Modulation of Expression of Endothelial Intercellular Adhesion Molecule-1, Platelet-Endothelial Cell Adhesion Molecule-1, and Vascular Cell Adhesion Molecule-1 in Aortic Arch Lesions

and John McGregorKazem Zibara, Elza Chignier, Chantal Covacho, Robin Poston, Georges Canard, Patrick Hardy

Deficient Compared With Wild-Type Mice−Arch Lesions of Apolipoprotein EEndothelial Cell Adhesion Molecule-1, and Vascular Cell Adhesion Molecule-1 in Aortic

−Modulation of Expression of Endothelial Intercellular Adhesion Molecule-1, Platelet

Print ISSN: 1079-5642. Online ISSN: 1524-4636 Copyright © 2000 American Heart Association, Inc. All rights reserved.

Greenville Avenue, Dallas, TX 75231is published by the American Heart Association, 7272Arteriosclerosis, Thrombosis, and Vascular Biology

doi: 10.1161/01.ATV.20.10.22882000;20:2288-2296Arterioscler Thromb Vasc Biol.

http://atvb.ahajournals.org/content/20/10/2288World Wide Web at:

The online version of this article, along with updated information and services, is located on the

http://atvb.ahajournals.org/content/suppl/2000/09/27/20.10.2288.DC1.htmlData Supplement (unedited) at:

http://atvb.ahajournals.org//subscriptions/

at: is onlineArteriosclerosis, Thrombosis, and Vascular Biology Information about subscribing to Subscriptions:

http://www.lww.com/reprints

Information about reprints can be found online at: Reprints:

document. Question and AnswerPermissions and Rightspage under Services. Further information about this process is available in the

which permission is being requested is located, click Request Permissions in the middle column of the WebCopyright Clearance Center, not the Editorial Office. Once the online version of the published article for

can be obtained via RightsLink, a service of theArteriosclerosis, Thrombosis, and Vascular Biologyin Requests for permissions to reproduce figures, tables, or portions of articles originally publishedPermissions:

by guest on June 12, 2013http://atvb.ahajournals.org/Downloaded from

http://atvb.ahajournals.org/content/20/10/2288

http://atvb.ahajournals.org/content/suppl/2000/09/27/20.10.2288.DC1.html

http://www.ahajournals.org/site/rights/

http://www.lww.com/reprints

http://atvb.ahajournals.org//subscriptions/

http://atvb.ahajournals.org/

Modulation of Expression of Endothelial IntercellularAdhesion Molecule-1, Platelet–Endothelial Cell AdhesionMolecule-1, and Vascular Cell Adhesion Molecule-1 in

Aortic Arch Lesions of Apolipoprotein E–DeficientCompared With Wild-Type Mice

Kazem Zibara, Elza Chignier, Chantal Covacho, Robin Poston, Georges Canard,Patrick Hardy, John McGregor

Abstract—Human vascular adhesion molecules, such as intercellular adhesion molecule-1 (ICAM-1), platelet–endothelialcell adhesion molecule-1 (PECAM-1), and vascular cell adhesion molecule-1 (VCAM-1), are thought to play a criticalrole in the homing of leukocytes to sites of atherosclerotic lesions. However, very little is known about the expressionof adhesion molecules in the vasculature of mice models, such as apolipoprotein E knockout (apoE2/2) mice, the lesionsof which closely mimic human atherosclerotic lesions. This study has first quantitatively characterized the meanexpression of endothelial adhesion molecules, lining the whole vessel intimal circumference, over a period of time (0to 20 weeks of diet) in aortic arch lesions of male apoE-deficient compared with wild-type (C57BL/6) mice. Theseanimals were fed a chow or a cholesterol-rich diet. ApoE2/2 animals showed first an increase (at 6 weeks) and then areduction (at 16 weeks) in the mean expression of ICAM-1 (P,0.05) and PECAM-1 (P,0.05) but not VCAM-1 levels.Such modulation of the mean expression of adhesion molecules was not observed in wild-type mice. Confirmation ofimmunohistochemistry results on ICAM-1 was obtained by Northern blots performed on the aortic arch of apoE andC57BL6 chow-fed mice over a period of 20 weeks. Moreover, the presence of VCAM-1 was also confirmed at the RNAlevel, on aortas of control and apoE mice, by reverse transcription–polymerase chain reaction. In the second part of thestudy, we assayed the levels of adhesion molecules, in different types of histologically defined atherosclerotic lesions,in apoE2/2 animals fed for 20 weeks. All 3 adhesion molecules (ICAM-1, PECAM-1, and VCAM-1) were observed tobe reduced in fibrofatty and complex lesions but not in fatty streaks or in areas without lesions. These results indicatethat the expression of these adhesion molecules in apoE-deficient animals varies with the evolution of the plaque froma fatty to a fibrous stage.(Arterioscler Thromb Vasc Biol. 2000;20:2288-2296.)

Key Words: atherosclerosisn adhesion moleculesn apolipoprotein E–deficient micen quantitative image analysisn Northern blots

A therosclerosis may be the result of genetic susceptibilitycombined with environmental factors, such as diet,

lifestyle, and/or possibly microbial infections.1,2 OxidizedLDL, one of the factors thought to affect vessel wall integ-rity,3 can lead to an inflammatory response.4 Such a responsewill induce endothelial cell activation, extravasation of leu-kocytes, and a migratory/reparative process by vascularsmooth muscle cells (SMCs).5 Activated endothelium willexpress, in sequence, a series of adhesion molecules andpowerful cofactors, such as growth factors, cytokines, or NO,which will tether and activate integrin complexes, initiate de

novo gene transcription, and allow the extravasation ofmonocytes or T lymphocytes.6 These adhesion moleculesinclude intercellular adhesion molecule-1 (ICAM-1 orCD54),7 platelet– endothelial cell adhesion molecule-1(PECAM-1 or CD 31),8 vascular cell adhesion molecule-1(VCAM-1 or CD106),9 and P-selectin (CD 62P).10

Genetic variation at the apoE locus in humans is associatedwith hyperlipidemia and premature atherosclerotic risk.11

Recently, apoE-null (apoE2/2) mice, generated by gene tar-geting,12 have been shown to develop pronounced hypercho-lesterolemia and atherosclerotic lesions13 with certain fea-

Received December 13, 1999; revision accepted February 14, 2000.From INSERM U331/Faculte´ de Medecine RTH Laennec (K.Z., E.C., C.C., J.M.), Lyon, France; the Department of Experimental Pathology (R.P.),

United Medical and Dental Schools of Guy’s and St. Thomas’ Hospitals, London, UK; and Transgenic Alliance (G.C., P.H.), Iffa Credo, L’Arbresle,France.

Presented in part at the XVIIth International Society on Thrombosis and Hemostasis Congress, Washington, DC, August 14–21, 1999, and publishedin abstract form (Thromb Haemost. 1999;82[suppl 1]:344).

Correspondence to Kazem Zibara, PhD, INSERM U331, Faculte´ de Medecine RTH Laennec, 8 rue Guillaume Paradin, F-69732 Lyon Cedex 08,France. E-mail [email protected] 1.fr

© 2000 American Heart Association, Inc.

Arterioscler Thromb Vasc Biol.is available at http://www.atvbaha.org

2288 by guest on June 12, 2013http://atvb.ahajournals.org/Downloaded from


tures resembling those seen in humans14,15 and otherspecies.16 These mice have become accepted as an animalmodel for the study of factors involved in atherogenesis.17

However, for this model, little is known about the expressionof the endothelial adhesion molecules that are implicated inhuman atherosclerosis.

In the present study, the mean expression of adhesionmolecules, lining the whole vessel intimal circumference,over a period of time (0 to 20 weeks of diet) was quantita-tively assessed in apoE2/2 mice (C57BL/6 background) andwild-type mice fed a chow or a cholesterol-rich diet. Resultsshowed first an increase (at 6 weeks) and then a reduction (at16 weeks) in ICAM-1 and PECAM-1 (P,0.05) levels inapoE2/2 but not in wild-type animals. In the second part of thestudy, we assayed the levels of adhesion molecules indifferent types of histologically defined atherosclerotic le-sions in apoE2/2 animals fed for 20 weeks. All 3 adhesionmolecules (ICAM-1, PECAM-1, and VCAM-1) were ob-served to be reduced in fibrofatty and complex lesions but notin fatty streaks or adjacent to areas without lesions.

MethodsAnimal HandlingSurgical procedures and animal care strictly conformed to theGuidelines of the National Institute of Health and Medical Research(decree No. 87-848, October 19, 1987). All animals used in thisstudy were ether-anesthetized before organ sampling.

MiceThe apoEm1Unc line was obtained from Dr N. Maeda (University ofNorth Carolina, Chapel Hill). Control C57BL/6JIco and apoE-deficient mice (C57BL/6JIco background) were backcrossed, bred,and housed under specific and opportunistic pathogen-free condi-tions by Transgenic Alliance (Iffa Credo S.A., a Charles River Co,Lyon, France). Control (n545) and apoE-deficient (n545) micewere weaned at 3 weeks of age and maintained on a chow diet for 1week (“Souriffarat” breeding diet, standard formulation, pellets,irradiated at 25 kGy, from Extralabo). After that stage, they eitherhad access to a chow diet (4% fat, 0% cholesterol) or a Western-typediet (21% fat, 0.15% cholesterol, special high fat formulationpowder, irradiated at 25 kGy). Basal observations were made in3-week-old weaned control or apoE-deficient mice. All animalsreceived water and food ad libitum during the 3-, 6-, 16-, and20-week schedules.

Cholesterol Level Analysis in ApoE-Deficient andWild-Type MiceThis section can be accessed online at www.ahajournals.org.

Organ Isolation and Preparation forImmunohistochemistry and MolecularBiology TechniquesThis section can be accessed online at www.ahajournals.org.

Validation of All Types of Vascular Lesions andIntimal/Media Thickness RatioThis section can be accessed online at www.ahajournals.org.

ImmunohistochemistryFive serial sections were immunostained and quantitatively analyzedfor each animal. Briefly, one of these 5 sections, originating fromapoE and C57BL6 animals at different time periods (0 to 20 weeks),was simultaneously stained as described online at www.ahajournal-s.org. In addition, 3 positive and 3 negative controls were present inall staining series. Finally, calibration of the Leica image analyzer,for the whole study, was kept at the same original setting. Thefollowing primary monoclonal antibodies were used for immunohis-tochemical studies. Anti-mouse PECAM-1 (rat IgG2a, 50mg/mL),

anti-mouse VCAM-1 (rat IgG2a, 5mg/mL), and the nonimmune IgG(rat IgG2a, 5mg/mL) were purchased from Pharmingen. Anti-mouseICAM-1 (rat IgG2a, 4mg/mL) was obtained from Seikagaku Co.Anti–a-actin monoclonal antibody (mouse IgG2a, 5mg/mL) wasfrom Boehringer-Mannheim, and anti-mouse macrophage (ratIgG2b, 5mg/mL) was from Serotec. Endothelial cells were identifiedthrough the use of an anti-human von Willebrand factor (rabbitpolyclonal), which was purchased from Dako. Antibodies weredetected as described online at www.ahajournals.org. A nonimmuneIgG was used at the place of the primary antibodies as a negativecontrol. A nuclear counterstaining with hematoxylin followed im-munohistochemistry for the identification of macrophagesand SMCs.

Image AnalysisEndothelial layer staining of the aortic arch sections was quantifiedby using a color image analyzer (Quantimet 600 Leica analyzer)according to the technique described by Poston et al.7 The techniqueused is described online at www.ahajournals.org.

Data ComparisonsThe Student test or 1-way ANOVA was performed with the use ofStatView 4.02 software (Abacus Concept, Inc). Results are ex-pressed as mean6SEM, and a value ofP,0.05 was consideredsignificant.

Total RNA IsolationAortas and aortic arches from C57BL6 and apoE2/2 mice (n564),isolated at different periods of time (0, 6, 16, and 20 weeks), weresnap-frozen in liquid nitrogen and stored at280°C. Total RNA wasextracted from each individual mouse at the indicated times (n58).Briefly, frozen tissue was ground in a mortar in liquid nitrogen. Thefrozen powdered sample was immediately mixed with TRIzol (GibcoBRL, Life Technologies) and homogenized with a Polytron (Brink-mann). Total RNA was extracted by using the TRIzol methodadapted from the procedure of Chomczynski and Sacchi.18

Probe Synthesis and LabelingThe 625-bp ICAM probe was prepared by reverse transcription(RT)–polymerase chain reaction (PCR) by use of the followingprimers: ICAM1390U (CATCGGGGTGGTGAAGTCTGT) andICAM1996L (TGTCGGGGGAAGTGTGGTC). RT-PCR amplifica-tion, labeling, and purification are described online atwww.ahajournals.org.

Northern BlotsTotal RNA (20mg) was denatured, separated by electrophoresis ona formaldehyde-MOPS-agarose gel, and then transferred to a nylonmembrane (Hybond N1, Amersham). Capillary blotting was per-formed overnight, and then the membrane was baked for 2 hours at80°C. Prehybridization and hybridization were performed accordingto standard protocols.19 Blots were exposed against a PhosphorIm-ager screen (Molecular Dynamics) for 24 hours. Scanning wasperformed under a 100-m scale, and the ImageQuant software wasthen used for quantification. Variations in RNA loading wereassessed by using the GAPDH probe (Clontech), which allowednormalizing ICAM-1 values. All quantification values were cor-rected for background levels by using the local median method of theImageQuant software. The initial scan image (gel format) wastransferred into a tif file to provide the Northern blot figurespresented in this article.

RT-PCR Analysis of VCAM-1RNA-extracted aortas of C57BL6 and apoE mice were treated withDNase I to remove genomic contamination (MessageClean, Gen-Hunter). Removal of DNA was verified by performing a PCR, withuse of GAPDH as well as VCAM-1 primers, on the extracted RNA(or an RT-PCR without the addition of the reverse transcriptaseenzyme). Absence of these transcripts confirmed efficient removal ofgenomic DNA. The 375-bp GAPDH cDNA was obtained by usingthe following primers: GPDH-793U21 (ACCTGCCAAGTATGAT-GACAT) and GPDH-1148L21 (CCTGTTATTATGGGGGTCTG).

Zibara et al Adhesion Molecule Expression in ApoE2/2 Mice 2289



The 447-bp VCAM-1 cDNA was obtained by using the followingprimers: VCAM-1660U21 (CAGCTAAATAATGGGGAACTG)and VCAM-2088L19 (GGGCGAAAAATAGTCCTTG). The RT-PCR conditions were the same as for the synthesis of the ICAM-1probe (see above).

ResultsQualitative ResultsQualitative results, with use of immunohistochemical tech-niques, were obtained with antibodies directed againstICAM-1, PECAM-1, and VCAM-1. Endothelial cells wereidentified with an anti–von Willebrand factor monoclonalantibody (Figure 1A and 1B). Such von Willebrand factorlabeling allowed the correlation of the endothelial layerstaining with monoclonal antibodies directed against adhe-sion molecules. ICAM-1 was strongly expressed in regions

adjacent to the lesions but weakly expressed on endothelialcells overlying fibrofatty or complex lesions (Figure 1C and1D). Moreover, SMCs proliferating within the atheroscleroticlesions also expressed ICAM-1. PECAM-1 was qualitativelyobserved to be expressed by endothelial cells (Figure 1E and1F). Endothelial cells overlying fibrofatty and complex le-sions weakly expressed VCAM-1. However, the shoulder oflesions expressed VCAM-1. In addition, VCAM-1 was alsoseen to be expressed by SMCs proliferating within theatherosclerotic lesions (Figure 1G and 1H).

Quantitative ResultsQuantitative results, obtained from image analysis of stainedsections, are presented in 2 main parts: (1) the mean expres-sion of endothelium adhesion molecules, lining the wholevessel circumference, over a period of time (0 to 20 weeks of

Figure 1. Immunohistochemical analysisof adhesion molecules. Serial sectionswere taken from an apoE2/2 mouse after16 weeks of chow diet. A, C, E, and G,Same fibrofatty lesion at different levels ofthe aortic arch. B, D, F, and H, Samecomplex lesion at different levels of theaortic arch. Von Willebrand factor (A andB) was detected by use of a polyclonalanti-rabbit monoclonal antibody. ICAM-1(C and D), PECAM-1 (E and F), andVCAM-1 (G and H) were detected by useof rat anti-mouse monoclonal antibodies.A corresponding biotinylated secondarymonoclonal antibody (mouse-adsorbed)was used before ABC–horseradish perox-idase and AEC chromogen kits (Vector)(see Methods). L indicates lumen; M,media. Bar5100 mm. A, Endothelial cells,overlying a fibrofatty lesion, staining forvon Willebrand factor (arrows) are shown.B, Endothelial cells, overlying a complexlesion, staining for von Willebrand factor(arrows) are shown. C, Endothelial cells(e), overlying the same fibrofatty lesion asin panel A, do not stain for ICAM-1. How-ever, SMCs (arrowhead) within the lesionsexpress ICAM-1. D, Endothelial cells(arrows), overlying the same complexlesion as in panel B, stain weakly forICAM-1. SMCs (arrowhead) within thelesions also express ICAM-1. E, Endothe-lial cells (arrows), overlying the samefibrofatty lesion as in panel A, stain forPECAM-1. F, Endothelial cells (arrows),overlying the same complex lesion as inpanel B, stain for PECAM-1. G, Endotheli-al cells (e), overlying the same fibrofattylesion as in panel A, do not stain forVCAM-1. However, SMCs (arrowhead)within the lesions express VCAM-1. H,Endothelial cells (e), overlying the samecomplex lesion as in panel B, do not stainfor VCAM-1. However, SMCs (arrow-heads) within the lesions expressVCAM-1.

2290 Arterioscler Thromb Vasc Biol. October 2000



diet in chow- or fat-fed apoE2/2 compared with wild-typeanimals), and (2) the mean expression of adhesion molecules,correlated with the different types of histologically definedvascular lesions, in 20-week fat-fed apoE2/2 mice.

Mean Expression of Adhesion Molecules Over Time (0 to20 Weeks of Diet)Background expression of adhesion molecules was calculatedfrom the mean of ICAM-1, PECAM-1, and VCAM-1 expres-sion by endothelial cells, which were present all around theintimal vessel circumference. ApoE2/2 mice (n55) werecompared with C57BL/6 mice (n55) over a period of time (0to 20 weeks of the chow or fat diet, Figure 2 and Figures I, II,III, which can be accessed online at www.ahajournals.org).

The apoE2/2 mice weaned at 3 weeks of age (no diet)showed moderate expression of ICAM-1 (Figure 2A).ICAM-1 expression was strongly increased (P,0.001) in theendothelium of apoE2/2 animals fed either diet for 3 or 6weeks compared with weaned mice. Compared with 6 weeks,after 16 or 20 weeks of either diet, ICAM-1 expression wassignificantly reduced (P,0.001). Such lower ICAM-1 ex-pression was particularly significant in apoE2/2 animals fed afat diet. In contrast, C57BL/6 mice showed a steady expres-sion of ICAM-1 from 3 to 20 weeks, irrespective of diet.C57BL/6 mice on a fat diet, compared with those on a chowdiet, showed a slight but significant (P,0.001) increase inICAM-1 expression (Figure 2B).

A high basal PECAM-1 expression, measured in theendothelium of the apoE2/2 mice weaned at 3 weeks of age(no diet), was observed. Moreover, upregulated expression ofPECAM-1 (P,0.05) was observed for apoE2/2 animals oneither diet for 3 weeks. In addition, after 6 weeks of the chowdiet, endothelial PECAM-1 expression was significantly(P,0.05) increased. PECAM-1 expression was significantlydecreased (P,0.001) for apoE2/2 animals fed a chow diet for16 and 20 weeks compared with those fed a chow diet for 6weeks (Figure 2C). C57BL/6 mice showed a major increase(P,0.001) in PECAM-1 expression after 3 weeks of eithertype of diet compared with weaned mice. Then, after 6 to 20weeks of either diet, the expression of PECAM-1 was foundto be more or less steady. One should note a consistentlyhigher level of PECAM-1 expression (P,0.05) in the fat-fedcompared with the chow-fed animals (Figure I, which can beaccessed online at www.ahajournals.org).

VCAM-1 basal expression, measured in the endothelium ofthe weaned apoE2/2 mice (3 weeks of age and no diet),showed variable levels. VCAM-1 expression did not show asignificant modulation pattern, as was observed for ICAM-1and PECAM-1. Moreover, the VCAM-1 expression levelswere consistently lower compared with those of ICAM-1 andPECAM-1. No significant differences in VCAM-1 expressionwere observed between apoE animals fed a fat or chow diet(Figure II, which can be accessed at www.ahajournals.org).In addition, compared with weaned mice, wild-type miceshowed no significant changes in VCAM-1 expression byendothelial cells over time (Figure III, which can be accessedonline at www.ahajournals.org).

Mean Expression of Adhesion Molecules Correlated WithVascular Lesions (ApoE2/2 Mice After 20 Weeks of Diet)Background expression of adhesion molecules correlatedwith vascular lesions was calculated from the expression

of ICAM-1, PECAM-1, and VCAM-1 by endothelial cells.Such endothelial cells overlay vessels that showed eitherfatty-streak, fibrofatty, complex, or no lesions in apoE2/2

mice (n55) fed a fat diet for 20 weeks or apoE2/2 animals(n55) aged 3 weeks of age that were not on a diet (Figure3 and Figure IV, which can be accessed online atwww.ahajournals.org).

ICAM-1 expression in weaned animals not on a diet waslow (Figure 3A). In contrast, in animals fed 20 weeks of thefat diet, compared with weaned animals, ICAM-1 expression

Figure 2. Background expression of adhesion molecules over time.The expression of ICAM-1 (n545), VCAM-1 (n545), and PECAM-1(n545) by the endothelium all around the vessel circumference wasquantified by using a color image Quantimet 600 Leica analyzer. Theanalysis was displayed by use of a 340 objective. Results areexpressed as mean6SEM of 6 to 24 measurements obtained from 5individuals per group. *Significantly different from week 0. A, Expres-sion of ICAM-1 was significantly increased (P,0.001) betweenweaned apoE2/2 mice (represented by 0) and animals fed either dietfor 3 or 6 weeks. However, at 16 and 20 weeks, compared with 6weeks, the expression is reduced. ICAM-1 expression, at 16 and 20weeks, was comparable to that of weaned animals for fat-fed apoE2/2

mice but significantly higher for chow-fed apoE2/2 animals (P,0.001).B, In the C57BL6 mice, there was a steady expression of ICAM-1from 3 to 20 weeks, irrespective of diet. On the other hand, there wasa slight but significant (P,0.001) increase in ICAM-1 expression infat-fed compared with chow-fed C57BL6 animals. This increase wasunchanged from 3 to 20 weeks. C, Expression of PECAM-1 was sig-nificantly increased (P,0.05) between weaned apoE2/2 mice andmice fed 3 weeks of either diet. At 6 weeks, only chow-fed apoE2/2

mice showed an enhanced expression (P,0.05). However, at 20weeks of diet, the expression was significantly (P,0.05) decreased infat-fed apoE2/2 compared with weaned mice.




was significantly elevated in areas with no lesions. This highlevel of ICAM-1 expression, associated with histologicallyidentified atherosclerotic lesions, was also present in endo-thelium overlying fatty streaks. However, ICAM-1 levelswere significantly (P,0.05) reduced in fibrofatty and com-plex lesions compared with areas with no lesions (Figure 3A).

PECAM-1 expression by endothelium from weaned ani-mals was very high. No difference was observed betweenareas showing no lesions or fatty-streak lesions. In contrast,PECAM-1 expression was significantly reduced in endothe-lial cells overlying fibrofatty or complex lesions comparedwith areas with no lesions (Figure IV, which can be accessedonline at www.ahajournals.org).

VCAM-1 expression by endothelium from weaned animalswas low (Figure 3B). VCAM-1 levels in histologically

identified lesions in animals fed 20 weeks of the fat diet weremarkedly increased (P,0.05) in the endothelium overlyingthe fatty streaks and decreased in a very significant way(P,0.001) in fibrofatty or complex lesions compared withareas with no lesions.

Northern BlotsConfirmation of immunohistochemical results on ICAM-1was obtained by Northern blots performed on aortic archsamples of apoE and C57BL6 chow-fed mice over a period of20 weeks. Samples from 8 different animals (C57BL6 andapoE) at different time points (0, 6, 16, and 20 weeks) wereseparately investigated (Figure 4A). This overall analysis ofaortic arch samples was performed on a total of 64 animals.Results show that ICAM-1, in aortic arch samples of apoEmice at 6 weeks of chow diet, is upregulated (by at least2-fold) compared with C57BL6 and apoE animals at 0 and 16weeks (Figure 4B). However, an increase in ICAM-1 tran-scription was observed in the aortic arch at 20 weeks. Therewas no particular pattern for ICAM-1 expression in C57BL6.The present study shows for the first time, with use ofNorthern blots, that the ICAM-1 transcription level is mod-ulated in the aortic arch of 6-week chow-fed apoE but notC57BL6 mice. One should note that Northern blot results areobtained from RNAs extracted from whole vessels. In con-trast, immunohistochemistry is performed on endothelial cellslining the vessel wall.

RT-PCR Analysis of VCAM-1In the present study, we report for the first time the presenceof VCAM-1 mRNA transcripts in murine aortas at differentperiods of time (Figure 5A). The presence of VCAM-1mRNA was tested by RT-PCR on aortas, aortic arches, andhearts of C57BL6 and apoE mice. All these tissues showedthe presence of VCAM-1 mRNA after genomic DNA re-moval (Figure 5B). A GAPDH-positive control in the RT-PCR experiments is shown in Figure V (which can beaccessed online at www.ahajournals.org). The above-mentioned VCAM-1 data confirm that detection of VCAM-1by immunological methods is not a background noise. Theseobservations are very much in line with those obtained byimmunological techniques as shown in the present study.

DiscussionThe present study reports, for the first time, a quantitativeanalysis of major adhesion molecules expressed by endothe-lial cells from the aortic arch of apoE-deficient mice com-pared with wild-type mice (C57BL/6). The following resultswere observed: (1) The mean expression of 2 major vascularadhesion molecules (ICAM-1 and PECAM-1), lining thewhole intimal vessel circumference, over a period of time (0to 20 weeks of diet) is modulated in the atheroscleroticlesions of apoE2/2 mice but not in C57BL/6 control mice.Confirmation of immunohistochemical results on ICAM-1was obtained by Northern blots performed on the aortas ofapoE and C57BL6 chow-fed mice over a period of 20 weeks.(2) The intensity of expression of 3 major vascular adhesionmolecules (ICAM-1, PECAM-1, and VCAM-1) by the endo-thelium, lining different types of histologically defined ath-erosclerotic lesions after 20 weeks of diet, is correlated withthe progression and severity of atherosclerotic lesions. In line

Figure 3. Expression of adhesion molecules over lesions.Expression levels of adhesion molecules were measured on theendothelium overlying vessels from weaned chow-fed apoE2/2

animals (n55) and animals after 20 weeks of fat diet. Ten to 53measurements per mouse were used for the analysis of the 3adhesion molecules expressed by the endothelium over thedescribed areas. A, ICAM-1 showed a low expression inweaned mice (no diet). ICAM-1 expression was significantly ele-vated in areas with no lesions in apoE2/2 animals fed 20 weeksof fat diet compared with weaned mice. This high level ofICAM-1 expression, associated with histologically identified ath-erosclerotic lesions, was also present in endothelium overlyingfatty streaks. However, fibrofatty plaques and complex lesionsshowed a significant decrease of ICAM-1 expression (P,0.05)compared with areas with no lesions. B, VCAM-1 expressionlevels in the endothelium of weaned apoE2/2 mice were quitevariable. Fatty streak areas, obtained from apoE2/2 mice fed 20weeks of fat diet, showed significantly increased levels ofVCAM-1 compared with areas with no lesions. With theincreased severity of atherosclerosis, VCAM-1 expression wasdiminished (P,0.001 and 0.05), compared with areas with nolesions, in the endothelium of 20-week fat-fed apoE2/2 mice.




with previously published data, our results involving athero-sclerotic lesions are characterized by typical lipid deposition,cellular infiltration, and SMC proliferation.14,20 In addition,plasma cholesterol levels and an increase of the intima/mediaratio, significantly higher in apoE2/2 compared with wild-type animals, did vary with the type of diet used.

Atherosclerotic lesions may be the result of some form ofinflammation, induced by the presence of oxidized LDL,Chlamydia pneumoniae,21 or viral or other factors, occurringat the level of the vessel wall.22 Vascular endothelial cells,activated at sites of inflammation, interact with differentleukocyte subtypes via adhesion molecules and differentcofactors and are thought to play a key role in the initiationand perpetuation of atherosclerotic lesions.23,24 Among anumber of adhesion molecules implicated in the homing ofleukocytes to sites of inflammation, endothelial ICAM-1 andits leukocyte ligand CD11a/CD18 (also known asaLb2 orlymphocyte function–associated antigen-1) play a major rolein this process.25,26 In the present study, a significant modu-lation of ICAM-1 expression over time by endothelial cellslining the whole vessel wall circumference was observed forthe aortic arch region of apoE-deficient mice fed a fat or chowdiet. Northern blots on aortic arch samples, for determinationof ICAM-1 gene expression, showed an increase at 6 weeks(by at least 2-fold) compared with 0 and 16 weeks in C57BL6and apoE animals. However, an increase in ICAM-1 tran-

scription was observed in the aortic arch at 20 weeks. TheseNorthern data results are in line with those obtained byimmunohistochemistry at 0, 6, and 16 weeks but not at 20weeks. One should note that Northern blots are performed onwhole vessels, whereas immunohistochemistry was per-formed on endothelial cells lining the vessel circumference.Additional transcription of ICAM-1 may take place in othercells, such as SMCs, present in the vessel. It is interesting thatsuch an increase of ICAM-1 transcription levels at 20 weeksin aortic arch samples is not present in aortas (data notshown). Reduced endothelial ICAM-1 expression coincidedwith the presence of a significant number of more advancedfibrotic lesions. A decrease in ICAM-1 expression may bematched with a reduced influx of leukocytes within athero-sclerotic walls. Indeed, Roselaar et al27 indicate that thenumber of T lymphocytes, immunoreactive for Thy 1.2, CD4,CD5, and CD8, in atherosclerotic lesions of 16-week-oldapoE2/2 and LDL receptor–deficient mice is very signifi-cantly decreased from the levels present in 4-week-old mice.Interestingly, blocking the access of ICAM-1 to leukocytesby monoclonal antibodies in apoE-deficient animals on achow diet reduced the homing of macrophages to atheroscle-rotic plaques by 65%.28 Our results are supported by a recentstudy that used qualitative analysis and reported increasedICAM-1 expression in apoE-deficient animals.29 Moreover,and very significantly, observations made on human coronar-

Figure 4. Northern blot analysis ofICAM-1. A, Typical Northern blot experi-ment showing samples from 4 differentanimals (C57BL6 and apoE mice) at dif-ferent time points (0, 6, 16, and 20weeks). Northern blot analysis of aorticarch samples was performed on a totalof 64 animals. GAPDH expressionserved as a control for loading. B,Quantification of ICAM-1 signals, per-formed on a total of 64 animals, in rela-tion to GAPDH levels is shown. Resultsshow that ICAM-1 gene expression isupregulated in aortic arch samples of6-week chow-fed apoE but not C57BL6mice. Quantification of ICAM-1 signalsshowed an overexpression by at least2-fold in apoE mice at 6 weeks com-pared with controls and apoE animalsat 0 and 16 weeks. However, anincrease in ICAM-1 transcription wasobserved in aortic arches of chow-fedapoE mice at 20 weeks. Results arerepresented in a quantitative way, withmean6SEM.




ies and carotids show ICAM-1 expression to be correlatedwith vascular lesions.7 ICAM-1, as well as VCAM-1, isexpressed in a flow-dependent manner.30 Upregulation ofICAM-1 from its constitutive levels of expression on culturedhuman and rabbit arterial endothelial cells has been shown tooccur after lysophosphatidylcholine treatment.31 Moreover,lysophosphatidylcholine induced the expression of ICAM-1on endothelium derived from human iliac arteries but notfrom umbilical veins.31 It is of interest to note that high levelsof lysophosphatidylcholine are present in a hyperlipidemicstate.

Endothelial adhesion molecules, together with other im-portant cofactors, such as chemoattractants, play a criticalrole in the homing of monocytes to sites of vascular lesions.In apoE2/2 compared with wild-type animals, a significantmodulation of ICAM-1 expression over time is observed.Other factors, in addition to adhesion molecules, appear to beimplicated in the swift initiation and perpetuation of vascularlesions. Indeed, knocking out monocyte chemoattractantprotein-1 (MCP-1) or its receptor, in LDL receptor–deficientor apoE2/2 mice, respectively, will also significantly decreaselesion formation.32,33 Blocking nuclear factor-kB activity inendothelial cells by anti-sense oligonucleotides will affect notonly ICAM-1 upregulation but also MCP-1 production and,ultimately, the homing of monocytes.34 Adhesion and trans-migration, mediated by several interacting molecular mech-anisms, appear to be essential for monocyte traffic in athero-sclerosis. Some of these factors, such as nuclear factor-kb,MCP-1, interleukin-8/neutrophil-activating peptide, platelet-activating factor, and RANTES, may be activated or upregu-lated at an early stage in apoE2/2 but not wild-type mice.

PECAM-1 is one of the most abundant constitutivelyexpressed endothelial cell adhesion molecules (up to 106

molecules per cell).7 There is good evidence to suggest that itis a key participant in the adhesion cascade leading toextravasation of leukocytes to sites of inflammation.35 How-ever, the mechanism explaining PECAM-1 implication inleukocyte transmigration is not yet completely elucidated.PECAM-1 molecules expressed by leukocytes and endothe-lial cells are known to allow homophilic interactions.36 Inaddition, it has been suggested that PECAM-1 can interactwith upregulatedavb3.37,38 In the present study, a significantmodulation of endothelial PECAM-1 expression, lining thewhole vessel wall circumference, was observed for apoE-deficient but not wild-type mice. It is of interest to note thatPECAM-1 expression can be significantly modulated aftertreatment of human umbilical vein endothelial cells withinflammatory cytokines. Indeed, tumor necrosis factor-a andinterferon-g can lead to the disappearance of PECAM-1 fromcell junctions and a very significant reduction in the migra-tion of leukocytes through endothelial cells.39 In a recentlypublished report31 on apoE, it was stated that PECAM-1appears not to be differentially regulated. Differences be-tween our results and those of Nakashima et al29 mayconceivably be due to the fact that we have used a quantita-tive technique to assay the mean expression level ofPECAM-1. It is conceivable that the increased expression ofPECAM-1 and ICAM-1 is the result of either a continuousinsult of endothelial cells or repeated insult and injury, whichmay result in endothelial cell regeneration.1 Albelda et al35,36

inhibited in vitro confluence of cultured endothelial cells byusing anti-PECAM-1 antibodies. Such data strongly indicatethat PECAM-1, through its homotypic mechanism of adhe-sion, is actively involved in the regulation of cell-cell adhe-sion.36 The cooperation between adhesion molecules mayenhance cell-cell cross talk and subsequent interactions. It

Figure 5. RT-PCR analysis of VCAM-1. A, Typical RT-PCR experiment shows the presence of VCAM-1 transcripts in C57BL6 andapoE aortic murine tissues. Lanes 1, 2, 3, and 4 correspond to VCAM-1 cDNA after amplification from RNAs of C57BL6 aortas at 0, 6,16, and 20 weeks, respectively, of chow diet. Lanes 5, 6, 7, and 8 correspond to VCAM-1 cDNA after amplification from RNAs of apoEaortas at 0, 6, 16, and 20 weeks, respectively, of chow diet. B, Removal of genomic DNA was verified by PCR, with use of GAPDHprimers, on the extracted RNAs. Absence of GAPDH transcript confirmed efficient removal of genomic DNA. Lower band correspondsto free nucleotides.




was recently suggested that homophilic adhesion ofPECAM-1 might lead to integrin upregulation.40

Endothelial VCAM-1, an inducible cell surface adhesionmolecule of the immunoglobulin gene superfamily, interactswith cells expressing the integrina4b1 ligand.41 VCAM-1 hasbeen identified as a very early event in the development ofatherosclerotic lesions in experimental animal models.42 Ourresults show that over time the profile of endothelialVCAM-1 mean expression, lining the whole vessel intimalcircumference, did not significantly change for either apoE2/2

or wild-type mice. However, endothelial VCAM-1 washighly expressed over fatty streaks and was decreased onfibrofatty and complex lesions. In our samples, VCAM-1 notonly was identified on endothelial cells but also was presenton proliferating SMCs. These data report for the first time thepresence of VCAM-1 mRNA levels in murine controlC57BL6, as well as apoE, aortas. All murine tissues tested(aortas, aortic arches, and hearts) showed the presence ofVCAM-1 mRNA after genomic DNA removal. Great careshould be taken in the selection of primers, PCR productlength, and PCR conditions to be able to detect murineVCAM-1 mRNA. These observations are very much in linewith those obtained with the use of immunological tech-niques, as shown in the present study and in those reported bya number of authors. In fact, by use of in vivo radiolabeledmonoclonal antibody techniques, constitutive murine(C57BL/6Jstrain) VCAM-1 expression was shown to bepresent in the heart vasculature. Moreover, murine constitu-tive VCAM-1 expression is quite heterogeneous, with thehighest level present in the heart, followed by the mesentery,brain, and small intestine.43 Another study showed the pres-ence of constitutive VCAM-1 expression by the endotheliumof the coronary artery and the endocardium in C57BL/6mice.44 In addition, scattered endothelial cells in normalmurine aorta express VCAM-1.45 Moreover, Ando et al46

demonstrated that cultured murine endothelial cells showconstitutive high levels of VCAM-1 expression. Furthermore,Li et al47 found similar results within arteriosclerotic plaquesfrom rabbits fed a 0.3% cholesterol–containing diet. More-over, a recent study involving apoE-deficient mice31 verymuch supports the present observations. In human tissues,different workers showed VCAM-1 expression to be eitherpresent or weakly detected in atherosclerotic lesions. Toexplain such discrepancies, it is conceivable that lesionsexamined by different teams may have been at slightlydifferent stages of evolution of the plaque or ages of thepatients. De novo expression of VCAM-1 may be induced, asit is for ICAM-1, by the generation of lysophosphatidylcho-line during hyperlipidemia, leading preferentially for mono-nuclear recruitment to sites of atherogenesis.48 Finally,VCAM-1 may play a vital role in the vasa vasorum, bymodulating the extravasation of leukocytes.11,25

One possible way to investigate the role of adhesionmolecules in initiating and perpetuating vascular lesions overtime is by measuring their mean expression level presentaround the whole vessel circumference. Conceivably, such ananalysis may have its limitations, with an increase of anadhesion molecule at one site of lesion neutralized by adecrease at another. However, results in the present studyshow that the mean level of adhesion molecule expression,assayed by measurements on healthy and diseased endothe-

lium over time, show a significantly different pattern forapoE2/2 and wild-type mice. ICAM-1 and PECAM-1 areadhesion molecules that are constitutively expressed, asopposed to VCAM-1, which is inducible, by vascular endo-thelial cells. Such differences may perhaps give a clue to theresults that have been obtained in the present study. Greatcare should be taken in evaluating the role of these adhesionmolecules, inasmuch as a number of other adhesion mole-cules, such as P-selectin and E-selectin, have not been takenin consideration in the present study.49 In addition, cautionhas to be taken in extrapolating results from mice to humansbecause of the considerable differences in genetic, metabolic,and other pathways leading to atherosclerosis. Indeed, anabsence of cholesteryl ester transfer protein and Lp(a) isobserved in mice. Moreover, most studies in mice areperformed on the aorta instead of the coronary arteries. Genesimplicated in diseased coronaries are thought to differ fromthose implicated in aortic lesions.50

In conclusion, our results suggest that ICAM-1, PECAM-1,and VCAM-1 expressions may provide a background to theatherosclerotic plaque formation in this model. Specifically,they would greatly facilitate monocyte adhesion to the endo-thelium and subsequent extravasation. However, the com-plexity of the interplay of biomechanical and humoral stimuliin the induction and modulation of adhesion molecules andtheir cofactors remains far from being clear. Expressions ofthese adhesion molecules in knockout animals were corre-lated with the evolution of the plaque from a fatty to a fibrousstage.

AcknowledgmentsThis work was supported by the French Ministry of EducationScientific Research (grant MESR ACC-SV9) and by the EuropeanNetwork on Atherosclerosis (ENA, BIOMED 2, grant PL 1195). Theauthors are indebted to Dr Catherine Souchier, Center Commun deQuantimetrie, Universite Claude Bernard (Lyon-1), for helping withthe computing studies.

References1. Ross R. The pathogenesis of atherosclerosis.Nature.1993;362:801–809.2. Suzuki H, Kuriara Y, Takeya M, Kamada N, Kataoka M, Jishage K, Ueda

O, Sagakuchi H, Higashi T, Suzuki T, et al. A role for macrophagescavenger receptors in atherosclerosis and susceptibility to infection.Nature.1997;386:292–296.

3. Hajjar DP, Nicholson AC. Atherosclerosis.Am Scientist.1995;83:460–467.

4. Munro JM, Cotran RS. Biology of the disease: the pathogenesis ofatherosclerosis: atherogenesis and inflammation.Lab Invest.1988;58:249–261.

5. Ohno T, Gordon D, San H, Pompili VJ, Imperiale MJ, Nabel GJ, NabelEG. Gene therapy for vascular smooth muscle cell proliferation afterarterial injury.Science.1994;265:781–784.

6. Springer TA. Adhesion receptors of the immune system.Nature.1990;346:425–434.

7. Poston RN, Haskard DO, Coucher JR, Gall NP, Johnson-Tidey RR.Expression of intercellular adhesion molecule-1 in atheroscleroticplaques.Am J Pathol.1992;140:665–673.

8. Bogen S, Pak J, Garifallou M, Deng X, Muller WA. Monoclonal antibodyto murine PECAM-1 (CD31) blocks acute inflammation in vivo.J ExpMed.1994;179:1059–1064.

9. Cybulsky MI, Gimbrone MA Jr. Endothelial expression of a mononuclearleukocyte adhesion molecule during atherogenesis.Science.1991;251:788–791.

10. Johnson-Tidey RR, McGregor JL, Taylor PR, Poston RN. Increase in theadhesion molecule P-selectin in endothelium overlaying atheroscleroticplaques: coexpression with intercellular adhesion molecule-1.Am JPathol.1994;144:952–961.




11. Schaefer EJ, Gregg RE, Ghiselli G, Forte TM, Ordovas JM, Zech LA,Brewer HB Jr. Familial apolipoprotein deficiency.J Clin Invest.1986;78:1206–1219.

12. Piedrahita JA, Zhang SH, Hagaman JR, Oliver PM, Maeda N. Generationof mice carrying a mutant apolipoprotein E gene inactivated by genetargeting in embryonic stem cells.Proc Natl Acad Sci U S A.1992;89:4471–4475.

13. Reddick RL, Zhang SH, Maeda N. Atherosclerosis in mice lacking apo E:evaluation of lesional development and progression.Arterioscler Thromb.1994;14:141–147.

14. Nakashima Y, Plump AS, Raines EW, Breslow JL, Ross R. ApoE-deficient mice develop lesions of all phases of atherosclerosis throughoutthe arterial tree.Arterioscler Thromb.1994;14:133–140.

15. Davies MJ, Woolf N, Rowles PM, Pepper J. Morphology of the endo-thelium over atherosclerotic plaques in human coronary arteries.BrHeart J.1988;60:459–464.

16. Rosenfeld ME, Tsukada T, Gown AM, Ross R. Fatty streak initiation ina Watanabe heritable hyperlipemic and comparably hypercholesterolemicfat-fed rabbits.Arteriosclerosis.1987;7:9–23.

17. Shih DM, Welch C, Lusis AJ. New insights into atherosclerosis fromstudies with mouse models.Mol Med Today.1995;1:364–372.

18. Chomczynski P, Sacchi N. Single step method of RNA isolation by acidguanidinium thiocyanate-phenol-chloroform extraction.Anal Biochem.1987;162:156–159.

19. Sambrook J, Fritsch EF, Maniatis T.Molecular Cloning: A LaboratoryManual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Labo-ratory; 1989.

20. Plump AS, Breslow JL. Apolipoprotein E and the apolipoproteinE-deficient mouse.Annu Rev Nutr.1995;15:495–518.

21. Shor A, Kuo CC, Patton DL. Detection ofChlamydia pneumoniaeinaortic lesions of atherosclerosis by immunocytochemical stain.Arte-rioscler Thromb.1993;13:1501–1504.

22. Ross R. Atherosclerosis: a problem of the biology of arterial wall cellsand their interactions with blood components.Arteriosclerosis.1981;1:293–311.

23. O’Brien KD, McDonald TO, Chait A, Allen MD, Alpers CE. Neovascularexpression of E-selectin, intercellular adhesion molecule-1, and vascularcell adhesion molecule-1 in human atherosclerosis and their relation tointimal leukocyte content.Circulation. 1996;93:672–682.

24. Poston RN, Johnson-Tidey RR. Localized adhesion of monocytes tohuman atherosclerotic plaques demonstrated in vitro.Am J Pathol.1996;149:73–80.

25. Marlin SD, Springer TA. Purified intercellular adhesion molecule(ICAM-1) is a ligand for lymphocyte function-associated antigen 1(LFA-1). Cell. 1987;51:813–819.

26. Makgoba MW, Sanders ME, Ginther Luce GEG, Dustin ML, SpringerTA, Clark EA, Mannoni P, Shaw S. ICAM-1 a ligand for LFA-1dependent adhesion of B, T and myeloid cells.Nature.1988;331:86–88.

27. Roselaar SE, Kakkanathu PX, Daugherty A. Lymphocyte populations inatherosclerotic lesions of apoE2/2 and LDL receptor2/2 mice: decreasingdensity with disease progression.Arterioscler Thromb Vasc Biol.1996;16:1013–1018.

28. Patel SS, Thiagarajan R, Willerson JT, Yeh ET. Inhibition of alpha4integrin and ICAM-1 markedly attenuate macrophage homing to athero-sclerotic plaques in ApoE-deficient mice.Circulation. 1998;97:75–81.

29. Nakashima Y, Raines EW, Plump AS, Breslow JL, Ross R. Upregulationof VCAM-1 and ICAM-1 at atherosclerosis-prone sites on the endothe-lium in the apoE-deficient mouse.Arterioscler Thromb Vasc Biol.1998;18:842–851.

30. Walpola PL, Gotlieb AI, Cybulsky MI, Langille BL. Expression ofICAM-1 and VCAM-1 and monocyte adherence in arteries exposed toaltered shear stress.Arterioscler Thromb Vasc Biol.1995;15:2–10.

31. Kume N, Cybulsky MI, Gimbrone MA Jr. Lysophosphatidylcholine, acomponent of atherogenic lipoproteins, induces mononuclear leukocyte

adhesion molecules in cultured human and rabbit arterial endothelialcells.J Clin Invest.1992;90:1138–1144.

32. Boring L, Gosling J, Cleary M, Charo IF. Decreased lesion formation inCCR2-/- mice reveals a role for chemokines in the initiation of athero-sclerosis.Nature.1998;394:894–897.

33. Gu L, Okada Y, Clinton SK, Gerard C, Sukhova GK, Libby P, Rollins BJ.Absence of monocyte chemoattractant protein-1 reduces atherosclerosisin low density lipoprotein receptor-deficient mice.Mol Cell. 1998;2:275–281.

34. Gawaz M, Neuman F-J, Dickfeld T, Koch W, Laugwitz K-L, AdelsbergerH, Langenbrink K, Page S, Neumeier D, Schomig A, et al. Activatedplatelets induce monocyte chemotactic protein-1 secretion and surfaceexpression of intercellular adhesion molecule-1 on endothelial cells.Cir-culation.1998;98:1151–1152.

35. Vaporcyian AA, DeLisser HM, Yan H, Mendiguren II, Thom SR, JonesPA, Ward PA, Albelda SM. Involvement of platelet endothelial celladhesion molecule-1 in neutrophil recruitment in vivo.Science.1993;262:1580–1582.

36. Albelda SM, Muller WA, Buck CA, Newman PJ. Molecular and cellularproperties of PECAM-1 (endoCam/CD 31): a novel vascular cell-celladhesion molecule.J Cell Biol. 1991;114:1059–1068.

37. Piali L, Hammel P, Uherek C, Bachmann F, Gisler RH, Dunon D, ImhofBA. CD31/PECAM-1 is a ligand foravb3 integrin involved in adhesionof leukocytes to endothelium.J Cell Biol. 1995;130:451–460.

38. Buckley CD, Doyonnas R, Newton JP, Blystone SD Brown EJ, Watt SM,Simmons DL. Identification ofavb3 as a heterotopic ligand for CD31/PECAM-1.J Cell Sci.1996;109:437–445.

39. Rival Y, Del Maschio A, Rabiet MJ, Dejana E, Duperray A. Inhibition ofplatelet endothelial cell adhesion molecule-1 synthesis and leukocytetransmigration in endothelial cells by the combined action of TNF-a andIFN-g. J Immunol.1996;157:1233–1241.

40. Newman PJ. Perspectives series on cell adhesion in vascular biology: thebiology of PECAM-1.J Clin Invest.1997;99:3–7.

41. Elices MJ, Osborn L, Takada Y, Crouse C, Luhowskyl S, Hemler ME,Lobb RR. VCAM-1 on activated endothelium interacts with the leukocyteintegrin VLA-4 at a site distinct from the VLA-fibrinogen binding site.Cell. 1990;60:577–584.

42. Cybulsky MI, Gimbrone MA. Endothelial expression of a mononuclearleukocyte adhesion molecule during atherogenesis.Science.1991;251:788–791.

43. Henninger DD, Panes J, Eppihimer M, Russell J, Gerritsen M, AndersonDC, Granger DN. Cytokine-induced VCAM-1 and ICAM-1 expression indifferent organs of the mouse.J Immunol.1997;158:1825–1832.

44. Russell PS, Chase CM, Colvin RB. Accelerated atheromatous lesions inmouse hearts transplanted to apolipoprotein-E-deficient recipients.Am JPathol.1996;149:91–99.

45. Lindner V, Collins T. Expression of NF-kappa B and I kappa B-alpha byaortic endothelium in an arterial injury model.Am J Pathol.1996;148:427–438.

46. Ando J, Tsuboi H, Korenaga R, Takada Y, Toyama Sorimachi N,Miyasaka M, Kamiya A. Shear stress inhibits adhesion of cultured mouseendothelial cells to lymphocytes by downregulating VCAM-1 expression.Am J Physiol.1994;267:C679–C687.

47. Li H, Cybulsky MI, Gimbrone MA Jr, Libby P. Inducible expression ofvascular cell adhesion molecule-1 by vascular smooth muscle cells invitro and within rabbit atheroma.Am J Pathol.1993;143:1551–1559.

48. Carlos TM, Harlan JM. Leukocyte-endothelial adhesion molecules.Blood.1994;84:2068–2101.

49. Dong ZM, Chapman SM, Brown AA, Frenette PS, Hynes RO, WagnerDD. The combined role of P- and E-selectins in atherosclerosis.J ClinInvest.1998;102:1,145–152.

50. Shih DM, Welch C, Lusis AJ. New insights into atherosclerosis fromstudies with mouse models.Mol Med Today.1995;1:364–373.




Documents

Modulation of Expression of Endothelial Intercellular Adhesion Molecule-1, Platelet-Endothelial Cell Adhesion Molecule-1, and Vascular Cell Adhesion Molecule-1 in Aortic Arch Lesions