ortho-diagnostics) oranti-CD8 (DK25–FITC, Dako) antibodies and quantified by flowcytometry (FACScan).

+ Analysis of IFN-β-transduced cells. The presence of IFN-β-transduced cells was evaluated, in duplicate or triplicate depending on theamount of sample, by semiquantitative PCR with 200 ng genomic DNA.The amount of DNA used for each sample was normalized afteramplifying a fragment of the endogenous IFN-β gene (with 5«ATGACCAACAAGTGTCTCCT 3« as the sense primer and 5« ACA-GGCTAGGAGATCTTCA 3« as the antisense primer, delineating a600 bp sequence) as a quantitative control. Detection of the H-2Kb-MaIFN-β transgene was performed by using 5« GTTCAGGCAAAG-TCTTAGTC 3« (®228 to ®209) as the sense primer in the H-2Kb genepromoter and 5« TGAAGATCTCCTAGCCTGT 3« (579 to 560) as theantisense primer in the Ma IFN-β coding sequence. Detection of anyremaining murine packaging cells was performed by PCR with a murineα-globin primer set described by Erhart et al. (1987). The PCRamplification products were identified by dot-blot hybridization with anIFN-β probe (Vieillard et al., 1995) and quantified by using a phosphor-imager (Molecular Dynamics). The relative intensity of the signals wascompared to serial dilutions of lysate derived from plasmid-transfectedcells that contained known numbers of IFN-β transgene copies per cell.

+ Measurements of SIV replication. Anti-SIV antibodies weredetermined by using an HIV-2 antigen-detection ELISA (ELAVIAII ;Sanofi Diagnostics Pasteur) as reported previously (Le Grand et al., 1994).

CHEC

Anti-SIV gene therapy with IFN-βAnti-SIV gene therapy with IFN-β

To reveal anti-SIV antibodies, we used a peroxidase-labelled goat anti-monkey IgG (Organon Teknika). The ELISA was performed with aplasma dilution of 1 :100. Titres were determined by reference to astandard titrated positive pool from sera of SIV-infected macaques. Thep27 nucleocapsid protein was detected in undiluted plasma by using theCoulter SIV core Ag assay (Retrovirology Coulter Corporation). SIVRNA levels were determined in plasma by using the SIVmac-bDNAassay (Chiron Diagnostics).

+ IFN titration. In view of the absence of a commercially availableELISA for measuring macaque IFN-β, IFN was measured by its biologicalactivity on human WISH cells with vesicular stomatitis virus (VSV) as thechallenge (Matheux et al., 1999). Before titration, sera were inactivated byexposure to 56 °C for 30 min but, in spite of this, the presence of smallamounts of IFN could not be measured in some serum samples due to thetoxicity of low serum dilutions (1 :3, 1 :6) on WISH cells. Because of thenon-specific acid-labile anti-VSV activity present in the serum (Fall et al.,1995), the IFNs were characterized after acid treatment (pH 2). IFN-α wascharacterized as acid-stable IFN-α by neutralization with a rabbit anti-human (Hu) IFN-α polyclonal serum that recognized Ma IFN-α and IFN-β by neutralization with a rabbit anti-Hu IFN-β polyclonal serum thatcross-reacted with Ma IFN-β.

+ RT–PCR analysis. Total RNA was extracted by using theTriReagent kit (Sigma) and DNase-treated before synthesizing cDNAusing the First Strand cDNA synthesis kit (Pharmacia Biotech). Tran-scription from the construct was evidenced by using primers absent fromthe endogenous gene, a sense primer located downstream from the H-2Kb promoter and upstream from the IFN-β start codon (5« CTCAGA-AGTCGTGGTCGACT 3«) and an antisense primer located downstreamof the IFN-β stop codon (5« ATCAATTCGAGCTCGGTACC 3«),generating a 660 bp fragment (45 cycles). Control glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcripts were amplified with asense primer located in the second exon (5« ACTGGCGTCTTC-ACCACCATGGA 3«) and an antisense primer in the eighth exon (5«GGTCCACCACCCTGTTGCTGTAGC 3«), generating a 932 bp frag-ment (30 cycles).

ResultsTransduction and infusion of IFN-β-transduced PBL

To transfer the IFN-β gene into PBL from two SIV-negativemacaques, we used a retroviral vector containing the macaqueIFN-β coding sequence placed under the control of a 0±6 kbfragment of the murine H-2Kb gene promoter (Matheuxet al., 1999). After transduction, the lymphocytes were re-administered ; 4¬10) PBL for animal IFN1 and 6¬10) PBL foranimal IFN2. Semiquantitative PCR analysis revealed a mean of0±2 IFN-β transgene copies per infused cell for both macaques.Hence, the estimated numbers of IFN-β-transduced PBLintroduced into the animals were 8¬10( and 12¬10( formacaques IFN1 and IFN2.

In vivo persistence of IFN-β-transduced PBL

After inoculation of IFN-β-transduced cells, PBL sampleswere drawn at regular intervals for 74 days for PCR analysis.To ensure that the IFN transgene signal did not result from thepresence of murine packaging cells, we performed PCR analysisto detect murine DNA sequences. A murine signal was found

10

8

6

4

2

–20 –10 0 10 20 30 40 50 60 70 80

(a)

PBL

(×10

–3 p

er µ

l blo

od)

3000

2000

10000 10 20 30 40 50 60 70 80

(b)

6000

4000

2000

00 10 20 30 40 50 60 70 80

(c)

10 000

1000

100

100 10 20 30 40 50 60 70 80

(d)

Time after infusion (days)

CD

4+ c

ells

(per

µl b

lood

)C

D8+

cel

ls (p

er µ

l blo

od)

IFN

-β (c

opie

s pe

r 10

6 ce

lls)

Fig. 1. Analysis of macaques IFN1 (D) and IFN2 (*) infused with IFN-β-transduced lymphocytes before SIV infection. The proportion of IFN-β-transduced lymphocytes was estimated by semiquantitative PCR, asdescribed in Methods. (a) Number of total lymphocytes in the circulation.(b) Number of CD4+ T cells in the circulation. (c) Number of CD8+ T cellsin the circulation. (d) Proportion of IFN-β-transduced cells in thecirculation.

only the day after infusion in the PBL of one macaque (IFN1).No more murine DNA could be detected thereafter in eithermacaque and the presence of IFN-β-transduced cells could bedemonstrated in both animals (Fig. 1 d). The proportion of IFN-β-transduced cells increased in the circulation during the first 2weeks following infusion, 15-fold in macaque IFN1 and 4-foldin macaque IFN2, reaching a peak of 600 and 6000 transducedcells per 10' PBL for macaques IFN1 and IFN2, respectively.

CHED

F. Matheux and othersF. Matheux and others

105

104

103

102

101

0 20 40 60 80

(c)

Seru

m a

nti-

SIV

ant

ibod

ies

105

104

103

102

101

0 20 40 60 80Time after SIV infection (days)

106

105

104

103

102

101

0 20 30 40

(b)

SIV

RN

A in

pla

sma

(keq

/m

l)

0 20 4010

106

105

104

103

102

101

3

2

1

00 20 30 40

(a)

SIV

p27

in p

lasm

a (n

g/m

l)

10

3

2

1

00 20 30 4010

3010

Fig. 2. Virus parameters in control and infused macaques during primary infection. Macaques C1 (_), C2 (E), C3 (+), IFN1(D) and IFN2 (*) were studied. The p27 nucleocapsid protein was detected in undiluted plasma by using the Coulter SIVcore Ag assay. SIV RNA levels (keq, thousands of RNA equivalents) were determined in plasma by using the SIVmac-bDNAassay.

Thereafter, a mean level of 300 Ma IFN-β-transduced cells per10' circulating cells was maintained in macaque IFN1 until day66 whereas, in macaque IFN2, the number of transduced cells,close to 6000 per 10' cells on day 7, declined gradually toreach 200 Ma IFN-β-transduced cells per 10' circulating cells74 days after infusion.

To investigate the potential side effects of the IFN-β-

transduced cells, we followed the behaviour, haematologicalvalues and weight of the animals. None of these altered duringthe 74 days of observation, except for a slight and transientdecrease of the leukocyte counts in the peripheral blood whichaffected the CD4+ and CD8+ lymphocyte populations equally(Fig. 1a–c). Other haematological parameters were notaffected.

CHEE

Anti-SIV gene therapy with IFN-βAnti-SIV gene therapy with IFN-β

0 30 60 90

(c)

Time after SIV infection (days)

5000

4000

3000

2000

1000

0

0

CD

8+ ly

mph

ocyt

es (p

er µ

l blo

od)

(a)

120 150 180 210 240 270 300 330 360 390 420 450 480

0 30 60 90

(b)1800

1600

1400

1200

1000

800

600

400

200

0CD

4+ ly

mph

ocyt

es (p

er µ

l blo

od)

120 150 180 210 240 270 300 330 360 390 420 450 480

0 30 60 90

(a)1000000

100000

10000

1000

100

10

0

SIV

RN

A c

opie

s (k

eq/

ml)

120 150 180 210 240 270 300 330 360 390

cut-off 2

cut-off 1

0 30 60 90

(d)10000

1000

100

10

0

IFN

-β (c

opie

s pe

r 10

6 ce

lls)

120 150 180 210 240 270 300 330 360 390 420 450 480

Fig. 3. Analysis of control and infused macaques after SIV infection. Macaques C1 (_), C2 (E), C3 (+), IFN1 (D) and IFN2(*) were studied. The p27 nucleocapsid protein was detected in undiluted plasma by using the Coulter SIV core Ag assay. SIVRNA levels were determined in plasma by using the SIVmac-bDNA assay. The proportion of IFN-β-transduced lymphocytes wasestimated by semiquantitative PCR, as described in Methods. (a) SIV RNA copies in the plasma (keq, thousands of RNAequivalents) ; (b) number of CD4+ T cells in the circulation ; (c) number of CD8+ T cells in the circulation ; (d) proportion of IFN-β-transduced cells in the circulation.

CHEF

F. Matheux and othersF. Matheux and others

Table 1. Distribution of Ma IFN-β-transduced cells among circulating and lymph nodelymphocytes

The proportion of IFN-β-transduced lymphocytes was estimated by semiquantitative PCR, as described inMethods. PBMC, Peripheral blood mononuclear cells ; LNMC, lymph node mononuclear cells. , Not done.

Day 50 post-infusion Day 552 post-infusion

Cell population Purity (%)IFN-β copies per

106 cells Purity (%)IFN-β copies per

106 cells

Macaque IFN1Total PBMC – 250CD4+ PBMC 80 100CD8+ PBMC 99 250Total LNMC – 1000CD8+ LNMC 90 400

Macaque IFN2Total PBMC – 2300 – 1000CD4+ PBMC 96 400

CD4− PBMC 99 2800

CD8+ PBMC 88 2500 95 50CD8− PBMC 95

Total LNMC – 1000CD4+ LNMC 200CD8+ LNMC 93 200

Evolution of the virus parameters

To determine the anti-SIV resistance of the two IFN-β-infused macaques and of the three untreated animals used ascontrols (C1, C2, C3), they were infected intravenously withSIVmac251 (4 AID

&!). The course of SIV infection was studied

by measuring the following virus parameters : plasma p27antigen, plasma SIV RNA copies and serum antibodies directedagainst SIV antigens (Fig. 2). Between days 12 and 17 afterinfection, the three control macaques developed a peak of p27antigenaemia, higher for macaque C2 (2±5 ng}ml) and lowerfor macaques C1 and C3 (0±5 and 0±4 ng}ml), whereasmacaques infused with IFN-β-transduced cells maintained alevel of p27 antigenaemia below 0±25 ng}ml (Fig. 2a). Withthe more sensitive Chiron b-DNA assay, our results showedthat, between days 10 and 25, the peak numbers of plasma SIVRNA copies in control macaques reached values of 5¬10)

copies}ml for macaque C2, 4±1¬10( copies}ml for macaqueC1 and 2±7¬10( copies}ml for macaque C3, while the peakvalues measured in the infused macaques were lower, 4±7¬10'

and 8¬10' in macaques IFN2 and IFN1, respectively (Fig. 2b).All of the SIV-infected macaques seroconverted within 1month of SIV inoculation, with anti-SIV antibody titresreaching 5¬10% within 2 months of inoculation (Fig. 2 c).

When the numbers of SIV RNA copies in the plasma weremeasured during chronic infection (Fig. 3a), SIV RNA wasdetected in two control macaques, amounting to between 10(

and 8¬10( SIV RNA copies}ml for macaque C2 and between

5¬10% and 10& copies}ml for macaque C1. Macaque C2 wasmoribund on day 380 and was sacrificed. SIV RNA remainedundetectable for control animal C3 and the two infusedmacaques throughout the study (lower limit of detection, 1500copies}ml).

Evolution of CD4M and CD8M cells

For all animals, control and infused, SIV infection led to adecline in the absolute numbers of CD8+ and CD4+ lympho-cytes 14 days after SIV challenge (Fig. 3b, c) and these valuesreturned to normal 30 days after the onset of infection. At 293days after SIV inoculation, two of the three control animals, C1andC2, had reduced numbers of circulating CD4+ lymphocytescompared with their baseline. The other control animal, C3,and the two infused animals still have sustained numbers ofcirculating CD4+ lymphocytes at the time of writing (day 478)(Fig. 3b). The number of circulating CD8+ cells of controlmacaques C1 and C2 declined in the circulation during chronicinfection in parallel with the decrease of the number of CD4+

T cells (Fig. 3 c).

Evolution of IFN-β-transduced cells in peripheralblood

The day after SIV challenge, the numbers of circulatingIFN-β-transduced PBL were 150 (IFN1) and 160 (IFN2) per 10'

cells. During the first month following SIV inoculation, thelevel of IFN-β-transduced cells decreased to reach a nadir of 30

CHEG

Anti-SIV gene therapy with IFN-βAnti-SIV gene therapy with IFN-β

IFN-β-transduced PBL per 10' circulating cells 25 days afterSIV challenge in macaque IFN1 (Fig. 3d). In macaque IFN2, thisproportion increased transiently to reach 700 Ma IFN-β-transduced PBL per 10' circulating cells 20 days after SIVinoculation and then decreased to reach a nadir of 160 Ma IFN-β-transduced PBL per 10' circulating cells 5 days later. Theseproportions increased thereafter to reach 300 (IFN1) and 3000(IFN2) Ma IFN-β-transduced cells per 10' cells 40 days afterSIV infection (Fig. 3d).

During the 16-month follow-up following the primaryinfection, both macaques maintained a level of IFN-β-transduced cells, ranging from 150 to 500 per 10' circulatingcells in macaque IFN1 and from 250 to 1000 per 10' circulatingcells in macaque IFN2.

Distribution of IFN-β-transduced cells

To follow the distribution of IFN-β-transduced cells amonglymph nodes, a biopsy of an inguinal lymph node was obtainedfrom macaque IFN1 the day after infusion, which revealed aconcentration of IFN-β-transduced cells similar to that in thecirculation (45 per 10' cells). A similar analysis was performed66 and 478 days after SIV inoculation. In macaque IFN1, onday 66, when the proportion of IFN-β-transduced cells was 360per 10' cells in the circulation, 10-fold more IFN-β-transducedcells were found among lymph node cells (3500 per 10' cells).In the same animal, 478 days after SIV infection, the proportionof IFN-β-transduced cells was four times higher in the lymphnode as compared with the proportion in the peripheral blood,whereas there was no significant difference in the proportion ofIFN-β-transduced cells between the lymph node and circulatingcells in macaque IFN2 at this time (Table 1).

The distribution of IFN-β-transduced cells among CD4+

and CD8+ populations was analysed by cell-sorting exper-iments performed on PBMC obtained from macaque IFN2 onday 50 after infusion, with population purities of 88–99%(Table 1). PCR analysis of these sorted cells indicated that mostof the transduced circulating lymphocytes in this monkey wereof the CD8+ phenotype. Such an analysis was also performedon day 478 after SIV infection on circulating and lymph nodecells of both animals. In contrast to the results obtained 50 daysafter infusion, IFN-β-transduced cells did not consist mainly ofthe CD8+ phenotype and were equally distributed amongCD4+ and CD8+ T cells (Table 1).

Serum IFN subtypes

During primary infection, a peak of IFN-α production wasobserved in three macaques, high in macaques C1 and IFN1(2000 U}ml) and lower in macaque C3 (120 U}ml) (Table 2).Thereafter, IFN-α could only be detected at a low level(between 60 and 120 U}ml) in some serum samples ofmacaques C2 and IFN2. When analysing IFN-β production, weobserved the presence of IFN-β in some serum samples of thetwo infused monkeys, ranging from 60 to 120 U}ml, and

Table 2. IFN subtypes present in the sera of control andinfused macaques before and after SIV infection

IFN was measured as described in Methods. p.i., Post-infection ; ,not done ; , not determined due to the toxicity of the serum.

Amount of IFN (U/ml)

Time p.i. (days) C1 C2 C3 IFN1 IFN2

IFN-α®388 ! 60 ! 60 ! 60

®88

®4 ! 60 ! 60 ! 60

7 60 12014 2000 120 2000

21 60 60 ! 60

28 120 ! 60 ! 60194 ! 60 ! 60

279 ! 60 ! 60 ! 60293 120 ! 60 ! 60347 120 120386 ! 60 120

IFN-β®388

®88 ! 60 ! 60 120

®4 120

7 ! 60 ! 60 120

14 ! 60 ! 6021 ! 60 120

28 60 60

194 ! 60 120 60279 ! 60 120

293 ! 60

347 ! 60 120 ! 60386 120

1 2 3 4

IFN-β transgene

GAPDH

Fig. 4. RT–PCR analysis of the expression of the IFN-β transgene in PBL478 days after SIV infection. PBL from animals C1 (lane 1), C3 (2), IFN1(3) and IFN2 (4) were analysed. Total RNA was extracted by using theTriReagent kit (Sigma) and DNase-treated before synthesizing cDNA.Transcription from the construct was evidenced by using a sense primerlocated downstream of the H-2Kb promoter and upstream of the IFN-βstart codon and an antisense primer located downstream of the IFN-β stopcodon, generating a 660-bp fragment (45 cycles) as described inMethods. GADPH transcripts serve as an internal control.

RT–PCR analysis performed on day 478 after SIV infectionrevealed the presence of small amounts of transcripts specificfor the transgene in PBL of macaques IFN1 and IFN2 (Fig. 4,

CHEH

F. Matheux and othersF. Matheux and others

lanes 3 and 4, respectively). No IFN-β could be detected at anytime in the serum of control macaques C1 and C2. HoweverIFN-β was regularly detected at 60–120 U}ml in the serum ofmacaque C3. This surprising observation prompted us to lookfor the possible presence of IFN-β in the sera of all the monkeysbefore SIV infection. This revealed the presence of IFN-β in theserum of macaque C3 at a level identical to that observed afterinfection, but not in the sera of the other monkeys. RT–PCRanalysis revealed that, in the three control macaques, circulatingcells did not produce detectable levels of IFN-β (data notshown).

DiscussionThe IFN-β-transduced lymphocytes infused into the two

cynomolgus macaques (IFN1 and IFN2) were well toleratedand could still be detected in the circulation 552 days afterinfusion. After SIVmac251 infection of these infused macaques,virus replication was limited and disease progression wasdelayed, as opposed to two control, untreated animals.However, in the third control macaque, SIV replication waslimited to an extent comparable to the IFN-β-infused macaques ;this animal was characterized by constitutive IFN-β production,already present before SIV infection. The continuous presenceof IFN-β in the serum of macaque C3 points to the existence ofa site of production releasing this cytokine constantly into thecirculation. That no IFN-β mRNA could be detected in thelymphocytes of this macaque is in line with the fact thatlymphocytes produce only IFN-α and not IFN-β. In view of thestable level of IFN-β throughout the experiment in the serumof macaque C3, it is rather unlikely that this IFN-β productionresults from a chronic virus infection, which would give rise toa mixture of IFN-α and -β. Most studies on the cellular sourcesof IFN-β production have been done in mice and the only celltype in which evidence for constitutive IFN-β production hasbeen reported is the macrophage (De Maeyer & De Maeyer-Guignard, 1988). There are no data available in the literatureconcerning the presence of IFN-β in the serum of macaques. Inhumans, one study reported that no IFN-β was present in theserum of uninfected individuals (1±72³3±48 U}ml, n¯ 77 ;Minagawa et al., 1989).

SIV replication was reduced in IFN-β-infused macaques aswell as in the control macaque characterized by permanentIFN-β production and these three macaques maintained normallevels of CD4+ and CD8+ T cells during the 478 days ofobservation, as opposed to the two other control macaques.We are aware that the number of animals used in our study isnot sufficient to prove that IFN-β is responsible for this anti-SIV resistance and that several hypotheses such as geneticinfluences (Michael, 1999) or chemokines controlling infection(Lehner et al., 1996 ; Wang et al., 1998) could be invoked toexplain these data, but our results are in line with ourhypothesis. The production of IFN-β, directly in the lymphnodes, could enhance the antiviral resistance of the CD4+ T

transduced cells directly and, furthermore, could induce aprotective bystander effect on neighbouring untransducedcells, as demonstrated in vitro by the protection of neigh-bouring untransduced cells in culture (Matheux et al., 1999).Secondly, CD8+ cells are important immune effector cells forthe control of early viraemia in primate lentivirus infection, ashighlighted by at least two studies (Jin et al., 1999 ; Schmitz etal., 1999) that reported that depletion of CD8+ cells duringinfection led to uncontrolled viraemia. There is convincingevidence that IFN-β can boost the production and activity ofCD8+ memory cells, including cells displaying specific cyto-toxic activity against HIV-expressing cells, during primary andchronic HIV infection. In this respect, Tough et al. (1996) haveshown that, during the primary response to viruses, type I IFNacts as adjuvant and augments both the intensity of theresponse and the survival of early memory cells. Furthermore,during chronic infection, the survival of pre-existing memoryCD8+ T cells does not require continuous T cell receptorcontact with specific antigen but simply intermittent contactwith type I IFN released during intercurrent virus infections(Tough et al., 1996). Recently, Zhang et al. (1998) havedemonstrated that this property is mediated by IL-15. IFN-β isnot only able to maintain the survival of the memory CD8+

cells, but has been demonstrated to enhance HIV-specific CTLactivity mediated by RANTES via the chemokine receptorCCR3 (Hadida et al., 1999). Finally, IFN-β triggers the releaseof IFN-γ and IL-12, essential for controlling HIV replication(Clerici & Shearer, 1994 ; Vieillard et al., 1997). We havetherefore transduced both CD4+ and CD8+ cells, because ofthe benefits provided by the presence of the transgene in bothcell types.

Because of the well-known inhibitory effects of IFN on cellproliferation and haematopoiesis, as reviewed in De Maeyer &De Maeyer (1988), we looked into the possible effects of thepresence of IFN-β-transduced cells. We have assessed pre-viously that macaque lymphocytes that constitutively expresssmall amounts of IFN-β in vitro (3–10 U IFN-β per 10% cells per2 days) were not impaired in their proliferative potential andreplicated to the same extent as untransduced lymphocytes(Matheux et al., 1999). Furthermore, the control macaque C3,characterized by the presence of about 100 U}ml IFN-β in thecirculation, did not display any impairment of haematologicalvalues before SIV infection, indicating that this level of IFN-βproduction is compatible with normal haematopoiesis.

In summary, of the five infected macaques, the threecharacterized by continuous IFN-β production (IFN1, IFN2 andC3) were more resistant to SIV infection. We are well awarethat the number of animals used and the number of transducedlymphocytes were low and believe that further exploration ofan IFN-β-based anti-HIV gene therapy is warranted beforereaching definite conclusions. To this purpose, we are currentlydirecting our efforts towards the construction of high-titrevectors, with the aim of increasing the proportion of vector-transduced HIV target cells.

CHEI

Anti-SIV gene therapy with IFN-βAnti-SIV gene therapy with IFN-β

E. Lauret and F. Matheux contributed equally to this work. This workwas supported by the Centre National de la Recherche Scientifique, theInstitut Curie, the Agence Nationale de Recherches sur le SIDA (ANRS,Paris, France), the Commissariat a' l«Energie Atomique (CEA, Paris,France), the Centre de Recherches du Service de Sante! des Arme! es(CRSSA, La Tronche, France) and ‘Tous ensemble contre le SIDA«(SIDACTION, Paris, France). Franck Matheux was the recipient of afellowship from the Association Française contre les Myopathies(AFM, Evry, France). We thank Sophie Peyramaure for expert technicalassistance, Philippe Caufour and Olivier Neildez for their help during thestudy, Juana Wietzerbin for providing us with antibodies to Hu-IFN-γ andIon Gresser, William Vainchenker and Jean Louis Virelizier for criticallyreading the manuscript.

ReferencesBaca-Regen, L., Heinzinger, N., Stevenson, M. & Gendelman, H. E.(1994). Alpha interferon-induced antiretroviral activities : restriction ofviral nucleic acid synthesis and progeny virion production in humanimmunodeficiency virus type 1-infected monocytes. Journal of Virology68, 7559–7565.

Baltimore, D. (1988). Gene therapy. Intracellular immunization. Nature335, 395–396.

Belardelli, F. (1995). Role of interferons and other cytokines in theregulation of the immune response. APMIS 103, 161–179.

Cheret, A., Le Grand, R., Caufour, P., Dereuddre-Bosquet, N., Matheux,F., Neildez, O., Theodoro, F., Maestrali, N., Benveniste, O., Vaslin, B.& Dormont, D. (1996). Cytokine mRNA expression in mononuclearcells from different tissues during acute SIVmac251 infection of macaques.AIDS Research and Human Retroviruses 12, 1263–1272.

Clerici, M. & Shearer, G. M. (1994). The Th1–Th2 hypothesis of HIVinfection : new insights. Immunology Today 15, 575–581.

Coccia, E. M., Krust, B. & Hovanessian, A. G. (1994). Specific inhibitionof viral protein synthesis in HIV-infected cells in response to interferontreatment. Journal of Biological Chemistry 269, 23087–23094.

Cremer, I., Vieillard, V. & De Maeyer, E. (2000). Retrovirally mediatedIFN-β transduction of macrophages induces resistance to HIV, correlatedwith up-regulation of RANTES production and down-regulation of C-Cchemokine receptor-5 expression. Journal of Immunology 164, 1582–1587.

Daniel, M. D., Letvin, N. L., King, N. W., Kannagi, M., Sehgal, P. K.,Hunt, R. D., Kanki, P. J., Essex, M. & Desrosiers, R. C. (1985). Isolationof T-cell tropic HTLV-III-like retrovirus from macaques. Science 228,1201–1204.

De Maeyer, E. & De Maeyer-Guignard, J. (1988). Interferons and OtherRegulatory Cytokines. New York : John Wiley.

Desrosiers, R. C. (1990). The simian immunodeficiency viruses. AnnualReview of Immunology 8, 557–578.

Erhart, M. A., Piller, K. & Weaver, S. (1989). Polymorphism and geneconversion in mouse α-globin haplotypes. Genetics 115, 511–519.

Fall, L. S., M«Bika, J. P., Le Coq, H., Fouchard, M., Astgen, A., Bizzini,B., Gringeri, A., Santagostino, E., Burny, A., Zagury, D. & Chams, C.(1995). Biological effect of active anti-IFN-α immunization in HIV-infected patients. Biomedicine & Pharmacotherapy 49, 422–428.

Hadida, F., De Maeyer, E., Cremer, I., Autran, B., Baggiolini, M.,Debre! , P. & Vieillard, V. (1999). Acquired constitutive expression ofinterferon beta after gene transduction enhances human immuno-deficiency virus type 1-specific cytotoxic T lymphocyte activity by aRANTES-dependent mechanism. Human Gene Therapy 10, 1803–1810.

Hansen, B. D., Nara, P. L., Maheshwari, R. K., Sidhu, G. S., Bernbaum,J. G., Hoekzema, D., Meltzer, M. S. & Gendelman, H. E. (1992). Loss of

infectivity by progeny virus from alpha interferon-treated humanimmunodeficiency virus type 1-infected T cells is associated withdefective assembly of envelope gp120. Journal of Virology 66, 7543–7548.

Jin, X., Bauer, D. E., Tuttleton, S. E., Lewin, S., Gettie, A., Blanchard,J., Irwin, C. E., Safrit, J. T., Mittler, J., Weinberger, L., Kostrikis, L. G.,Zhang, L., Perelson, A. S. & Ho, D. D. (1999). Dramatic rise in plasmaviremia after CD8+ T cell depletion in simian immunodeficiency virus-infected macaques. Journal of Experimental Medicine 189, 991–998.

Kornbluth, R. S., Oh, P. S., Munis, J. R., Cleveland, P. H. & Richman,D. D. (1990). The role of interferons in the control of HIV replication inmacrophages. Clinical Immunology & Immunopathology 54, 200–219.

Lauret, E., Vieillard, V., Rousseau, V., De Maeyer-Guignard, J. & DeMaeyer, E. (1994). Exploring interferon beta for gene therapy of HIVinfection. Research in Immunology 145, 674–677.

Le Grand, R., Clayette, P., Noack, O., Vaslin, B., Theodoro, F., Michel,G., Roques, P. & Dormont, D. (1994). An animal model for antilentiviraltherapy : effect of zidovudine on viral load during acute infection afterexposure of macaques to simian immunodeficiency virus. AIDS Researchand Human Retroviruses 10, 1279–1287.

Lehner, T., Wang, Y., Cranage, M., Bergmeier, L. A., Mitchell, E., Tao,L., Hall, G., Dennis, M., Cook, N., Brookes, R., Klavinskis, L., Jones, I.,Doyle, C. & Ward, R. (1996). Protective mucosal immunity elicited bytargeted iliac lymph node immunization with a subunit SIV envelope andcore vaccine in macaques. Nature Medicine 2, 767–775.

Matheux, F., Le Grand, R., Rousseau, V., De Maeyer, E., Dormont, D.& Lauret, E. (1999). Macaque lymphocytes transduced by a con-stitutively expressed interferon beta gene display an enhanced resistanceto SIVmac251 infection. Human Gene Therapy 10, 429–440.

Michael, N. L. (1999). Host genetic influences on HIV-1 pathogenesis.Current Opinion in Immunology 11, 466–474.

Minagawa, T., Mizuno, K., Hirano, S., Asano, M., Numata, A.,Kohanawa, M., Nakane, A., Hachimori, K., Tamagawa, S., Negishi, M.and others (1989). Detection of high levels of immunoreactive humanbeta-1 interferon in sera from HIV-infected patients. Life Sciences 45,iii–vii.

Pantaleo, G. (1997). How immune-based interventions can change HIVtherapy. Nature Medicine 3, 483–486.

Piscitelli, S. C., Minor, J. R., Saville, M. W. & Davey, R. T., Jr (1996).Immune-based therapies for treatment of HIV infection. Annals ofPharmacotherapy 30, 62–76.

Poli, G., Orenstein, J. M., Kinter, A., Folks, T. M. & Fauci, A. S. (1989).Interferon-alpha but not AZT suppresses HIV expression in chronicallyinfected cell lines. Science 244, 575–577.

Schmitz, J. E., Kuroda, M. J., Santra, S., Sasseville, V. G., Simon, M. A.,Lifton, M. A., Racz, P., Tenner-Racz, K., Dalesandro, M., Scallon, B. J.,Ghrayeb, J., Forman, M. A., Montefiori, D. C., Rieber, E. P., Letvin,N. L. & Reimann, K. A. (1999). Control of viremia in simian immuno-deficiency virus infection by CD8­ lymphocytes. Science 283, 857–860.

Shirazi, Y. & Pitha, P. M. (1993). Interferon alpha-mediated inhibition ofhuman immunodeficiency virus type 1 provirus synthesis in T-cells.Virology 193, 303–312.

Tough, D. F., Borrow, P. & Sprent, J. (1996). Induction of bystander Tcell proliferation by viruses and type I interferon in vivo. Science 272,1947–1950.

Vieillard, V., Lauret, E., Rousseau, V. & De Maeyer, E. (1994). Blockingof retroviral infection at a step prior to reverse transcription in cellstransformed to constitutively express interferon beta. Proceedings of theNational Academy of Sciences, USA 91, 2689–2693.

Vieillard, V., Lauret, E., Maguer, V., Jacomet, C., Rozenbaum, W.,Gazzolo, L. & De Maeyer, E. (1995). Autocrine interferon-beta synthesis

CHEJ

F. Matheux and othersF. Matheux and others

for gene therapy of HIV infection : increased resistance to HIV-1 inlymphocytes from healthy and HIV-infected individuals. AIDS 9,1221–1228.

Vieillard, V., Cremer, I., Lauret, E., Rozenbaum, W., Debre, P., Autran,B. & De Maeyer, E. (1997). Interferon beta transduction of peripheralblood lymphocytes from HIV-infected donors increases Th1-typecytokine production and improves the proliferative response to recallantigens. Proceedings of the National Academy of Sciences, USA 94,11595–11600.

Vieillard, V., Jouveshomme, S., Leflour, N., Jean-Pierre, E. Debre, P.,De Maeyer, E. & Autran, B. (1999). Transfer of human CD4+ Tlymphocytes producing beta interferon in Hu-PBL-SCID mice controlshuman immunodeficiency virus infection. Journal of Virology 73, 10281–10288.

Wang, Y., Tao, L., Mitchell, E., Bogers, W. M. J. M., Doyle, C., Bravery,C. A., Bergmeier, L. A., Kelly, C. G., Heeney, J. L. & Lehner, T. (1998).Generation of CD8 suppressor factor and β chemokines, induced byxenogeneic immunization, in the prevention of simian immunodeficiencyvirus infection in macaques. Proceedings of the National Academy of Sciences,USA 95, 5223–5228.

Zhang, L., He, T., Huang, Y., Chen, Z., Guo, Y., Wu, S., Kunstman,K. J., Brown, R. C., Phair, J. P., Neumann, A. U., Ho, D. D. & Wolinsky,S. M. (1998). Chemokine coreceptor usage by diverse primary isolates ofhuman immunodeficiency virus type 1. Journal of Virology 72, 9307–9312.

Received 4 April 2000; Accepted 24 July 2000

CHFA