Pro-proliferative function of the long isoform of PML-RARα involved in acute promyelocytic leukemia

ORIGINAL ARTICLE

Pro-proliferative function of the long isoform of PML-RARa involved

in acute promyelocytic leukemia

MI Tussie-Luna1, L Rozo1 and AL Roy1,2,3

1Department of Pathology, Tufts University School of Medicine, Boston, MA, USA; 2Program in Immunology, Tufts UniversitySchool of Medicine, Boston, MA, USA and 3Program in Genetics, Tufts University School of Medicine, Boston, MA, USA

The promyelocytic leukemia (PML) gene codes for atumor suppressor protein that is associated with distinctsubnuclear macromolecular structures called the PMLbodies. The PML gene is frequently involved in thet(15;17) chromosomal translocation of acute promyelocy-tic leukemia (APL). The translocation results in a fusiongene product, PML-RARa, in which the PML gene fusesto the retinoic acid receptor a (RARa) gene. PML-RARahas been shown to promote transcriptional repression ofgenes involved in myeloid terminal differentiation and todisrupt the architecture of PML bodies, a phenotypereversed by treatment with all trans retinoic acid (ATRA).However, there are several alternatively spliced isoformsof PML-RARa. Here, we addressed the differencesbetween the short and the long isoforms of PML-RARa(L and S) since both are associated with APL. Wedemonstrate that PML-RARaL, but not PML-RARaS,can directly promote cell growth by transcriptionallyactivating the pro-proliferative gene, c-fos, in response tomitogenic stimulation. The activity of the PML-RARaLis completely sensitive to ATRA. We further show thatthis activation is not via direct recruitment of the proteinto the c-fos promoter but indirectly by altering thechromosomal environment of the c-fos gene, therebyrendering it more accessible to the signal inducedtranscriptional activators. Our results suggest that inaddition to antagonizing the PML-tumor suppressor orthe PML-pro-apoptotic activity, PML-RARa proteinscan also directly promote cell growth by activating c-fos.Oncogene (2006) 25, 3375–3386. doi:10.1038/sj.onc.1209388;published online 23 January 2006

Keywords: APL; PML-RARa; c-fos; transcription;chromatin

Introduction

The promyelocytic leukemia (PML) gene is frequentlyinvolved in the t(15;17) chromosomal translocation of

acute promyelocytic leukemia (APL), a subtype ofmyeloid leukemia. The PML gene was initially clonedas the t(15;17) chromosomal translocation partner ofRARa in APL patients (de The et al., 1991; Goddardet al., 1991; Zhong et al., 2000b; Salomoni and Pandolfi,2002). Because the translocation takes place in only oneallele, the APL blast still carries one wild-type allele ofboth genes, PML and RARa (Pandolfi, 2001; Salomoniand Pandolfi, 2002). The PML protein is typically foundin distinct subnuclear dotted structures along with otherproteins. These speckled macromolecular structures arehallmark of PML bodies. In normal cells, 20–30 of thesePML bodies are found per nucleus, with diametersbetween 0.2 and 1 mm, which could vary during cell cycle(Zhong et al., 2000a, b; Salomoni and Pandolfi, 2002).However, in APL blasts, PML, together with otherproteins are delocalized from the PML bodies intoaberrant micro-speckled nuclear structures. In APLblasts, the fusion protein PML-RARa causes disruptionof the architecture of PML bodies through directphysical association, a phenotype reversed by treatmentwith all trans retinoic acid (ATRA) (Zhong et al.,2000b). ATRA causes degradation of PML-RARa andcorresponding relocalization of the various PML bodyconstituents into macromolecular structure (Zhu et al.,1999; Lallemand-Breitenbach et al., 2001; Zhu et al.,2001). Consistent with these observations, it has alsobeen shown in transgenic mice that while PML-RARacauses leukemia with APL-like features, the dominant-negative RARa mutants fail to do so (Pandolfi, 2001;Salomoni and Pandolfi, 2002). These observationsunderscore the functional importance of PML-RARaand disruption of PML bodies in leukemogenesis. PMLacts as coactivator of RARa, and thereby alsocontributes to differentiation of myelod precursor cells(Wang et al., 1998a). Besides its role as a tumorsuppressor, PML is shown to be a pro-apoptotic factorsince it participates in several apoptotic pathways(Quignon et al., 1998; Wang et al., 1998b; Guo et al.,2000; Lunghi et al., 2005).

Biochemical identification of several transcriptionfactors and chromatin modifying enzymes associatedwith PML bodies suggest that the PML bodies may actas store-house for transcription factors and that boththe activities and/or local concentrations of these factorsmay be modulated by their association with PML bodies(Zhong et al., 2000b; Salomoni and Pandolfi, 2002). The

Received 28 July 2005; revised 11 November 2005; accepted 7 December2005; published online 23 January 2006

Correspondence: Dr AL Roy, Department of Pathology, Tufts UniversitySchool of Medicine, 150 Harrison Avenue, Boston, MA 2111, USA.E-mail: [email protected]

Oncogene (2006) 25, 3375–3386& 2006 Nature Publishing Group All rights reserved 0950-9232/06 $30.00

www.nature.com/onc

sequence analysis of PML reveals that it has acharacteristic RING finger motif, often found intranscription factors. Although PML does not appearto bind DNA in a sequence-specific fashion, it possessesa cryptic transcription activation domain that isdependent on the integrity of the RING finger. Incontrast, the full-length PML protein inhibits transcrip-tion (Zhong et al., 2000b). The function of PML-RARaas a transcription factor is better studied. PML-RARafusion protein maintains both the ligand responsivenessand DNA binding domains of retinoic acid receptor(RAR), producing a deregulated transcription factor(Zhong et al., 2000b). But at the same time, the fusionprotein also exhibits higher affinity for histone deacety-lases (HDACs), so that a high dose of ATRA is neededto dissociate HDACs from PML-RARa and to inducethe degradation of PML-RARa (Lin et al., 1998; Altucciand Gronemeyer, 2001). The consequence of theformation of PML-RARa is a block of differentiationat the promyelocytic stage. Because HDACs are potenttranscriptional co-repressors (Lin et al., 1998; Cress andSeto, 2000; Lin and Evans, 2000; Marmorstein, 2001;Narlikar et al., 2002; Hake et al., 2004), HDACdependent gene silencing of normal retinoid signalingduring myelopoiesis may cause the differentiation block.

In contrast, it is likely that the altered function of PMLin the fusion protein such as the loss of its proapoptoticactivity (Quignon et al., 1998; Wang et al., 1998b;Lunghi et al., 2005), or abrogation of co-repressorfunction, adds to the growth potential or survivalcapacity of APL blasts (Grignani et al., 1993; Altucciand Gronemeyer, 2001). Despite these observations,precise biological function and mechanism of action ofeither PML or PML-RARa remain unclear.

Transgenic mice carrying the PML-RARa proteinproduce an APL-like phenotype (significant latency andan incomplete penetrance) (Insinga et al., 2005). It wasshown that the RARa component is indispensable for itsability to impair hematopoietic terminal differentiation,so RA target genes are thought to represent downstreameffectors of PML-RARa. The ability to silence RAtarget genes depends on its capacity to bind DNA eitheras homodimers or heterodimers with RXR and PML,recruit chromatin modifiers (HDACs and DNA-methyl-transferases – DNMTs) and induce changes in chroma-tin structure that are not permissive for transcription(Grignani et al., 1998; Lin et al., 1998; Khan et al., 2001;Di Croce et al., 2002; Segalla et al., 2003). In addition,PML-RARa has different oligomerization charac-teristics from RARa, it can homodimerize/oligomerize

Figure 1 Schematic representation of PML and RARa genes as well as the different gene products of the PML-RARa isoforms.Exons are numbered consecutively. Regions encoded by different exons are indicated by arrowheads underneath each diagram. Redtriangles denote fusion points between the PML and RARa sequences. The PML-RARa fusion gene always contains the same C-terminal region of RARa (B-F) and different sizes of the N-terminal PML sequence. Positions of the translocation breakpoint clusterregions (Bcr1–3) within the PML gene as well as the major breakpoints within the RARa gene are indicated by arrows. Bcr1, 2 and 3within the PML gene leads to the expression of the long (PML-RARa L), variable (PML-RARa V) and short (PML-RARa S) isoformof the fusion protein. In adults, PML-RARa L isoform is expressed approximately in 55% of the patients with APL, while the S and Visoforms are expressed in approximately 35 and 8% of the patients, respectively.

Activation of c-fos by PML-RARa

MI Tussie-Luna et al

3376

Oncogene

through the coiled-coil region of PML, bind to retinoicacid response elements (RARE) and act as a dominantsilencing transcription factor that represses transcriptionactivation mediated by the RAR-RXR heterodimer,which is still produced from the intact RARa allele (Linand Evans, 2000; Minucci et al., 2000; Altucci andGronemeyer, 2001). The interaction of PML-RARawith corepressor/HDAC complexes is responsible forboth transcriptional repression of target genes andsensitivity to RA. PML-RARa, in the absence of RA,recruits aberrantly corepressor complexes, such asNCoR, SMRT, mSin3a, HDAC1 or DNMTs, binds totarget promoters and represses transcription (Grignaniet al., 1998; Khan et al., 2001; Di Croce et al., 2002).High doses of RA release the corepressor/HDACcomplexes from PML-RARa and restores RARaresponsiveness of genes involved in myeloid terminaldifferentiation.

The two major PML-RARa isoforms, while havingsubtle differences in biological activity and producingslightly different APL phenotypes, have prognosticdifferences in patients treated with ATRA/chemother-apy combinations. Among newly diagnosed patients,those who expressed the short isoform appeared to haveshorter disease-free and overall survival durations thanpatients who expressed the long isoform (Jurcic et al.,2001; Sucic et al., 2002). PML-RARa L isoform isexpressed in approximately 55% of adult patients withAPL, while the S and V isoforms are expressed inapproximately 35 and 8% of patients, respectively(Zelent et al., 2001). In the pediatric population, the Visoform accounts for a larger proportion of cases than inadults (Kane et al., 1996), with a corresponding decrease

in the number of PML-RARa S cases. However, theprecise functional differences between these isoformsare not yet clear. Here, we show that in addition toantagonizing the tumor suppressor or the proapoptoticactivity of PML, both of which lend the leukemicblasts a marked survival advantage, PML-RARaL, butnot PML-RARaS, can directly promote cell growth bytranscriptionally activating the pro-proliferative gene,c-fos, in response to growth factor signaling in vitro andin vivo.

Results

Rearrangement between the RARa and PML geneWithin the RARa gene, all breakpoints map to genomicsequences lying upstream of exon 4 and as a conse-quence, the PML-RARa fusion product always containsthe same regions of RARa (B-F) containing its DNAand ligand-binding domains. In contrast, the N-terminalPML sequences joined to B-F domains of the RARashow patient-to-patient variability determined by theposition of the translocation breakpoint within the PMLgene and by alternative exon splicing. Three majorbreakpoints clusters within the PML gene have beendescribed: intron 3 (bcr3), exon 6 (bcr2) and intron 6(bcr1) (Figure 1). Patients with chromosomal break-points in bcr1, bcr2 or bcr3 express either the long (L),the medium (M) or the short (S) isoform of thePML-RARa protein (Pandolfi et al., 1992). The RNAencoding the PML-RARa L isoform can be alternativelyspliced to give PML-RARa M (medium) isoform, whichis usually coexpressed with the long isoform in a given

Figure 2 PML-RARa is a potent and specific activator of the c-fos promoter. (a) c-fos luciferase activity in the presence of increasingamounts (1, 2, 3mg) of PML or PML-RARa expression plasmids in the presence (filled columns) or in the absence (open columns) of25 ng/ml rhEGF (top panel). Cells transfected with the highest amount of PML or PML-RARa were also treated for 30 h with 1mM ofATRA. Cell extracts from indicated lanes were analysed by Western blot probed with anti-RARa antibody (a-RARa) (top blot) oranti-PML antibody (a-PML) (bottom blot). (b) Luciferase activity of PML-RARa on indicated reporter constructs. PML-RARainduced luciferase activity (1–2mg) in the presence (filled columns) or in the absence (open columns) of 25 ng/ml rhEGF (top panel).Extracts from indicated lanes were analysed by Western blot and probed with anti-RARa antibody (a-RARa) (bottom blot).



3377

Oncogene

patient (Zelent et al., 2001). Although the transcrip-tional functions of the PML-RARaS have been wellstudied, much less is known about the mechanism ofaction of the long isoform. We sought out to elucidatethe transcriptional function of PML-RARaL.

PML-RARa is a potent and specific activator of c-fospromoterBy gene array, PML-RARa upregulates 1569 anddownregulates another 1726 genes (Alcalay et al.,2003; Park et al., 2003; Nouzova et al., 2004; Meaniet al., 2005). Examples of repressed genes are RARb2and C/EBPb (Di Croce et al., 2002; Duprez et al., 2003),while examples of induced genes are Cyclin A1, p21 andc-fos (Casini and Pelicci, 1999; Muller et al., 2000;Alcalay et al., 2003; Meani et al., 2005). Given that c-fosgene is involved in proliferation, we hypothesized thatpart of the function of PML-RARa may be to directlypromote cellular growth via transcriptional regulationof c-fos. To investigate the transcriptional effect of PMLand PML-RARa on the c-fos promoter, we performeda transient co-transfection assay with c-fos luciferasereporter and either PML or PML-RARaL. PMLactivated the c-fos luciferase reporter in the absenceand in the presence of growth factor signaling and in adose-dependent manner (about seven-fold over the

vector only lane at the highest concentration used,compare lanes 2 and 10) (Figure 2a), whereas PML-RARa hyper-activated the c-fos promoter in response togrowth factor signaling in a dose-dependent manner(about 28-fold increase at the highest concentration,compare lanes 2 and 18) (Figure 2a). Importantly, PML-RARa (lanes 19–20) but not PML (lanes 11–12)mediated activation of c-fos was ATRA sensitive.Western blot analysis shows the expression levels ofthe ectopic proteins (bottom panels). However, after30 h in the presence of 1 mM ATRA, we could not detectany appreciable degradation of ectopic PML-RARaprotein (lanes 19 and 20, bottom panels), due probablyto a suboptimal concentration of ATRA used. To test ifthe PML-RARa activation of c-fos was specific for thispromoter, we tested other promoter constructs. Weobserved that activation by PML-RARa is somewhatspecific for c-fos (Figure 2b). To test whether the effectof PML-RARa is solely via the c-fos promoter orperhaps could also be observed in the context of apotent enhancer, we performed a reporter assay withc-fos promoter fused to the SV40 enhancer. A c-fospromoter construct, pSVOA-D3-c-fos-luc, was stimu-lated about nine-fold (lane 6, inset), whereas a reporterconstruct containing the murine c-fos plus the SV40enhancer, pGL3-Enh-c-fos-luc, showed a 750-foldincrease in the presence of PML-RARaL protein and

Figure 3 Upregulation of c-fos by PML-RARa is isoform specific. (a) Luciferase activity of the murine c-fos reporter construct(pSVOA-D5-c-fos-luc) in the presence of either PML-RARa L or PML-RARa S isoform (1–2mg) and in the presence (filled columns)or in the absence (open columns) of 25 ng/ml rhEGF (top panel). Extracts from indicated lanes were analysed by Western blot andprobed with anti-RARa antibody (a-RARa) (bottom blot). (b) Luciferase activity of the c-fos reporter construct with an SV40enhancer (pGL3-Enh-c-fos-luc) in the presence of PML-RARaL (1mg) or PML-RARaS (2 mg) isoform, and in the presence (filledcolumns) or in the absence (open columns) of 25 ng/ml rhEGF (top panel).



3378

Oncogene

upon growth factor signaling (lane 12). Other reporterconstructs, viz, Vb-luciferase and NF-kB-luciferase,showed only marginal induction upon growth factorsignaling, respectively, at the highest concentration ofPML-RARaL tested (lanes 18 and 30, inset), whereasa control promoter, pFR-Luc (Gal4-dependent), didnot exhibit any appreciable effect in the presence ofPML-RARaL (lane 24, inset). We conclude that PML-RARaL is a potent and specific activator of the c-fospromoter.

Upregulation of c-fos by PML-RARa is isoform specific(L vs S)We next tested whether the transcriptional activation ofc-fos is mediated by both isoforms. While PML-RARaLisoform activated the c-fos promoter substantially ina dose-dependent fashion, the short isoform failed todo so (Figure 3a). Moreover, the transcriptional effectsof PML-RARaS are also not observed when thec-fos promoter fused to the SV40 enhancer was used(Figure 3b). Thus, we conclude that the transcrip-tional activation of c-fos by PML-RARa is isoformspecific since it is mediated by the long but not the shortisoform.

Upregulation of the endogenous c-fos mRNAby PML-RARaBecause c-fos is an immediate early gene that is turnedon rapidly upon mitogenic signaling (Thomson et al.,2001; Hazzalin and Mahadevan, 2002), we tested thekinetics of endogenous c-fos induction by the twoisoforms of PML-RARa, both in the absence and inthe presence of mitogenic stimulation (20% serum), andfurther analysed whether the induction of endogenousc-fos is also sensitive to ATRA. The induction of c-fosby PML-RARaL followed the usual kinetics and thegene was maximally expressed at 45 min poststimulationin the presence of both serum and ectopic PML-RARaL(Figure 4). Although there was some activation by thePML-RARaS isoform, the induction was not above thelevel achieved by serum stimulation alone. As observedin transient transfection assays, induction of theendogenous c-fos gene by PML-RARa was alsosensitive to ATRA since prior treatment of thesecells with 2 mM ATRA for 30 h results in substantialreduction of c-fos activation (Figure 4). A Western blotanalysis showed that indeed ATRA treatment led toa significant degradation of both isoforms, althoughthe degradation appears to be more significant for thelong isoform (Figure 4, bottom panel). Taken together,these data suggest that overexpression of PML-RARaLisoform could activate the c-fos gene, but that suchactivation is ATRA sensitive and, thus, must be causedby the fusion protein.

Acetylated H4 recruitment to the c-fos promotercorrelates with activity of PML-RARa isoformsc-fos is an immediate early gene that is basally off butturned on very rapidly after signaling (Thomson et al.,2001; Hazzalin and Mahadevan, 2002). This rapidresponse precludes it to be elaborately regulated at thelevel of chromatin (Alberts et al., 1998; Thomson et al.,2001). Lack of this constraint together with rapid signal-induced transcriptional response also necessitates anunusual specificity at the level of promoter occupancy.Mechanistically, PML-RARa fusion protein functionsin most cases as a potent transcriptional co-repressor byvirtue of its tight association with HDAC proteins(Altucci and Gronemeyer, 2001). Because there are noknown RARE on the c-fos promoter (data not shown),making it unlikely that PML-RARa binds directly to thec-fos promoter, we tested whether the activation of c-fosby PML-RARaL is via indirect mechanisms involvingalteration in the chromatin structure. To test this, weanalysed the acetylation status of both histone H4 andhistone H3 by chromatin immmunoprecipitation (ChIP)assays coupled with real-time PCR in the presence andin the absence of PML-RARa isoforms in a kineticexperiment. The acetylation status of H3 did not changewith either isoforms over time, which is consistent withthe promoter being relatively open (Figure 5a). How-ever, dramatic alterations in H4 acetylation wereobserved over time with PML-RARaL but not PML-RARaS (Figure 5b). The maximal acetylation wasobserved 30 min poststimulation, which is when c-fos

Figure 4 Upregulation of c-fos mRNA by PML-RARa isoforms(L vs S) and sensitivity to ATRA. Time course of c-fos expressionupon 20% serum stimulation in NIH3T3 cells alone (opencolumns) or NIH3T3 cells transfected with PML-RARa L (14mg,filled columns) or PML-RARaS (8mg, shaded columns) isoform,assessed by real-time RT–PCR (c-fos/18S rRNA). Cells were eithertreated for 30 h with 2 mM of ATRA or untreated (top panel).Extracts from indicated samples were analysed by Western blot andprobed with anti-RARa antibody (a-RARa) (bottom blot).



3379

Oncogene

is maximally induced. While these observations weremade with a promoter region overlapping, the serumresponse element (SRE) (bottom schematics), similarobservations were made when a promoter regionadjacent to the TATA box was analysed (data notshown), suggesting that changes in the H3 and H4acetylation status is not localized to one particularregion on the c-fos promoter. Thus, PML-RARaLmediates acetylation of H4 on the promoter, therebyrendering it open for transcription.

PML-RARa L interacts physically with HDAC1and HDAC3Although it has been shown that PML-RARaS interactswith HDAC1 (Lin et al., 1998; Lin and Evans, 2000;Khan et al., 2001), the interactions of PML-RARaLwith HDAC3 have never been shown. We expressedeither Flag-tagged HDAC1 or HDAC3 with PML-RARaS or PML-RARaL isoforms in COS cells andperformed an immmunoprecipitation analysis with ananti-RARa antibody. Although expression of HDAC1was similar to that of HDAC3 (Figure 6, top rightpanel), it was evident that HDAC3 interacts with PML-RARaL much better than HDAC1 (Figure 6, top leftpanel). Much weaker interaction of HDAC1 with PML-RARaS was observed and interactions between HDAC3and PML-RARaS were not tested. Nevertheless, it isclear that PML-RARaL isoform interacts strongly withHDAC3 and to a lesser extent with HDAC1. Further-more, the long isoform interacts better with HDAC1compared to the short isoform.

HDAC3 is recruited to the c-fos promoter and its kineticscorrelates with the activity of PML-RARa isoformsPML-RARa retains both DNA and ligand bindingdomains of RARa, and thus inhibits its transcriptionalfunction through aberrant recruitment of co-repressorsand HDACs (Salomoni and Pandolfi, 2002). To addresshow might PML-RARaL induce acetylation of H4and possible recruitment of HDACs, we analysed thekinetics of HDAC3 recruitment to the c-fos promoterin the presence of PML-RARa isoforms. Interestingly,we observed that PML-RARaL but not PML-RARaSinduced recruitment of HDAC3 at the c-fos promoter15-min postsimulation, but that recruitment is abolishedby 30 min (Figure 7a). There was also an enhanced,albeit less, recruitment of HDAC3 to the promoter byPML-RARaS at 45-min poststimulation. To further testthe functional involvement of HDAC3, we cotransfectedPML-RARaL and HDAC3 in the absence and in thepresence of trichostatin A (TSA). The PML-RARaLmediated activation of the c-fos promoter was drama-tically enhanced in the presence of TSA, which inhibitsHDAC activity (Figure 7b). Conversely, HDAC3expression resulted in inhibition of the c-fos activity.

Role of SRE on c-fos promoter in PML-RARaL activityTo investigate if SRE plays a role in PML-RARaLmediated activation of the c-fos promoter, we performeda transient co-transfection assay with a luciferasepromoter construct that contains five SRE sitesupstream of a TATA box and either PML-RARaSor PML-RARaL (1 mg). PML-RARaL but not

Figure 5 AcH4 but not AcH3 recruitment to the c-fos promoter correlates with activity of PML-RARa isoforms. (a) Kinetics ofAcH3 recruitment to the c-fos promoter in the absence (open columns) or in the presence of PML-RARa L (18 mg, filled columns) orPML-RARa S (10 mg, shaded columns) isoform, upon 20% serum stimulation and assessed by real-time PCR (cfos1/amylase). (b)Kinetics of AcH4 recruitment to the c-fos promoter under the same conditions as in (a). Localization of the cfos1 primers and probeused in the assay along with known transcription factors binding sites are shown in the lower diagram.



3380

Oncogene

PML-RARaS activated this reporter construct in thepresence of 20% serum stimulation (about 2.8-fold overthe vector only lane, compare lanes 2 and 6) (Figure 8a).Importantly, PML-RARaL activity on c-fos was alsoinhibited upon ectopic expression of HDAC3 (comparelanes 6 and 12). To further test the role of the SRE sitewithin the c-fos promoter, we performed a transient co-transfection assay using a c-fos luciferase construct thatcontains a mutated SRE (SRE-ST) (Kim et al., 1998)and either PML-RARaS or PML-RARaL (1 mg). Asexpected, neither isoforms activated this reporter con-struct (Figure 8b).

Discussion

Leukemic cells are characterized by arrest of differentia-tion at a specific stage compatible with continuedproliferation and enhanced resistant to stress. Accord-ingly, the consequence of the formation of PML-RARain APL is a block of differentiation at the promyelocyticstage. It is reasonable to assume that the altered

functionality of PML in the fusion protein, such as lossof its pro-apoptotic activity or abrogation of itscorrepressor function, adds to the growth potentialor survival capacity of APL blast, whereas HDAC-dependent silencing of normal retinoid signaling duringmyelopoiesis causes the differentiation block (Altucciand Gronemeyer, 2001). PML-RARa induces DNAhypermethylation and heterochromatin formationthrough aberrant recruitment of different chromatinmodifying enzymes to specific promoters, leading to itstranscriptional silencing. But PML-RARa also has beenshown to upregulate a number of genes on differentmicroarray setups (Alcalay et al., 2003; Park et al., 2003;Nouzova et al., 2004; Meani et al., 2005). Either PML-RARa has acquired new DNA-binding propertiesdifferent from those of the RARa (Hauksdottir andPrivalsky, 2001) such that it does not only bind toRAREs, or it can also upregulate target genes throughindirect mechanisms (Duprez et al., 2003; Duprez,2004). Thus, the transcriptional activity of PML-RARain the absence of specific RARE sequences in most ofthe myeloid gene promoters and the c-fos promoter can

Figure 6 PML-RARa L isoform interacts physically with HDAC1 and HDAC3. Whole-cell extracts of COS7 cells transfected witheither FLAG-HDAC1 (7mg) or FLAG-HDAC3 (13mg) alone or plus PML-RARaL (20mg) or PML-RARaS (12mg) isoform weresubjected to immunoprecipitation with anti-RARa antibody. Immunoprecitations with anti-RARa antibody developed first, with a-FLAG antibody (a-FLAG) (top) and then stripped and reprobed with anti-RARa antibody (a-RARa) (bottom). Western blots ofwhole-cell extracts probed with anti-FLAG antibody (a-FLAG) (top), stripped and reprobed with anti-RARa antibody (a-RARa)(bottom).



3381

Oncogene

be explained. Consistent with an indirect mechanism, weshow that the PML-RARa long isoform can stimulatethe c-fos promoter via its antirepressor activity.

RARa is a member of the superfamily of nuclearhormone receptors (Soprano et al., 2004). It binds tospecific RAR elements (RARE) as heterodimer withretinoid X receptors (RXR). Retinoic acid (RA)modulates the activity of RARa/RXR. In the absenceof RA, RARa/RXR recruits repressor complexes(SMRT/mSin3a/HDAC1) and represses target genes.In the presence of physiological levels of RA, corepres-sor complexes are released and the receptor associateswith transcriptional coactivators (PML, ATP-dependentchromatin remodeling complexes, HATs and RNApolymerase II) to transactivate target genes critical forthe induction of myelod terminal differentiation.

In general, PML-RARa acts as a dominant-negativeof RARa activities. In the case of AP-1 transcriptionalactivity, where usually RARa is a potent RA-dependentinhibitor of AP-1, PML-RARa transforms into aRA-dependent activator of AP-1 (Doucas et al., 1993).Given that AP-1 consists of fos and jun, it is likely thatthe effects seen before are due to activation of c-fos.However, PML-RARa acts not only as a dominant-negative of RARa but also of PML activities. Forinstance, it has been shown that wild-type PML acts as a

cofactor of p53, favors its post-transcriptional modifica-tions (phosphorylation and acetylation) and enhancesits activity. Inactivating p53 mutations are the mostcommon genetic alteration found in human cancers;however, mutations in p53 are extremely rare in APL.Nevertheless, it was found that PML-RARa associateswith p53 and, by recruitment of HDAC, causesdeacetylation and subsequent degradation/inhibition ofp53 via the proteasome/Mdm2 pathway in hematopoie-tic precursors. PML-RARa induced p53 deacetylation/degradation results in downregulation of p53 dependenttranscription and inhibition of p53-dependent stressresponses (Insinga et al., 2004). PML-RARa expressionin primary hematopoietic cells enhances survival underconditions of various p53-dependent stresses and thiseffect depends on the presence of wt PML (Insinga et al.,2004,). Inhibition of p53 is achieved by the capacityof PML-RARa to associate with the product ofthe remaining wild-type PML allele. PML acts as amolecular bridge between p53 and the PML-RARafusion protein. Enhanced survival of primary hema-topoietic cells upon expression of PML-RARa is incontrast to what was found previously in a wide numberof cell lines (including hematopoietic cell lines), wherePML-RARa expression lead to apoptosis rather thanenhanced survival (Ferrucci et al., 1997).

Figure 7 Role of HDAC3 in PML-RARa activity on c-fos promoter. (a) HDAC3 is recruited to the c-fos promoter and its kineticscorrelates with the activity of PML-RARa isoforms. Kinetics of HDAC3 recruitment to the c-fos promoter in the absence (opencolumns) or in the presence of PML-RARa L (12mg, filled columns) or PML-RARa S (10mg, shaded columns) isoform, on 20% serumstimulation, assessed by real-time PCR (cfos1/gapdh). (b) Inhibition of HDAC activity enhances PML-RARa mediated activation ofthe c-fos promoter. COS7 cells were transfected with PML-RARaL alone (1mg), FLAG-HDAC3 alone (2mg) or PML-RARaL plusFLAG-HDAC3, untreated or treated with 100 nM of TSA (trichostatin) for 26.5 h and c-fos luciferase activity was assessed in thepresence (filled columns) or in the absence (open columns) of 20% serum (top panel). Cell extracts from indicated samples wereanalysed by Western blot probed with anti-RARa (a-RARa) (top) or anti-FLAG (a-FLAG) (bottom) antibodies, respectively.



3382

Oncogene

While the biological functions of PML-RARa are wellstudied, mechanisms of its action are less clear. This iscompounded by the fact that there are several alter-natively spliced isoforms of PML-RARa. Most of whatis known in the literature regarding the function ofPML-RARa is for the short isoform. Given the fact that55% of the APL patients exhibit the long isoform, webecame interested in deciphering its transcription func-tions. Our results suggest a novel pro-proliferativefunction for PML-RARaL via activation of the c-fosgene, which is sensitive to both ATRA and TSA. This isimportant since ATRA and TSA (HDAC inhibitor)restores terminal differentiation and remission of APLphenotype. However, we wish to emphasize that ATRA/chemotherapy is used largely as a postremission treat-ment and currently arsenic trioxide (ATO) is consideredthe treatment of choice for patients with relapseddisease. One of the surprising aspects of our model(Figure 9) is that PML-RARaL first induces recruitmentof HDAC3 to the c-fos promoter before induction ofthe gene begins. Subsequently, HDAC3 recruitment tothe promoter is abolished when maximal activation of

the gene ensues with. Given that PML-RARaL interactsstrongly with HDAC3, we propose that PML-RARaLremoves HDAC3 from the promoter, which allowsacetylation of H4 and concomitant recruitmentof signal-induced activators like TFII-I and SRF(Figure 9). Because HDAC3 has specificity for H4K5,upon removal of HDAC3 by PML-RARaL in thepresence of serum, a rapid reversal of H4 acetylation canbe expected (Codina et al., 2005; Hartman et al., 2005).Our results suggest an antirepressor activity forPML-RARaL rather than a direct activation function.Removal of HDAC3 in response to growth factorsignaling could thus, allow recruitment of co-activatorslike CBP/p300, which is known to interact with Elk/TCF and be recruited to the c-fos promoter (Nissenet al., 2001; Li et al., 2003). We believe this is a highlycoordinated process since it is specific for c-fos but couldbe true for other promoters where PML-RARaL hasindirect stimulatory effect, like on AP-1 responsivepromoters (Doucas et al., 1993). In this context, SRFmust also play an important role in coordinating theseresponses since PML-RARa mediated activation of the

Figure 8 Role of SRE in activation of the c-fos promoter by PML-RARa. (a) Luciferase activity of an (SRE)5-luciferase reporterconstruct in the presence of either PML-RARaS or PML-RARaL isoform (1mg) and in the presence (filled columns) or in the absence(open columns) of 20% serum. Extracts from the indicated lanes were analysed by Western blot and probed with anti-RARa antibody(top blot) or with anti-FLAG antibody (bottom blot). (b) Luciferase activity of a c-fos reporter construct containing a mutated SREsite in the presence of either PML-RARaS or PML-RARaL isoform (1mg) and in the presence (filled columns) or in the absence (opencolumns) of 20% serum.



3383

Oncogene

c-fos promoter appears largely via the SRE. The precisereason for c-fos promoter selectivity by PML-RARaL iscurrently unknown and elucidation of this mechanismwill be a challenge for the future. Our results suggest anovel pro-proliferative function for PML-RARaL viaactivation of the c-fos gene and predicts an increasedcellularity in patients that carry this isoform, althoughprecise and accurate analysis will be needed.

Materials and methods

Cell culture and plasmidsNIH3T3 and COS7 cells were grown under standard conditions.The pCMV-Tag2-FLAG-PML and pCMV-Tag2B-FLAG-PML-RARaS vectors were obtained from Dr Pier PaoloPandolfi (Memorial Sloan-Kettering Cancer Center, New York,NY, USA) and pCGN-PML-RARaL from Dr Donald Bloch(Massachussets General Hospital, Boston, MA, USA).

Transient transfections and reporter assaysTransfections in NIH3T3 (Figures 4, 5 and 7) and COS7(Figures 2, 3, 6 and 8) cells were carried out with Polyfect(Qiagen) or Fugene (Roche) and Lipofectamine (Invitrogen),respectively. For reporter assays, cells were serum-starved for

14–16 h and stimulated with 20% serum for 4 h. The luciferasereporter constructs used are: pSVOA-D5-c-fos-luc, containingthe wild-type murine c-fos promoter; pGL3-Enh-c-fos-luc,containing an SV40 enhancer and the wild-type murine c-fospromoter; pSVOA-D5-(SRE-ST)-c-fos-luc, containing themurine c-fos promoter with a mutated SRE site (SRE-ST:50GGATATTACC30) (Kim et al., 1998) and, p(SRE)5-luc,containing only five SREs in tandem (Stratagene). Luciferaseactivity was assessed using the Dual Luciferase kit (Promega).

Chromatin immunoprecipitation (ChIP)NIH3T3 cells were transfected with PML-RARa L or Sisoform and 22 h later, cells were serum starved for 43 h andthen, serum stimulated with DMEM/20% FCS for 0, 15, 30,45 and 60 min. Cells were fixed directly by adding formalde-hyde to a final concentration of 1% for 10 min at roomtemperature. ChIP assays were performed according to theprotocol of Chromatin Immunoprecipitation Assay Kit(Upstate Biotechnology Inc., Lake Placid, New York, USA)with minor modifications. Fixation was stopped by incubationwith a final concentration of 0.125 M glycine for 5 min,and elution from the beads was performed twice at 651Cfor 15 min. Anti-acetyl-histone H3 (Cat. No. 06-599, 5 ml),anti-acetyl-H4 (Cat. No. 06-866, 4 ml) were from UpstateBiotechnology Inc. Anti-HDAC3 (H-99, 5ml) was from Santa

Figure 9 Model of c-fos activation by PML-RARa. HDAC activity is partially responsible for keeping basal expression levels of c-foslow or off. In the presence of PML-RARa and within the first 15 min of 20% serum stimulation, more HDAC3 is recruited to the c-fospromoter but within the next 15 min (30 min post-stimulation), PML-RARa binds to the recruited HDAC3, strip off the deacetylaseactivity from the c-fos promoter, and thus favor opening of the chromatin as a result of increased recruitment of AcH4 and probablyincreased recruitment of HAT activity. This acetylation leads, presumably, to a more open chromatin structure and facilitatestranscription initiation by RNA polymerase II.



3384

Oncogene

Cruz Biotechnology, Inc. DNA samples from ChIP assayswere analysed by real-time PCR using a GeneAmp 5700instrument and Amplitaq PCR master mix (Applied Biosys-tems, Branchburg, NJ, USA). The sequences of the real-timePCR primers were as follows: c-fos1 50 CCTTTACACAGGATGTCCATATTAGGA 30, 50 CGTGTAGGATTTCGGAGATGGT 30; amylase 50 GCTTTCCCTCATTGGGTTCTG30, 50 CGCTCACATTCCTTGGCAATAT 30. The sequencesof the Taqman probes were: c-fos1 50 6FAM TGCGTCAGCAGGTTT-MGBNFQ 30 and amylase, 50 6FAM-CCTGTTCGAGTGGCGCTGGGTT-MGBNFQ 30. Primers and probefor rodent GAPDH were purchased from Applied Biosystems(P/N 4308313). Relative fold induction is expressed as the ratioof cfos1/amylase or cfos1/gapdh, calculated both, as % ofinput that was immunoprecipitated. Amylase, a pancreaticspecific gene, was used as a control for the recruitment ofacetylated histones and GAPDH, a housekeeping gene, wasused as a control for the recruitment of HDAC3.

Real-time RT–PCRRNA was prepared using the RNeasy kit from Qiagen andcDNA was prepared in 20 ml out of 1mg of total RNA using

the Taqman Reverse Transcription Reagents from AppliedBiosystems (P/N N808-0234). The sequences of the c-fos real-time RT–PCR primers were 50 ATCCGAAGGGAACGGAATAAG 30 and 50 CAACGCAGACTTCTCATCTTCAA 30.The sequence of the c-fos RT Taqman probe was 50 6FAM-TCCAAGCGGAGACAGA-MGBNFQ 30. The primers andprobe for eukaryotic 18S rRNA were purchased from AppliedBiosystems (P/N 4319413). Relative fold induction is expressedas the ratio of cfos1/18S.

Acknowledgements

We thank Dr Pier Paolo Pandolfi for providing the PMLand PML-RARaS isoform constructs. We thank Dr DonaldBloch for providing the PML-RARaL isoform construct.We thank Munya Al-Fulaij for the p(SRE)5-luc contruct.We also thank the Roy lab members for helpful discussions.We are particularly grateful to Edouard Vannier for helpwith the design of all real-time c-fos primers and probes.This work is supported in part by NIH grant (AI056240)to ALR.

References

Alberts AS, Geneste O, Treisman R. (1998). Cell 92: 475–487.Alcalay M, Meani N, Gelmetti V, Fantozzi A, Fagioli M,

Orleth A et al. (2003). JCI 112: 1751–1761.Altucci L, Gronemeyer H. (2001). Nat Rev 1: 181–193.Casini T, Pelicci PG. (1999). Oncogene 18: 3235–3243.Codina A, Love JD, Li Y, Lazar MA, Neuhaus D, Schwabe

WR. (2005). Proc Natl Acad Sci USA 102: 6009–6014.Cress WD, Seto E. (2000). J Cell Physiol 184: 1–16.de The H, Lavau C, Marchio A, Chomienne C, Degos L,

Dejean A. (1991). Cell 66: 675–684.Di Croce L, Raker VA, Corsaro M, Fazi F, Fanelli M, Faretta

M et al. (2002). Science 295: 1079–1082.Doucas V, Brockes J, Yaniv M, deThe H, Dejean A. (1993).

Proc Natl Acad Sci USA 90: 9345–9349.Duprez E. (2004). Cell Cycle 3: 389–390.Duprez E, Wagner K, Koch H, Tenen DG. (2003). EMBO J22: 5806–5816.

Ferrucci PF, Grignani F, Pearson M, Fagioli M, Nicoletti I,Pelicci PG. (1997). Proc Natl Acad Sci USA 94:10901–10906.

Goddard AD, Borrow J, Freemont PS, Solomon E. (1991).Science 254: 1371–1374.

Grignani F, De Matteis S, Nervi C, Tomassoni L, Gelmetti V,Cioce M et al. (1998). Nature 391: 815–818.

Grignani F, Ferrucci PF, Testa U, Talamo G, Fagioli M,Alcalay M et al. (1993). Cell 74: 423–431.

Guo A, Salomoni P, Luo J, Shih A, Zhong S, Gu W et al.(2000). Cell Biol 2: 730–736.

Hake SB, Xiao A, Allis CD. (2004). Br J Cancer 90: 761–769.Hartman HB, Yu J, Alenghat T, Ishizuka T, Lazar MA.

(2005). EMBO Rep 6: 445–451.Hauksdottir H, Privalsky ML. (2001). Cell Growth Differ 12:

85–98.Hazzalin CA, Mahadevan LC. (2002). Nat Rev 31: 30–40.Insinga A, Monestiroli S, Ronzoni S, Carbone R, Pearson M,

Pruneri G et al. (2004). EMBO J 10: 1144–1154.Insinga A, Pelicci PG, Minucci S. (2005). Cell Cycle 4: 67–69.Jurcic JC, Nimer SD, Scheinberg DA, DeBlasio T, Warrell Jr

RP, Miller Jr WH. (2001). Blood 98: 2651–2656.Kane JR, Head DR, Balaz L, Hulshof MG, Motroni TA,

Raimondi SC et al. (1996). Leukemia 10: 1296–1302.

Khan MM, Nomura T, Kim H, Kaul SC, Wadhwa R,Shinagawa T et al. (2001). Mol Cell 7: 1233–1243.

Kim DW, Cheriyath V, Roy AL, Cochran BH. (1998).Mol Cell Biol 18: 3310–3320.

Lallemand-Breitenbach V, Zhu J, Puvion F, Koken M,Honore N, Doubeikovsky A et al. (2001). J Exp Med 193:1361–1372.

Li QJ, Yang SH, Maeda Y, Sladek FM, Sharrocks AD,Martins-Green M.. (2003). EMBO J 22: 281–291.

Lin R, Evans R. (2000). Mol Cell 5: 821–830.Lin RJ, Nagy L, Inoue S, Shao W, Miller Jr WH, Evans RM.

(1998). Nature 391: 811–814.Lunghi P, Tabilio A, Lo-Coco F, Pelicci P, Bonati A. (2005).

Leukemia 19: 234–244.Marmorstein R. (2001). Nat Rev 2: 422–432.Meani N, Minardi S, Licciulli S, Gelmetti V, Coco FL, Nervi

C et al. (2005). Oncogene 24: 3358–3368.Minucci S, Maccarana M, Cioce M, De Luca P, Gelmetti V,

Segalla S et al. (2000). Mol Cell 5: 811–820.Muller C, Yang R, Park DJ, Serve H, Berdel WE, Koeffler P.

(2000). Blood 96: 3894–3899.Narlikar GJ, Fan HY, Kingston RE. (2002). Cell 108: 475–487.Nissen LJ, Gelly JC, Hipskind RA. (2001). J Biol Chem 276:

5213–5221.Nouzova M, Holtan N, Oshiro MM, Isett RB, Munoz-

Rodriguez JL, List AF et al. (2004). J Pharmacol Exp Ther311: 968–981.

Pandolfi PP. (2001). Hum Mol Gen 10: 769–775.Pandolfi PP, Alcalay M, Fagioli M, Zangrilli D, Mencarelli A,

Diverio D et al. (1992). EMBO J 11: 1397–1407.Park DJ, Vuong PT, de Vos S, Douer D, Koeffler HP. (2003).

Blood 102: 3727–3736.Quignon F, De Bels F, Koken M, Feunteun J, Ameisen JC,

de The H. (1998). Nat Genet 20: 259–265.Salomoni P, Pandolfi PP. (2002). Cell 108: 165–170.Segalla S, Rinaldi L, Kilstrup-Nielsen C, Badaracco G, Minucci

S, Pelicci PG et al. (2003). Mol Cell Biol 23: 8795–8808.Soprano DR, Qin P, Soprano KJ. (2004). Annu Rev Nutr 24:

201–221.Sucic M, Zadro R, Burazer B, Labar B, Nemet D, Mrsic Met al. (2002). J Hematother Stem Cell Res 11: 941–950.



3385

Oncogene

Thomson S, Clayton AL, Mahadevan LC. (2001). Mol Cell 8:1231–1241.

Wang ZG, Delva L, Gaboli M, Rivi R, Giorgio M, Cordon-Cardo C et al. (1998a). Science 279: 1547–1551.

Wang ZG, Ruggero D, Ronchetti S, Zhong S, Gaboli M,Rivi R et al. (1998b). Nat Genet 20: 266–272.

Zelent A, Guidez F, Melnick A, Waxman S, Licht JD. (2001).Oncogene 20: 7186–7203.

Zhong S, Muller S, Freemont PS, Dejeann A, PandolfiPP. (2000a). Blood 95: 2748–2753.

Zhong S, Salomoni P, Pandolfi PP. (2000b). Nat Cell Biol 2:E85–E90.

Zhu J, Gianni M, Kopf E, Honore N, Chelbi-Alix M, KokenM et al. (1999). Proc Natl Acad Sci USA 96: 14807–14812.

Zhu J, Lalleman-Breitenbach V, de The H. (2001). Oncogene20: 7257–7265.



3386

Oncogene

Documents

Pro-proliferative function of the long isoform of PML-RARα involved in acute promyelocytic leukemia