Journal of Neurochemistry, 2001, 77, 1396±1406

Pharmacological and functional characterization of muscarinic

receptor subtypes in developing oligodendrocytes

Fadi Ragheb,*,1 Eduardo Molina-Holgado,*,1,2 Qiao-Ling Cui,* Amani Khorchid,*Hsueh-Ning Liu,* Jorge N. Larocca² and Guillermina Almazan*

*Department of Pharmacology and Therapeutics, McGill University, Montreal, Quebec, Canada

²Department of Neurology, Albert Einstein College of Medicine, Bronx, New York, USA

Abstract

This study focused on the molecular and pharmacological

characterization of muscarinic acetylcholine receptors

expressed by progenitors and differentiated oligodendrocytes.

We also analyzed the role of muscarinic receptors in

regulating downstream signal transduction pathways and the

functional signi®cance of receptor expression in oligodendro-

cytes. RT-PCR analysis revealed the expression of transcripts

for M3, and to a lesser extent M4, followed by M1, M2 and M5

receptor subtypes in both progenitors and differentiated

oligodendrocytes. Competition binding experiments using

[3H]N-methylscopolamine and several antagonists, as well

as inhibition of carbachol-mediated phosphoinositide hydro-

lysis, showed that M3 is the main subtype expressed in these

cells. In progenitors the activation of p42/44-mitogen-activated

protein kinase (MAPK) and cAMP-response element binding

protein (CREB) as well as c-fos mRNA expression were

blocked by the M3 relatively selective antagonist, 4-DAMP,

and its irreversible analogue, 4-DAMP-mustard. Carbachol

increased proliferation of progenitors, an effect prevented by

atropine and 4-DAMP, as well as by the MAPK kinase inhibitor

PD98059. These results indicate that carbachol modulates

oligodendrocyte progenitor proliferation through M3 receptors,

involving activation of a MAPK signaling pathway. Receptor

density and phosphoinositide hydrolysis are down-regulated

during oligodendrocyte differentiation. Functional conse-

quences of these events are a reduction in carbachol-

stimulated p42/44MAPK and CREB phosphorylation, as well

as induction of c-fos.

Keywords: carbachol, c-fos, CREB, muscarinic receptor,

oligodendrocyte, p42MAPK.

J. Neurochem. (2001) 77, 1396±1406.

Oligodendrocytes produce myelin, the insulating sheath that

facilitates nerve impulse conduction. Recent reports indicate

that oligodendrocytes maintain a dynamic communication

with neurons through their neurotransmitter receptors.

Indeed, cortical oligodendrocytes form contacts with

noradrenergic boutons resembling symmetrical synapses

(Paspalas and Papadopoulos 1996) and functional glutama-

tergic synapses terminating on oligodendrocyte progenitors

have been reported (Bergles et al. 2000). In addition,

glutamatergic, GABA, and purinergic receptors have been

identi®ed on oligodendrocytes, in vitro or in situ, using Ca21

imaging and electrophysiological techniques (see for review

Belachew et al. 1999).

Studies from our laboratory and others demonstrated the

capacity of oligodendrocytes to respond to cholinergic

stimulation via muscarinic receptors (mAChR), (Ritchie

et al. 1987; Kastritsis and McCarthy 1993; Cohen and

Almazan 1994; Takeda et al. 1995). The family of mAChR

is composed of ®ve subtypes (M1±M5) with different

1396 q 2001 International Society for Neurochemistry, Journal of Neurochemistry, 77, 1396±1406

Received February 2, 2001; revised manuscript received March 15,

2001; accepted March 15, 2001.

Address correspondence and reprint requests to Dr Guillermina

Almazan, Department of Pharmacology and Therapeutics, McGill

University, 3655 Sir-William Osler Promenade, Montreal, Quebec H3G

1Y6, Canada. E-mail: galmazan@pharma.mcgill.ca1Both authors contributed equally to this paper.2Present address, Instituto Cajal, CSIC, Madrid, Spain

Abbreviations used: ATR, atropine; bFGF, basic ®broblast growth

factor; [Ca21]i, intracellular calcium; CCh, carbachol; CS, calf serum;

CREB, cAMP-response element binding protein; 4-DAMP, 4-dipheny-

lacetoxy-N-methylpiperidine methiodide; DMEM, DIV, days in vitro;

Dulbecco's, modi®ed Eagle's medium; FCS, fetal calf serum;

G-protein, guanine nucleotide-binding protein; IPs, total [3H]inositol

phosphates; p42MAPK, p42 mitogen activated protein kinase; MET,

methoctramine; mAChR, muscarinic acetylcholine receptor; M1±M5,

muscarinic receptor subtypes; OD, optical density; PDGF, platelet-

derived growth factor-AA; PLC, phospholipase C; PI, phosphoinositide;

PIR, pirenzepine; PKC, protein kinase C; [3H]NMS, [3H]N-methylsco-

polamine; SFM, serum free medium; RT-PCR, reverse-transcriptase

polymerase chain reaction.

molecular and pharmacological properties (for a review see

Caul®eld and Birdsall 1998). All mAChR subtypes possess

seven membrane-spanning domains and transduce their

biological effects through association with the a subunits of

Gi, Go or Gq proteins. Type-M1 receptors (M1, M3 and M5)

are positively coupled to phospholipase C, while type M2

(M2, M4) negatively regulate adenylyl cyclase. At present it

is unknown whether the ®ve mAChR subtypes are expressed

in cells of oligodendrocyte lineage. However, progenitors

and mature oligodendrocytes in culture respond to muscari-

nic stimulation (Ritchie et al. 1987; Kastritsis and McCarthy

1993; Cohen and Almazan 1994; Takeda et al. 1995). In a

previous study we reported the presence of M1 and M2

mAChR mRNAs in developing oligodendrocytes (Cohen

and Almazan 1994). In these cells, activation of mAChRs

with carbachol (CCh), a stable acetylcholine analogue,

increases inositol-1,4,5 trisphosphate (IP3) and intracellular

Ca21 levels (Ritchie et al. 1987; Kastritsis and McCarthy

1993; Cohen and Almazan 1994), while decreasing

b-adrenergic-stimulated formation of cAMP (Cohen and

Almazan 1994). In addition, CCh triggered Ca21 waves

(Simpson and Russell 1996), inhibited an inwardly rectify-

ing K1 channel (Karschin et al. 1994), activated p42/

44MAPK and c-fos gene expression and increased prolifera-

tion of oligodendrocyte progenitor (Cohen et al. 1996;

Larocca and Almazan 1997).

The response of oligodendrocytes to muscarinic agonists

is developmentally regulated. After 6 days in vitro (DIV),

CCh-mediated IP3 accumulation observed in galactocere-

broside positive (GC1) oligodendrocytes was several times

lower than that obtained in oligodendrocyte progenitors

(Cohen and Almazan 1994). Similarly, after 8 DIV only

10% of GC1 cells showed an increase in [Ca21]i in response

to CCh (He and McCarthy 1994). Furthermore, CCh

stimulated the phosphorylation of CREB in young oligo-

dendrocytes isolated from four-day-old rat cerebrum, but not

in oligodendrocytes isolated from 11-day-old or older rats

(Sato-Bigbee et al. 1999).

The mechanisms that modulate the oligodendrocyte

response to acetylcholine during development remain

largely unknown. It is possible that mAChR density and/or

their coupling with second messenger systems are down-

regulated during development. An alternative possibility is

that the subtypes of mAChR expressed change during

oligodendrocyte differentiation. In this work we have

made considerable progress towards the clari®cation of

these issues. We have characterized the subtypes of

mAChRs present in progenitors and mature oligodendro-

cytes and assessed their level of expression using

pharmacological and molecular approaches. In addition,

we identi®ed the mAChR subtype that mediate down-

stream cholinergic signaling events, including phosphoi-

nositide hydrolysis, activation of both p42/44MAPK and

CREB as well as c-fos mRNA expression. Finally, we

examined the role of muscarinic receptors in oligoden-

drocyte proliferation.

Materials and methods

Materials

The following reagents were obtained from the indicated supplier:

Dulbecco's Modi®ed Eagle Medium (DMEM), Ham's F12, Hank's

balanced salt solution, 7.5% bovine serum albumin (BSA) fraction

V, fetal calf serum (FCS), calf serum (CS), 4-(2-hydroxyethyl)-1-

piperazineethanesulfonic acid (HEPES), penicillin/streptomycin

mix, SuperScript II and PLATINUM Taq DNA Polymerase High

Fidelity from Gibco/BRL (Burlington, Ontario, Canada); proges-

terone, biotin, sodium selenite, insulin, putrescine, carbachol,

atropine methyl bromide, Triton X-100, poly-d-lysine, hydrocorti-

sone-21-P, transferrin and 3,3 0,5-tri-iodo-l-thyronine from Sigma-

Aldrich Canada (Oakville, Ontarion, Canada); methoctramine,

4-DAMP methiodide, 4-DAMP-mustard, pirenzepine, and tropica-

mide from RBI (Natick, MA, USA); human recombinant platelet

derived growth factor-AA (PDGF-AA) and basic ®broblast growth

factor (bFGF) from PeproTech Inc (Rocky Hill, NJ, USA);

[3H]N-methylscopolamine ([3H]NMS) (82 Ci/mmol) and the che-

miluminescence detection kit (ECL) from Amersham Canada Ltd.

(Oakville, Ontario, Canada). Phospho-speci®c p42/44MAPK anti-

body (Thr183 and Tyr185) was obtained from Promega (Montreal,

Quebec, Canada); phospho-speci®c CREB antibody from New

England Biolabs (Mississauga, Ontario, Canada) and the MAPK

kinase inhibitor (MEK) PD98059 from Calbiochem (La Jolla, CA,

USA). Secondary antibodies used for immuno¯uorescence were

purchased from Jackson Immunoresearch Laboratories (West

Grove, PA, USA); analytical-grade Dowex 1-X8 (AG1-X8100±

200 mesh) from Bio-Rad (Mississauga, Ontario, Canada);

myo[3H]inositol (12.3 Ci/mmol) from Dupont Co. (Mississauga,

Ontario, Canada); Immobilon-P membranes from Millipore

(Mississauga, Ontario, Canada), Oligotex columns from Qiagen

(Mississauga, Ontario, Canada). All other reagents were obtained

from VWR (Mount Royal, Quebec, Canada) ICN (Montreal,

Quebec, Canada) or Fisher (Ottawa, Ontario, Canada).

Serum free medium (SFM) is de®ned as DMEM: F12 (1 : 1)

containing 25 mg/mL human transferrin, 30 nm triiodothyronine,

20 nm hydrocortisone-21-P, 20 nm progesterone, 10 nm biotin,

30 nm selenium, 5 mg/mL insulin, 1 mg/mL putrescine, 0.1% BSA,

50 units/mL penicillin, 50 mg/mL streptomycin. Complete medium

is composed of DMEM: F12 (1 : 1) containing 50 units/mL

penicillin plus 50 mg/mL streptomycin and 12% FCS.

Primary culture preparation

Cultures were generated as described by Almazan et al. (1993),

according to the modi®ed technique of McCarthy and de Vellis

(1980). Oligodendrocyte progenitors, also termed O-2 A progeni-

tors for their ability to generate oligodendrocytes and type-2

astrocytes in vitro, were plated on 6-well dishes at a density of

15 � 103 cells/cm2 in order to expand their numbers and prevent

differentiation. The cultures were grown in SFM containing 2.5 ng/

mL bFGF and PDGF-AA (SFM 1 GF) for 4 days. Morphological

examination established that the progenitor cultures were essen-

tially homogeneous bipolar cells, and acquired rami®ed processes

as they differentiated to mature oligodendrocytes in vitro. The

Muscarinic receptors in oligodendrocytes 1397

q 2001 International Society for Neurochemistry, Journal of Neurochemistry, 77, 1396±1406

cultures were immunocytochemically characterized as previously

described (Cohen and Almazan 1994; Radhakrishna and Almazan

1994). Ninety ®ve percent of the cells reacted positively with the

monoclonal antibody A2B5, a marker of oligodendrocyte progeni-

tors, and less than 5% were galactocerebroside (GC) positive

oligodendrocytes, glial ®brillary acidic protein positive astrocytes

or complement type-3-positive microglia. When progenitors were

cultured for 12 additional days in SFM containing 3% CS the cells

acquired complex morphology and the oligodendrocyte markers

GC1 and myelin basic protein (MBP1).

Reverse-transcriptase polymerase chain reaction

RNA was extracted from adult rat brain or from oligodendrocyte

cultures on a cesium chloride cushion and treated with DNase I to

remove traces of genomic DNA. For oligodendrocytes and

progenitor cells, polyA1RNA was puri®ed from total RNA with

Oligotex columns. Five mg of total RNA from brain or , 0.5 mg of

polyA1RNA from oligodendrocyte cultures (equivalent to 60 mg

of total RNA) was reversed transcribed with SuperScript II and

10 pmol of random hexamer. RNA was removed by RNase treat-

ment and the reaction was split into seven aliquots. These multiple

cDNA panels were subjected to PCR with PLATINUM Taq High

Fidelity DNA Polymerase and 5 pmol of each speci®c primer for

35 cycles; 948C denaturation for 1 min, 558C primer annealing for

1 min and 728C extension for 1 min. To exclude the presence of

genomic DNA, RNAs with and without reverse transcription were

used as controls with b-actin primers. Primers for rat mAChRs and

b-actin were derived from published nucleotide sequences (Nudel

et al. 1983; Bonner et al. 1987; Liao et al. 1989) and were obtained

from the GenBank data base with accession numbers M16406(M1),

AB017655(M2), M16409(M3), M16406(M4), M22926(M5) and

V01217(b-actin) as shown below. The PCR products were resolved

on a 1.5% agarose gel and stained with ethidium bromide:

Rm1a, 5 0-860AGCTCAGAGAGGTCACAA878-3 0;Rm1b, 5 0-1150TCGGTCTCG-GCCTTTCTTGGT1130-3 0 (PCR

product size 290 bp);

Rm2a, 5 0-18TCCTCGAACAATGGCTTGGCTAT41-3 0;Rm2b, 5-500CCTACGATGAACTGCCCAGAAGAGA477-3 0

(PCR product size 482 bp);

Rm3a, 5 0-978GGTTCACCACCAAGAGCTGG997-3 0;Rm3b, 5 0-1357GGTCTTGCCTGT-GTCCACGG1338-3 0 (PCR

product size 379 bp);

Rm4a, 5 0-72TGGAGACAGTGGA-GATGGTGTTCA97-3 0;Rm4b, 5 0-615ACAGGCAGGTAGAAGGCAGCAATG592-3 0

(PCR product size 544 bp);

Rm5a, 5 0- 1651GGCTGACCTCCAAGGTTCTG1671-3 0;Rm5b, 5 0-2084GAGTCTGTGAGCAGAGCTG2064-3 0 (PCR

product size 433 bp).

Radioligand binding experiments

Cells growing in 6-well dishes (around 100 mg protein/well for

progenitors and 300 mg protein/well for mature cells) were

incubated for 16 h at 48C in 1 mL of buffer containing 1 nm

[3H]NMS (Fisher 1988). For saturation binding experiments,

0.01±4 nm concentrations of radioligand were used. Competition

binding assays were performed with 0.75 nm [3H]NMS and the

mAChR antagonists atropine, pirenzepine, 4-DAMP, methoctra-

mine and tropicamide (10 pm20.5 mm). The binding reactions

were terminated by two rapid washes with ice-cold buffer. Cells

were solubilized in 250 mL of 0.2 N NaOH/0.1% Triton X-100 and

radioactivity was determined by liquid scintillation spectrometry.

Counting ef®ciency was 50% and values in dpm were used to

calculate fmol of ligand bound. Non-speci®c binding determined in

the presence of 25 mm atropine (Fisher 1988) was 15% at 1 nm

[3H]NMS.

Total [3H]inositol phosphates measurements

Cells were incubated for 18 h with 1mCi/mL of [3H]myo-inositol in

inositol-free DMEM containing the components found in SFM

(labeling media) plus 2.5 ng/mL bFGF and PDGF-AA (for

progenitors) or labeling media alone for mature cells as described

(Cohen and Almazan 1994). The inhibition pro®les of CCh-

mediated IP accumulation were determined with the mAChR

antagonists atropine, pirenzepine and 4-DAMP (10 pm-0.5 mm),

which were added to the cultures 10 min before stimulation with

1 mm CCh plus 10 mm LiCl. Total [3H]inositol phosphates were

determined as described (Berridge et al. 1983). Labeled IPs were

collected in 1.2 N ammonia formate in 0.1 N formic acid after free

inositol and glycerophosphate fractions were eluted from the

column.

Western immunoblot analysis

Cells were stimulated, harvested in sample buffer (62.5 mm Tris-

HCl, pH 6.82% w/v sodium dodecyl sulfate (SDS), 10% glycerol,

50 mm dithiothreitol, 0.1% w/v bromophenol blue) and boiled for

5 min as described (Larocca and Almazan 1997). Twenty

micrograms of protein extracts were resolved by SDS-polyacryla-

mide gel electrophoresis (10%, SDS±PAGE), transferred to

Immobilon-P membranes and incubated with antiphospho-speci®c

p42/44MAPK (1 : 10000) or antiphospho-speci®c CREB (1 : 1000).

The membranes were incubated with horseradish peroxidase-

conjugated secondary antibodies and visualized by chemilumines-

cence. The signals were quanti®ed with a Master Scan Interpretative

Densitometer (Howtek Inc., Hudson, NH, USA). To normalize for

equal loading and protein transfer, membranes were stripped and

incubated with an antibody for total p42MAPK.

RNA extraction and northern blot analysis

Total RNA was extracted from oligodendrocyte progenitors as

described previously (Cohen et al. 1996). RNA pellets were

resuspended in 50% formamide/2.2 m formaldehyde/20 mm MOPS

and denatured for 30 min at 658C. Ten micrograms of RNA

extracts were electrophoresed on a 1.3% agarose-formaldehyde gel

and transferred to Hybond-N membranes. The c-fos probe was

labeled with [a-32P]dCTP using a random primer kit to a speci®c

activity of 108 cpm/mg DNA. Membranes were hybridized at 428C

for 48 h with 106 cpm of c-fos cDNA per mL of hybridization

solution (50% formamide, 25 mm sodium phosphate buffer,

pH 6.5, 0.8 m NaCl, 0.5% SDS, 1 mm EDTA) and exposed to

X-ray ®lms. Autoradiographs were quanti®ed by densitometry. To

standardize for equal RNA loading and transfer, the membranes

were stripped of radioactive probe and were stained with methylene

blue.

Cell proliferation assay

The rate of oligodendrocyte progenitor proliferation was

measured by [3H]thymidine incorporation into DNA as described

(Radhakrishna and Almazan 1994). Cells grown on 24-well dishes

in SFM were deprived of growth factors for 8 h before treatment

1398 F. Ragheb et al.

q 2001 International Society for Neurochemistry, Journal of Neurochemistry, 77, 1396±1406

with 100 mm CCh, 1 mm atropine, 1 mm 4-DAMP or 10 mm

PD98059 in the presence of 1 mCi/mL [3H]thymidine. After 24 h,

the medium was aspirated and cultures were rinsed three times

with ice-cold trichloroacetic acid (TCA) and solubilized in 0.2 N

NaOH/0.1% Triton-X-100. Radioactivity was determined with a

scintillation spectrometer (cpm/well).

Data analysis

Results are presented as mean ^SEM of at least three experiments

performed in triplicate with different cell preparations unless

otherwise indicated. One-way analysis of variance, followed by

Dunnett's or Tukey's tests for multiple comparison, was used as

indicated in order to examine the statistical signi®cance; p-values

less than 0.05 were considered signi®cant. The equilibrium binding

parameters and the competition binding data were estimated using

the non-linear iterative algorithm ligand (Munson and Rodbard

1980; McPherson 1985). Protein content in all samples was

determined by a Bio-Rad protein assay kit.

Results

Expression of muscarinic receptor mRNAs in

oligodendroglial cells

To detect the mAChR subtypes expressed by oligodendro-

cyte primary cultures, RT-PCR was carried out with speci®c

M1±M5 oligonucleotide primer pairs. The cDNAs from

progenitor and mature oligodendrocyte cultures were

ampli®ed and the resulting products were resolved on a

1.5% agarose gel using rat brain cDNA as a positive control.

A representative gel showing the PCR-ampli®ed products

representing mRNA for M1, M2, M3, M4 and M5 subtypes

(290, 482, 379, 544 and 433 bp, respectively) is shown in

Fig. 1. All subtypes were expressed in both progenitors and

mature oligodendrocytes but levels of expression were more

signi®cant for M3, followed by M4, and to a lower extent

the M1, M2 and M5.

Pharmacological characterization of muscarinic

receptors in progenitors and mature oligodendrocytes

To con®rm the RT-PCR data we carried out radioligand

binding analysis in progenitors and differentiated oligoden-

drocytes with the muscarinic antagonist [3H]NMS. Satura-

tion curves obtained at equilibrium conditions (16 h

incubation at 48C) with 9±10 concentrations of [3H]NMS

(0.01±4 nm) showed that speci®c binding was saturable and

of high-af®nity (Fig. 2). The Scatchard plot gave single

straight unbroken lines, indicating one apparent single class

of binding sites with no evidence of co-operativity. In

progenitors the dissociation constant (KD) for [3H]NMS was

60 ^ 2 pm, and the maximum binding capacity (Bmax) was

54 ^ 0.5 fmol/mg protein. In 12 DIV oligodendrocytes the

Bmax for [3H]NMS (15 ^ 1 fmol/mg protein) was reduced

by 72%, and the KD was 43 ^ 3 pm.

To characterize the mAChR subtypes expressed in

oligodendrocytes, speci®c [3H]NMS binding in intact cells

was displaced by increasing concentrations of various

antagonists. Although muscarinic antagonists lack very

high selectivity for any single receptor subtype, pirenzepine

binds to M1 with high-af®nity, methoctramine to M2 and

tropicamide to M4/M2. 4-DAMP has been considered a

selective antagonist for M3, but binds with high-af®nity to

expressed M1, M3, M4 and M5 receptors, while atropine is

a non-selective antagonist and displays high-af®nity for the

Fig. 1 RT-PCR analysis of mRNA encod-

ing mAChR subtypes. Total RNA was

extracted from oligodendroglial cultures

(O � oligodendrocytes differentiated in vitro

for 12 days, P � progenitor cells) and

whole rat brain (B). RT-PCR ampli®cation

was performed with speci®c primers. Three

separate analyses were conducted and a

representative experiment is shown.

Fig. 2 Scatchard analysis of a representa-

tive [3H]NMS binding experiment with intact

O-2A progenitors and oligodendrocytes dif-

ferentiated for 12 days (12 DIV). Cells were

incubated for 16 h at 48C with 0.01±4 nM of

[3H]NMS, washed two times with cold buffer

and radioactivity determined as described in

Materials and methods. Non-speci®c bind-

ing was determined with 25 mM atropine.

Results of three independent experiments

performed in triplicate are shown.

Muscarinic receptors in oligodendrocytes 1399

q 2001 International Society for Neurochemistry, Journal of Neurochemistry, 77, 1396±1406

®ve mAChR subtypes (Michel et al. 1989; Lazareno et al.

1990; Caul®eld 1993; Kondou et al. 1994). In progenitors

[3H]NMS binding was inhibited by pirenzepine (Ki �112 ^ 5 nm) and methoctramine (Ki � 1.43 ^ 0.5 mm)

with low-af®nity, and with high-af®nity by atropine

(Ki � 0.17 ^ 0.01 nm) and 4-DAMP (0.25 ^ 0.01 nm)

providing evidence that the M3 mAChRs are the main

subtypes (Fig. 3, upper panel). The presence of M4

receptors was con®rmed using tropicamide, which displaced

[3H]NMS with high-af®nity (Ki � 15 ^ 0.1 nm). In 12 DIV

oligodendrocytes, atropine (Ki � 0.29 ^ 0.01 nm) and

4-DAMP (Ki � 0.33 ^ 0.01 nm) displaced [3H]NMS

binding with similar af®nity to progenitor cells (Fig. 3,

lower panel). However, an increased af®nity was observed

for pirenzepine (Ki � 56 ^ 3 nm), methoctramine (Ki �135 ^ 7 nm) and tropicamide (Ki � 38 ^ 2 nm).

Fig. 3 Competition binding experiments showing the effect of

various antagonist on speci®c [3H]NMS binding in intact O-2 A pro-

genitors and 12 DIV oligodendrocytes. Cells were exposed to

increasing concentrations of antagonists and 0.75 nM radioligand.

Model testing of the competition binding data was performed using a

weighed non-linear least-squares curve ®tting program LIGAND, and

the choice of the best ®t to either a one-site or to a two-site model

was determined using the appropriate F-test. The experimental data

points are the means of triplicate determinations from three indepen-

dent experiments. The best ®t of the competitions was to a one-site

model. The inhibition constants (Ki) are given in the text. B, Atrophine;

W, 4-DAMP; P, pirenzepine; S, methoctramine; X, tropicamide.

Table 1 Developmental regulation of mAChRs and their signaling

systems in oligodendrocytes (mean ^SEM)

Progenitors Oligodendrocytes

MAChR (fmol/mg protein) 54 �̂ 0.5 15 �̂ 1

[3H]IP (dpm/well)

Control 556 �̂ 14 2223 �^ 69

CCh (1 mM) 7028 �^ 237 3825 �^ 50

p42MAPK (OD units)

Control 51.3 �̂ 4.2 56.9 �^ 8.7

CCh (100 mM) 122.5 �̂ 0.2 81.3 �^ 2.4

CREB (OD units)

Control 43.1 �̂ 4.0 163.2 �^ 15

CCh (300 mM) 261.3 �̂ 17.2 193.2 �^ 15.1

Experimental conditions are speci®ed in the legends of Figs 2±8.

Fig. 4 Inhibition of CCh-stimulated total [3H]inositol phosphates

accumulation by muscarinic antagonists in intact O-2A progenitors

and 12 DIV oligodendrocytes. Cells were incubated with 1 mM CCh

in the absence or presence of increasing concentration of muscarinic

antagonists. Data are expressed as a percentage stimulation by

1 mM CCh without antagonist and represent the means ^SEM of

three independent experiments performed in triplicate. B, atropine;

W, 4-DAMP; P, pirenzepine.

1400 F. Ragheb et al.

q 2001 International Society for Neurochemistry, Journal of Neurochemistry, 77, 1396±1406

The functional coupling of the receptors was assessed

by examining CCh-stimulated phosphoinositide hydrolysis

(PI) in oligodendrocyte cultures. As previously reported

(Cohen and Almazan 1994), CCh at 1 mm concentration

activated this second messenger system more effectively

in progenitors (12-fold increase over basal levels) than in

oligodendrocytes (1.7-fold) (Table 1). To investigate

mAChRs subtypes coupled to PI hydrolysis, the

inhibition pro®les of CCh-induced [3H]IP accumulation

were examined for atropine, 4-DAMP and pirenzepine

in both progenitors and 12 DIV oligodendrocytes

(Fig. 4). Receptors had the selectivity expected of the

M3 subtype. At both developmental stages, CCh-

stimulated PI hydrolysis was inhibited by atropine and

4-DAMP with high potency and pirenzepine with low

potency. The IC50s values in progenitor cells were

0.86 nm for atropine, 1.44 nm for 4-DAMP and

1.56 mm for pirenzepine. In mature oligodendrocytes the

IC50 was 1.57 nm for atropine, 5.27 nm for 4-DAMP

and 0.59 mm for pirenzepine. The inhibition curve for

pirenzepine in progenitors had a tendency to be

biphasic suggesting the presence of more than one binding

sites.

Muscarinic M3 receptors mediate p42/44MAPK and

CREB phosphorylation, and c-fos mRNA expression

Previous studies have shown that cholinergic stimulation of

oligodendrocyte progenitors increases p42/44MAPK activa-

tion (Larocca and Almazan 1997), CREB phosphorylation

(Pende et al. 1997; Sato-Bigbee et al. 1999) and c-fos

mRNA expression (Cohen et al. 1996) through activation of

mAChRs. To determine the mAChR subtype that mediates

these responses, progenitors were pre-treated, for 20 min

with pirenzepine, methoctramine, 4-DAMP and atropine. A

concentration of 1 mm was used for each muscarinic

antagonist, which is suf®cient to fully block its preferred

subtype(s) without losing speci®city (Michel et al. 1989;

Lazareno et al. 1990; Caul®eld 1993; Kondou et al. 1994).

Cultures were then treated with 100 mm CCh for a period of

5 min to activate p42/44MAPK or to phosphorylate CREB.

For c-fos mRNA expression, cultures were treated with

100 mm CCh for 30 min. The concentrations of CCh used in

our experiments are close to those required to produce

maximal effects (Cohen and Almazan 1994; Cohen et al.

1996; Larocca and Almazan 1997; Pende et al. 1997).

Levels of p42/44MAPK and CREB phosphorylation were

Fig. 5 p42MAPK and CREB activation are mediated by the M3

mAChR. Cells were treated for 20 min with each of the muscarinic

antagonists (at 1 mM) pirenzepine (PIR), 4-DAMP (DAM), methoctra-

mine (MET) or atropine (ATR) prior to stimulation with 100 mM CCh

for 5 min p42MAPK and CREB activation were determined by immu-

noblot analysis as described in Materials and methods. The upper

panel shows a typical experiment in duplicates. Western blots were

analyzed by densitometry and the values are expressed as the

mean ^SEM of three independent experiments performed in dupli-

cate. Statistical differences are indicated: basal versus CCh

( p , 0.001); CCh versus ATR or DAM ( p , 0.001) for both

p42MAPK and CREB.

Fig. 6 4-DAMP blocks the phosphorylation of p42MAPK and CREB

in a concentration-dependent manner. Cells were pre-treated with

increasing concentrations of the M3 selective antagonist 4-DAMP for

20 min (1 nM21 mM), followed by 5 min stimulation with CCh

(100 mM). p42MAPK and CREB activation were determined by immu-

noblot analysis as described in Materials and methods. Top shows

western blots of a typical experiment in duplicate. The blots were

analyzed by densitometry and the values are expressed as the

mean ^SEM of percentage inhibition of CCh-stimulated cultures of

three independent experiments performed in duplicate. Statistical dif-

ferences are indicated: basal versus 100 mM CCh ( p , 0.001); CCh

versus 100 or 1000 nM CCh 1 4-DAMP ( p , 0.001).

Muscarinic receptors in oligodendrocytes 1401

q 2001 International Society for Neurochemistry, Journal of Neurochemistry, 77, 1396±1406

determined by western blotting and c-fos mRNA expression

by northern blotting.

CCh increased p42/44MAPK and CREB phosphorylation

by , 2±3-fold (Fig. 5). Pre-treatment with atropine or

4-DAMP blocked both responses while pirenzepine and

methoctramine did not affect the levels of phosphorylation.

4-DAMP reduced in a concentration-dependent manner the

phosphorylation of p42/44MAPK and CREB with IC50s

values of 1±10 nm (Fig. 6). Furthermore, an irreversible

M3 selective antagonist, 4-DAMP-mustard (DAMP-m)

(Barlow et al. 1991), was equally effective in blocking the

CCh-mediated phosphorylation of both proteins (Table 2).

These results con®rm the RT-PCR, binding and PI

hydrolysis data and demonstrate the predominance of the

M3 receptor subtype in progenitors.

In line with the developmental regulation of receptor

density and CCh-mediated PI hydrolysis, we observed

that CCh activated p42/44MAPK and CREB phosphory-

lation more effectively in progenitors than in mature

oligodendrocytes (Table 1). Thus, CCh increased the

phosphorylation of p42/44MAPK and CREB by 200% and

500% above control in progenitors and by 30% in mature

cells.

CCh increased c-fos mRNA levels six-fold above non-

stimulated controls (Fig. 7) while pre-treatment of the

cultures with atropine or 4-DAMP blocked c-fos mRNA

expression. In contrast, 1 mm of methoctramine had no

Fig. 7 CCh-stimulated c-fos mRNA expression is mediated by the

M3 mAChR. Cells were treated for 20 min with the muscarinic

antagonist (at 1 mM) pirenzepine (PIR), 4-DAMP (DAM), methoctra-

mine (MET) or atropine (ATR) prior to stimulation with 100 mM CCh

for 30 min. Levels of c-fos mRNA were detected by northern blotting

as described in Materials and methods. Top shows an autoradio-

graph of a typical experiment. Autoradiographs were analyzed by

densitometry and the values are expressed as mean ^SEM of 3

independent experiments performed in duplicate. Statistical differ-

ences are indicated: basal versus CCh ( p , 0.001); CCh versus

CCh 1 ATR or DAM ( p , 0.001); CCh versus CCh 1 PIR

( p , 0.01).

Fig. 8 4-DAMP blocks the expression of c-fos mRNA in a concen-

tration-dependent manner. Cells were pre-treated for 20 min with

increasing concentrations of the M3 selective antagonist 4-DAMP

(1 nM21 mM) followed by CCh (100 mM) stimulation for 30 min. Levels

of c-fos mRNA were determined by northern blotting and quanti®ed

densitometrically. Values are expressed in arbitrary optical density

units of percentage inhibition of CCh stimulation. Statistical differ-

ences are indicated: basal versus CCh (p , 0.001); CCh versus

CCh 1 50±1000 nM DAM ( p , 0.001); CCh versus CCh 1 10 nM

DAM ( p , 0.01).

Table 2 4-DAMP-mustard (4-DAMP-m) blocks the CCh-stimulated

p42MAPK and CREB phosphorylation as well as c-fos mRNA

expression

p42MAPK

Phosphorylation

c-fos mRNA

Expression

CREB

Phosphorylation

Control 51 �̂ 4 45 �̂ 19 43 �^ 4

CCh 122 �^ 0.2 662 �̂ 107 261 �^ 17

4-DAMP-m 41 �̂ 0.1 49 �̂ 7 38 �^ 2

4-DAMP-m1CCh 35 �^ 3 74 �̂ 7 40 �^ 2

Progenitors were pre-incubated with 1 mM 4-DAMP-m, an irreversible

M3 muscarinic antagonist, for 20 min followed by 100 mM CCh.

Phosphorylated (active) p42MAPK and CREB were detected by

western blotting and c-fos mRNA by northern blotting. Signals were

quanti®ed densitometrically. Values are the mean ^SEM of triplicate

determinations and represent relative OD units. Statistical differences

were: control versus CCh ( p , 0.01, for all responses); control versus

4-DAMP-M 1 CCh ( p . 0.05, for all responses); CCh versus

4-DAMP-M 1 CCh ( p , 0.001, for all responses).

1402 F. Ragheb et al.

q 2001 International Society for Neurochemistry, Journal of Neurochemistry, 77, 1396±1406

effect, whereas pirenzepine slightly reduced the CCh-

stimulated response. In addition, 4-DAMP antagonized the

effect of CCh on c-fos mRNA expression in a dose-

dependent manner (Fig. 8) with an approximate IC50 of

1±10 nm. Furthermore, pre-treatment with 1 mm DAMP-m,

the irreversible analog of DAMP, blocked c-fos expression

(Table 2). These results demonstrate that M3 receptors

are responsible for c-fos mRNA induction, and further

con®rm the predominance of the M3 receptor subtype in

oligodendrocyte progenitors. Mature oligodendrocytes

showed only a small increase in c-fos mRNA in response

to CCh (, 20% above untreated cultures) and was only

statistically signi®cant in 1 out of 3 experiments (results are

not shown).

Muscarinic M3 receptors mediate the proliferative

effects of CCh

Oligodendrocyte progenitors, grown for 2 days in SFM

supplemented with bFGF plus PDGF, were deprived of

growth factors for 8 h before the assays. Under these

conditions, 2.5 ng/mL PDGF and bFGF treatment for

24 h increased [3H]thymidine incorporation by four-fold

(Table 3). In the absence of either mitogen, 100 mm CCh

signi®cantly stimulated [3H]thymidine incorporation (two-

fold). The proliferative effect of CCh was blocked by the

antagonist atropine (non-speci®c) as well as by the selective

M3 receptor antagonist 4-DAMP. The antagonists pirenze-

pine (M1) and methoctramine (M2) did not modify

progenitor proliferation (data not shown). These results

show that activation of muscarinic receptors increases

oligodendrocyte progenitor proliferation through the M3

receptor subtype.

To explore the signaling mechanisms involved in the

proliferative effects of CCh we focused on the MAPK

pathway. Carbachol activated the p42/44MAPK cascade

rapidly and transiently (Larocca and Almazan 1997). In

the present study, the MAPK kinase (MEK) inhibitor

PD98059 prevented the proliferative effects of CCh,

indicating that p42/44 MAPK is involved in mAChR-

mediated proliferation.

Discussion

The present study demonstrates that M3 is the predominant

muscarinic receptor subtype expressed in progenitors and

differentiated oligodendrocytes. M3 is involved in the

activation of downstream signaling pathways, in the

regulation of c-fos gene expression, and in the stimulation

of progenitor cell proliferation. In addition, the expression

and the functional activity of mAChR receptors are subject

to developmental regulation.

RT-PCR analysis demonstrated that developing oligoden-

drocytes express transcripts encoding M3, followed by the

M4 subtype, and lower levels of M1, M2 and M5. These

®ndings correlated well with our competition binding

experiments using relatively selective mAChR antagonists.

Thus, both progenitors and mature oligodendrocytes pos-

sessed high-af®nity binding sites for 4-DAMP and atropine

(Ki , 0.2 nm), intermediate-af®nity binding sites for tropi-

camide (M4 selective) (Ki , 5 nm) and low-af®nity sites for

pirenzepine (M1 selective) (Ki ,112 nm) and methoctra-

mine (M2 selective) (Ki ,1.4 mm). However, a small

difference between the pharmacological pro®les of progeni-

tors and mature oligodendrocytes was observed. The af®nity

for tropicamide, pirenzepine and methoctramine increased

in mature oligodendrocytes, suggesting that as oligoden-

drocytes differentiate, a more heterogeneous population of

receptors is acquired. The predominance of the M3 subtype

was further con®rmed by measuring functional receptor

activity, i.e. PI hydrolysis, activation of p42/44MAPK and

CREB signaling pathways, and induction of gene expres-

sion. Of all antagonists tested only atropine and 4-DAMP

inhibited CCh mediated effects with high potency. Pirenze-

pine, an M1 selective antagonist, inhibited CCh-stimulated

PI hydrolysis with low potency (IC50 , 1.56 mm) and

caused a signi®cant decrease in p42/44MAPK at high

concentrations. Nevertheless as the inhibition curve for

pirenzepine on PI hydrolysis had a tendency to be biphasic,

we can not dismiss the presence of a small number of

higher-af®nity sites, M1, not detected by the binding and

contributing to these effects. Furthermore, we previously

reported that pirenzepine at 1 mm concentration inhibited

calcium transients as well (Cohen and Almazan 1994).

The density of mAChRs in oligodendroglial cells, is

lower than in cerebellar granule neurons (Alonso et al. 1990;

Whitham et al. 1991), but similar to those measured in

Table 3 Inhibition of carbachol-stimulated [H3]thymidine incorporation

by mAChR antagonists and the MAPK kinase inhibitor PD98059

[3H]thymidine incorporation

(100% of control)

Control 100 �̂ 5

PDGF 1 bFGF (2�.5 ng/mL) 540 �̂ 10

CCh (100 mM) 216 �̂ 5

CCh 1 ATR (10 mM) 106 �̂ 9

CCh 1 4-DAMP (10 mM) 123 �̂ 9

CCh 1 PD98059 (10 mM) 97 �̂ 3

Oligodendrocyte progenitors proliferation was measured by [3H]thymi-

dine incorporation. Cells were pre-treated with the mAChR antagonists

atropine (ATR, 10 mM), 4-DAMP (10 mM) or the MAPK kinase inhibitor

PD98059 (10 mM) for 30 min before the addition of 100 mM CCh and

were incubated for 24 h in the presence of 1 mCi/mL [3H]thymidine.

Radioactivity was quanti®ed in the TCA precipitate. Values are the

mean ^SEM of triplicate experiments and represent relative dpm

expressed as percent of control. Statistical differences were: control

versus PDGF 1 bFGF ( p , 0.001); control versus CCh ( p , 0.001).

Muscarinic receptors in oligodendrocytes 1403

q 2001 International Society for Neurochemistry, Journal of Neurochemistry, 77, 1396±1406

corticostriatal neurons (Eva et al. 1990) and astrocytes

(Andre et al. 1994; Kondou et al. 1994). Puri®ed myelin

isolated from adult rat brain was shown to possess high-

af®nity mAChR binding sites (Larocca et al. 1987a),

which mediated both phosphoinositide hydrolysis and

inhibition of cyclic AMP formation (Larocca et al. 1987b;

Kahn and Morell 1988). A portion of the binding sites

present in myelin (25%) were labeled with pirenzepine

suggesting the presence of M1 receptors, while the

remaining receptor sites were not identi®ed. These ®ndings

demonstrate that oligodendrocytes in the adult brain

express receptors and signaling systems able to sense their

neuronal milieu and respond to acetylcholine released by

neurons.

Our investigation highlights a central role for the M3

subtype in the control of intracellular signaling events.

Signaling pathways initiated by muscarinic receptors

involve activation of the p42/44MAPK. These Ser/Thr kinases

are important intermediates to transduce mitogenic and

differentiating signals to the nucleus and can be activated

by both M1- and M2-like receptors (Igishi and Gutkind

1998). In oligodendrocyte progenitors, mAChRs activate

p42/44MAPK through a mechanism that requires the presence

of extracellular Ca21 and involves mainly a 12-O-tetra-

decanolylphorbol 13-acetate-insensitive PKC pathway

(Larocca and Almazan 1997). Recent studies have shown

that muscarinic stimulation also induces phosphorylation of

the transcription factor CREB, an event that is dependent on

Ca21, downstream of the p42/44MAPK pathway, and is

developmentally regulated (Pende et al. 1997; Sato-Bigbee

et al. 1999). A potential gene target for CREB is the

proto-oncogene c-fos, which is induced after muscarinic

stimulation in oligodendrocyte progenitor cultures (Cohen

et al. 1996) under conditions that promote proliferation of

progenitors. Similar to p42/44MAPK and CREB activation,

increases in c-fos mRNA are Ca21-dependent, suggesting

that the same muscarinic receptor subtype is mediating these

events. In our experiments, the M3 mAChR antagonist

4-DAMP, and its irreversible analogue 4-DAMP-mustard,

blocked the CCh-stimulation of MAPK and CREB phos-

phorylation, and induction of c-fos mRNA expression. All

these data clearly support our proposal that the M3 receptor

is the subtype mediating the above-mentioned events in

progenitors.

Mitogenic responses triggered by muscarinic receptor

activation have been reported in astrocytes (Ashkenazi et al.

1989; Guizzetti et al. 1996) and in neural precursors (Ma

et al. 2000; Li et al. 2001). In agreement with our previous

results, CCh caused a two-fold increase in [3H]thymidine

incorporation, suggesting that mAChRs mediate prolifera-

tion of oligodendrocyte progenitors (Cohen et al. 1996). We

found that the M3 antagonist, 4-DAMP, as well as the non-

selective antagonist, atropine, prevented CCh-mediated

proliferation. Inhibition of CCh-stimulated proliferation of

progenitors with the MAPK kinase inhibitor, PD 98059,

revealed the involvement of the p42/44MAPK cascade in

this event. The proliferative responses mediated by

mAChRs are apparently related to the activation of PI

hydrolysis, DAG production, and activation of PKC in

astrocytes and in transfected cell lines (Ashkenazi et al.

1989). A most recent report provides evidence that the

atypical PKCz isoform is involved in mAChR-induced

proliferation of astrocytoma cells as a selective peptide

inhibitor blocked PKCz translocation as well as [3H]thymi-

dine incorporation (Guizzetti and Costa, 2000). Although we

showed that MAPK activation by carbachol is blocked by

PKC inhibitors (Larocca and Almazan 1997), more studies

are required to determine whether PKCz isoform is involved

in the upstream activation of p42/44MAPK and consequent

proliferation of oligodendrocyte progenitors.

Oligodendrocyte differentiation results in a diminished

responsiveness to CCh stimulation (Kastritsis and McCarthy

1993; Cohen and Almazan 1994; He and McCarthy 1994).

Our study shows that the density of mAChRs is down-

regulated during in vitro development. Hence, the decrease

in CCh-mediated PI hydrolysis, p42/44MAPK and CREB

phosphorylation as well as the previously observed reduc-

tion in intracellular Ca21 release are a consequence of

reduced receptor levels. In progenitors, binding studies

indicate a receptor density of 55 fmol/mg protein, whereas

in oligodendrocytes [3H]NMS binding was decreased by

72%. Similar reductions in total [3H]IP accumulated after

CCh stimulation were measured in mature oligodendrocytes.

In agreement with our results, others have provided

evidence for a developmental regulation of mAChR

responsiveness in oligodendrocytes. Using both 4- and

11-day-old progenitors and differentiated oligodendrocytes

isolated from rat cerebrum, CCh-mediated CREB-

phosphorylation increased around three-fold above control

levels in 4-day-old rats, an effect that was abolished in

11-day-old rats (Sato-Bigbee et al. 1999). It could be

postulated that factors in culture medium or differences in

oligodendrocyte function related to the lack of axonal

contact or activity are responsible for the alteration in

mAChR density that we observed in vitro. In fact, one report

has shown that coculture of mature oligodendrocytes with

neurons from dorsal root ganglia or superior cervical ganglia

prevents the loss of CCh-mediated Ca21 signaling (He et al.

1996). It therefore seems possible that ACh, either alone

or in combination with other cellular signals, may contribute

to the maintenance of functional mAChR in mature

oligodendrocytes which serve neuromodulatory functions

in addition to their proposed mitogenic role in progenitor

cells.

In summary, our results show that cultured oligoden-

droglial cells express all ®ve mAChRs. The M3 receptor

subtype is highly expressed and seems to play an important

role in oligodendrocyte growth.

1404 F. Ragheb et al.

q 2001 International Society for Neurochemistry, Journal of Neurochemistry, 77, 1396±1406

Acknowledgements

This work was funded by the Medical Research Council and the

Multiple Sclerosis Society of Canada (GA). EM-H was

supported by a postdoctoral fellowship from the Ministry of

Education and Culture of Spain. H-NL and AK held student-

ships from the Multiple Sclerosis Society of Canada. JNL was

supported by the American National Multiple Sclerosis Society.

We thank Dr Jose M. Vela for his help with the computer

photoimages, Dr R. Gould for his help during our ®rst attempts

to assess muscarinic receptors gene expression by PCR and

Dr Paul Clarke for his help with ®gures. We also thank

Drs William Norton and Walter Mushynski for their useful

comments on the manuscript.

References

Almazan G., Afar D. E. H. and Bell J. C. (1993) Phosphorylation and

disruption of intermediate ®lament proteins in oligodendrocyte

precursor cultures treated with calyculin A. J. Neurosci. Res. 36,

163±172.

Alonso R., Didier M. and Soubrie P. (1990) [3H]N-methylscopolamine

binding studies reveal M2 and M3 muscarinic receptor subtypes

on cerebellar granule cells in primary culture. J. Neurochem. 55,

334±337.

Andre C., Dos Santos G. and Koulakoff A. (1994) Muscarinic receptors

pro®les of mouse brain astrocytes in culture vary with their tissue

of origin but differ from those of neurons. Eur. J. Neurosci. 6,

1702±1709.

Ashkenazi A., Ramachandran J. and Capon D. J. (1989) Acetylcholine

analogue stimulates DNA synthesis in brain-derived cells via

speci®c muscarinic receptor subtypes. Nature 340, 146±150.

Barlow R. B., McMillen L. S. and Veale M. A. (1991) The use of

4-diphenylacetoxy-N-(2-chloroethyl)-piperidine (4-DAMP mus-

tard) for estimating the apparent af®nities for some agonists

acting at muscarinic receptors in guinea pig ileum. Br. J.

Pharmacol. 102, 657±662.

Belachew S., Rogister B., Rigo J. M., Malgrange B. and Moonen G.

(1999) Neurotransmitter-mediated regulation of CNS myelination:

a review. Acta Neurologica Belgica 1, 21±31.

Bergles D. E., Roberts J. D. B., Somogyi P. and Jahr C. E. (2000)

Glutamatergic synapses on oligodendrocyte precursor cells in the

hippocampus. Nature 405, 187±191.

Berridge M. J., Dawson C. P., Downes C. P., Helsop J. P. and Irvine R. F.

(1983) Changes in the levels of inositol phosphates after agonist-

dependent hydrolysis of membrane phosphoinositides. Biochem. J.

212, 473±482.

Bonner T. I., Buckley N. J., Young A. C. and Brann M. R. (1987)

Identi®cation of a family of muscarinic acetylcholine receptor

genes. Science 237, 527±532.

Caul®eld M. P. (1993) Muscarinic receptors: characterization, coupling

and function. Pharmacol. Ther. 58, 319±379.

Caul®eld M. B. and Birdsall N. J. M. (1998) International Union of

Pharmacology. XVII.Classi®cation of Muscarine Acetylcholine

Receptors. Pharmacol. Rev. 50, 279±290.

Cohen R. I. and Almazan G. (1994) Rat oligodendrocytes express

muscarinic receptors coupled to phosphoinositide hydrolysis and

adenylyl cyclase. Eur. J. Neurosci. 6, 1213±1224.

Cohen R. I., Molina-Holgado E. and Almazan G. (1996) Carbachol

stimulates c-fos expression and proliferation in oligodendrocyte

progenitors. Mol. Brain Res. 43, 193±201.

Eva C., Ricci S., Genazzani E. and Costa E. (1990) Molecular

mechanism of homologous desensitization and internalization of

muscarinic receptors in primary cultures of neonatal neurons.

J. Pharmacol. Exp. Ther. 253, 257±265.

Fisher S. K. (1988) Recognition of muscarinic cholinergic receptors in

human SK-N-SH neuroblastoma cells by quaternary and tertiary

ligands is dependent upon temperature, cell integrity, and the

presence of agonists. Mol. Pharmacol. 33, 414±422.

Guizzetti M. and Costa L. G. (2000) Possible role of protein kinase Cz

in muscarinic receptor-induced proliferation of astrocytoma cells.

Biochem. Pharmacol. 60, 1457±1466.

Guizzetti M., Costa P., Peters J. and Costa L. G. (1996) Acetylcholine

as a mitogen: muscarinic receptor-mediated proliferation of rat

astrocytes and human astrocytoma cells. Eur. J. Pharmacol. 297,

265±273.

He M. and McCarthy K. D. (1994) Oligodendroglial signal transduction

systems are developmentally regulated. J. Neurochem. 63,

501±508.

He M., Howe D. G. and McCarthy K. D. (1996) Oligodendroglial

signals transduction systems are regulated by neuronal contact.

J. Neurochem. 67, 1491±1499.

Igishi T. and Gutkind S. J. (1998) Tyrosine kinases of the Src family

participate in signaling to MAP kinase from both Gq and

Gi-coupled receptors. Biochem. Biophys. Res. 244, 5±10.

Kahn D. W. and Morell P. (1988) Phosphatidic acid and phosphoinosi-

tide turnover in myelin and its stimulation by acetylcholine.

J. Neurochem. 50, 1542±1550.

Karschin A., Wischmeyer E., Davidson N. and Lester H. A. (1994) Fast

inhibition of inwardly rectifying K1 channels by multiple

neurotransmitter receptors in oligodendroglia. Eur. J. Neurosci.

6, 1756±1764.

Kastritsis C. H. and McCarthy K. D. (1993) Oligodendroglial lineage

cells express neuroligand receptors. Glia 8, 106±113.

Kondou H., Inagaki N. and Fukui H. (1994) Formation of inositol

phosphates mediated by M3 muscarinic receptors in type-1 and

type-2 astrocytes from neonatal rat cerebral cortex. Neurosci. Lett.

180, 131±134.

Larocca J. N. and Almazan G. (1997) Acetylcholine agonists stimulate

mitogen-activated protein kinase in oligodendrocyte progenitors

by muscarinic receptors. J. Neurosci. Res. 50, 743±754.

Larocca J. N., Cervone A. and Ledeen R. W. (1987a) Stimulation of

phosphoinositide hydrolysis in myelin by muscarinic agonist and

potassium. Brain Res. 436, 357±362.

Larocca J. N., Ledeen R. W., Dvorkin B. and Makman M. H. (1987b)

Muscarinic receptor binding and muscarinic receptor-mediated

inhibition of adenylate cyclase in rat brain myelin. J. Neurosci. 7,

3869±3876.

Lazareno S., Buckley N. J. and Roberts F. F. (1990) Characterization of

muscarinic M4 binding sites in rabbit lung, chicken heart, and

NG108-15 cells. Mol. Pharmacol. 38, 805±815.

Li B.-S., Ma W., Zhang L., Barker J. L., Stenger D. A. and Pant H. C.

(2001) Activation of phosphatidylinositol-3 kinase (PI-3K) and

extracellular regulated kinases (Erk1/2) is involved in muscarinic

receptor-mediated DNA synthesis in neural progenitor cells.

J. Neurosci. 21, 1569±1579.

Liao C. F., Themmen A. P. N., Joho R., Barberis C., Birnbaumer M. and

Birnbaumer L. (1989) Molecular cloning and expression of a

®fth muscarinic acetylcholine receptor. J. Biol. Chem. 264,

7328±7337.

Ma W., Maric D., Li B.-S., Hu Q., Andreadis J. D., Grant G. M.,

Liu Q.-Y., Shaffer K. M., Chang Y. H., Zhang L., Pancrazio J. J.,

Pant H. C., Stenger D. A. and Barker J. L. (2000) Acetylcholine

stimulates cortical precursor cell proliferation in vitro via

muscarinic receptor activation and MAP kinase phosphorylation.

Eur. J. Neurosci. 12, 1227±1240.

McCarthy K. D. and de Vellis J. (1980) Preparation of separate

Muscarinic receptors in oligodendrocytes 1405

q 2001 International Society for Neurochemistry, Journal of Neurochemistry, 77, 1396±1406

astroglial and oligodendroglial cell cultures from rat cerebral

tissue. J. Cell Biol. 85, 890±902.

McPherson G. A. (1985) Analysis of radioligand binding experiments: a

collection of computer programs for the IBM PC. J. Pharmacol.

Meth. 14, 213±228.

Michel A. D., Stefanich E. and Whiting R. L. (1989) Direct labeling of

rat M3-muscarinic receptors by [3H]4DAMP. Eur. J. Pharmacol.

166, 459±466.

Munson P. J. and Rodbard D. (1980) LIGAND: a versatile

computerized approach for characterization of ligand-binding

systems. Ann. Biochem. 107, 220±239.

Nudel U., Zakut R., Shani M., Neuman S., Levy Z. and Yaffe D. (1983)

The nucleotide sequence of the rat cytoplasmic b-actin gene.

Nucleic Acids Res. 11, 1759±1771.

Paspalas C. D. and Papadopoulos G. C. (1996) Ultrastructural

relationships between noradrenergic nerve ®bers and non-neuronal

elements in the rat cerebral cortex. Glia 17, 133±146.

Pende M., Fisher T. L., Simpson P. B., Russell J. T., Blenis J. and

Gallo V. (1997) Neurotransmitter- and growth factor-induced

cAMP response element binding protein phosphorylation in glial

cell progenitors: role of calcium ions, protein kinase C, and

mitogen activated protein kinase/ribosomal S6 kinase pathway.

J. Neurosci. 17, 1291±1301.

Radhakrishna M. and Almazan G. (1994) Protein kinases mediate basic

®broblast growth factor's stimulation of proliferation and c-fos

induction in oligodendrocyte progenitors. Mol. Brain Res. 26,

18±128.

Ritchie T., Cole R., Kim H. S., de Vellis J. and Noble E. P. (1987)

Inositol phospholipid hydrolysis in cultured astrocytes and

oligodendrocytes. Life Sci. 41, 31±39.

Sato-Bigbee C., Pal S. and Chu A. K. (1999) Different neuroligands and

signal transduction pathways stimulate CREB phosphorylation at

speci®c developmental stages along oligodendrocyte differentia-

tion. J. Neurochem. 72, 139±147.

Simpson P. B. and Russell J. T. (1996) Mitochondria support inositol

1,4,5-trisphosphate-mediated Ca21 waves in cultured oligoden-

drocytes. J. Biol. Chem. 271, 33493±33501.

Takeda M., Nelson D. J. and Soliven B. (1995) Calcium signalling in

cultured rat oligodendrocytes. Glia 14, 225±236.

Whitham E. M., Challiss R. A. and Nahorski S. R. (1991) M3

muscarinic receptors are linked to phosphoinositide metabolism in

rat cerebellar granule cells. Eur. J. Pharmacol. 206, 181±189.

1406 F. Ragheb et al.

q 2001 International Society for Neurochemistry, Journal of Neurochemistry, 77, 1396±1406