Searching for Genes Responsible for Patulin Degradation in a Biocontrol Yeast Provides Insight into the Basis for Resistance to This Mycotoxin

Published Ahead of Print 1 March 2013. 10.1128/AEM.03851-12.

2013, 79(9):3101. DOI:Appl. Environ. Microbiol. Mannina, R. Ferracane, A. Ritieni and R. CastoriaG. Ianiri, A. Idnurm, S. A. I. Wright, R. Durán-Patrón, L. Resistance to This MycotoxinProvides Insight into the Basis forPatulin Degradation in a Biocontrol Yeast Searching for Genes Responsible for

http://aem.asm.org/content/79/9/3101Updated information and services can be found at:

These include:

SUPPLEMENTAL MATERIAL Supplemental material

REFERENCEShttp://aem.asm.org/content/79/9/3101#ref-list-1at:

This article cites 81 articles, 25 of which can be accessed free

CONTENT ALERTS more»articles cite this article),

Receive: RSS Feeds, eTOCs, free email alerts (when new

http://journals.asm.org/site/misc/reprints.xhtmlInformation about commercial reprint orders: http://journals.asm.org/site/subscriptions/To subscribe to to another ASM Journal go to:

on June 12, 2014 by guesthttp://aem

.asm.org/

Dow

nloaded from


.asm.org/

Dow

nloaded from

http://aem.asm.org/content/79/9/3101

http://aem.asm.org/content/suppl/2013/04/09/AEM.03851-12.DCSupplemental.html

http://aem.asm.org/content/79/9/3101#ref-list-1

http://aem.asm.org/cgi/alerts

http://journals.asm.org/site/misc/reprints.xhtml

http://journals.asm.org/site/subscriptions/

http://aem.asm.org/

http://aem.asm.org/

Searching for Genes Responsible for Patulin Degradation in aBiocontrol Yeast Provides Insight into the Basis for Resistance to ThisMycotoxin

G. Ianiri,a,b A. Idnurm,b S. A. I. Wright,a* R. Durán-Patrón,c L. Mannina,d,g R. Ferracane,e A. Ritieni,f* R. Castoriaa

Dipartimento di Agricoltura, Ambiente e Alimenti, Facoltà di Agraria, Università degli Studi del Molise, Campobasso, Italya; Division of Cell Biology and Biophysics, Schoolof Biological Sciences, University of Missouri—Kansas City, Kansas City, Missouri, USAb; Departamento de Química Orgánica, Facultad de Ciencias, Universidad de Cádiz,Puerto Real, Cádiz, Spainc; Dipartimento di Chimica e Tecnologie del Farmaco, Sapienza Universita’ di Roma, Rome, Italyd; Istituto di Metodologie Chimiche, Laboratorio diRisonanza Magnetica Annalaura Segre, CNR, Monterotondo, Rome, Italyg; Dipartimento di Scienza degli Alimenti, Università di Napoli Federico II, Parco Gussone, Portici,Italye; Dipartimento di Chimica Farmaceutica e Tossicologica, Università di Napoli Federico II, Naples, Italyf

Patulin is a mycotoxin that contaminates pome fruits and derived products worldwide. Basidiomycete yeasts belonging to thesubphylum Pucciniomycotina have been identified to have the ability to degrade this molecule efficiently and have been exploredthrough different approaches to understand this degradation process. In this study, Sporobolomyces sp. strain IAM 13481 wasfound to be able to degrade patulin to form two different breakdown products, desoxypatulinic acid and (Z)-ascladiol. To gaininsight into the genetic basis of tolerance and degradation of patulin, more than 3,000 transfer DNA (T-DNA) insertional mu-tants were generated in strain IAM 13481 and screened for the inability to degrade patulin using a bioassay based on the sensitiv-ity of Escherichia coli to patulin. Thirteen mutants showing reduced growth in the presence of patulin were isolated and furthercharacterized. Genes disrupted in patulin-sensitive mutants included homologs of Saccharomyces cerevisiae YCK2, PAC2, DAL5,and VPS8. The patulin-sensitive mutants also exhibited hypersensitivity to reactive oxygen species as well as genotoxic and cellwall-destabilizing agents, suggesting that the inactivated genes are essential for tolerating and overcoming the initial toxicity ofpatulin. These results support a model whereby patulin degradation occurs through a multistep process that includes an initialtolerance to patulin that utilizes processes common to other external stresses, followed by two separate pathways fordegradation.

Contamination of food and feed by fungal metabolites knownas mycotoxins is a global health issue. These metabolites are

harmful to humans and include compounds like aflatoxins, tri-chothecenes, and other mycotoxins that represent a serious healthhazard. Patulin (4-hydroxy-4H-furo[3,2c]pyran-2[6H]-one) is amycotoxin that was first isolated from Aspergillus clavatus andstudied in the early 1940s (1, 2). Initial interest in this moleculewas due to its antibacterial activity, and its investigation featuredsuch pioneers in the development of antimicrobial agents as theNobel laureates Selman Waksman, Howard Florey, and ErnestChain (see early discoveries in references 3 and 4). However, bythe 1950s, it was revealed that patulin is also toxic to plants andanimals, and its use as a drug to treat bacterial diseases was aban-doned. Since then, research has focused on how to eliminate thistoxin. Patulin is produced by a suite of species in the fungal generaAspergillus and Penicillium. Penicillium expansum is the causativeagent of the blue mold disease of stored apples. The most commonsource of human exposure to patulin is apple juice, which has ledto regulations of maximum tolerable levels in most countries.These levels are set at 50 ppb in the United States, the world’sprimary consumer of apple juice. The same level is set by theEuropean Union, with an additional maximum tolerable level at10 ppb in the case of baby food.

Currently, the main approach to reduce patulin accumulationin stored pome fruits is the control of P. expansum infections bysynthetic fungicides (5). However, chemical control is increas-ingly limited because of environmental and toxicological risks aswell as the onset of fungicide-resistant strains of fungal pathogens.Therefore, alternative or integrative measures are of growing im-

portance to control P. expansum infection on apples and pears andpatulin accumulation in these fruits. Biocontrol of fungal patho-gens by beneficial microorganisms is one promising approach.For example, two biocontrol agents (BCAs), the basidiomyceteyeasts Rhodosporidium kratochvilovae LS11 (originally namedRhodotorula glutinis) and Cryptococcus laurentii LS28, were effec-tive in reducing the incidence of blue mold on apples with differ-ent mechanisms of action (6–8). The combination of these BCAswith food-grade additives or low doses of recently developed fun-gicides resulted in a significant rot reduction and in lower patulincontamination in apples (9, 10).

Besides prevention of P. expansum attack on stored apples,strategies to detoxify patulin may also contribute to providingsafer juice for consumption. In the last decade, a few studies in-vestigated the effect on patulin accumulation by BCAs that are

Received 12 December 2012 Accepted 25 February 2013

Published ahead of print 1 March 2013

Address correspondence to G. Ianiri, [email protected], or R. Castoria,[email protected].

* Present address: S. A. I. Wright, Department of Electronics, Mathematics andNatural Sciences, University of Gävle, Gävle, Sweden; A. Ritieni, Dipartimento diFarmacia, Università di Napoli Federico II, Naples, Italy.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.03851-12.

Copyright © 2013, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AEM.03851-12

May 2013 Volume 79 Number 9 Applied and Environmental Microbiology p. 3101–3115 aem.asm.org 3101


.asm.org/

Dow

nloaded from

http://dx.doi.org/10.1128/AEM.03851-12



http://aem.asm.org

http://aem.asm.org/

effective against P. expansum. Pichia ohmeri (11), Candida sakeand Pantoea agglomerans (12), and several Lactobacillus species(13) were able to reduce patulin accumulation in vitro. These stud-ies excluded the metabolism of patulin by these microorganisms,and the observed reduction was attributed to the protection offruits from infection by patulin-producing P. expansum and/or tothe decrease of mycotoxin production. The only case of metabo-lism of patulin by a BCA was reported by Castoria et al. (14). Theseauthors showed that the BCA R. kratochvilovae LS11, a basidiomy-cete red yeast belonging to the subphylum Pucciniomycotina, wasable to resist and degrade a high concentration of patulin both invitro and in a model system mimicking P. expansum-infected ap-ple tissue (8, 14). Intriguingly, it has been recently reported thatpatulin is a pathogenicity factor of P. expansum (15), suggestingthat patulin degradation may itself be considered a mechanism ofbiocontrol.

A major consideration in the biodegradation of mycotoxins isthat degradation products are less toxic than the original com-pound (or, preferably, not toxic at all) (16). The major patulindegradation product formed in vitro by R. kratochvilovae LS11 wasidentified as desoxypatulinic acid (DPA), which was reported tobe nontoxic to different microorganisms (17, 18) and to culturedhuman lymphocytes (19). Additional mechanisms that result inbreakdown of patulin exist but do not generate DPA, as has beenreported for Saccharomyces cerevisiae during fermentation of ap-ple juice (20) and for the bacterium Gluconobacter oxydans (21).In both cases, the products formed are two different isomers ofascladiol, (E)-ascladiol and (Z)-ascladiol. Limited data exist onthe toxicity of ascladiol; it may still retain a quarter of the toxicityof patulin (22). The chemical structures of patulin, (E)-ascladiol,(Z)-ascladiol, and DPA are shown in Fig. 1.

The mechanisms of patulin toxicity and its effects on livingcells have been explored and recently reviewed (4, 23). The targetsseem numerous and nonspecific. The main targets of patulin arecellular nucleophiles (24). Patulin induces oxidative stress by low-ering the concentration of the antioxidant peptide glutathione, towhich it binds due to its electrophilic reactivity, and through gen-eration of reactive oxygen species (ROS) (25, 26). ROS generationplays a role in the molecular events leading to apoptotic processesparticularly by inducing peroxidation of membrane lipids andoxidative DNA damage (27–29). Furthermore, global analysis ofS. cerevisiae genes transcribed 2 h after exposure to patulin re-vealed that 8.2% of the genome was upregulated more than 2-foldand 7.5% was downregulated below a 1.5 threshold (30). This studyfurther confirmed the broad effects of this mycotoxin. It also re-vealed, through cluster analysis, that the regulatory profile in re-sponse to patulin was most closely related to that of the dithiocar-bamates, which are suspected to act by inducing oxidative stress (30).

Despite the extensive research on patulin and its current im-portance in food safety, nothing is known about the genes thatprotect organisms against patulin or may degrade this mycotoxin.The original aim of this study was to examine the genetic basis ofpatulin metabolism in the BCA R. kratochvilovae strain LS11 usingan insertional mutagenesis approach. For this purpose, binaryvectors that had been successfully used for transforming the ba-sidiomycete yeast Cryptococcus neoformans (31–33) were testedfor Agrobacterium tumefaciens-mediated and biolistic transforma-tion of strain LS11. No transformants were obtained, and onlyrecently has the challenge of transformation of this species beenresolved (34). Consequently, we examined the basis for patulinmetabolism in another red yeast species, Sporobolomyces sp. strainIAM 13481. The genome of this strain has been sequenced, and itcan be transformed to generate mutants (35). In this study, we firstdemonstrate that this fungus is able to degrade patulin in a similarway to R. kratochvilovae LS11. Second, transfer DNA (T-DNA)insertional mutants generated in strain IAM 13481 were screenedfor their ability to degrade patulin, and mutants exhibiting slowerpatulin degradation were characterized through gene identificationand other phenotypes. These results provide new insights into howpotential biocontrol agents can tolerate and then degrade this com-mon mycotoxin.

MATERIALS AND METHODSStrains used in this study. The strains used in this study are listed inTable 1. Sporobolomyces sp. IAM 13481 was used as the wild type for genefunction studies. This strain has a complete genome sequence available atthe Joint Genome Institute of the U.S. Department of Energy, and forwardand reverse genetic tools to mutate genes were recently developed (35).The strain DH5� of Escherichia coli was used in a bioassay previouslydeveloped for preliminary evaluation of patulin degradation (18) in acollection of Sporobolomyces sp. strains. The strain 7015 of P. expansumwas used for patulin production. The strain FY834 of S. cerevisiae (36) wasused for the S. cerevisiae in vivo recombination system with plasmidpRS426 (37) (see below for details).

Agrobacterium-mediated transformation. For Agrobacterium-medi-ated transformation (AMT), the strain EHA105 containing the binaryvector pAIS4 was used to transform the uracil auxotrophic strain AIS2,which was isolated previously and characterized as bearing a 129-bp de-letion in the URA5 gene. This plasmid pAIS4 contains the Sporobolomycessp. URA5 gene between the right and the left borders of the T-DNA (35).Overnight cultures of cells of A. tumefaciens (grown in Luria Bertani plus50 mg/liter kanamycin) and cells of the auxotroph AIS2 (grown in yeastextract-peptone-dextrose [YPD], 20 g/liter Bacto peptone, 10 g/liter yeastextract, 20 g/liter glucose) were adjusted to an optical density at 600 nm(OD600) of 0.6. Four mixes of 200 �l, which included fungal and bacterialcells at an OD600 of 0.6 or diluted further to a 1/10 concentration mixed inequal proportions, were spotted directly onto induction medium agarcontaining 100 �M acetosyringone (38). After 2 days of coincubation, the

FIG 1 Structures of patulin, (E)-ascladiol, (Z)-ascladiol, and desoxypatulinic acid (DPA).

Ianiri et al.

3102 aem.asm.org Applied and Environmental Microbiology


.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

mixes of cultures were transferred to 20 ml of liquid yeast nitrogen base(YNB) and centrifuged at 2,000 rpm for 5 min. The supernatant, consist-ing primarily of Agrobacterium cells, was discarded and the pelleted cellswere plated onto YNB agar plates supplemented with cefotaxime (200�g/ml) to inhibit bacterial growth. Colonies appeared after 4 days ofgrowth at room temperature.

Patulin. Patulin was produced by P. expansum strain 7015 and puri-fied as described by Castoria et al. (19) with slight modifications. Briefly,P. expansum was inoculated in potato dextrose broth (PDB) mediumdiluted with H2O to a final ratio of 1:10 and incubated at 24°C for 7 dayson an orbital shaker. The medium was extracted twice with ethyl acetate,the extract was dried over anhydrous Na2SO4, and the solvent was evap-orated under reduced pressure. The residue was purified by column chro-matography on Silica gel (Merck, Darmstadt, Germany) using hexane/ethyl acetate as the mobile phase. Commercial patulin (A.G. Scientific,San Diego, CA) was used as the reference standard. The stock solutions ofpurified patulin were prepared in ethyl acetate and stored at �20°C. Theamount of purified patulin was determined by high-performance liquidchromatography (HPLC) by comparing the peak area with that of knownamounts of the reference standard. Working solutions of patulin to beused in the experiment were prepared by evaporating a calculated amountof the stock solution and by redissolving the mycotoxin in an appropriatevolume of Lilly-Barnett medium (LiBa; 10.0 g of D-glucose, 2.0 g of L-as-paragine, 1.0 g of KH2PO4, 0.5 g of MgSO4·7 H2O, 0.01 mg of FeSO4·7H2O, 8.7 mg of ZnSO4·7 H2O, 3.0 mg of MnSO4·H2O, 0.1 mg of biotin,and 0.1 mg of thiamine per liter) (39) to obtain the desired concentration.

Incubation of Sporobolomyces sp. IAM 13481 with patulin and anal-yses of mycotoxin fate. The analysis of patulin persistence in LiBa me-dium was performed as described by Castoria et al. (14, 19) with minormodifications. Sporobolomyces sp. IAM 13481 was grown overnight in 50ml of LiBa medium in shake cultures at 24°C. The culture was centrifugedfor 5 min at 4,000 rpm, the cells were resuspended in LiBa, and theirconcentration was adjusted to 1 � 107 CFU/ml. Three milliliters of thissuspension was incubated on an orbital shaker for 10 days at 24°C in25-ml flasks in the presence of 100 �g/ml of patulin. Controls were LiBamedium with 100 �g/ml of patulin inoculated with autoclaved cells ofSporobolomyces sp. IAM 13481, LiBa without patulin inoculated withSporobolomyces sp. IAM 13481 at the same cell concentration as reportedabove, and uninoculated LiBa with patulin (100 �g/ml). Growth wasmonitored on a daily basis by reading the OD at 595 nm in a microplate

reader (Bio-Rad Laboratories, Hercules, CA) (40). At the same timepoints, the time course of patulin degradation was monitored by thin-layer chromatography (TLC) and high-performance liquid chromatogra-phy (HPLC).

TLC and HPLC analyses. TLC qualitative analysis was performed aspreviously described (14). Samples were centrifuged at 14,000 rpm for 5min to pellet the cells, and the supernatant was extracted twice with ethylacetate adjusted to pH 2. Extracted samples were dried under a nitrogenstream, resuspended in 10 �l of ethyl acetate, and loaded on aluminum-backed silica gel 60 F254 plates (EMD Chemicals, Gibbstown, NJ). Chro-matography was performed at room temperature in glass tanks by usingtoluene/ethyl acetate/formic acid at a 5:4:1 (vol/vol/vol) ratio as the sol-vent system. After development, plates were dried, observed, and photo-graphed under UV light (� � 254 nm).

Quantitative analysis of patulin and breakdown products formed bySporobolomyces sp. IAM13481 was performed by HPLC as described byMacDonald et al. (41) with slight modifications. Three samples per timepoint were centrifuged, filter sterilized, and injected for analysis. TheHPLC apparatus was a Dionex (Sunnyvale, CA) analytical system consist-ing of a P680 solvent delivery system and a 20-�l injector loop (Rheodyne,Cotati). The UVD170 detector (Dionex, Sunnyvale) set at 276 nm wasconnected to a data integration system (Dionex Chromeleon version 6.6).For analysis of patulin incubated with the T-DNA insertional mutants, theapparatus was a Kontron HPLC analytical system (Kontron, Milan, Italy)(325 apparatus) equipped with a 20-�l loop and autosampler (HPLC360). The UV detector (HPLC 335) set at 276 nm was connected to a dataintegration system. In all HPLC analyses, an Agilent Zorbax C18 columnwas used (250-mm length, 4.6-mm internal diameter, 5-�m particle size;Agilent Technologies Italia, Milan, Italy), and the mobile phase was wateracidified with 1% acetic acid (vol/vol) and methanol (95:5 [vol/vol]). Theflow rate was 1 ml/min, and the total run time was 20 min. Serial dilutionsof the patulin standard in LiBa medium were injected, and the peak areaswere determined to generate a standard curve for quantitative analyses.Quantification of desoxypatulinic acid (DPA) and ascladiols was carriedout as described for patulin, following purification and nuclear magneticresonance (NMR) characterization (see below) from a culture of Sporobo-lomyces sp. IAM 13481 incubated with the mycotoxin. Data from theexperiments were expressed as �g/ml of patulin, desoxypatulinic acid,and ascladiols � standard deviations (n � 9).

TABLE 1 Strains and plasmids used in this study

Strain or plasmid Genotype/features Purpose/comments Reference(s) Source

StrainsSporobolomyces sp. IAM 13481 Wild type Reference strain in patulin degradation

assays82 FGSCa

AIS2 ura5 auxotroph Transformation recipient 35 FGSCAgrobacterium tumefaciens

EHA105 � pAIS4pAIS4 Agrobacterium transformation 35 FGSC

Escherichia coli DH5� F� 80dlacZ M15 (lacZYA-argF)U169 deoR recA1endA1 hsdR17(rK�, mK�) phoA upE44 �� thi-1gyrA96 relA1

Bioassay for evaluation of the ability ofinsertional mutants to degradepatulin

18, 83 FGSC

Penicillium expansum 7015 Wild type Patulin production 7 DiAAAb

Saccharomyces cerevisiaeFY834

MAT� his3200 ura3-52 leu21 lys2202 trp163 Recipient transformation strain forgeneration of the vps8::URA5construct for VPS8 deletion

36 FGSC

PlasmidspAIS4 Sporobolomyces sp. URA5 in pPZP-201BK Agrobacterium transformation 35 FGSCpRS426 S. cerevisiae URA3 in pRS420 Plasmid RS426 digested with XbaI and

EcoRI for generation of the vps8::URA5 construct

37 FGSC

a FGSC, Fungal Genetics Stock Center, University of Missouri—Kansas City, Kansas City, MO, USA (44).b DiAAA, Dipartimento di Agricoltura, Ambiente e Alimenti, Facoltà di Agraria, Università degli Studi del Molise, Campobasso, Italy.

Insight on Patulin Resistance in Sporobolomyces spp.

May 2013 Volume 79 Number 9 aem.asm.org 3103


.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

Purification of the biodegradation products of patulin for NMRanalysis. For the characterization of the main products of patulin degra-dation, 300 ml of LiBa supplemented with 100 �g/ml of patulin was in-oculated with Sporobolomyces sp. IAM 13481 as described above and in-cubated on a rotary shaker at 24°C. The degradation process wasmonitored by TLC analysis. At the sixth day of incubation, when the twoproducts with retention factors (Rf) of 0.45 and 0.25 were clearly detect-able on TLC plates, culture filtrates were centrifuged at 4,000 rpm for 10min, filter sterilized (0.22-�m filters) and lyophilized. Samples were thenresuspended in acidified water, pH 4, and centrifuged at 13,200 rpm for 3min at 4°C.

The patulin degradation products were purified using an HPLC appa-ratus equipped with two LC-20AD class VP pumps, an SPD-20A UV/VISdetector set at 276 nm, and an SIL-20A autosampler (Shimadzu, Kyoto,Japan). A Phenomenex Luna C18 100 A column was used (250-mmlength, 10.0-mm internal diameter, 5-�m particle size; Phenomenex,Torrance, CA). The mobile phase was acidified water (with 0.1% aceticacid [vol/vol]) and methanol (95:5 [vol/vol]) with a flow rate of 4 ml/minand a total run time of 18 min. Seventy aliquots of 200 �l were injected.Multiple fractions were pooled, and the solvent was evaporated underreduced pressure. After drying, the weight of the purified samples wasdetermined as 4.40 mg for the compound with a retention time (Rt) � of7.74 min [corresponding to (Z)-ascladiol] and 4.60 mg for that with an Rtof 10.65 min (corresponding to desoxypatulinic acid). Prior to NMR ex-periments, samples with Rt of 7.74 min and 10.65 min were dissolved indimethyl sulfoxide (DMSO)-D6 (700 �l) and in D2O with 0.17 M deuter-ated acetic acid (19), respectively.

1H NMR experiments were recorded at 300 K on a BrukerAVANCE600 spectrometer (Bruker BioSpin Gmbh; Rheinstetten, Ger-many) operating at the proton frequency of 600.13 MHz (B0 � 14.1 T)and equipped with a Bruker multinuclear Z gradient 5-mm probe head.The 1H spectra were acquired in order to have a good signal-to-noise ratioand a good spectral resolution. The 1H spectrum of the sample with an Rtof 7.74 min in DMSO-D6 was referred to the residual 1H signal of thesolvent set at 2.5 ppm, whereas the 1H spectrum of sample with an Rt of10.65 min was referred to the residual 1H signal of CHD2COOD set at2.08 ppm.

Screening Agrobacterium-mediated transformants for patulin deg-radation. Transformants were transferred from the original plates ontoYPD agar and then tested for their ability to degrade patulin. A bioassaywas used based on the sensitivity of E. coli DH5� to patulin and its insen-sitivity to the mycotoxin breakdown products. Experiments were per-formed in 96-well plates. Transformants were inoculated in 100 �l of LiBamedium supplemented with 100 �g/ml of patulin using sterile toothpicks.Seven days later, the 96-well plates were centrifuged at 5,500 rpm for 15min and the supernatants were kept on ice until use. The bioassay consistsof an overlay of Luria Bertani (LB) soft agar (0.7% [wt/vol]) inoculatedwith E. coli DH5�. A culture of E. coli grown in LB was allowed to reach anOD600 of 0.2 (corresponding to 2.0 � 107 CFU/ml). Cells were centri-fuged, resuspended in an equal volume of phosphate-buffered saline(PBS), pH 7.4, and diluted 10-fold in PBS. Seven milliliters of this suspen-sion was added to 73 ml of melted LB soft agar precooled to 50°C, mixed,and poured into petri dishes (diameter of 140 mm). Forty microliters ofculture supernatant from transformants grown in the presence of patulinwas spotted on the petri dishes. The plates were subsequently incubatedovernight at 37°C. Transformants impaired in patulin degradation wereidentified by a zone of inhibition of E. coli DH5�, which was due toundegraded or partially degraded patulin in their culture filtrate.

The results obtained with the bioassay were confirmed in a largervolume for those transformants whose supernatants had caused inhibi-tion of E. coli growth. Experiments were performed in 15-ml tubes con-taining 500 �l of LiBa or the same volume of LiBa supplemented with 100�g/ml of patulin. Cultures were incubated at 24°C on an orbital shaker.The growth of each strain in the presence and in the absence of patulin wasmonitored by measuring the OD at 595 nm in a microplate reader. On the

sixth day of incubation, HPLC analyses of patulin were performed accord-ing to the conditions reported above. Data from the experiments wereexpressed as �g/ml of patulin, desoxypatulinic acid, and ascladiols �standard deviations (n � 9).

Molecular characterization of insertional mutants. Genomic DNAof Sporobolomyces sp. strains was extracted from freeze-dried cells ob-tained after overnight culture in 50 ml of liquid YPD medium (42). Toestimate the minimum number of T-DNA insertions, DNA was digestedwith the restriction enzyme ClaI, which does not cut inside the T-DNA.Digested DNA was resolved on a 0.8% agarose 1� Tris-acetate-EDTA(TAE) gel and blotted to a Zeta-Probe membrane (Bio-Rad, Hercules,CA). The membrane was hybridized with the T-DNA region of binaryvector pAIS4, obtained by means of PCR with the universal primers M13Fand M13R, and radiolabeled with [32P]dCTP using the AmershamRediprime II kit (GE Healthcare, Piscataway, NJ).

Inverse PCR was used to determine regions flanking the T-DNA in-sertions in strains of interest as previously described (35). Briefly, 2 to 5 �gof genomic DNA was digested with an individual restriction enzyme (seebelow) and self-ligated with T4 DNA ligase, and then the ligation reactionproducts were used as templates in PCR. Primers ai76 and ai77 were usedfor genomic DNA digested with the restriction enzyme ClaI or NdeI (nei-ther enzyme cuts inside the T-DNA). In situations in which the restrictionenzymes cut inside the T-DNA region (EcoRI, BglII, and KpnI were mostoften used), primer combinations were ai76 with the M13F primer andai77 with the M13R primer. The PCR products were precipitated or gelpurified and directly sequenced. The sequences were used for BLASTncomparisons with the Sporobolomyces sp. IAM 13481 genome database.Sporobolomyces predicted proteins were used in BLASTp searches of theGenBank database, the Saccharomyces Genome Database, and the Cryp-tococcus neoformans var. grubii H99 database to identify homologs andinfer functions.

For targeted gene replacement, the Sporobolomyces VPS8 gene wasmutated by homologous recombination. The 5= and 3= fragments of theVPS8 gene were amplified from genomic DNA with primer pairs GI0005-GI0002 and GI0003-GI0006, respectively, and the URA5 gene was ampli-fied with primer pair ALID0562-ALID0564 from plasmid pAIS4 (35). Thethree fragments were fused together with plasmid pRS426 using the S.cerevisiae in vivo recombination system and strain FY834 (43), which wereprovided by the Fungal Genetics Stock Center (44). The construct wasamplified with primer pair ALID0917-ALID0918 from DNA purifiedfrom S. cerevisiae transformants, coated on gold beads, and transformedwith a Bio-Rad particle delivery system into the ura5 auxotroph strainAIS2 plated on YNB medium supplemented with 1 M sorbitol. Strainswith a disrupted VPS8 gene were confirmed by PCR and Southern blotanalysis. The sequences of the primers used in this study are provided inTable 2.

Stress sensitivity tests. For sensitivity tests, strains were serially di-luted 10-fold in liquid YPD and spotted (in a volume of 2.5 �l) onto solidYPD agar containing one of the following compounds: 2 mM hydrogenperoxide (H2O2), 2.5 mM diamide [diazenedicarboxylic acid bis(N,N-dimethylamide)], 0.1 mM menadione, 0.4 mM tert-butyl hydroperoxide(tBOOH), and 0.1 mM cumene hydroperoxide (CHP) for the oxidativestress; 1 mM cadmium sulfate (CdSO4) for genotoxic stress or proteindamage; 0.8 mg/ml caffeine, 0.015% (wt/vol) sodium dodecyl sulfate(SDS), 0.6% (wt/vol) Congo red, 0.9 M KCl, and 1 M NaCl to test plasmamembrane and cell wall integrity. Experiments were performed threetimes.

RESULTSSporobolomyces sp. IAM 13481 degrades patulin to produceboth desoxypatulinic acid and ascladiols. Patulin degradation bySporobolomyces sp. IAM 13481 was examined by inoculating theyeast in LiBa medium with or without patulin (Fig. 2A). The pres-ence of patulin drastically affects the growth of the yeast. In par-ticular, while the growth of control cells reached its maximum

Ianiri et al.



.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

OD595 value on the third day of incubation, the growth of patulin-treated cells was characterized by a 4-day lag phase and reached itsmaximum value on the seventh day of incubation. Interestingly,from the fifth day of incubation, TLC analysis showed the appear-ance of two major spots, with Rf of 0.46 and 0.25, in the lanescorresponding to Sporobolomyces sp. IAM 13481 plus patulin. Inall lanes in which these spots appeared, the greater their intensitythe lower the intensity of the patulin spot. Conversely, at the lasttime point, only the spot of patulin (Rf � 0.56) was visible in thelanes corresponding to the mycotoxin incubated in uninoculatedLiBa medium and incubated with autoclaved cells of Sporobolo-myces sp. (data not shown). These results demonstrate that strainIAM 13481 can degrade patulin.

Figure 2B reports the quantitative results of patulin and break-down products in time-course HPLC analyses, and Fig. 3 showstypical chromatograms on which the quantitative results in Fig. 2Bare based. In the presence of viable yeast cells, the reduction of thepatulin peak (Rt � 9.93) in the chromatograms paralleled theappearance of three new peaks with Rt of 6.78, 7.74, and 10.65min. At the last time point, no patulin was detected and only thepeaks with Rt of 7.74 and 10.65 min were still detected. The peakswith Rt ranging from 1.5 to 5.2 min originated from yeast metab-olism since they were also detected when Sporobolomyces sp. wasincubated in medium in the absence of patulin (data not shown).

The products with Rt of 6.78 and 7.74 min (both correspond-ing to an Rf of 0.25 on TLC plates) were identified as (E)-ascladioland (Z)-ascladiol, respectively, by comparing the retention timesand UV spectra of these peaks with those of purified ascladiolsobtained from a culture of G. oxydans incubated with patulin (21)and by NMR analyses. The 1H NMR spectrum of the product withan Rt of 7.74 in DMSO-d6 showed the presence of a multiplet at �6.19 ppm, a triplet (J � 6.8 Hz) at � 5.55 ppm, and two doublets at� 4.64 (J � 1.7 Hz) and 4.37 (J � 6.8 Hz) ppm, which correspondto C3H, C6H, C8H2, and C7H2, respectively, of (Z)-ascladiol (21).The product with an Rf of 0.46 and an Rt of 10.65 min was iden-tified as desoxypatulinic acid (DPA) by comparing the NMR datawith those obtained in a previous study (19).

Screening and identification of insertional mutants with re-duced patulin degradation activity. A total of 3,024 T-DNAtransformants were generated and screened for their ability todegrade patulin. A higher-throughput bioassay that is less time-consuming than TLC was used as the preliminary screen to rapidlydetect the persistence of patulin in culture supernatants (18).Transformants were grown in LiBa medium containing patulin,and aliquots of the supernatant were dropped onto freshly sownlawns of E. coli. Patulin inhibits E. coli growth, so any zone ofinhibition suggested that the Sporobolomyces sp. T-DNA mutantwas hindered in the degradation of patulin. Only 13 out of 3,024

TABLE 2 Primers used in this studya

Name Sequence (5= to 3=) Purpose

M13F GTAAAACGACGGCCAG Probe generation from plasmid pAIS4M13R ACAGGAAACAGCTATGAC Probe generation from plasmid pAIS4ai76 AACAGTTGCGCAGCCTGAATG Inverse PCRai77 AGAGGCGGTTTGCGTATTGG Inverse PCRALID0562 TCTCTCCCTGGAAAGACC Amplification of 5= URA5 flankALID0564 AACCCTTCGTTCTACTTG Amplification of 3= URA5 flankGI0005 GTAACGCCAGGGTTTTCCCAGTCACGACGGCGATCTCCCAGGATCACAC Amplification of 5= VPS8 flankGI0002 GGTCTTTCCAGGGAGAGAGGCATAGAAATCATTCGA Amplification of 5= VPS8 flankGI0003 CAAGTAGAACGAAGGGTTCAAGAACTCGCCGCAACG Amplification of 3= VPS8 flankGI0006 GCGGATAACAATTTCACACAGGAAACAGCCTTGGAAGAGAGCGAGAG Amplification of 3= VPS8 flankALID0917 GTTTTCCCAGTCACGACG Amplification of 5= flank of the construct for

gene replacementALID0918 TTTCACACAGGAAACAGC Amplification of 3= flank of the construct for

gene replacementa Underlined regions in primers GI0002 and GI0003 are homologous to the primers ALID0562 and ALID0564 used to amplify the flanks of the URA5 selectable marker. Sequencesin italics in primers GI0005 and GI0006 are homologous to the primers ALID0917 and ALID0918 used to amplify the gene replacement construct vps8::URA5 from S. cerevisiaetransformants.

FIG 2 (A) Growth rate of Sporobolomyces sp. strain IAM 13481 in LiBa medium and LiBa medium supplemented with 100 �g/ml of patulin. (B) Time course ofpatulin decrease (black line) and breakdown product formation (gray lines) on LiBa medium spiked with patulin at 100 �g/ml, inoculated with Sporobolomycessp. strain IAM 13481, and incubated for 10 days on a rotary shaker at 24°C. Pat, patulin; E ascl, (E)-ascladiol; Z ascl, (Z)-ascladiol. Values are expressed as �g/mland are the means � standard deviations (n � 9).




.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

transformants had supernatants causing clear zones of inhibitionwithin the lawn of E. coli. The results were confirmed by inoculat-ing the 13 strains at 1 � 107 CFU/ml in LiBa medium supple-mented with patulin (100 �g/ml) and by analyzing through TLCand HPLC their supernatants on the sixth day of incubation.

Figure 4A shows that all 13 selected mutants degrade patulinmore slowly than the wild-type strain. Mycotoxin recovery rangedfrom 97.56 � 1.44 �g/ml (transformant 123a) to 8.13 � 0.72�g/ml (transformant 870a) (Fig. 4A). Regarding the productionof breakdown products, for transformant 123a only traces of (E)-

ascladiol were found, while 8.85 � 1.04 �g/ml of DPA and 6.76 �1.16 �g/ml of (Z)-ascladiol were detected for transformant 870aand 3.56 � 0.96 �g/ml of (E)-ascladiol was detected for strain596a. Only for transformant GIS5 were no traces of breakdownproducts detected. On the other hand, biodegradation of patulinby the wild-type strain was almost complete (residual patulin was0.38 � 0.34 �g/ml) (Fig. 4A), with the production of 10.51 � 1.09�g/ml of DPA, 8.06 � 1.04 �g/ml of (Z)-ascladiol, and 1.53 �0.13 �g/ml of (E)-ascladiol (see Table S1 in the supplemental ma-terial). Interestingly, in the absence of patulin, all selected strains grew

FIG 3 Time course HPLC chromatograms of culture filtrates of Sporobolomyces sp. strain IAM 13481 at time zero (A) and after 4 days (B), 6 days (C), and 10 days(D) of incubation at 23°C in LiBa medium in the presence of 100 �g/ml of patulin. The retention times are 9.93 min for patulin (1), 10.65 min for DPA (2), 6.78min for (E)-ascladiol (3), and 7.74 min for (Z)-ascladiol (4). The peaks with Rt ranging from 1.5 to 5.2 min originated from yeast metabolism since they arepresent when Sporobolomyces sp. is incubated in LiBa medium in the absence of patulin.

Ianiri et al.



.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

at a rate similar to that of the wild type, with the OD595 ranging fromof 0.65 to 0.75; contrarily, in the presence of the mycotoxin, thegrowth of the tested insertional mutants was less than that of IAM13481 (Fig. 4B), suggesting that their retardation in patulin degrada-tion is related to their slower growth in the presence of patulin.

Identification of genes affected in patulin-sensitive strains.The genomic DNA was subjected to Southern blot analysis toconfirm that T-DNA insertions had occurred and to assess theminimum number of T-DNA insertion events in each strain. Forall analyzed strains, including the wild-type IAM 13481 ofSporobolomyces sp. and the untransformed ura5 auxotroph AIS2,the URA5 probe hybridized to the endogenous locus (Fig. 5).Compared to the wild-type strain, a smaller hybridization bandwas observed for the auxotroph AIS2 and its derived transfor-mants due to the 129-bp deletion in the ura5 mutant allele (35).The URA5 probe hybridized to additional regions in the genomeof the transformed strains, indicating the success of AMT experi-ments. Specifically, the transformants 954a and 523c appeared tobear three T-DNA insertions, transformant 870a appeared to beartwo, and the other 10 transformants appeared to bear single T-DNA insertions (Fig. 5).

Inverse PCR was used to amplify DNA flanking the T-DNAinsertions, and the sequence was compared to the genome data-base of strain IAM 13481 to identify the affected genes. At least oneflanking region was identified for 12 of these strains. Transfor-mant 18a was also impaired in patulin degradation, but the T-DNA insertion regions have yet to be identified. The predicted

proteins associated with the insertions were compared by BLASTp tothe GenBank, S. cerevisiae, and C. neoformans databases (Table 3).

For four transformants, T-DNA insertions lie within the openreading frame (ORF) of coding genes. Transformant 40a had aninsertion in the S. cerevisiae and Candida albicans homolog YCK2,which encodes the highly conserved serine/threonine kinase ca-sein kinase 1. Yck2 is plasma membrane associated and attaches tomembranes via palmitoylation of its C terminus; it traffics to theplasma membrane through secretory vesicles (45). The proteinYck2 and the isoform Yck1 are encoded by an essential gene pair(46, 47) whose functionally redundant products are involved innumerous cellular processes, including bud morphogenesis, cyto-kinesis (48), nutrient sensing (49), and the internalization ofplasma membrane permeases (50). Blankenship et al. (51) re-ported that Ypk2 may indirectly affect cell wall biogenesis in C.albicans by regulating the flow of carbohydrates into cell wall bio-synthesis pathways. Transformant 596a had an insertion in thehomolog of S. cerevisiae PAC2, which is a microtubule effectorrequired for tubulin heterodimer formation and for normal mi-crotubule function (52). It is also involved in protein turnover.Transformant 938a had an insertion in a gene of the major facili-tator superfamily (MFS) transporters; its homolog in S. cerevisiaeis DAL5, which encodes an allantoate and ureidosuccinate trans-membrane permease. Transformant 985b had a T-DNA insertionin a gene encoding a hypothetical protein (ID 28891). No ho-mologs of the protein were found in C. neoformans, C. albicans, orSchizosaccharomyces pombe, and no putative conserved domainswere detected in the CDD (Conserved Domain Database). Its ho-molog in S. cerevisiae is uncharacterized, and in Rhodotorulagraminis WP1, a Pucciniomycotina red yeast related to Sporobolo-myces sp., it corresponds to a protein annotated as a putative ser-ine/threonine protein kinase involved in signal transductionmechanisms.

For three transformants, the T-DNA inserted into predictedpromoters of genes. Transformant 34a had a T-DNA insertion inthe promoter of the S. cerevisiae homolog GCV1. This gene en-codes the T subunit of the mitochondrial glycine decarboxylase

FIG 4 (A) Recovery of patulin (expressed as �g/ml) from in vitro cultures ofthe wild-type (WT) strain IAM 13481 of Sporobolomyces sp., selected transfor-mants, and the vps8 mutant incubated for 6 days in the presence of 100 �g/mlof patulin. Values are the means � standard deviations (n � 9). (B) Compar-ison between the growth of the WT strain and the selected transformants inLiBa medium with and without patulin (100 �g/ml) after 6 days of incubationat 24°C. Values are the means � standard deviations (n � 9).

FIG 5 Southern blot analysis of 13 insertional mutants of Sporobolomyces sp.with slower patulin degradation. Genomic DNA extracted from the wild type,the ura5 auxotroph AIS2, and the 13 selected insertional mutants was digestedwith ClaI, which does not cut inside the T-DNA region, and resolved on a 0.8%agarose gel. The blot was probed with the T-DNA region of plasmid pAIS4,amplified with the universal primers M13F and M13R. The names of the ana-lyzed strains are indicated. The common band of 4.5 Kb represents the originalura5 locus.




.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

complex, required for the catabolism of glycine to 5,10-methyl-enetetrahydrofolate (53). For transformant 123a, the T-DNA in-serted into the promoter of the S. cerevisiae and C. albicans ho-molog CDC24, which encodes a guanine nucleotide exchangefactor (GEF or GDP release factor) for the Rho-like proteinCdc42. The S. cerevisiae Cdc24 homolog in the basidiomycetes C.neoformans and Ustilago maydis is Cdc24. The Cdc24 homologsare more closely related to a protein of Sporobolomyces sp. IAM13481 with ID 949, based on BLASTp analysis and on the presenceof conserved Cdc24 domains. In contrast, the protein with ID31953 identified in our screen corresponds to a conserved hypo-thetical protein in C. neoformans (GenBank accession numberXP_568368.1) and U. maydis (GenBank accession numberXP_760624.1), suggesting that transformant 123a has a T-DNAinsertion in the promoter of an uncharacterized RhoGEF protein.Analysis in the CDD reveals that these proteins share a motif, aRhoGEF conserved domain. Proteins with a RhoGEF domain arespecific GEFs that activate Rho family GTPases in response toexternal stimuli through the replacement of bound GDP withGTP. GEFs work immediately upstream of Rho-like proteins toprovide a direct link between Rho activation and cell surface re-ceptors. The active Rho species interact, in turn, with a large arrayof effector targets that relay the signals to downstream signalingcomponents, resulting in diverse biological responses, includingcytoskeletal remodeling and other cellular processes, such as

membrane trafficking, transcriptional activation, and cell growthcontrol (reviewed by Zheng [54]). For transformant 164c, the T-DNA insertion is either in the promoter of the gene NAR1 or in thepromoter of a poorly characterized gene. NAR1 encodes a com-ponent of the cytosolic iron-sulfur (FeS) protein assembly ma-chinery, required for maturation of cytosolic and nuclear FeS pro-teins and for normal resistance to oxidative stress (55).

As shown in Fig. 6, for two transformants (GIS5 and 685c), anintrachromosomal rearrangement occurred after the insertion ofthe T-DNA in the genome, with the sequence of each flank of theT-DNA matching different regions on the same scaffold. For thetransformant GIS5, the right border was inserted in the ORF ofthe gene VPS8 while the left border was found to lie in a noncodingregion. VPS8 encodes a membrane-associated protein that inter-acts with Vps21p to facilitate soluble vacuolar protein localization(56); it is a component of the CORVET complex and is requiredfor localization and trafficking of the carboxypeptidase Y sortingreceptor (57, 58). In S. cerevisiae, Vps8, like other vacuolar proteinsorting factors, is required for rescue from lethal effects of oxida-tive damage and for synthesis of cell surface components that areessential for cell wall maintenance (59, 60). For the transformant685c, the right border was found in an intron of the S. cerevisiaehomolog SSO1 while the left border was within the homolog of S.cerevisiae IML1 (Fig. 6). Sso1 is a plasma membrane t-SNAREinvolved in fusion of secretory vesicles at the plasma membrane

TABLE 3 Characterization and identification of T-DNA insertions

Straina

No. of T-DNAinsertions JGI protein ID Closest S. cerevisiae geneb Putative role/commentsc

40a 1 22490 YCK2 Involved in bud morphogenesis, cytokinesis, nutrient sensing, andinternalization of plasma membrane permease and pheromone receptors

596a 1 29097 PAC2 Required for tubulin heterodimer formation and for normal microtubulefunction

938a 1 26185 DAL5 Major facilitator superfamily which encodes an allantoate and ureidosuccinatetransmembrane permease

985b 1 28891 YJR098C, uncharacterized ORF Putative protein kinase involved in signal transduction34a 1 10170 GCV1 T subunit of the mitochondrial glycine decarboxylase complex, required for

the catabolism of glycine to 5,10-methylene-THF123a 1 31953 CDC24 Guanine nucleotide exchange factor (GEF or GDP release factor) for Cdc42p;

required for polarity establishment and maintenance164c 1 34946 YIL025C Poorly annotated gene in Sporobolomyces sp. database

24701 NAR1 Component of the cytosolic iron-sulfur (FeS) protein assembly machinery,required for maturation of cytosolic and nuclear FeS proteins and fornormal resistance to oxidative stress

GIS5 1 72 VPS8 Protection against different reactive oxygen species and oxidative damage685c 1 20596 SSO1 Plasma membrane t-SNARE involved in fusion of secretory vesicles at the

plasma membrane and in vesicle fusion during sporulation (proteintransport)

25175 IML1 Subunit of both the SEA (Seh1-associated) and Iml1p complexes; SEAcomplex is a coatomer-related complex that associates with the vacuole;Iml1p complex (Iml1p-Npr2p-Npr3p) is required for non-nitrogen-starvation-induced autophagy

954a* 3 2161 TVP23 Polysaccharide deacetylase involved in carbohydrate metabolism523c* 3 Not applicable Not applicable870a* 2 Not applicable Not applicable18a 1 Not determined Not applicablea Based on Southern blot analysis (Fig. 5), mutants indicated with an asterisk (*) have multiple T-DNA insertions, and only the loci that were able to produce PCR products and besequenced are described.b The closest S. cerevisiae homologs were found by BLASTp analysis of the identified Sporobolomyces sp. IAM 13481 proteins to the S. cerevisiae Genome Database (SGD) (http://www.yeastgenome.org/).c Annotations were obtained from SGD and Sporobolomyces sp. databases with additional information based on characterized homologs identified in GenBank.

Ianiri et al.



.asm.org/

Dow

nloaded from

http://www.ncbi.nlm.nih.gov/nuccore?term=XP_568368.1

http://www.ncbi.nlm.nih.gov/nuccore?term=XP_760624.1

http://www.yeastgenome.org/

http://www.yeastgenome.org/

http://aem.asm.org

http://aem.asm.org/

and in vesicle fusion during sporulation. It is a homolog of syn-taxin 1A and is functionally redundant with Sso2 (61–63). Iml1 isrequired for both mitochondrial function and filamentous growthin haploid yeasts (64).

The transformant GIS5 was the only mutant strain that alsoshowed impaired growth in LiBa medium without patulin(Fig. 4B). As reported above, this strain is characterized by an

intrachromosomal rearrangement following T-DNA integration,with the right border inserted into the ORF of the gene VPS8 andthe left border inserted into a noncoding region. Thus, it wasunclear if VPS8 contributes to the phenotype observed in ourexperiments or if another gene is impaired by the rearrangement.To test whether the T-DNA insertion is the cause of the mutantphenotype, an independent deletion allele of VPS8 was created by

FIG 6 T-DNA arrangement in the insertional mutants of Sporobolomyces sp. showing lower resistance to patulin and slower degradation of the mycotoxin. TheT-DNA borders are in bold, and Agrobacterium plasmid sequences that are not part of the border sequences are in gray font. Underlined bases in mutant 596a(mutant pac2) were found to be the same after right and left borders, indicating a 7-bp rearrangement of the host genomic DNA following the insertion of theT-DNA. For mutants GIS5 and 685c, the borders are inserted into different regions of the same scaffold, indicating intrachromosomal rearrangements. The topline indicates the predicted amino acid sequence, introns, promoters, and noncoding regions, with the JGI ID protein and the closest homolog of S. cerevisiaeindicated in most cases (Hypo. is a hypothetical protein; Deac. is a polysaccharide deacetylase). In some instances, a single border sequence was obtained due toidentification of only one junction by inverse PCR.




.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

homologous recombination in the auxotroph ura5 AIS2 by biolis-tic transformation. The vps8::URA5 gene replacement was con-firmed by PCR and Southern blot analyses (data not shown). Mu-tant vps8 showed kinetics of patulin degradation that weredifferent from those of the insertional vps8 mutant GIS5. In par-ticular, while in the absence of patulin the growth of the vps8mutant was similar to that of the wild type, in the presence ofpatulin it reached an OD595 of 0.24 � 0.06, which resulted inproduction of 3.04 � 0.49 and 2.21 � 0.76 �g/ml of (E)- and(Z)-ascladiols, respectively, and 3.44 � 1.35 �g/ml of DPA with apatulin recovery of 59.14 � 3.11 �g/ml (Fig. 4A; see also Table S1in the supplemental material).

As shown in Fig. 5, three transformants had multiple T-DNAinsertions. Transformant 954a had three insertions of T-DNA. Byinverse PCR, we were able to identify only one insertion, whichwas found in a polysaccharide deacetylase-encoding gene in-volved in carbohydrate metabolism. The closest gene in S. cerevi-siae is TVP23, which encodes an integral membrane protein local-ized to late Golgi vesicles along with the v-SNARE Tlg2. As shownin Fig. 6, this insertion also includes an extra T-DNA region of 464bp beyond the left border. For transformants 870a and 523c,which had three and two T-DNA insertions, respectively, we wereable to find only one insertion that in both cases was within non-coding regions (Fig. 6). Because there are multiple possible muta-tion events in these strains, this complicates the identification ofthe gene responsible for the phenotype.

Lower tolerance to patulin in a subset of slow-patulin-de-grading mutants correlates with sensitivity to oxidative andother stresses. The nature of the genes reported above and previ-ous studies suggested a link between the effects of patulin andother stress sources. Patulin is known to react with SH-bearingcompounds, such as glutathione (26), and to cause generation ofreactive oxygen species (ROS) and oxidative stress, leading to per-oxidation of lipids of the cell membranes (27, 28). Other perturb-ing effects on plasma membranes are also reported (65–67).Therefore, the T-DNA insertion mutants were tested for their sen-sitivity to different classes of compounds related to patulin toxic-ity. To test mutants with putative altered cell wall and alteredplasma membrane integrity, cells were exposed to caffeine, whichhas been used extensively to probe signal transduction and cellintegrity phenotypes in S. cerevisiae, Congo red, which binds to(1,4)�-glucans and interferes with proper cell wall assembly (68),sodium dodecyl sulfate, which affects membrane stability andalso, indirectly, cell wall construction (69), and NaCl and KCl totest the osmotic stress response (70–72). Moreover, mutants weretested for their sensitivity to different sources of ROS-generatingcompounds, including hydrogen peroxide, the alkyl hydroperox-ide tert-butyl hydroperoxide, the superoxide (O2

�) generatormenadione, the aromatic hydroperoxide cumene hydroperoxide,and the thiol oxidant diamide (60). Cadmium was used to testgenotoxic stress response and protein damage (72).

The relevant phenotypes of the mutants are shown in Fig. 7 andsummarized in Table S2 in the supplemental material. All trans-formants showed sensitivity to at least one of the stress agentsused, suggesting a relationship between the toxic effect of patulinand the slower growth of these mutants incubated with the myco-toxin. Specifically, the mutants for a RhoGEF protein (strain 123a)and transformant GIS5 exhibited the highest number of alteredphenotypes. The two strains were sensitive to all cell wall-perturb-ing and oxidative-stress-inducing agents tested. Moreover, they

showed different sensitivity to CdSO4, which caused a stronggrowth inhibition only for transformant GIS5. Mutant pac2(transformant 596a) and transformant 954a showed high sensitiv-ity to oxidative-stress-inducing agents, with lower sensitivity ob-served for transformant 954a to CHP. Additionally, both strainsshowed impaired growth on SDS, KCl, and NaCl. Transformant954a was also slightly sensitive to caffeine, while mutant pac2showed sensitivity to Congo red and, as expected, to thiabenda-zole, which is a microtubule-destabilizing agent (data not shown).Transformant 164c showed hypersensitivity to three differentsources of stress (SDS, menadione, and CdSO4) and slight sensi-tivity to KCl and NaCl. Mutant dal5 (transformant 938a) showedsensitivity to all oxidative-stress-inducing agents and also to SDS,KCl, and NaCl. The mutant for the protein kinase-encoding geneYCK2 (strain 40a) was very sensitive to SDS, Congo red, andCdSO4. Regarding the oxidative stress response, mutant yck2showed no growth on hydrogen peroxide and slight sensitivity toCHP and menadione. Transformants 34a, 685c, and 985b weresensitive to SDS and CdSO4. Furthermore, compared to the wild-type strain, transformant 34a showed a smaller reduction ingrowth on hydrogen peroxide and tBOOH while transformant685c was slightly sensitive to KCl and NaCl. Transformants 870aand 523c, whose insertions were found in noncoding regions ofthe Sporobolomyces genome, showed sensitivity to SDS andCdSO4. Moreover, transformant 870a showed a slight growth re-duction on diamide, and transformant 523c was sensitive to hy-drogen peroxide. Finally, transformant 18a, whose T-DNA inser-tion was not rescued by means of inverse PCR, showed highsensitivity to SDS, caffeine, NaCl, KCl, H2O2, diamide, CHP, andtBOOH. The vps8 mutant exhibited a slight reduction in growthon the oxidative-stress-inducing agent diamide and sensitivity toSDS, KCl, NaCl, and CdSO4.

DISCUSSION

Patulin is a mycotoxin that frequently contaminates pome fruitsand their derived products as a consequence of a P. expansumattack during fruit storage. Patulin represents an economic chal-lenge to pome fruit food industries and a health hazard to con-sumers. However, this mycotoxin can be degraded under aerobicconditions by several species of red yeasts belonging to the sub-phylum Pucciniomycotina (14, 19), providing impetus to under-stand these mechanisms and to identify the genes involved. To-ward this aim, the red yeast Sporobolomyces sp. IAM 13481 wasused, since it can be transformed for forward and reverse geneticanalysis (35) and its genome has been sequenced, which facilitatesidentification of genes based on the sequences flanking T-DNAinsertions. Moreover, strain IAM 13481 itself has biocontrol agentproperties (our unpublished data).

We first examined Sporobolomyces sp. strain IAM 13481 to testif it can degrade patulin and whether degradation occurredthrough a mechanism similar to that observed for R. kratochvilo-vae strain LS11, reported by Castoria et al. (14, 19). These authorsfound that the incubation of R. kratochvilovae LS11 with patulinresulted in the formation of a final compound that was identifiedby NMR analysis as desoxypatulinic acid (19). Two other transientpeaks that eluted before patulin in HPLC analyses were also de-tected. In the present study, HPLC analysis of medium containingpatulin showed that in the presence of Sporobolomyces sp. IAM13481, three compounds with Rt of 6.78, 7.74, and 10.65 minappeared, and that their onset and time course increase paralleled

Ianiri et al.



.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

a patulin decrease. The product with an Rt of 6.78 min is transient,while those with Rt of 7.74 and 10.65 min are the final products ofpatulin degradation (Fig. 2B and 3A).

The nature of the metabolites produced by Sporobolomyces sp.IAM 13481 was investigated to understand the biochemistry ofpatulin degradation. The three compounds detected were identi-fied as (E)-ascladiol, (Z)-ascladiol, and desoxypatulinic acid bycomparing them to the purified compounds through TLC andHPLC analyses. The presence of (Z)-ascladiol and DPA was con-firmed by NMR analyses. The identification of the transient prod-uct (E)-ascladiol by NMR analysis was unsuccessful. As high-

lighted by others, a possible explanation is that (E)-ascladiol isrelatively unstable and is rapidly isomerized through a nonenzy-matic reaction to the more stable (Z)-ascladiol (20, 21, 73).

Ascladiols and DPA are clearly generated from patulin degra-dation by Sporobolomyces sp., since the incubation of patulin withautoclaved yeast cells and in uninoculated medium did not lead totheir formation and the patulin concentration remained un-changed. Furthermore, DPA and ascladiols are most likely theproducts of two independent pathways of patulin degradation, assuggested by their contemporary appearance, which paralleled apatulin decrease. Previous studies and the chemical structures of

FIG 7 Sensitivity to different stress-generating compounds of selected insertional mutants and vps8 of Sporobolomyces sp. displaying slower patulin degrada-tion than the wild-type strain. The genes bearing a single T-DNA insertion in the ORF of coding genes are reported in parentheses. Ten-fold serial dilutions ofyeast cells were spotted (in 2.5-�l volumes) onto YPD without any supplements (3 days) or containing (A) the oxidative stress agents hydrogen peroxide (H2O2;2 mM) (3 days), diamide (2.5 mM) (3 days), cumene hydroperoxide (CHP; 0.1 mM) (3 days), menadione (0.1 mM) (3 days), and tert-butyl hydroperoxide(tBOOH; 0.4 mM) (3 days); (B) the cell wall- and plasma membrane-destabilizing agents sodium dodecyl sulfate (SDS; 0.015%), Congo red (0.6%) (5 days),caffeine (0.8 mg/ml) (6 days), KCl (0.9 M) (5 days), and NaCl (1 M) (5 days); or (C) cadmium sulfate (CdSO4; 1 mM) (4 days). Cells were grown for the timesindicated and photographed.




.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

the patulin breakdown products produced by Sporobolomyces sp.IAM 13481 corroborate this hypothesis. (E)-ascladiol is oxidizedto patulin in a one-step enzymatic reaction in patulin biosynthesis(73); thus, it is reasonable that the reverse enzymatic reaction leadsto the formation of (E)-ascladiol from patulin. Ascladiol resultsfrom the hemiacetal opening of patulin and reduction of the de-rived aldehyde. DPA instead is formed through the hydrolysis ofthe �,�-unsaturated -lactone ring and subsequent modifying re-actions involving more than a single enzymatic step (R. Durán-Patrón, unpublished data). Comparative HPLC analysis showedthat these three compounds have the same retention time as thoseproduced by R. kratochvilovae LS11 (although in the case of LS11,(E)- and (Z)-ascladiols are only transient), suggesting that the twoyeasts metabolize patulin in a conserved manner. Our previousstudies show that strain LS11 resists higher patulin concentrationsthan Sporobolomyces sp. IAM 13481, it is more rapid in degradingthe mycotoxin, and it forms only DPA as the final metabolite ofpatulin degradation. These differences may be due to the preva-lence of the DPA-forming pathway in R. kratochvilovae (14, 19).

The ability to degrade patulin seems to be fairly widespread inPucciniomycotina red yeasts. Preliminary assays indicate that 36%of these strains were able to form ascladiols and DPA as the finalproducts of patulin degradation (F. De Curtis, personal commu-nication). This may indicate conserved pathways for patulin deg-radation in the Pucciniomycotina or, alternatively, reflect a skew insampling of isolates from environments shared with fungi pro-ducing patulin or related molecules.

Because of the paucity of information on the genetics of patulindegradation or tolerance in any organism, insertional mutagenesisis a suitable approach for understanding this process at a molec-ular level. To this aim, a recently developed protocol based on anA. tumefaciens T-DNA delivery system was used (35). Agrobacte-rium-mediated transformation (AMT) has several advantagescompared to biolistic and electroporation transformation meth-ods (74, 75), and it has been used in numerous fungal species (74).However, analysis of plant and fungal transformants generatedwith Agrobacterium indicates that multiple T-DNA insertions,chromosomal rearrangements, and integration of extra T-DNAsequences normally occurred during T-DNA delivery, eventhough at a low frequency (32, 35, 74, 76, 77). We also foundevidence for these events in our Sporobolomyces T-DNA transfor-mants (Fig. 5 and 6).

The insertional mutants of Sporobolomyces sp. were screenedfor their ability to degrade patulin. Thirteen mutants that werehindered in patulin degradation were isolated (Fig. 4A). The ini-tial intention was to isolate mutants that were not able to metab-olize patulin as a consequence of the T-DNA insertion into genesencoding the enzymes responsible for degradation. However, inall cases, we still detected the production of breakdown products(see Table S1 in the supplemental material), although at a lowerrate than the wild-type strain. Only for the transformant GIS5, nobreakdown products were detected; this is due to the high patulinsensitivity shown by GIS5 and not to the lack of enzymatic activity,since a protein extract from this strain is still able to degrade themycotoxin (see Fig. S1 in the supplemental material). The mu-tants impaired in patulin degradation showed slower growth inthe presence of the mycotoxin than did the wild-type strain IAM13481 (Fig. 4B), consistent with the hypothesis that the mutantsare affected in tolerance rather than in the degradation pathways.Two factors may contribute to not isolating a T-DNA insertion in

a gene specific for the pathways of patulin degradation. First, 3,000transformants are insufficient to obtain insertions in each of the5,500 genes estimated in the genome of Sporobolomyces sp. IAM13481. Second, the discovery of two degradation pathways sug-gests that the original screen using the supernatants of the T-DNAstrains on E. coli may have been too selective.

One caveat in assigning unequivocally the involvement of thegenes hit by the T-DNA insertions in patulin biodegradation/re-sistance is the lack of complementation or genetic linkage. This isdue to the experimental limitation of the absence of a secondselectable marker or a genetic segregation system in Sporobolomy-ces sp. IAM 13481. Thus, gene function was tentatively assignedbased on phenotypic responses of the patulin-sensitive strains todifferent stress agents that exert effects that are similar to those ofpatulin. The stressors included reactive oxygen species (ROS), cellwall- and plasma membrane-destabilizing agents, and genotoxicor protein-damaging agents. Analysis of global microarraychanges in S. cerevisiae exposed to patulin showed that many genesinvolved in detoxification processes, oxidative stress response, andDNA repair are highly induced (30). In another study, a genetic cor-relation in patulin- and oxidative-stress-susceptible strains of S.cerevisiae was found, indicating a mechanistic similarity betweenpatulin toxicity and oxidative stress (78). In agreement with thesestudies, we found that 10 of 13 (77%) patulin-sensitive strainswere also highly sensitive to at least one oxidative-stress-inducingagent, and 6 (46%) (mutants pac2 and dal5, transformants 123a,GIS5, 954a, and 18a) exhibited hypersensitivity to all ROS or ROS-generating compounds (Fig. 7A; see also Table S2 in the supple-mental material). Eight strains (62%) (mutant yck2, strains 34a,985b, 164c, GIS5, 685c, 523c, and 870a) were also sensitive tocadmium sulfate, and surprisingly, all selected strains showed hy-persensitivity to at least one cell wall- or plasma membrane-stress-ing agent used (Fig. 7B; see also Table S2 in the supplementalmaterial). This indicates the existence of a relationship betweenresistance to stresses and cell wall integrity.

In our screen, we isolated a mutant, GIS5, characterized by anintrachromosomal rearrangement involving the gene VPS8(Fig. 6). This strain exhibited hypersensitivity to patulin and to allstress-inducing agents used in this study. To test whether or notthese phenotypes were due to the gene VPS8, a deletion allele ofthis gene was created. Contrary to transformant GIS5, the mutantvps8 showed slow growth only in LiBa medium supplementedwith patulin (Fig. 3B), suggesting that the intrachromosomal re-arrangement causes a phenotype in addition to impaired Vps8function. Corroborating this hypothesis, the mutant vps8showed sensitivity only to SDS and cadmium sulfate and exhibiteda growth rate similar to that of the wild-type strain when exposedto oxidative-stress-inducing agents, except the slight sensitivity todiamide. This suggests that Sporobolomyces sp. Vps8 is involvedmainly in cell wall maintenance and genotoxic stress resistancerather than oxidative stress response. These results are in contrastwith previous findings on S. cerevisiae, for which a genome-widesurvey of changes in transcripts and proteins of cells exposed todifferent ROS revealed that Vps8, like other Vps proteins, wasessential for broad resistance to oxidative stress by processing andtrafficking of response proteins and by removal of damaged pro-teins (60).

Taken together, our results from genetic and phenotypic anal-ysis build upon previous studies carried out toward understand-ing the toxic effects of patulin (27–29, 65, 79). They also clearly

Ianiri et al.



.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

indicate that the slower patulin degradation ability observed forthe mutants selected in this study is due not to the inactivation ofgenes encoding enzymes directly involved in the patulin degrada-tion pathway but to the loss of function of genes involved in resis-tance to patulin-induced stresses.

The results from this study also provide new insights into theprocess of patulin degradation by red yeasts belonging to thePucciniomycotina. We propose that the degradation process is di-vided into two related stages. In the first one, when the yeastgrowth is in the lag phase and patulin is present, a role is played bygenes that are necessary for the cells to resist different stressesinduced by the mycotoxin. According to genetic and phenotypicdata obtained in this study, these genes are involved mainly inmaintaining the functionality of the plasma membrane and thecell wall and in oxidative and genotoxic stress responses. In thesecond stage, with the yeast growth in the log phase, enzymes orthe respective encoding genes involved in two different pathwaysof patulin degradation are activated, thus leading to the formationof DPA and ascladiols. This two-stage process is similar to thatdescribed for the anaerobic degradation of patulin by S. cerevisiae(80). To confirm this hypothesis and to gain insight into themechanisms of patulin degradation by Pucciniomycotina redyeasts, studies of isotope incorporation in DPA and ascladiols areto be carried out to elucidate the steps of the patulin biodegrada-tion pathway(s) of Sporobolomyces sp. IAM 13481.

The identification of the mechanisms of patulin degradationmay pave the way to the development of new technologies for theprevention or the detoxification of patulin contamination inpome fruit-based products. The genes may be used for producingapples capable of degrading patulin, as has already been describedfor transgenic rice plants harboring trichothecene- and zearale-none-inactivating genes (81), or used industrially to degrade pat-ulin in contaminated juice.

ACKNOWLEDGMENTS

We thank A. Fratianni and R. Pizzuto for assistance during HPLC analysisand M. Solfrizzo (ISPA-CNR, Bari, Italy) for providing ascladiol standards.This was the starting point for purification and NMR characterization.

This research was supported by a grant from the U.S.-Italian JointCommission on Scientific and Technological Cooperation, by the ItalianMinistry for University and Scientific Research (MIUR) within the con-text of Incentivazione alla mobilità di studiosi stranieri e italiani residentiall’estero (DM 1.2.2005, n.18; to S.A.I.W.), by PRIN 2008 —prot.2008JKH2MM—Exploitation of genes and proteins from different bio-logical sources for limiting patulin contamination caused by the patho-genic fungus Penicillium expansum (to R.C.), by a grant from the Dotto-rato di Ricerca in Difesa e Qualità delle Produzioni Agro-alimentari eForestali (to G.I.), and by the U.S. National Science Foundation (grantMCB-0920581 to A.I.). The work conducted by the Joint Genome Insti-tute is supported by the Office of Science of the U.S. Department of Energyunder contract no. DE-AC02-05CH11231.

Access to the genome sequence of strain IAM 13481 was provided bythe U.S. Department of Energy.

REFERENCES1. Waksman SA, Horning ES, Spencer EL. 1942. The production of two

antibacterial substances, fumigacin and clavacin. Science 96:202–203.2. Wiesner BP. 1942. Bactericidal effects of Aspergillus clavatus. Nature 149:

356.3. Katzman PA, Hays EE, Cain CK, van Wyk JJ, Reithel FJ, Thayer SA,

Doisy EA, Gaby WL, Carroll CJ, Muir RD, Jone LR, Wade NJ. 1944.Clacacin, an antibiotic substance from Aspergillus clavatus. J. Biol. Chem.154:475– 486.

4. Puel O, Galtier P, Oswald IP. 2010. Biosynthesis and toxicological effectsof patulin. Toxins 2:613– 631.

5. Morales H, Marín S, Ramos AJ, Sanchis V. 2010. Influence of post-harvesttechnologies applied during cold storage of apples in Penicillium expansumgrowth and patulin accumulation: a review. Food Control 21:953–962.

6. Castoria R, Caputo L, De Curtis F, De Cicco V. 2003. Resistance ofpostharvest biocontrol yeasts to oxidative stress: a possible new mecha-nism of action. Phytopathology 93:564 –572.

7. Castoria R, De Curtis F, Lima G, De Cicco V. 1997. �-1,3-Glucanaseactivity of two saprophytic yeasts and possible mode of action involved asbiocontrol agents against postharvest diseases. Postharvest Biol. Technol.12:293–300.

8. Lima G, De Curtis F, Castoria R, De Cicco V. 1998. Activity of the yeastsCryptococcus laurentii and Rhodotorula glutinis against post-harvest rotson different fruits. Biocontrol Sci. Technol. 8:257–267.

9. Lima G, Castoria R, De Curtis F, Raiola A, Ritieni A, De Cicco V. 2011.Integrated control of blue mould using new fungicides and biocontrolyeasts lowers levels of fungicide residues and patulin contamination inapples. Postharvest Biol. Technol. 60:164 –172.

10. Lima G, Spina AM, Castoria R, De Curtis F, De Cicco V. 2005.Integration of biocontrol agents and food-grade additives for enhancingprotection of stored apples from Penicillium expansum. J. Food Prot. 68:2100 –2106.

11. Coelho AR, Celli MG, Ono EYS, Wosiacki G, Hoffmann FL, PagnoccaFC, Hirooka EY. 2007. Penicillium expansum versus antagonist yeasts andpatulin degradation in vitro. Braz. Arch. Biol. Technol. 50:725–733.

12. Morales H, Sanchis V, Usall J, Ramos AJ, Marín S. 2008. Effect ofbiocontrol agents Candida sake and Pantoea agglomerans on Penicilliumexpansum growth and patulin accumulation in apples. Int. J. Food Micro-biol. 122:61– 67.

13. Florianowicz T. 2001. Antifungal activity of some microorganismsagainst Penicillium expansum. Eur. Food Res. Technol. 212:282–286.

14. Castoria R, Morena V, Caputo L, Panfili G, De Curtis F, De Cicco V.2005. Effect of the biocontrol yeast Rhodotorula glutinis strain LS11 onpatulin accumulation in stored apples. Phytopathology 95:1271–1278.

15. Sanzani SM, Reverberi M, Punelli M, Ippolito A, Fanelli C. 2012. Studyon the role of patulin on pathogenicity and virulence of Penicillium expan-sum. Int. J. Food Microbiol. 153:323–331.

16. Karlovsky P. 1999. Biological detoxification of fungal toxins and its use inplant breeding, feed and food production. Nat. Toxins 7:1–23.

17. Scott PM, Kennedy B, Walbeek WV. 1972. Desoxypatulinic acid from apatulin-producing strain of Penicillium patulum. Experientia 28:1252.

18. Wright SAI, Ianiri G, De Felice DV, Castoria R. 2008. A rapid assay forpatulin degradation by the basidiomycetous yeast Rhodotorula glutinisstrain LS11, p 19 –29. COST Action 924. University of Bologna, Bologna,Italy, 3 to 5 May 2007.

19. Castoria R, Mannina L, Durán-Patrón R, Maffei F, Sobolev AP, DeFelice DV, Pinedo-Rivilla C, Ritieni A, Ferracane R, Wright SAI. 2011.Conversion of the mycotoxin patulin to the less toxic desoxypatulinic acidby the biocontrol yeast Rhodosporidium kratochvilovae strain LS11. J.Agric. Food Chem. 59:11571–11578.

20. Moss MO, Long MT. 2002. Fate of patulin in the presence of the yeastSaccharomyces cerevisiae. Food Addit. Contam. 19:387–399.

21. Ricelli A, Baruzzi F, Solfrizzo M, Morea M, Fanizzi FP. 2007. Biotrans-formation of patulin by Gluconobacter oxydans. Appl. Environ. Microbiol.73:785–792.

22. Suzuki T, Takeda M, Tanabe H. 1971. A new mycotoxin produced byAspergillus clavatus. Chem. Pharm. Bull. 19:1786 –1788.

23. Moake MM, Padilla-Zakour OI, Worobo RW. 2005. Comprehensivereview of patulin control methods in foods. Compr. Rev. Food Sci. FoodSaf. 1:8 –21.

24. Fliege R, Metzler M. 1999. The mycotoxin patulin induces intra- andintermolecular protein crosslinks in vitro involving cysteine, lysine, andhistidine side chains, and alpha-amino groups. Chem. Biol. Interact. 123:85–103.

25. Barhoumi R, Burghardt RC. 1996. Kinetic analysis of the chronology ofpatulin- and gossypol-induced cytotoxicity in vitro. Fundam. Appl. Toxi-col. 30:290 –297.

26. Fliege R, Metzler M. 2000. Electrophilic properties of patulin. N-acetylcysteine and glutathione adducts. Chem. Res. Toxicol. 13:373–381.

27. Ferrer E, Juan-García A, Font G, Ruiz MJ. 2009. Reactive oxygen speciesinduced by beauvericin, patulin and zearalenone in CHO-K1 cells. Toxi-col. In Vitro 23:1504 –1509.




.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

28. Liu BH, Wu TS, Yu FY, Su CC. 2007. Induction of oxidative stressresponse by the mycotoxin patulin in mammalian cells. Toxicol. Sci. 95:340 –347.

29. Zhou SM, Jiang LP, Geng CY, Cao J, Zhong LF. 2009. Patulin-inducedgenotoxicity and modulation of glutathione in HepG2 cells. Toxicon 53:584 –586.

30. Iwahashi Y, Hosoda H, Park J-H, Lee J-H, Suzuki Y, Kitagawa E,Murata SM, Jwa N-S, Gu M-B, Iwahashi H. 2006. Mechanisms of patulintoxicity under conditions that inhibit yeast growth. J. Agric. Food Chem.54:1936 –1942.

31. Idnurm A, Reedy JL, Nussbaum JC, Heitman J. 2004. Cryptococcusneoformans virulence gene discovery through insertional mutagenesis. Eu-karyot. Cell 3:420 – 429.

32. Idnurm A, Walton FJ, Floyd A, Reedy JL, Heitman J. 2009. Identifica-tion of ENA1 as a virulence gene of the human pathogenic fungus Cryp-tococcus neoformans through signature-tagged insertional mutagenesis.Eukaryot. Cell 8:315–326.

33. Walton FJ, Idnurm A, Heitman J. 2005. Novel gene functions requiredfor melanization of the human pathogen Cryptococcus neoformans. Mol.Microbiol. 57:1381–1396.

34. Abbott EP, Ianiri G, Castoria R, Idnurm A. 2013. Overcoming recalci-trant transformation and gene manipulation in Pucciniomycotina yeasts.Appl. Microbiol. Biotechnol. 97:283–295.

35. Ianiri G, Wright SAI, Castoria R, Idnurm A. 2011. Development ofresources for the analysis of gene function in Pucciniomycotina red yeasts.Fungal Genet. Biol. 48:685– 695.

36. Winston F, Dollard C, Ricupero-Hovasse SL. 1995. Construction of a setof convenient Saccharomyces cerevisiae strains that are isogenic to S288C.Yeast 11:53–55.

37. Christianson TW, Sikorski RS, Dante M, Shero JH, Hieter P. 1992.Multifunctional yeast high-copy-number shuttle vectors. Gene 110:119 –122.

38. Bundock P, den Dulk-Ras A, Beijersbergen A, Hooykaas PJ. 1995.Trans-kingdom T-DNA transfer from Agrobacterium tumefaciens to Sac-charomyces cerevisiae. EMBO J. 14:3206 –3214.

39. Lilly VG, Barnett HL. 1951. Physiology of the fungi. McGraw-Hill, NewYork, NY.

40. López-García B, González-Candelas L, Pérez-Payá E, Marcos JF. 2000.Identification and characterization of a hexapeptide with activity againstphytopathogenic fungi that cause postharvest decay in fruits. Mol. PlantMicrobe Interact. 13:837– 846.

41. MacDonald S, Long M, Gilbert J, Felgueiras I. 2000. Liquid chromato-graphic method for determination of patulin in clear and cloudy applejuices and apple puree: collaborative study. J. AOAC Int. 83:1387–1394.

42. Pitkin JW, Panaccione DG, Walton JD. 1996. A putative cyclic peptideefflux pump encoded by the TOXA gene of the plant-pathogenic fungusCochliobolus carbonum. Microbiology 142:1557–1565.

43. Colot HV, Park G, Turner GE, Ringelberg C, Crew CM, Litvinkova L,Weiss RL, Borkovich KA, Dunlap JC. 2006. A high-throughput geneknockout procedure for Neurospora reveals functions for multiple tran-scription factors. Proc. Natl. Acad. Sci. U. S. A. 103:10352–10357.

44. McCluskey K, Wiest A, Plamann M. 2010. The Fungal Genetics StockCenter: a repository for 50 years of fungal genetics research. J. Biosci.35:119 –126.

45. Babu P, Deschenes RJ, Robinson LC. 2004. Akr1p-dependent palmitoyl-ation of Yck2p yeast casein kinase 1 is necessary and sufficient for plasmamembrane targeting. J. Biol. Chem. 279:27138 –27147.

46. Robinson LC, Hubbard EJ, Graves PR, DePaoli-Roach AA, Roach PJ,Kung C, Haas DW, Hagedorn CH, Goebl M, Culbertson MR. 1992.Yeast casein kinase I homologues: an essential gene pair. Proc. Natl. Acad.Sci. U. S. A. 89:28 –32.

47. Wang PC, Vancura A, Mitcheson TG, Kuret J. 1992. Two genes inSaccharomyces cerevisiae encode a membrane-bound form of casein ki-nase-1. Mol. Biol. Cell 3:275–286.

48. Robinson LC, Menold MM, Garrett S, Culbertson MR. 1993. Caseinkinase I-like protein kinases encoded by YCK1 and YCK2 are required foryeast morphogenesis. Mol. Cell. Biol. 13:2870 –2881.

49. Moriya H, Johnston M. 2004. Glucose sensing and signaling in Saccha-romyces cerevisiae through the Rgt2 glucose sensor and casein kinase I.Proc. Natl. Acad. Sci. U. S. A. 101:1572–1577.

50. Marchal C, Haguenauer-Tsapis R, Urban-Grimal D. 2000. Casein kinaseI-dependent phosphorylation within a PEST sequence and ubiquitination

at nearby lysines signal endocytosis of yeast uracil permease. J. Biol. Chem.275:23608 –23614.

51. Blankenship JR, Fanning S, Hamaker JJ, Mitchell AP. 2010. An extensivecircuitry for cell wall regulation in Candida albicans. PLoS Pathog.6:e1000752. doi:10.1371/journal.ppat.1000752.

52. Hoyt MA, Macke JP, Roberts BT, Geiser JR. 1997. Saccharomyces cerevi-siae PAC2 functions with CIN1, 2 and 4 in a pathway leading to normalmicrotubule stability. Genetics 146:849 – 857.

53. McNeil JB, Zhang F, Taylor BV, Sinclair DA, Pearlman RE, Bognar AL.1997. Cloning, and molecular characterization of the GCV1 gene encodingthe glycine cleavage T-protein from Saccharomyces cerevisiae. Gene 186:13–20.

54. Zheng Y. 2001. Dbl family guanine nucleotide exchange factors. TrendsBiochem. Sci. 26:724 –732.

55. Fujii M, Adachi N, Shikatani K, Ayusawa D. 2009. [FeFe]-hydrogenase-like gene is involved in the regulation of sensitivity to oxygen in yeast andnematode. Genes Cells 14:457– 468.

56. Horazdovsky BF, Cowles CR, Mustol P, Holmes M, Emr SD. 1996. Anovel RING finger protein, Vps8p, functionally interacts with the smallGTPase, Vps21p, to facilitate soluble vacuolar protein localization. J. Biol.Chem. 271:33607–33615.

57. Chen YJ, Stevens TH. 1996. The VPS8 gene is required for localizationand trafficking of the CPY sorting receptor in Saccharomyces cerevisiae.Eur. J. Cell Biol. 70:289 –297.

58. Peplowska K, Markgraf DF, Ostrowicz CW, Bange G, Ungermann C.2007. The CORVET tethering complex interacts with the yeast Rab5 ho-molog Vps21 and is involved in endo-lysosomal biogenesis. Dev. Cell12:739 –750.

59. Martinez M, Pramanik A, Moto-Ndje S, Moore CW. 2003. Overexpres-sion of genes involved in vesicular trafficking to the vacuole defendsagainst lethal effects of oxidative damage. Cell Mol. Biol. 49:1025–1035.

60. Thorpe GW, Fong CS, Alic N, Higgins VJ, Dawes IW. 2004. Cells havedistinct mechanisms to maintain protection against different reactive ox-ygen species: oxidative-stress-response genes. Proc. Natl. Acad. Sci.U. S. A. 101:6564 – 6569.

61. Aalto MK, Ronne H, Keränen S. 1993. Yeast syntaxins Sso1p and Sso2pbelong to a family of related membrane proteins that function in vesiculartransport. EMBO J. 12:4095– 4104.

62. Nakanishi H, Morishita M, Schwartz CL, Coluccio A, Engebrecht J,Neiman AM. 2006. Phospholipase D and the SNARE Sso1p are necessaryfor vesicle fusion during sporulation in yeast. J. Cell Sci. 119:1406 –1415.

63. Nicholson KL, Munson M, Miller RB, Filip TJ, Fairman R, HughsonFM. 1998. Regulation of SNARE complex assembly by an N-terminaldomain of the t-SNARE Sso1p. Nat. Struct. Biol. 5:793– 802.

64. Kang CM, Jiang YW. 2005. Genome-wide survey of non-essential genesrequired for slowed DNA synthesis-induced filamentous growth in yeast.Yeast 22:79 –90.

65. Horváth E, Papp G, Belágyi J, Gazdag Z, Vágvölgyi C, Pesti M. 2010. In vivodirect patulin-induced fluidization of the plasma membrane of fission yeastSchizosaccharomyces pombe. Food Chem. Toxicol. 48:1898–1904.

66. Mahfoud R, Maresca M, Garmy N, Fantini J. 2002. The mycotoxinpatulin alters the barrier function of the intestinal epithelium: mechanismof action of the toxin and protective effects of glutathione. Toxicol. Appl.Pharmacol. 181:209 –218.

67. Riley RT, Showker JL. 1991. The mechanism of patulin’s cytotoxicity andthe antioxidant activity of indole tetramic acids. Toxicol. Appl. Pharma-col. 109:108 –126.

68. Wood PJ, Fulcher RG. 1983. Dye interactions. A basis for specific detec-tion and histochemistry of polysaccharides. J. Histochem. Cytochem. 31:823– 826.

69. Igual JC, Johnson AL, Johnston LH. 1996. Coordinated regulation of geneexpression by the cell cycle transcription factor Swi4 and the protein kinase CMAP kinase pathway for yeast cell integrity. EMBO J. 15:5001–5013.

70. Gerik KJ, Bhimireddy SR, Ryerse JS, Specht CA, Lodge JK. 2008. PKC1is essential for protection against both oxidative and nitrosative stresses,cell integrity, and normal manifestation of virulence factors in the patho-genic fungus Cryptococcus neoformans. Eukaryot. Cell 7:1685–1698.

71. Gerik KJ, Donlin MJ, Soto CE, Banks AM, Banks IR, Maligie MA,Selitrennikoff CP, Lodge JK. 2005. Cell wall integrity is dependent on thePKC1 signal transduction pathway in Cryptococcus neoformans. Mol. Mi-crobiol. 58:393– 408.

72. Maeng S, Ko YJ, Kim GB, Jung KW, Floyd A, Heitman J, Bahn YS. 2010.Comparative transcriptome analysis reveals novel roles of the Ras and cyclic

Ianiri et al.



.asm.org/

Dow

nloaded from

http://dx.doi.org/10.1371/journal.ppat.1000752

http://aem.asm.org

http://aem.asm.org/

AMP signaling pathways in environmental stress response and antifungaldrug sensitivity in Cryptococcus neoformans. Eukaryot. Cell 9:360–378.

73. Sekiguchi J, Shimamoto T, Yamada Y, Gaucher GM. 1983. Patulinbiosynthesis: enzymatic and nonenzymatic transformations of the myco-toxin (E)-ascladiol. Appl. Environ. Microbiol. 45:1939 –1942.

74. Michielse CB, Hooykaas PJ, van den Hondel CA, Ram AF. 2005.Agrobacterium-mediated transformation as a tool for functional genomicsin fungi. Curr. Genet. 48:1–17.

75. Weld RJ, Plummer KM, Carpenter MA, Ridgway HJ. 2006. Approachesto functional genomics in filamentous fungi. Cell Res. 16:31– 44.

76. Meng Y, Patel G, Heist M, Betts MF, Tucker SL, Galadima N, DonofrioNM, Brown D, Mitchell TK, Li L, Xu JR, Orbach M, Thon M, Dean RA,Farman ML. 2007. A systematic analysis of T-DNA insertion events inMagnaporthe oryzae. Fungal Genet. Biol. 44:1050 –1064.

77. Nacry P, Camilleri C, Courtial B, Caboche M, Bouchez D. 1998. Majorchromosomal rearrangements induced by T-DNA transformation inArabidopsis. Genetics 149:641– 650.

78. Suzuki T, Sirisattha S, Mori K, Iwahashi Y. 2009. Mycotoxin toxicity in

Saccharomyces cerevisiae differs depending on gene mutations. Food Sci.Technol. Res. 15:453– 458.

79. Liu BH, Wu TS, Yu FY, Wang CH. 2006. Mycotoxin patulin activates thep38 kinase and JNK signaling pathways in human embryonic kidney cells.Toxicol. Sci. 89:423– 430.

80. Sumbu ZL, Thonart P, Bechet J. 1983. Action of patulin on a yeast. Appl.Environ. Microbiol. 45:110 –115.

81. Higa A, Kimura M, Mimori K, Ochiai-Fukuda T, Tokai T, Taka-hashi-Ando N, Nishiuchi T, Igawa T, Fujimura M, Hamamoto H,Usami R, Yamaguchi I. 2003. Expression in cereal plants of genes thatinactivate Fusarium mycotoxins. Biosci. Biotechnol. Biochem. 67:914 –918.

82. Yamazaki M, Komagata K. 1983. An electrophoretic comparison ofenzymes of ballistosporogenous yeasts. J. Gen. Appl. Microbiol. 29:115–143.

83. Schweizer H, Boos W. 1983. Transfer of the (argF-lac)U169 mutationbetween Escherichia coli strains by selection for a closely linked Tn10 in-sertion. Mol. Gen. Genet. 192:293–294.




.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

Documents

Searching for Genes Responsible for Patulin Degradation in a Biocontrol Yeast Provides Insight into the Basis for Resistance to This Mycotoxin