Oxygen Plasma Treated Interactive Polycarbonate DNA Microarraying Platform

Oxygen Plasma Treated Interactive Polycarbonate DNAMicroarraying PlatformJesus Tamarit-Lopez, Sergi Morais, Rosa Puchades, and Angel Maquieira*

Departamento de Química, Instituto de Reconocimiento Molecular y Desarrollo Tecnologico, Universidad Politecnica de Valencia,Camino de Vera s/n, 46071 Valencia, Spain

*S Supporting Information

ABSTRACT: A novel DNA microarrying platform based onoxygen plasma activation of polycarbonate surface of compactdisks (DVD) is presented. Carboxylic acid groups aregenerated in few seconds on polycarbonate in an efficient,fast, and clean way. Following this surface activation strategy,amino-modified oligonucleotide probes were covalentlyattached, reaching an immobilization density of 2 pmol cm−2.Atomic force microscopy imaging revealed the nondestructivecharacter of this treatment when applied for short times,allowing for disk scanning in standard DVD drives. DNA assaysperformed on oxygen plasma treated disks resulted veryefficient with maximum hybridization yield of 93% andreaching a low limit of detection (200 pM) for perfect matchsynthetic oligonucleotide targets when reading the disk with astandard drive as detector. The approach was also evaluated by scoring single nucleotide polymorphisms with a discriminationratio of 12.8. As proof of concept, the oxygen plasma treated interactive polycarbonate DNA microarraying platform was appliedto the detection of PCR products of Salmonella spp., reaching a detection limit of 2 nM that corresponds to a DNA concentrationof only 1 c.f.u./mL. The results confirm the suitability of the microarray platform for analysis of biological samples with highsensitivity.

■ INTRODUCTIONDNA assays have been growing due to their broad applicationsin many fields (e.g., gene analysis, clinical diagnosis, orpathogen detection). Among the numerous assay types,oligonucleotide microarray technology allows for high-throughput, sensitive and selective DNA detection in aminiaturized format. For that, glass is the support commonlyemployed, but organic polymers also have high potential inmicroarray analysis due to their good mechanical and opticalproperties, mass production, and price.Optical disks are attractive analytical supports, given the low

cost of mass production and the countless surface chemistrystrategies to attach probes for biosensing in different formats.Several approaches have been reported for bioanalyticalapplications in microarray format on optical disks.1,2 Perform-ances of drive as detector demonstrated that compact disk(CD) technology is very competitive. Ubiquity and the price ofa disk reader provide huge advantages compared to the usualequipment, including fluorescence scanners and flow cytom-eters.Electrostatic immobilization of DNA probes on positively

charged surfaces, e.g., amino-silanized glass or charged-nylonmembranes, is a common strategy to attach them in a randommanner. However, covalent immobilization achieves probedirectionality, reduces background noise, and develops a stable

biomolecule layer.3,4 Indeed, this strategy has been employedfor the vast majority of commercial products because of itsversatility, durability, and good functionality.5,6

Covalent linking of probes on optical disks requiresfunctionalization of the surface since polycarbonate (PC), themain component of disks, lacks appropriated reactive chemicalgroups. A number of chemical and physical processes forcovalent attachment of proteins and nucleic acid probes on PCsurfaces are reported in the literature.7−12 Most of thesemethods have limitations since they modify the opto-mechanical properties of the surface or use experimental setupsthat disable disk reading with disk drives. Also, classicalchemical reactions must be carefully handled on disks as PCcan be severely damaged. Our research group has developedchemical approaches, involving covalent attachment of probeson PC.13−15 Several advantages were highlighted in DNAhybridization assays with limits of detection of 2.5 nM andscoring single nucleotide polymorphism (SNP), using cova-lently anchored aminated oligomers through a glutaraldehydecross-linker.14

Received: August 3, 2011Revised: October 31, 2011Published: November 2, 2011

Article

pubs.acs.org/bc

© 2011 American Chemical Society 2573 dx.doi.org/10.1021/bc2004268 | Bioconjugate Chem. 2011, 22, 2573−2580

pubs.acs.org/bc

However, cleaner, easy-going, and more efficient methods aredemanded. Thus, Li et al.16 reported UV/O3 treated compactdisks, allowing the immobilization of biotin, oligonucletotides,and immunoglobulins by covalent linkage. Maintaining the diskstructure, DNA hybridization events were detected with asensitivity of 25 nM by analyzing errors of the disk reading in astandard CD drive. These figures should be improved to reachthe sensitivity required in real applications.Plasma methods have attracted much attention for surface

modification of polymeric materials. It is generated by applyingan electric discharge to a neutral gas, developing radicals highlyreactive with any species or surface they reach. Plasmatreatment is a fast, effective, and clean method to createchemical moieties with minimal waste products. Plasmamethods to develop chemically reactive polymeric surfaceshave been reviewed by Siow et al.17 Surface modification ofpolymers by plasma has been widely physico-chemicallycharacterized, including treated PC surfaces.18 Oxygen plasmais reported to be more effective than others gases such as air,N2, or Ar, for the treatment of PC, introducing oxygenatedgroups on the surface and providing a very low treatment depthand homogeneity on a molecular scale.19 To the best of ourknowledge, studies about the ability of these treated PCsurfaces to covalently link DNA probes for bioassaying have notbeen published yet.In this article, we describe an oxygen plasma activated PC

surface of compact disks to covalently attach aminatedoligonucleotide probes, developing a novel and generalmicroarraying platform applicable to nucleic acid basedmethods. The optimal working conditions to maintain diskoperations and surface activity were also approached despitethe delicate structure of DVD (PC substrate covered withseveral layers of different materials) and the hard conditionsinside the plasma reactor.This novel microarray platform, compatible with disk

reading, is created and applied, as a proof of concept, toscore SNPs and detect polymerase chain reaction (PCR)products, achieving good performance.

■ EXPERIMENTAL PROCEDURES

Chemicals. The immobilization-printing buffer (HEPES:50 mM 2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonicacid buffer, containing 40% (v/v) glycerol, pH 7.0); hybrid-ization buffer (3 × SSC: 45 mM sodium citrate buffer and 450mM NaCl, pH 7.0); PBS-T (10 mM sodium phosphate buffer,150 mM NaCl, and 0.05% (v/v) Tween 20, pH 7.2); andwashing solutions were filtered through a 0.22 μm pore sizenitrocellulose membrane from Whatman GmbH (Dassel,Germany), before use.

Oligonucleotides were from Sigma-Aldrich (Madrid, Spain),and the sequences are shown in Table 1. Digoxigenin labeledPCR products were 151 bp long and used to detect specificallySalmonella spp. Ten nanometer colloidal gold labeledantidigoxigenin immunoglobulin was from Aurion (Wagenin-gen, The Netherlands). N-Hydroxysuccinimide (NHS), 1-ethyl-3-(3′-dimethylaminopropyl)carbodiimide (EDC), CrystalViolet, Tween 20, formamide, and silver enhancer solutionswere supplied by Sigma-Aldrich (Madrid, Spain). Note: All thechemicals should be handled following the correspondingmaterial safety data sheets.Surface Activation and Characterization. DVD-R disks

were purchased from MPO Iberica (Madrid, Spain). The diskswere first conditioned by gentle ethanol washing, water rinsing,and dried by centrifugation. For oxygen plasma activation, diskswere introduced inside a microwave plasma reactor PVA Tepla200 Plasma System (Feldkirchen, Germany) operating at 2.45GHz and continuous 100 W power for 30 s. Oxygen pressureinside the reactor was 120 Pa. Disks were stored under vacuumand dry conditions until probe attachment.Surface contact angle measurements were taken on OCA20

equipment and data analyzed using SCA20 software fromDataphysics Instruments GmbH (Filderstadt, Germany). Themeasurements were done in quintuplicate at room conditionswith a volume drop of 10 μL.X-ray photoelectron spectra were recorded with a Sage 150

spectrophotometer from SPECS Surface Nano Analysis GmbH(Berlin, Germany). Nonmonochromatic AlKa radiation (1486.6eV) was used as the X-ray source operating at 30 eV constantpass energy for elemental specific energy binding analysis.Vacuum in the spectrometer chamber was 9 × 10−9 hPa andthe sample area analyzed 1.0 mm2. The surface topographieswere examined with a Nanoscope IIIa atomic force microscopefrom Digital Instruments (Santa Barbara, CA, USA), operatingin tapping mode in air at room temperature.Crystal violet dye was employed to estimate the density of

carboxylic acid groups generated on oxygen plasma treated PCsurfaces, as previously described.20 Raw polycarbonate surfacefrom standard DVDs was used as the control.Oligonucleotide Immobilization. Amino modified oli-

gonucleotide probes were attached to oxygen plasma DVD bycarbodiimide chemistry. To this end, the oligo probe wasserially dissolved (concentration ranging from 0.05 to 5 μM) inprinting buffer with EDC and NHS at 20 mM. Solutions wereimmediately microarrayed on the oxygen plasma activatedsurface as 50 nL drops with a noncontact dispenser (AD1500,Biodot Inc., Irvine, CA) in a 90% humidity environment. Thedisk layout consisted of eight segmented areas (45° separation)each one constituted of 30 spots of ∼500 μm diameter, spaced1 mm and distributed in 6 columns and 5 rows. In this manner,

Table 1. Oligonucleotide Sequences of Probes and Targetsa

name sequence (5′−3′) 5′ end 3′ end

tracer TTACGATCGATTAGTTAGCCC-(T)15 Cy5 C7-NH2

probe 1 (T)15-CCCGATTGATTAGCTAGCATT C7-NH2 noneprobe 2 (T)10- TTTGATTACAGCCGGTGTACGACCCT C7-NH2 nonetarget 1 AATGCTAGCTAATCAATCGGG Cy5 nonetarget 2 AGGGTCGTACACCGGCTGTAATCAAA digoxigenin nonetarget 3 AGGGTCGTACATCGGCTGTAATCAAA digoxigenin nonetarget 4 AGGGTCGCGCACTATCTGTAATCAAA digoxigenin nonetarget 5 ACCGTCGCGCACTATCTGATTTCAAA digoxigenin none

aThe nucleotide bases for polymorphism detection are marked in bold.

Bioconjugate Chemistry Article

dx.doi.org/10.1021/bc2004268 | Bioconjugate Chem. 2011, 22, 2573−25802574

eight samples can be simultaneously analyzed. The couplingreaction was carried out at 4 °C for 16 h under controlledhumidity conditions. After that, the activated surface waswashed with PBS-T for 1 min, rinsed with water, and dried byslight centrifugation.DNA Hybridization Assays on DVD. For hybridization

studies, both digoxigenin labeled oligomer target and PCRproducts were used. The latter, first, was denaturated into singleDNA strands by high temperature treatment prior to theirapplication to the disk. This method involves a 5 minincubation step at 95 °C followed by 1 min on ice. Targetand PCR product solutions (100 μL) in hybridization bufferwere evenly distributed on disk areas using 22 × 22 mm glasscoverslips. After 1 h at 37 °C, the disk was washed with PBS-T,rinsed with deionized water, and dried by slight centrifugation.Next, 1 mL of gold labeled antidigoxigenin solution (1:100 inPBS-T) was dispensed onto the disk and covered with a 12 cmdiameter dummy plastic surface. After 1 h at room temperature,the disk was washed, rinsed, and dried as before. To display thehybridization reaction, the disk was incubated with 1 mL of 1:1(v/v) silver enhancer solution distributed as before and thereaction stopped by washing with water after 18 min at roomtemperature. The disk was dried as described above and readwith a CD/DVD drive.The CD/DVD drive was from LG Electronics (Englewood

Cliffs, NJ, USA) and holds two lasers, 650 and 780 nm, whichfocus on the spiral data track of CD and DVD disks,respectively. During the disk reading, the laser hits the reactionproduct which modifies the optical properties of the disksurface, attenuating the signal captured by the photodiode. Thissignal is related with target concentration. A detaileddescription of the optical disk drive working as chemicaldetector is described elsewhere.2 A scheme of surface activation,probe immobilization, and DNA hybridization assays isdepicted in Figure 1.Oligonucleotide Surface Density. The immobilization

probe density was estimated by measuring the fluorescence of aCy5-labeled oligonucleotide tracer (Table 1), and the

hybridized target density was calculated through thefluorescence of the target-1 after hybridization with probe-1,immobilized on PC activated chips at different densities. Thefluorescent intensity of the spots was determined by ahomemade apparatus incorporating a charge couple devicecamera Retiga EXi from Qimaging Inc. (Burnaby, Canada) andlight emitting diodes Toshiba TLOH157P as the fluorescenceexcitation source.21

After the corresponding immobilization and hybridizationsteps, the chips were washed, rinsed, and dried, the fluorescencesignal of the spots was quantified, and the density ofimmobilized and hybridized DNA was extracted from therespective calibration curves (Figures S3 and S4, SupportingInformation). For each experimental condition tested on themicroarrays, 12 replicates spots of each solution were spottedon the treated polycarbonate DVD surface. The experiment wasrepeated three times. The immobilization and hybridizationdata presented are the average of these repetitions, and theerror bars represent the standard deviation observed on thisaverage. The yield of DNA hybridization was calculated as theratio of the target to probe densities.

■ RESULTS AND DISCUSSION

Surface Characterization. Oxygen activated DVD surfacewas characterized by water contact angle measurements whichgive information about surface hydrophilicity that, in fact, isrelated to the presence of oxygenated functional groups. Thecontact angle in water decreased from 79° of raw hydrophobicPC surface to a constant value of 16° after 30 s plasmatreatment (Figure 2A). The efficiency of oxygen plasmatreatment was demonstrated considering that only 5 s ofactivation decreases the contact angle up to 30°, being in goodagreement with that observed in raw polycarbonate aftertreatment with different plasma gases.19,22 As is shown inFigure 2, uniformity of the oxidized surfaces was corroboratedfrom the low dispersion of the contact angle measurementsrandomly taken on the disk surface.

Figure 1. Scheme of oxygen plasma activation procedure of DVD PC surfaces, covalent attachment of oligonucleotides, DNA hybridization, andassay development.



Considering that the oxygen plasma treatment incorporatesto the polycarbonate surface different oxygenated groups suchas alcohols, carboxylic acids, and other carbonyl functions andthat these groups are protonated or deprotonated dependingon their pKa and the pH of the medium, we found out theirpresence by means of a contact angle titration curve using

buffered solutions. Thus, the contact angle was graduallydecreased as the pH was raised, observing two smoothtransitions from pH 1.0 to 5.0 and from 8.0 to 12.0 (Figure2B). Contrarily, the contact angle remained constant onuntreated disks within the pH range tested. This might suggestthe presence of phenols and aromatic acids on the activatedsurface since the pKa of benzoic acid and phenol is 4.2 and 9.9,respectively. Nevertheless, the smoothness of the titration leapspoints to a mixture of several moieties and other functionalities,in different ratios, making it difficult to identify the nature ofeach chemical surface group. Although carboxylic acids are theonly preferred groups for the subsequent covalent attachmentof aminated probes, phenols would not interfere in the couplingefficiency of oligonucleotides through carbodiimide chemistry.Furthermore, phenols contribute to surface hydrophilicity,reducing the nonspecific adsorption of oligonucleotide targetsand other assay reagents such as gold-labeled antidigoxigeninimmunoglobulin.The whole leap in the contact angle titration curve is about

20°, which is lower than that the obtained with othertreatments.23 However, the high density of the functionalgroups was determined by the crystal violet procedure. Thedifferences in the signal obtained between activated and raw PCsurfaces determine a density of ionizable groups (acids andphenols) of 1.2 × 10−9 mol cm−2. This figure is higher than thatreported for PC surfaces after 1 h of UV irradiation or 10 minof UV/ozone treatment (0.25 and 0.48 × 10−9 mol cm−2,respectively).24,25 Although the estimated density refers tofunctional ionizable groups, it can be considered that carboxylicacid moieties constitute approximately half of the total since themagnitudes of the two titration curve leaps were similar (Figure2B). Even so, the density of carboxylic acid groups is muchhigher than 0.15 × 10−9 mol cm−2, that is, the one calculatedfor close-packed ssDNA strands.26

The change of hydrophobicity of the treated surface was alsostudied by XPS. The C1s and O1s spectra of untreated andtreated DVDs revealed a change in the atomic ratio O/C from0.17 to 0.29 after oxygen plasma treatment for 30 s.Deconvolution of C1s spectra showed that new bonds of C−O are formed during the activation (Figure S1, SupportingInformation). Thus, to the bands at 286.6 and 290.5 eV, due tosingle and quadruple bonds between C and O present in thechemical structure of PC, plasma activation adds new bands at287.5 and 288.8 eV, corresponding to double and triple bonds,respectively.18 This confirms the presence of new carbonyl andcarboxylic groups on the treated surface. Also, a slight increasein the band height at 286.5 eV points the generation of newphenol or phenoxy functionalities. However, given theperformances of the XPS technique, new spectra with higherresolution could be required to accurately corroborate theseresults.Achieving an efficient functionalization of the surface is as

important as keeping its physical properties in order to read thedisks in a standard CD/DVD drive. AFM imaging of treatedand untreated surfaces revealed that the topography of DVDs,in terms of root-mean-square roughness value (Rrms), does notchange during the first minute of plasma treatment (Figure S2,Supporting Information). Contrarily, 5 min of activationresulted on disk imperfections (visible by naked eye) becausethe DVD is composed of several layers of materials whoseadherence fails during prolonged plasma treatment. Never-theless, shorter activation times produce only minimum etching

Figure 2. (A) Change of contact angle in water of DVD PC surfacestreated by oxygen plasma (100 W, 120 Pa) with the activation time.(B) Contact angle titration curves of untreated and oxygen plasmaactivated (100 W, 120 Pa, 30 s) DVD PC surfaces. The dotted linesare to facilitate reading only. (C) Variation of water contact angle ofplasma treated DVD PC surfaces as a function of storage time in avacuum desiccator.



of the surface, and PC chemical modification is the dominantprocess.However, plasma treated polymer surfaces progressively lose

their anchoring capacity during storage time: the aging effect.This phenomenon is detected through the increase ofhydrophobicity (surface contact angle increasing). As isshown in Figure 2C, when plasma activated DVD PC surfaceswere stored under vacuum and dry conditions, the watercontact angle only increased from 16° to 21° after a month ofstorage. This means that the aging effect over the activateddisks is minimum, and the surface continues being reactive forbiomolecule immobilization after storage.DNA Microarray Platform. A DVD derivatized surface

with carboxylic acid moieties constitutes a potential platform toattach probes for biosensing purposes. The application of thesemodified surfaces by covalent immobilization of aminatedoligonucleotide probes on 30 s plasma activated DVDs andfurther development of DNA hybridization-based assays wasdemonstrated for the first time.A study to ascertain the best conditions for oligonucleotide

immobilization on oxygen plasma treated PC surfaces wascarried out. The pH is a paramount parameter that needs to becontrolled when using carbodiimide chemistry; indeed, slightlyacidic solutions (pH 5) are known to better stabilize activeNHS esters, but alkaline conditions are needed to reach a gooddensity of the nonprotonated amino group of modifiedoligonucleotides and for nucleophilic attack to occur at theactivated surface (pKa of conjugated acid of aliphatic amino isapproximately 9.0). Thus, comparing different printing buffers,a maximum oligonucleotide immobilization density wasreached at neutral medium (HEPES buffer pH 7.0).The high hydrophilicity of the treated surfaces causes the

spreading of the printed spots in a manner in which theyoverlapped each other. Also, this diffusion of the spottedsolutions increased the evaporation speed, hindering reaction ofprobes with the disk surface. To control these issues, glycerolwas added to the printing solution showing that 40% (v/v) wasthe optimal content to avoid the aforementioned problems.Operating at the described conditions, the probe immobiliza-

tion was studied over PC oxygen plasma treated surfaces atdifferent times, using fluorescent dye marked oligonucleotide asthe tracer (See Experimental Procedures).Probe immobilization density increased with the surface

treatment time, probably due to the higher carboxylic acidgroup density, but 1 min treatment or longer decreased theefficiency to attach oligonucleotides (Figure 3). Extendedplasma treatments might also generate low molecular weightmaterial on it, including a weak boundary layer, due to theetching of the surface.18 This material, together with theimmobilized probe, is removed from the surface after thewashing step, and therefore, less amount of oligonucleotide isfinally attached on the surface. However, the immobilizationdensity increases with the concentration of oligonucleotidedispensed on the surface, reaching a plateau at concentrationsbetween 5 and 10 μM.An immobilization density of 2 pmol cm−2 was reached in

the studied conditions. This density was similar to that reportedby others authors working on activated plastics (5 and 10 pmolcm−2 for UV-Ozone activated PC and aminated PMMA,respectively)25,27 or commercial reactive microarray glass slides(11 pmol cm−2).28 High immobilization densities do notnecessarily imply an improvement in the hybridization yield, so

the obtained one is suitable to detect DNA with highsensitivity.However, a negligible response (S/N < 3) was obtained from

a nonspecific probe anchoring on a plasma treated polycar-bonate surface when fluorescent labeled oligonucleotideswithout an amino group are used (Target 1) or when theamino modified oligonucleotides were used in the absence ofEDC/NHS (negative controls). This confirmed that otherreactive groups formed on the PC surface during the plasmatreatment, such as epoxides or oxygen radicals, were notpresent in such an amount to react and produce significantnonspecific probe immobilization. Likewise, although somedegree of π−π or other hydrophobic interactions could beestablished between purine and pyrimidine bases and thearomatic moiety of the polycarbonate, no signal was observed,over nonactivated disks at the probe concentrations employed,supporting the suitability of the plasma treated surfaces forcovalent attachment of aminated probes at low concentrations.DNA Hybridization Assays. The performance of oxygen

plasma activated DVDs to attach DNA probes was assessedthrough hybridization assays with oligonucleotides and PCRproducts, establishing its sensitivity and selectivity. Severalconsiderations related with the design of the oligonucleotidessequence were taken into account before carrying outoptimization studies. First, a poly T tail 10 to15 long wasadded at the 5′ end with the role of spacer to physically separatethem from the surface, alleviating possible steric interferences.29

Second, the length of probes and targets ranged 21 to 26 bp asa trade off between hybridization efficiency and specificity.30

The yield of hybridization was determined by comparison ofthe response obtained after the recognition event betweenProbe 1 and Target 1 to that achieved by the immobilization oftracer. As shown in Figure 4A, hybridized target densityincreased with target concentration, reaching a plateau at 200nM for the tested probe concentrations (0.5−5 μM) and amaximum DNA target density of 0.93 pmol cm−2 (probe, 5μM; target, 500 nM). This figure was similar to that achievedon other activated plastics25,27 and corresponds to a hybrid-

Figure 3. Oligonucleotide immobilization density on activated DVDPC surfaces by oxygen plasma (100 W, 120 Pa) at different times.Inlet, immobilized density dependence on the time of plasmaactivation for two concentrations of tracer. Density values werecalculated from fluorescence intensity values of Cy5 labeled probesmeasured with a CCD camera.21 EDC/NHS in printing buffer withoutprobe oligonucleotide were employed as negative controls.



ization yield of 46%. The efficiency is higher than that reachedon other polymeric surfaces (between 6 and 18%), probablydue to the superiority of this novel platform to immobilizeprobes at the optimal density. Indeed, it is well known thathybridization efficiency depends strongly on the amount ofprobe attached on the sensing surface in a manner that fullhybridization is only achieved at lower probe densities becauserepulsive electrostatic and steric interactions are minimized.31

Although recent approaches have reported to avoid it,32 this“sweet spot” phenomenon has been confirmed multiple timesby others authors over several DNA microarray supports.33,34

Likewise, and in good agreement with these observations, theyield of hybridization on oxygen plasma activated PC was 93%at the lowest probe density tested (0.56 pmol cm−2).Detection of DNA target was performed on a DVD disk by

using 5′-digoxigenin labeled oligonucleotides and gold labeledantidigoxigenin immunoglobulin and silver amplification toproduce a solid reaction product. The hybridization assayperformed with these reagents showed the highest S/N valuescompared to those of others using biotin labeled oligonucleo-tides and gold labeled streptavidin (Figure S5, SupportingInformation). However, the modulation of the silver enhance-ment conditions is paramount to achieve an optimal contrastfor detection.35 Thus, shorter reactions do not develop enough

reaction product for quantification whereas reactions that aretoo long increase the level and noise of the background,dropping the signal-to-noise ratio. In our case, 18 min wasselected as the suitable amplification time to get the bestcontrast and S/R values. This time is longer than the optimalone found for assays over other PC disks, probably due to thedifferent surface chemistry achieved with plasma treatment.1,14

The linear dynamic range and limit of detection (LOD) relatedto the probe density and target concentration is shown inFigure 4B. Thus, a limit of detection of 200 pM, calculated asthe concentration of target giving a signal equal to three timesthe standard deviation of the background signal, was reachedwhen immobilizing the 5 μM probe. Likewise, the dynamicrange for the hybridization assay can be improved bycontrolling the amount of immobilized probe and the reactiontime of the silver enhancement step (e.g., shortening thereaction time to avoid saturation for higher target concen-trations, Figure S6, Supporting Information).At the conditions described here, the background signal was

negligible (S/N < 3), saving the blocking step with BSA orethanolamine and reducing assay time. In addition, such abackground level is indicative of low nonspecific adsorption ofgold-labeled antidigoxigenin immunoglobulin on this hydro-philic surface.The relatively high yield of hybridized target achieved with

our approach implies that very little amount of DNA probe isneeded to obtain a detectable signal. Thus, dispensing 50 nL of5 μM probe solution means that only 50 fmol ofoligonucleotide per assay is used (considering a single spot asan individual assay), which is quite low compared to that inother protocols such as microfluidic arrays.However, it is also important to keep the stability of the

probe-coated surface with time. Thus, weekly hybridizationassays demonstrated that the immobilized probes on plasmatreated PC surfaces were active during, at least, two monthsafter being printed on the disks without significant loss (12%)of the hybridization signal.The selectivity of our approach was evaluated through

hybridization assays using target oligonucleotides with mis-matched bases with respect to the sequence of the immobilizedprobe. Negligible responses (S/N < 3) were obtained assaying5 and 10 base-pair mismatch targets (Figure 5A) for a broadrange of concentrations (from 0.1 to 500 nM). Moreinteresting, due to its potential application in genotyping, isthe ability of the sensing platform to discriminate singlenucleotide polymorphisms (SNPs), predicting disease predis-positions or drug responses in individuals.36 Working withstringent conditions, such as a lower ionic strength hybrid-ization buffer (1 × SSC) and the addition of formamide at 50%(v/v), maximum discrimination ratio of 12.8 was reached(Figure 5B), being in the range of those achieved with otherapproaches for oligonucleotides of similar length.37

Also, the potential of the new microarray disk surface forsensitive and selective detection of PCR amplified DNAproducts of pathogens was tested. The nucleotide sequence ofthe immobilized probe 2 was complementary to the centralregion of 151 bp amplicon specific to detect Salmonella spp.Although the high temperature pretreatment denatures PCRproducts (dsDNA) into ssDNA complementary strands, duringits application on the disk, incubation time is an essentialparameter to avoid amplicon reassociation and control thehybridization assay, as shown in Figure 5C. Thus, higherresponses were obtained after 60 min. At the described

Figure 4. (A) Hybridized target density on oxygen plasma activatedDVD PC surfaces (100 W, 120 Pa, 30 s), calculated from fluorescenceintensity values of Cy5 labeled targets obtained with a CCD camera.21

Hybridization buffer without target was employed as the negativecontrol. (B) Absolute signal and S/N values (mean value ± standarddeviation of 15 replicates) for DNA hybridization assays on plasmaactivated standard DVDs with different probe and target concen-trations read with a standard DVD drive. Hybridization buffer withouttarget was employed as the negative control.



conditions, the new microarray was able to detect 2 nM ofamplicon. This limit of detection is about 1 order of magnitudebetter than that reached with synthetic oligonucleotides,probably due to the lower diffusion coefficient of larger targetsand the reassociation of the two amplicon strands duringhybridization on the disk. However, negligible responses (S/N< 3) in the detection of negative PCR control products(Cronobacter sakazakii) confirmed the selectivity of ourapproach.Considering the target solution volume used for hybrid-

ization assays (100 μL), and the number of spots printed perarray (30), a limit of detection of 200 pM is equivalent to 700amol of DNA molecules, which is 2 orders of magnitude lowerthan the reported one for DNA detection on UV/ozone treatedcompact disks.16 However, differences in assay format (linearray instead of spot microarray), type of disk (CD instead ofDVD), and reading strategy (error reading detection instead ofacquiring the attenuated analog signal) could be decisive for thedifferences found between the two approximations.2,38 Indeed,at this stage, the approach presented here shows an importantsensitivity enhancement on the state of the art (DNAmicroarrays on standard disk surfaces).14,37 The detectionlimit of 2 nM of PCR product reached with our approach isequivalent to detect 150 μgL−1 of PCR amplified DNA. Thisresult is very interesting because this amount of DNA comesfrom 1 colony-forming unit/mL. This achievement in

sensitivity, together with the ultrafast and nonaggressiveperformance of surface modification protocol, reveal plasmatreated DVDs as practical platforms for DNA microarraysensing. Moreover, the DVD disk and drive approachconstitutes an analytical tool with high potential compared toother microarray detection platforms such as confocalfluorescent scanners or flow cytometers, with advantages suchas low cost, portability, and high-throughput capability toanalyze thousands of samples in field conditions.

■ CONCLUSIONSOxygen plasma treated DVD polycarbonate surface is a noveland superior DNA microarray support. The surface activation isfast and clean adding to the optical and mechanical propertiesof the disk's new capabilities, allowing scanning with standarddisk drives. The treatment generates active and stable moietieson the polycarbonate surface, allowing for the covalentimmobilization of amino modified probes with appropriatedensities for developing sensitive DNA hybridization assays.Mass production of functionalized disks could be carried out

smartly and easily since only 30 s of treatment gives anappropriate surface density of functional moieties. At the sametime, in this process, the chemical modification is independentof substrate geometry, making it possible to uniformly activateseveral disks during a single plasma treatment. This is a cleanactivation strategy because it requires tiny amounts of chemicalsor solvents, avoiding the generation of classical synthesis wastebyproducts, adding extra value as an environmentally friendlyprocedure.However, polycarbonate could be derivatized with different

functional groups by proper selection of the employed plasmagases (e.g., introduction of amines from ammonia plasma forattaching biomolecules containing carboxylic acids). Also, otherimmobilization strategies such as streptavidin−biotin or the useof monofunctional or bifunctional linkers are of direct andsimple implementation.39

Detection of PCR amplified DNA products were alsodemonstrated, reaching high sensitivity and selectivity, withan inverse relationship between probe density and hybridizationyield. The limits of detection are very low and comparable tothose reported in the literature using fluorescent, enzymatic, ormetal nanoparticle labels on plastic supports. The advantagesshown by compact disk reading technology, such as ubiquity,low cost, portability, and high-throughput, give this approachscalability and great potential.

■ ASSOCIATED CONTENT*S Supporting InformationXPS spectra and AFM images of treated and untreated disks;calibration curves for oligonucleotide surface density calcu-lation; study of other oligonucleotide labels; signal amplifica-tion times; and hybridization conditions. This material isavailable free of charge via the Internet at http://pubs.acs.org.

■ AUTHOR INFORMATIONCorresponding Author*Tel: +34-963877342; Fax: +34-963879349. E-mail:[email protected].

■ ACKNOWLEDGMENTSThis research was funded through projects FEDER MICINNCTQ2010-15943 (CICYT, Spain) and by Generalitat Valenci-

Figure 5. Optical density images of DNA hybridization assaysperformed on DVD-Rs and read with a standard DVD drive.Columns, from left to right, correspond to probe 2 at concentrationsof 5, 1, 0.5, 0.25, 0.1, and 0.05 μM, respectively. (A) Hybridizationwith target at 5 nM in nonstringent conditions (3× SSC buffer withoutformamide). Panels 1−4 correspond to perfect match, single, 5, and 10base mismatch oligonucleotides targets, respectively (targets 2, 3, 4,and 5, respectively). (B) Hybridization with target at 5 nM in stringentconditions (1× SSC buffer with formamide at 50% (v/v)). Panels 1−4correspond to perfect match, single, 5, and 10 base mismatch targets,respectively (targets 2, 3, 4, and 5, respectively). (C) Panels 1−3correspond to hybridization with Salmonella spp. PCR product at 2nM for 15, 60, and 120 min, respectively. Panel 4 corresponds tohybridization with Cronobacter amplicon at 2 nM for 60 min used asthe negative control. S/N values were 21.8, 17.0, 8.7, 5.5, 2.2, and 0.5(panel 2) and 15.0, 11.4, 6.8, 3.8, 3.1, and 3.5 (panel 3) for 5, 1, 0.5,0.25, 0.1, and 0.05 μM probe 2 concentration, respectively.



http://pubs.acs.org

mailto:[email protected]

ana (GV/2009/028 and PROMETEO/2010/008). TheSpanish Ministerio de Educacion y Ciencia provided J.T.-L.with a grant for his Ph.D. studies. We thank Juan Hurtado forhis technical assistance with the plasma reactor.

■ REFERENCES(1) Morais, S., Carrascosa, J., Mira, D., Puchades, R., and Maquieira,A. (2007) Microimmunoanalysis on standard compact discs todetermine low abundant compounds. Anal. Chem. 79, 7628−7635.(2) Morais, S., Tamarit-Lopez, J., Carrascosa, J., Puchades, R., andMaquieira, A. (2008) Analytical prospect of compact disk technologyin immunosensing. Anal. Bioanal. Chem. 391, 2837−2844.(3) Du, Q., Larsson, O., Swerdlow, H., and Liang, Z. (2006) DNAimmobilization: silanized nucleic acids and nanoprinting. Top. Curr.Chem. 261, 45−61.(4) Ivanova, E. P., Wright, J. P., Pham, D. K., Brack, N., Pigram, P.,Alekseeva, Y. V., Demyashev, G. M., and Nicolau, D. V. (2006) Acomparative study between the adsorption and covalent binding ofhuman immunoglobulin and lysozyme on surface-modified poly(tert-butyl methacrylate). Biomed. Mater. 1, 24−32.(5) Di Giusto, D. A., and King, G. C. (2006) Special-Purposemodifications and immobilized functional nucleic acids forbiomolecular interactions. Top. Curr. Chem. 261, 131−168.(6) Sassolas, A., Leca-Bouvier, B. D., and Blum, L. J. (2008) DNAbiosensors and microarrays. Chem. Rev. 108, 109−139.(7) Bora, U., Sharma, P., Kumar, S., Kannan, K., and Nahar, P.(2006) Photochemical activation of a polycarbonate surface forcovalent immobilization of a protein ligand. Talanta 70, 624−629.(8) Witek, M. A., Llopis, S. D., Wheatley, A., McCarley, R. L., andSoper, S. A. (2006) Purification and preconcentration of genomicDNA from whole cell lysates using photoactivated polycarbonate(PPC) microfluidic chips. Nucleic Acids Res. 34, e74.(9) Carion, O., Souplet, V., Olivier, C., Maillet, C., Medard, N., El-Mahdi, O., Durand, J.-O., and Melnyk, O. (2007) Chemicalmicropatterning of polycarbonate for site-specific peptideimmobilization and biomolecular interactions. ChemBioChem 8,315−322.(10) Najmabadi, P., Ko, K.-S., La Clair, J. J., and Burkart, M. D.(2008) A method for fabrication of polycarbonate-based bioactiveplatforms. JALA 13, 284−288.(11) Remacle, J., Alexandre, I., and Houbion, Y. (2002) US Patent177144.(12) La Clair, J. J., and Burkart, M. D. (2003) Molecular screening ona compact disc. Org. Biomol. Chem. 1, 3244−3249.(13) Banuls, M. J., Gonzalez-Pedro, V., Puchades, R., and Maquieira,A. (2007) PMMA isocyanate-modified digital discs as a support foroligonucleotide-based assays. Bioconjugate Chem. 18, 1408−1414.(14) Banuls, M. J., García-Pinon, F., Puchades, R., and Maquieira, A.(2008) Chemical derivatization of compact disc polycarbonate surfacesfor SNPs detection. Bioconjugate Chem. 19, 665−672.(15) Tamarit-Lopez, J., Morais, S., Puchades, R., and Maquieira, A.(2011) Direct hapten-linked multiplexed immunoassays onpolycarbonate surface. Biosens. Bioelectron. 26, 2694−2698.(16) Li, Y., Ou, L. M. L., and Yu, H.-Z. (2008) Digitized moleculardiagnostics: reading disk-based bioassays with standard computerdrives. Anal. Chem. 80, 8216−8223.(17) Siow, K. S., Britcher, L., Kumar, S., and Griesser, H. J. (2006)Plasma methods for the generation of chemically reactive surfaces forbiomolecule immobilization and cell colonization: a review. PlasmaProcess. Polym. 3, 392−418.(18) Muir, B. W., Mc Arthur, S. L., Thissen, H., Simon, G. P.,Griesser, H. J., and Castner, D. G. (2006) Effects of oxygen plasmatreatment on the surface of bisphenol A polycarbonate: a study usingSIMS, principal component analysis, ellipsometry, XPS and AFMnanoindentation. Surf. Interface Anal. 38, 1186−1197.(19) Chen, T. N., Wuu, D. S., Wu, C. C., Chiang, C. C., Lin, H. B.,Chen, Y. P., and Horng, R. H. (2006) Effects of plasma pretreatment

on silicon nitride barrier films on polycarbonate substrates. Thin SolidFilms 514, 188−192.(20) Xu, F., Datta, P., Wang, H., Gurung, S., Hashimoto, M., Wei, S.,Goettert, J., McCarley, R. L., and Soper, S. A. (2007) Polymermicrofluidic chips with integrated waveguides for reading microarrays.Anal. Chem. 79, 9007−9013.(21) Mira, D., Llorente, R., Morais, S., Puchades, R., Maquieira, A.,and Martí, J. (2004) High throughput screening of surface-enhancedfluorescence on industrial standard digital recording media. Proc. SPIE-Int. Soc. Opt. Eng. 5617, 364−373.(22) Sharma, R., Holcomb, E., Trigwell, S., and Mazumder, M.(2007) Stability of atmospheric-pressure plasma induced changes onpolycarbonate surfaces. J. Electrostatics 65, 269−273.(23) Wang, Z., and Li, R.-X. (2007) Fabrication of DNAmicropatterns on the polycarbonate surface of compact discs.Nanoscale Res. Lett. 2, 69−74.(24) McCarley, R. L., Vaidya, B., Wei, S., Smith, A. F., Patel, A. B.,Feng, J., Murphy, M. C., and Soper, S. A. (2005) Resist-free patterningof surface architectures in polymer-based microanalytical devices. J.Am. Chem. Soc. 127, 842−843.(25) Li, Y., Wang, Z., Ou, L. M. L., and Yu, H.-Z. (2007) DNADetection on plastic: a mild and efficient surface activation protocolconverts polycarbonate substrates to biochip platforms. Anal. Chem.79, 426−433.(26) Steel, A. B., Levicky, R. L., Herne, T. M., and Tarlov, M. J.(2000) Immobilization of nucleic acids at solid surfaces: effect ofoligonucleotide length on layer assembly. Biophys. J. 79, 975−981.(27) Fixe, F., Dufva, M., Telleman, P., and Christensen, C. B. V.(2004) Functionalization of poly(methyl methacrylate) (PMMA) as asubstrate for DNA microarrays. Nucleic Acids Res. 32, e9.(28) Gong, P., Harbers, G. M., and Grainger, D. W. (2006) Multi-technique comparison of immobilized and hybridized oligonucleotidesurface density on commercial amine-reactive microarray slides. Anal.Chem. 78, 2342−2351.(29) Shchepinov, M. S., Case-Green, S. C., and Southern, E. M.(1997) Steric factors influencing hybridisation of nucleic acids tooligonucleotides arrays. Nucleic Acids Res. 25, 1155−1161.(30) Relogio, A., Schwager, C., Richter, A., Ansorge, W., andValcarcel, J. (2002) Optimization of oigonucleotide-based DNAmicroarrays. Nucleic Acids Res. 30, e51.(31) Vainrub, A., and Pettitt, B. M. (2002) Coulomb blockage ofhybridization in two-dimensional DNA arrays. Phys. Rev. E 66, 041905.(32) Song, K.-S., Nimse, S. B., Kim, J., Kim, J., Nguyen, V.-T., Ta, V.-T., and Kim, T. (2011) 9G DNA Chip: microarray based on themultiple interactions of 9 consecutive guanines. Chem. Commun. 47,7101−7103.(33) Peterson, A. W., Heaton, R. J., and Georgiadis, R. M. (2001)The effect of surface probe density on DNA hybridization. NucleicAcids Res. 29, 5163−5168.(34) Gong, P., and Levicky, R. (2008) DNA surface hybridizationregimes. Proc. Natl. Acad. Sci. U.S.A. 105, 5301−5306.(35) Taton, T. A., Mirkin, C. A., and Letsinger, R. L. (2000)Scanometric DNA array detection with nanoparticle probes. Science289, 1757−1760.(36) McCarthy, J. J., and Hilfiker, R. (2000) The use of single-nucleotide polymorphism maps in pharmacogenomics. Nat. Biotechnol.18, 505−508.(37) Morais, S., Marco-Moles, R., Puchades, R., and Maquieira, A.(2006) DNA microarraying on compact disc surfaces. Application tothe analysis of single nucleotide polymorphisms in Plum pox virus.Chem. Commun. 22, 2368−2370.(38) Morais, S., Tortajada-Genaro, L. A., Arnandis-Chover, T.,Puchades , R. , and Maquie ira , A. (2009) Mult ip lexedmicroimmunoassays on a digital versatile disk. Anal. Chem. 81,5646−5654.(39) Hermanson, G. T. (2008) Bioconjugate Techniques, 2nd ed.,Academic Press, San Diego, CA.



Documents

Oxygen Plasma Treated Interactive Polycarbonate DNA Microarraying Platform