Mode of leptin action in chicken hypothalamus

www.elsevier.com/locate/brainres

Brain Research 1047

Research report

Mode of leptin action in chicken hypothalamus

Sami Dridi*, Quirine Swennen, Eddy Decuypere, Johan Buyse

Laboratory of Physiology and Immunology of Domestic Animals, KU Leuven, 3001 Heverlee, Belgium

Accepted 15 April 2005

Abstract

While there have been many studies in various species examining the mode of central leptin action on food intake, there is however a

paucity of data in birds. We have, therefore, addressed this issue in broiler chickens because this strain was selected for high growth rate, hence

high food intake. Continuous infusion of recombinant chicken leptin (8 Ag/kg/h) during 6 h at a constant rate of 3 ml/h resulted in a significant

reduction (49–57%) of food intake in 3-week-old broiler chickens (P < 0.05). The effect of leptin within the central nervous system (CNS)

was mediated via selective hypothalamic neuropeptides. Leptin significantly decreased the expression of its receptor (Ob-R), neuropeptide Y

(NPY), orexin (ORX), and orexin receptor (ORXR) (P < 0.05), but not that of agouti-related protein (AgRP) (anabolic/orexigenic effectors) in

chicken hypothalamus. However, the catabolic/anorexigenic neuropeptides namely proopiomelanocortin (POMC) and corticotropin-releasing

hormone (CRH) mRNA levels remained unchanged after leptin treatment. Despite the absence of leptin effect on AgRP (the antagonist of

melanocortin receptor MCR) and POMC (the precursor of a-melanocyte stimulating hormone which is a potent agonist for MCR), leptin

significantly decreased the expression of MCR-4/5 gene in chicken hypothalamus (P < 0.05) suggesting that leptin acts directly (as ligand) or

indirectly (via other ligands) on MCRs to regulate food intake in birds. Additionally, leptin down-regulated the expression of fatty acid

synthase (FAS) gene in chicken hypothalamus, indicating an additional pathway of leptin action on food intake such as described for FAS

inhibitors. These findings provide new insight into the mechanism of leptin control of food intake in chickens.

D 2005 Elsevier B.V. All rights reserved.

Keywords: Chicken leptin; Food intake; Neuropeptides; FAS; Broiler; Hypothalamus

1. Introduction

Food intake is regulated via neural circuits located in the

hypothalamus. During the past decade, our knowledge on the

specific mediators and neuronal networks that regulate food

intake and body weight has increased dramatically. An

important contribution to the understanding of hypothalamic

control of food intake has been the characterization of the ob

gene product (leptin) via positional cloning [82]. Leptin, a

16-kDa peptide hormone, is mainly secreted by adipose

tissue in mammals [82] and functions as a hormonal sensing

mechanism for fat deposition and body weight homeostasis

[25,28,54]. Mammalian adipocytes produce and secrete

more leptin in the bloodstream as fat storage increases

0006-8993/$ - see front matter D 2005 Elsevier B.V. All rights reserved.

doi:10.1016/j.brainres.2005.04.034

* Corresponding author. Fax: +32 16321994.

E-mail address: [email protected] (S. Dridi).

[44], signaling the brain via leptin receptor [3,22,23,48] and

modulating the hypothalamic neuropeptide system to inhibit

food intake and increase energy expenditure [25,47,64,

65,81]. Among these hypothalamic neuropeptides, the

best-described anabolic effectors are neuropeptide Y

(NPY) [39,71] and agouti gene-related peptide (AgRP)

[27,60]. The catabolic counterparts of NPY/AgRP system

are proopiomelanocortin (POMC), the precursor of alpha-

melanocyte stimulating hormone (a-MSH) [11] and cocaine-

and amphetamine-regulated transcript (CART) [38]. NPY

and AgRP (NPY/AgRP) are co-localized in neurons in the

arcuate nucleus (ARC) [27], whereas POMC and CART

(POMC/CART) are expressed in distinct neurons in the ARC

[20]. NPY/AgRP and POMC/CART neurons in the ARC

project to second-order neurons, including those in the

paraventricular nucleus (PVN), perifornical area (PFA), and

lateral hypothalamus (LHA) [21]. The second-order target

neurons selectively express additional neuropeptides such as

(2005) 214 – 223

S. Dridi et al. / Brain Research 1047 (2005) 214–223 215

melanin-concentrating hormone (MCH) and orexin (hypo-

cretin) in LHA that can induce feeding [18,55,61,66] or

corticotropin-releasing hormone (CRH), thyrotropin-releas-

ing hormone (TRH), and oxytocin in the PVN that can

inhibit feeding [33,53,70]. It is the balance between these

two pathways (anabolic and catabolic) that ultimately

determines the animal’s ingestive behavior and defended

the body weight set point. More recently, it has been shown,

by using specific inhibitors, that fatty acid synthase (FAS)

regulates food intake in mammals [36,41,67] and that the

mechanism may involve hypothalamic neuropeptides as

those trigged by leptin [45]. The mechanism of central neu-

ropeptide-mediating leptin action on feeding behavior has

been the subject of many studies in mammals over the last

few years. Exogenous administration of leptin decreased the

orexigenic peptides (anabolic effectors) and increased the

anorexigenic ones (catabolic effectors) resulting in the

reduction of food intake. In chicken, leptin manifests some

particularities compared to that in mammals: (1) chicken

leptin is expressed not only in adipose tissue but also in liver

[2,78], (2) liver is the major source for leptin [58], (3) leptin

gene expression is sensitive to hormonal treatment in liver

but not in adipose tissue [2], and (4) chicken leptin protein

contains three cysteine residues as compared to two in

mammalian leptin [78]. Rock et al. [59] showed that these

two cysteines are involved in an intrachain disulfide bridge

that is critical for the structural integrity and biological acti-

vity of leptin in mammals. Despite these peculiarities, exo-

genous administration of leptin (recombinant chicken or

human leptin) to chickens resulted in reduction in food

intake as in mammals [14,17,57], whereas the mechanisms

involved are not yet known. Therefore, we undertook this

study to identify the targets of leptin action in chicken

hypothalamus.

2. Materials and methods

2.1. Recombinant chicken leptin infusion

Animal study was conducted with research protocol

approved by Ethical Commission for Experimental Use of

Animals of the Catholic University of Leuven (Belgium).

Day-old male broiler chicks (Ross) were purchased from

Avibel, Zoersel (Belgium) and reared on floor pen until 2

weeks of age, at which time the birds were transferred to

individual cages and provided with individual feeders and

drinking nipples. After 3 days of adaptation, birds were

weighed and cannulated in the brachial artery under local

anesthesia (xylocaine) [7]. The chickens were allowed to

recover and to adapt during four more days. Before the

infusion experiment, the chickens were divided into two

homogenous weight-matched groups (n = 5) and fasted for

2 h in order to increase their appetite. The mini pump

(Syringe pump series, Model 22, Harvard apparatus, USA)

infused recombinant chicken leptin prepared as previously

described [57] (8 Ag/kg/h) or saline at constant rate of 3 ml/

h during 6 h. Serial blood samples were taken at different

times (0, 1.5, 3, 4.5, and 6 h), and food intake was recorded

at 1, 2, 3, 4, 5, and 6 h after mini pump implantation. Birds

were sacrificed by cervical dislocation, and tissues (hypo-

thalamus) were removed and snap frozen in liquid nitrogen

and stored at �80 -C until use.

2.2. RNA extraction

Total RNA was extracted from hypothalamus using the

Trizol reagent (Invitrogen, Belgium) according to manufac-

turer’s recommendation. Pellets were suspended in 20–30 Alof DEPC-treated water. The quantity and integrity of

isolated RNA were determined for each sample by using

both UV absorbance (260/280) as well as by 1% agarose gel

electrophoresis.

2.3. Reverse transcription and polymerase chain reaction

(RT-PCR)

Total RNA from hypothalamus (1 Ag) was reverse

transcribed in a final volume of 20 Al containing 10 units

of AMV reverse transcriptase (Promega, Belgium), 1 mM

dNTP mixture (Promega, Belgium), 40 units of recombinant

RNasin ribonuclease inhibitor (Promega, Belgium), and

0.5 Ag of random primers (Promega, Belgium) in sterilized

water and buffer supplied by the manufacturer. After incu-

bation (42 -C, 45 min), the mixture was heated (80 -C,3 min). PCRwas performed in 50 Al containing 2 Al of the RTreaction, 1 unit of Taq DNA polymerase (Roche Diagnostic,

Belgium), 0.1 mM dNTP mixture, and 10 pmol of each

forward and reverse primer for FAS, hypothalamic neuro-

peptides, and ribosomal 18S (Table 1). Thermal cycling

parameters were as follows: 1 cycle of 94 -C for 2–9 min

followed by 25–30 cycles (35 cycles for characterization and

probe preparation) of 94 -C for 30–60 s, 58–60 -C for 1 min,

72 -C for 1 min with a final extension at 72 -C for 10 min.

2.4. Probe labeling

The amplified fragments (FAS, neuropeptides and 18S)

were separated on a low-melting point agarose gel (1%), and

the appropriate bands were cut out, purified by using

QIAquick Gel extraction kit protocol (Qiagen, Belgium),

and stored at �20 -C. The cDNA fragments were cloned

using the TOPO PCR cloning kit (Invitrogen, The Nether-

lands) and automatically sequenced using an ABI automated

sequencer. Then, 25–30 ng of cloned probes was labeled by

random priming with (a-32P)dCTP [24].

2.5. Southern blot analysis

The amplified PCR products were transferred to nylon

membrane by vacuum blotting apparatus (Amersham

Biosciences, the Netherlands) and cross linked by ultraviolet

Table 1

Oligonucleotide PCR primers

Gene GenBank

accession no

Primers sequence (5VY3V) Orientation Product

size (bp)

FAS J04485 GGAGTCAAACTAGTTATCCATGGCC Forward 423

AAAGGAGATTCCAGCATCGTGCAGC Reverse

Ob-R1 AB033383 GTCCACGAGATTCATCCCAG Forward 271

CCTGAGATGCAGAGATGCTC Reverse

NPY M87294 ATGCAGGGCACCATGAGGCTGTGGGTGTCG Forward 412

CTCCACAGAGTTCAGTACAATGGCTGCATG Reverse

AgRP AB029443 ATGCTGAACGTGCTGCTGCTGTG Forward 426

GCAGTAGCAGAAGGCGTTGAAGA Reverse

ORX AB056748 ACCTCCTGCACGGCATGGGCAACCA Forward 250

CAGGTCCTTCTCAGCGTGCTCCTGG Reverse

ORXR AB110634 ACAGTTTCAGTCTCTGTGTC Forward 240

CCAGTGTTCATCACACACTG Reverse

POMC AB019555 ATGCTGGGAGAACAGCAAGTGCC Forward 426

CATGGGGTAACTCTCAGCCGACT Reverse

MCR-4 XM426042 GATACAGACGCACAGAGCTTTACC Forward 647

CAAAGCCCTCTCAAGTTACAGCAG Reverse

MCR-1 AY220305 GAATCTGCACTCGCCCACGTACT Forward 369

CAGGATGGCGTTGTTGCGGTA Reverse

MCR-5 AB012868 ATCTGCATATCTGTGGTGGCTTCC Forward 446

CAGTAGAGGTTTTGAGGGCAGGAG Reverse

CRH AJ621492 TCTCCCTGGACCTGACTTTC Forward 219

GAGGTGACATCAGAGCAGCA Reverse

18S AF173612 CTGCCCTATCAACTTTCG Forward 515

CATTATTCCTAGCTGCGG Reverse

FAS (fatty acid synthase), Ob-R (leptin receptor), NPY (neuropeptide Y), AgRP (agouti-related protein), ORX (orexin), ORXR (orexin receptor), POMC

(proopiomelanocortin), MCR (melanocortin receptor), CRH (corticotropin-releasing hormone).

S. Dridi et al. / Brain Research 1047 (2005) 214–223216

irradiation and baked at 80 -C for 20–30 min. Membranes

were hybridized with heat denatured 32P-labeled DNA

probes, prepared as described above, at 42 -C overnight.

In the following day, the membranes were rinsed twice with

1 � SSC, 0.1% SDS at 55 -C. Each wash was for 20 min,

and then membranes were subjected to storage phosphor

autoradiography cassette. Hybridization signals were quan-

tified using phosphorimagery (Bio-Imaging Analyzer BAS

1000 Mac BAS, Fujix, TINA software, version 2.09 g,

Belgium).

2.6. Plasma parameters determination

2.6.1. Metabolites

Commercial colorimetric diagnostic kits were used to

measure plasma glucose (IL Testi kit, No. 182508-00),

triglycerides (IL Testi kit, No.181610-60), uric acid (IL

Testi kit, No. 181685-00), and nonesterified fatty acid

levels (Wako Chemicals, Neuss, Germany) with an

automated spectrophotometer (Monarch Chemistry Sys-

tems, Instrumentation Laboratories, B-1930 Zaventem,

Belgium).

2.6.2. Leptin

Plasma leptin concentrations were measured by RIAwith

a rabbit anti-chicken leptin antibody using recombinant chi-

cken leptin as standard [16]. Samples were assayed in a

single assay, and the intra-assay coefficient of variation was

5.2%.

2.6.3. Thyroid hormones

Plasma tri-iodothyronine (T3) levels were measured by

RIA using commercial rabbit anti-T3 antibody (Cam-

bridge Medical Technology/Ventrex, Billerica, MA) and

unlabeled 3, 3V, 5-triiodo-l-thyronine standards (Sigma,

France) [12]. Intra-assay coefficient of variation was

4.6%.

2.6.4. Corticosterone

The plasma corticosterone concentrations were measured

using a sensitive and specific RIA kit (IDS) as described

previously by Lin et al. [40]. The intra-assay variability was

4.2%.

2.7. Statistics

Statistical analyses were performed using Statistical

Analysis System (SAS) software (SAS Institute, 2000,

version 8.1). Repeated-measures ANOVA followed by post

hoc multiple comparisons test, Student–Newman–Keuls,

were performed to detect changes over time during treat-

ments. A P < 0.05 was considered significant. Data from

Southern blot Analysis were expressed in arbitrary densi-

tometry units normalized to the 18S rRNA levels. Values are

expressed as mean T SEM and analyzed by Student’s

unpaired t test, and STATVIEW software was used (Abacus

Concepts, Inc., Copyright* 1992–1996, version 4.57). For

RIA curve analysis, Graph Pad software (version 2, 94–95)

was used.


3. Results

3.1. Effect of recombinant chicken leptin infusion on food

intake in broiler chickens

Three-week-old broiler chickens were divided into two

homogeneous weight-matched groups (n = 5) and were

treated with recombinant chicken leptin or saline solution

(placebo) as described in Materials and methods. After 2 h of

food deprivation, leptin or saline solutions were continu-

ously infused, and animals were refed immediately after start

of infusion. Cumulative food intake was measured at 1, 2, 3,

4, 5, and 6 h after start of feeding. As shown in Fig. 1,

recombinant chicken leptin significantly reduced (P < 0.05

to P < 0.01) cumulative food intake during the next 2–6 h of

feeding with a mean reduction of about 49.1–57.3% as

compared to the placebo.

3.2. Effect of recombinant chicken leptin infusion on plasma

hormone levels

The administration of recombinant chicken leptin resulted

in a significant increase of plasma leptin levels during the

next 1 h 30–6 h of feeding (P < 0.05). The leptinemia in

leptin-treated group peaked 90 min postinjection at 62 ng/ml

and remained higher (17.9 to 37.3-folds) than that in vehicle-

treated group (55.7 T 4.7 to 65.03 T 2.85 vs. 2.52 T 0.25 to

3.46 T 0.23 ng/ml; mean T SEM, n = 5) (Fig. 2A). Leptin

tended to decrease plasma T3 levels, however, this reduction

(4.3 to 25.9% compared to control group) was not statisti-

cally significant at the 5% level (Fig. 2B). The effect of leptin

on plasma corticosterone levels was not consistent and not

significantly different compared to untreated group (Fig.

2C). It should be noted that a high individual variability was

observed in circulating corticosterone concentrations.

Fig. 1. Effect of recombinant chicken leptin infusion on cumulative food

intake in 3-week-old broiler chickens. Recombinant chicken leptin (8 Ag/kg/h) or saline solution was continuously administered at a constant rate of

3 ml/h during 6 h. Cumulative food intake was measured continuously and

presented graphically as mean T SEM (n = 5) and * indicates a significant

difference between leptin-treated group and the placebo at P < 0.05.

Fig. 2. Effect of recombinant chicken leptin on plasma hormone levels.

Recombinant chicken leptin (8 Ag/kg/h) or saline solution was continuouslyinfused at constant rate of 3 ml/h in 3-week-old broiler chickens during 6 h.

Circulating leptin (A), T3 (B), and corticosterone levels (C) were measured at

0, 1.5, 3, 4.5, and 6 h by RIAs, and values are mean T SEM (n = 5).

* Indicates a significant difference between the two groups at P < 0.05.

3.3. Effect of recombinant chicken leptin infusion on plasma

metabolite levels

Recombinant chicken leptin administration resulted in a

slight, but not significant decrease of plasma glucose levels

during the 1 h 30–6 h of feeding (Fig. 3A). The reduction

average was about 12.5–17.8% as compared to the control

group. The effect of leptin was not consistent on circulating

triglycerides, nonesterified fatty acids (NEFA), and uric acid

concentrations (Figs. 3B, C, and D, respectively).

Fig. 3. Effect of recombinant chicken leptin on plasma metabolite concentrations. Leptin administration was 8 Ag/kg/h during 6 h at constant rate of 3 ml/h.

Plasma glucose (A), triglycerides (B), nonesterified fatty acids (NEFA) (C), and uric acid (D) were continuously determined as described in Materials and

methods. Values are mean T SEM (n = 5).


3.4. Effect of recombinant chicken leptin infusion on chicken

hypothalamic fatty acid synthase (FAS) and leptin receptor

(Ob-R) gene expression

Leptin administration during 6 h significantly down-

regulated the hypothalamic FAS and Ob-R gene expression

by 21 and 15.2% respectively (P < 0.05, Fig. 4) as compared

to the control group.


hypothalamic anabolic/orexigenic peptides

Recombinant chicken leptin significantly reduced both

NPY, orexin (ORX), and ORXR gene expression by 14,

13.5, and 7% respectively (P < 0.05, Fig. 5) in the

hypothalamus of 3-week-old broiler chickens. However,

AgRP mRNA levels were not significantly affected by leptin

treatment (Fig. 5).


hypothalamic catabolic/anorexigenic peptides

Recombinant chicken leptin administration did not signi-

ficantly affect the POMC, MCR-1, and CRH gene expres-

sion in the hypothalamus of 3-week-old broiler chickens.

However, MCR-4, which plays the most important role in

mediating catabolic effects of a-MSH, and MCR-5 were

significantly reduced in leptin-treated group compared to

untreated group (0.911 T 0.044 vs. 0.592 T 0.066 and 0.587 T0.014 vs. 0.487 T 0.031, respectively, for MCR-4 and

-5; mean T SEM; arbitrary unit; P < 0.05) (Fig. 6).

4. Discussion

The biological activity of the recombinant chicken leptin

was demonstrated previously by its ability to stimulate the

proliferation of BAF/3 1442-CL4 cells, in vitro, transfected

with the functional long form of the human leptin receptor

[2] and in vivo by its inhibitory effect on food intake after a

single peripheral (intraperitoneal or intravenous) injection

[17,57]. Furthermore, Denbow et al. [14] have shown that

intracerebroventricular (ICV) injection of recombinant

human leptin decreased food intake in both broiler and

leghorn chickens in a dose-dependent manner, with 10 Ag asthe most efficacious dose. However, Bungo et al. [5] reported

that ICVadministration of recombinant mouse leptin did not

affect food intake in chickens. In this study, we have shown

that continuous infusion of recombinant chicken leptin (8 Ag/kg/h) during 6 h resulted in a 49–57% reduction of food

Fig. 5. Effect of recombinant chicken leptin infusion on neuropeptide Y

(NPY), agouti-related protein (AgRP), orexin (ORX), and orexin receptor

(ORXR) gene expression in the hypothalamus of 3-week-old broiler

chickens. Total RNA from hypothalamus was prepared and subjected to

RT-PCR and Southern blot analysis as described previously in Materials and

methods. Levels of NPY, AgRP, ORX, and ORXR gene expression are

expressed in arbitrary units relative to 18S levels and presented graphically as

mean T SEM (n = 5) and * indicates a significant difference at P < 0.05.

Fig. 4. Effect of recombinant chicken leptin on hypothalamic fatty acid

synthase (FAS) and leptin receptor (Ob-R) gene expression in 3-week-old

broiler chickens. Recombinant chicken leptin (8 Ag/kg/h) or saline solutionwas continuously administered at a constant rate (3 ml/h) during 6 h. Total

RNA was extracted and subjected to RT-PCR coupled to Southern blot

analysis. Data are presented as ratio of specific genes (FAS and Ob-R) to

ribosomal 18S gene expression and values are mean T SEM of 5 chickens

per group. *P < 0.05 indicates a significant difference between leptin- and

vehicle-treated groups.


intake in 3-week-old broiler chickens and support those

found in birds and in other species [4,9,28]. The observed

numeric, but not significant, decrease of plasma T3 and

glucose levels in leptin-infused chickens may be a con-

sequence of the lowered food intake as this will affect both

circulating glucose and T3 concentrations in a complex and

interactive way as described in previous studies [8]. The new

finding in this study was the identification of the central site

of leptin action on food intake regulation in birds. We have

shown firstly that leptin administration significantly reduced

the leptin receptor gene expression in chicken hypothalamus

confirming that leptin acts within the CNS to regulate food

intake. However, the mechanism(s) involved in the transport

of leptin to across the blood–brain barrier (BBB) remained

unclear. Indeed, McMurtry et al. [46] showed that no leptin

binding protein was detected in blood of chickens, whereas,

in mammals, leptin is secreted from adipose tissue, circulates

in the blood where it binds to a family of binding proteins

including the soluble leptin receptor (Ob-Re) [15,29,69],

then crosses the BBB to enter the brain [6,31,37], and then

interacts with hypothalamic neuropeptides that regulate

ingestive behavior. In this study, we have shown also that

recombinant chicken leptin significantly reduced orexigenic

neuropeptides (NPY, ORX, and ORXR). This result corrob-

orates previous findings in mammals [42,62]. NPY stim-

ulates food intake in birds similarly to that in mammals [35]

and has also been shown to be localized within the

hypothalamus [34]. Ohkubo et al. [52] showed that ORX

was expressed within the hypothalamus of chickens and is

induced by fasting. However, ICV administration of mam-

malian ORX did not affect food intake in neonatal chicks

[26]. Interestingly, leptin administration did not affect AgRP

(orexigenic neuropeptide) and POMC and CRH (anorexi-

genic/catabolic neuropeptides). This observation is com-

pletely different from the results obtained in mammals

because leptin-treated mammals showed lower AgRP

[19,49] and higher POMC and CRH mRNA levels than that

of vehicle-treated group [50,51,63,79,80]. This discrepancy

may be related to site or species-specific effects of leptin.

Indeed, Arvaniti et al. [1] showed that leptin treatment

decreased CRH mRNA levels in the paraventricular hypo-

thalamic nucleus (PVH) and enhanced CRH gene expression

in the central nucleus of amygdala and in the bed nucleus of

the stria terminalis in mice. In our study, we sampled the

whole hypothalamus, and the effect of leptin on CRHmay be

different according to the hypothalamic area. Denbow et al.

[13] have shown that ICV administration of CRF signifi-

cantly decreased food intake in both fed and overnight-fasted

Fig. 6. Effect of recombinant chicken leptin infusion on proopiomelano-

cortin (POMC), corticotropin-releasing hormone (CRH), and melanocortin

receptors (MCR-1, -4, and -5) gene expression in 3-week-old broiler

chickens. Recombinant chicken leptin (8 Ag/kg/h) or saline solution was

administered during 6 h at a constant rate of 3 ml/h. Relative hypothalamic

anorexigenic neuropeptide (POMC, CRH, MCRs) gene expression was

determined by RT-PCR and Southern blot analysis and graphically presented

as mean T SEM (n = 5). *P < 0.05 indicates a significant difference between

leptin-treated and untreated group.


broiler and leghorn chickens. a-MSH is derived from the

cleavage of the precursor, POMC, and significantly inhibited

fasting- and NPY-induced feeding in neonatal chicks in a

dose-dependent manner when administered by ICV injection

[32]. The anorexigenic effect of a-MSH was abolished after

the administration of AgRP in chickens [72]. It has been

shown that the effect of AgRP differed between chicken

strains; it stimulated food intake in layer but not in broiler-

type chickens [72]. These previous studies suggested that the

anorexigenic effect of endogenous a-MSH may not be

important in broiler chickens. Present results seem to support

their suggestion indicating that leptin may act selectively via

orexigenic neuropeptides (NPY and ORX, but not AgRP)

rather than anorexigenic pathways (POMC and CRH in this

study) at least in broiler chickens. and further studies are

required to examine other chicken strains. Additionally, we

used in this study male chickens, and the effect of leptin and

its interaction with hypothalamic neuropeptides may depend

on gender as previously reported for sheep [10]. It is also

known that the melanocortin system coordinates the main-

tenance of energy balance in mammals via the regulation of

both food intake and energy expenditure [30]. The adipo-

genic hormone leptin, which is involved in the regulation of

energy balance, is thought to act by stimulating the

production of a-MSH (the potent agonist of MCR-3 and

-4) [39] and inhibited the release of AgRP (the antagonist of

MCR-3 and -4) in mammals [43,56]. Five receptor genes

belonging to the MCR family have been recently cloned in

birds [73,75–77]. MCR-1 is implicated in melanogenesis

within melanocytes since it has been mapped at the genetic

locus which acts to control feather color pigmentation in the

chicken [74]. MCR-2 has been suggested to regulate

steroidogenesis in chicken [76], however, no clear function

has yet been ascribed to the other MCRs. MCR-3 is

expressed exclusively in the adrenal gland [77], while

MCR-4 and-5 showed a ubiquitous expression in peripheral

tissues as well as in the brain [73]. In this study, we have

shown that leptin significantly reduced MCR-4 and -5 gene

expression in chicken hypothalamus, whereas MCR-1

mRNA levels remained unchanged. These data suggest that

the central effects of leptin on food intake in chickens may

involve changes in signaling of MCR-4 and -5, however,

whether this interaction is direct or indirect remained unclear.

This result is intriguing and particularly of interest because it

is different from the classic model of leptin action in

mammals where leptin increased the production of a-MSH

(agonist of MCR-3 and -4) and decreased the release of

AgRP (antagonist of MCR-3 and -4) in the hypothalamus,

thereby modulating MCRs gene expression and regulating

food intake. The changes observed in MCR-4 and -5 gene

expression in this study without modification of both POMC

and AgRP gene expression suggest that leptin may act

directly as a ligand or indirectly via other ligands for MCRs.

The interaction between leptin and MRCs in the regulation

of food intake in chicken needs to be explored further. It has

been reported that naturally occurring fatty acid synthase

inhibitor cerulenin and its more potent synthetic analog C75

robustly inhibit food intake, reduce body weight, and

increase metabolic rate when injected into mice, possibly

by acting on hypothalamic glucose-sensing neurons through

a leptin-independent mechanism involving malonyl-CoA

accumulation [41]. However, other studies have reported that

these compounds modulate hypothalamic neuropeptides in a

manner similar to that of leptin [68]. In this study, we have

shown for the first time, in our knowledge, that leptin

reduces FAS gene expression, as cerulenin and C75, in the

hypothalamus of chickens suggesting a potential role of

leptin/FAS in the control of food intake in birds, while the

molecular mechanism(s) involved are unknown and beg

answers.

In conclusion, the present study is the first to report,

additionally to the single ICV or peripheral injection of


leptin, that continuous infusion of leptin inhibits food intake

in chickens and to identify some central targets of leptin

action in birds. It seems that leptin selectively modulates

anabolic (orexigenic) neuropeptides rather than catabolic

(anorexigenic) pathways to regulate ingestive behavior in

broiler chickens. The new finding that needs to be explored

in the future is the interaction, on the one hand, between

leptin and FAS, and on the other hand, between leptin and

MCRs in the regulation of food intake and energy balance in

chickens.

Acknowledgments

We wish to thank Gerda Nackaerts and Inge Vaesen for

their skilled technical assistance. This work was supported

by research grant (G012201) from the FWO-Flanders.

References

[1] K. Arvaniti, Q. Huang, D. Richard, Effects of leptin and corticosterone

on the expression of corticotrophin-releasing hormone, agouti-related

protein, and proopiomelanocortin in the brain of ob/ob mouse,

Neuroendocrinology 73 (2001) 227–236.

[2] C.M. Ashwell, S.M. Czerwinski, D.M. Brocht, J.P. McMurtry,

Hormonal regulation of leptin expression in broiler chickens, Am. J.

Physiol. 276 (1999) R226–R232.

[3] W.A. Banks, A.J. Kastin, W. Huang, J.B. Jaspan, L.M. Maness, Leptin

enters the brain by a saturable system independent of insulin, Peptides

17 (1996) 305–311.

[4] C.R. Barb, X. Yan, M.J. Azain, R.R. Draeling, G.B. Rampaeek, T.G.

Ramsay, Recombinant porcine leptin reduces feed intake and

stimulates growth hormone secretion in swine, Domest. Anim.

Endocrinol. 15 (1991) 77–86.

[5] T. Bungo, M. Shimojo, Y. Masuda, T. Tachibanab, S.J. Tanaka, K.

Sugahara, M. Furuse, Intracerebroventricular administration of mouse

leptin does not reduce food intake in the chicken, Brain Res. 817 (1999)

196–198.

[6] B. Burguera, M.E. Couce, Leptin access into the brain. A saturated

transport mechanism in obesity, Physiol. Behav. 74 (2001) 717–720.

[7] J. Buyse, A. Vanderpooten, B. Leclercq, R. Berghman, E. Decuypere,

Pulsatility of plasma growth hormone and hepatic growth hormone

receptor characteristics of broiler chickens divergently selected for

abdominal fat content, Br. Poultry Sci. 35 (1994) 145–152.

[8] J. Buyse, K. Janssens, S. Van der Geyten, P. Van As, E. Decuypere,

V.M. Darras, Pre- and postprandial changes in plasma hormone and

metabolite levels and hepatic deiodinase activities in meal-fed broiler

chickens, Br. J. Nutr. 88 (2002) 641–653.

[9] L.S. Campfield, F.J. Smith, Y. Guisez, R. Devos, P. Burn,

Recombinant mouse ob protein: evidence for a peripheral signal

linking adipocity and the central neural networks, Science 269 (1995)

546–549.

[10] I.J. Clarke, A.J. Tilbrook, A.I. Turner, B.W. Doughton, J.W. Goding,

Sex, fat and tilt of the earth: effects of sex and season on the feeding

response to centrally administered leptin in sheep, Endocrinology 142

(2001) 2725–2728.

[11] R.D. Cone, The central melanocortin system and energy homeostasis,

Trends Endocrinol. Metab. 10 (1999) 211–216.

[12] V.M. Darras, T.J. Visser, L.R. Berghman, E.R. Kuhn, Ontogeny of

type I and III deiodinase activities in embryonic and posthatch chicks:

relationship with changes in plasma triiodothyronine and growth

hormone levels, Comp. Biochem. Physiol. 103A (1992) 131–136.

[13] M.D. Denbow, N. Snapir, M. Furuse, Inhibition of food intake by CRF

in chickens, Physiol. Behav. 66 (1999) 645–649.

[14] D.M. Denbow, S. Meade, A. Robertson, J.P. McMurtry, M. Richards,

C. Ashwell, Leptin-induced decrease in food intake in chickens,

Physiol. Behav. 69 (2000) 359–362.

[15] F.B.J. Diamond, D.C. Eichler, G. Duckett, E.V. Jorgensen, D. Shul-

man, A.W. Root, Demonstration of a leptin binding factor in human

serum, Biochem. Biophys. Res. Commun. 233 (1997) 818–822.

[16] S. Dridi, J. Williams, V. Bruggeman, M. Onagbesan, N. Raver, E.

Decuypere, J. Djiane, A. Gertler, M. Taouis, A chicken leptin specific

radioimmunoassay, Domest. Anim. Endocrinol. 18 (2000) 325–335.

[17] S. Dridi, N. Raver, E.E. Gussakovsky, M. Derouet, M. Picard, A.

Gertler, M. Taouis, Biological activities of recombinant chicken leptin

C4S analog compared with unmodified leptons, Am. J. Physiol. 279

(2000) E116–123.

[18] M. Dube, S. Kalra, P. Kalra, Food intake elicited by central

administration of orexins/hypocretins: identification of hypothalamic

sites of action, Brain Res. 842 (1999) 473–477.

[19] K. Ebihara, Y. Ogawa, G. Katsuura, Y. Numata, H. Masuzaki, N.

Satoh, M. Tamaki, T. Yoshioka, M. Hayase, N. Matsuoka, M. Aizawa-

Abe, Y. Yoshimasa, K. Nakao, Involvement of agouti-related protein,

an endogenous antagonist of hypothalamic melanocortin receptor, in

leptin action, Diabetes 48 (1999) 2028–2033.

[20] C.F. Elias, C. Lee, J. Kelly, C. Aschkenasic, R.S. Ahima, P.

Couceyro, M.J. Kuhar, C.B. Saper, J.K. Elmquist, Leptin activates

hypothalamic CART neurons projecting to the spinal cord, Neuron 21

(1998) 1375–1385.

[21] C.F. Elias, C.B. Saper, E. Maratos-Flier, N.A. Tritos, C. Lee, J. Kelly,

J.B. Tatro, G.E. Hoffman, M.M. Ollmann, G.S. Barsh, T. Sakurai, M.

Yanagisawa, J.K. Elmquist, Chemically defined projections linking the

mediobasal hypothalamus and the lateral hypothalamic area, J. Comp.

Neurol. 402 (1998) 442–459.

[22] J.K. Elmquist, R.S. Ahima, C.F. Elias, J.S. Flier, C.B. Saper,

Distributions of leptin receptor mRNA isoforms in the rat brain,

J. Comp. Neurol. 395 (1998) 535–547.

[23] H. Fei, H.J. Okano, C. Li, G.H. Lee, C. Zhao, R. Darnell, J.M.

Friedman, Anatomic localization of alternatively spliced leptin

receptors (ob-R) in mouse brain and other tissues, Proc. Natl. Acad.

Sci. U. S. A. 94 (1997) 7001–7005.

[24] A.P. Feinberg, B. Vogelstein, A technique for radiolabeling DNA

restriction endonuclease fragments to high specific activity, Anal.

Biochem. 132 (1983) 6–13.

[25] J.M. Friedman, J.L. Halaas, Leptin and the regulation of body weight

in mammals, Nature 395 (1998) 763–770.

[26] M. Furuse, R. Ando, T. Bungo, R. Ao, M. Shimojo, Y. Masuda,

Intracerebroventricular injection of orexins does not stimulate food

intake in neonatal chicks, Br. Poultry Sci. 40 (1999) 698–700.

[27] T. Hahn, J. Breininger, D. Baskin, M. Schwartz, Coexpression of

AGRP and NPY in fasting-activated hypothalamic neurons, Nat.

Neurosci. 1 (1998) 271–272.

[28] J.L. Halaas, K.S. Kajiwala, M. Maffei, S.L. Cohen, B.T. Chait, D.

Rabinowitz, R.L. Lallone, S.K. Burley, J.M. Friedman, Weight-

reducing effects of the plasma protein encoded by the obese gene,

Science 269 (1995) 543–546.

[29] K.L. Houseknecht, C.S. Mantzoros, R. Kuliawat, E. Hadro, J.S. Flier,

B.B. Kahn, Evidence for leptin binding to proteins in serum of

rodents and humans: modulation with obesity, Diabetes 45 (1996)

1638–1643.

[30] D. Huszar, C.A. Lynch, V. Fairchild-Hunteress, J.H. Dunmore, Q.

Fang, L.R. Berkemeier, W. Gu, R.A. Kesterson, B.A. Boston, R.D.

Cone, F.J. Smith, L.A. Campfield, P. Burn, F. Lee, Targeted disruption

of the melanocortin-4 receptor results in obesity in mice, Cell 88

(1997) 131–141.

[31] A.J. Kastin, W. Pan, Dynamic regulation of leptin entry into brain by

the blood–brain barrier, Regul. Pept. 92 (2000) 37–43.

[32] S.I. Kawakami, T. Bungo, R. Ando, A. Ohgushi, M. Shimojo, Y.

Masuda, M. Furuse, Central administration of a-melanocyte stimulat-


ing hormone inhibits fasting- and neuropeptide Y-induced feeding in

neonatal chicks, Eur. J. Pharmacol. 398 (2000) 361–364.

[33] L. Kow, D. Pfaff, The effects of the TRH metabolite cyclo- (His-Pro-

and its analogs on feeding, Pharmacol. Biochem. Behav. 38 (1991)

359–364.

[34] W.J. Kuenzel, J. McMurtry, Neuropeptide Y: brain localization and

central effects on plasma insulin levels in chicks, Physiol. Behav. 44

(1988) 669–678.

[35] W.J. Kuenzel, L.W. Douglass, B.A. Davison, Robust feeding follow-

ing central administration of neuropeptide Y or peptide YY in chicks,

Peptides 8 (1987) 823–828.

[36] M.V. Kumar, T. Shimokawa, T.R. Nagy, M.D. Lane, Differential

effects of a centrally acting fatty acid synthase inhibitor in lean and

obese mice, Proc. Natl. Acad. Sci. U. S. A. 99 (2002) 1921–1925.

[37] D. Kurrimbux, Z. Gaffen, C.L. Farrell, D. Martin, S.A. Thomas, The

involvement of the blood–brain and the blood–cerebrospinal fluid

barriers in the distribution of leptin into and out of the rat brain,

Neuroscience 123 (2004) 527–536.

[38] P. Lambert, P. Couceyro, K. McGirr, S. Dall Vechia, Y. Smith, M.

Kuhar, CART peptides in the central control of feeding and

interactions with neuropeptide Y, Synapse 29 (1998) 293–298.

[39] B. Li, B. Xu, N. Rowland, S. Kalra, c-Fos expression in the rat brain

following central administration of neuropeptide Y and effects of food

consumption, Brain Res. 665 (1994) 277–284.

[40] H. Lin, E. Decuypere, J. Buyse, Oxidative stress induced by cortico-

sterone administration in broiler chickens (Gallus gallus domesticus),

short-term effect, Comp. Biochem. Physiol. 139 B (2004) 745–751.

[41] T.M. Loftus, D.E. Jaworsky, G.L. Frehywot, C.A. Townsend, G.V.

Ronnett, M.D. Lane, F.P. Kuhajda, Reduced food intake and body

weight in mice treated with fatty acid synthase inhibitors, Science 288

(2000) 2379–2381.

[42] M. Lopez, L. Seoane, M.C. Garcia, F. Lago, F.F. Casanueva, R.

Senaris, C. Dieguez, Leptin regulation of prepro-orexin and orexin

receptor mRNA levels in the hypothalamus, Biochem. Biophys. Res.

Commun. 269 (2000) 41–45.

[43] D. Lu, D. Willard, I.R. Patel, S. Kadwell, L. Overton, T. Kost, M.

Luther, W. Chen, R.P. Woychik, W.O. Wilkison, R.D. Cone, Agouti

protein is an antagonist of the melanocyte-stimulating hormone

receptor, Nature 371 (1994) 799–802.

[44] M. Maffei, J. Halaas, E. Ravussin, R.E. Pratley, G.H. Lee, Y. Zhang,

H. Fei, S. Kim, R. Lallone, S. Ranganathan, P.A. Kern, J.M. Friedman,

Leptin levels in human and rodent: measurement of plasma leptin and

ob RNA in obese and weight-reduced subjects, Nat. Med. 1 (1995)

1155–1161.

[45] H. Makimura, T.M. Mizuno, X.J. Yang, J. Silverstein, J. Beasley, C.V.

Mobbs, Cerulenin mimics effects of leptin on metabolic rate, food

intake, and body weight independent of the melanocortin system, but

unlike leptin, cerulenin fails to block neuroendocrine effects of fasting,

Diebetes 50 (2001) 733–739.

[46] J.P. McMurtry, C.M. Ashwell, D.M. Brocht, T.J. Caperna, Plasma

clearance and tissue distribution of radiolabeled leptin in the chicken,

Comp. Biochem. Physiol. 138 (2004) 27–32.

[47] B. Meister, Control of food intake via leptin receptors in the

hypothalamus, Vitam. Horm. 59 (2000) 265–304.

[48] J.G. Mercer, N. Hoggard, L.M.Williams, C.B. Lawrence, L.T. Hannah,

P. Trayhurn, Localization of leptin receptor mRNA and the long form

splice variant (ob-Rb) in mouse hypothalamus and adjacent brain

regions by in situ hybridization, FEBS Lett. 387 (1996) 113–116.

[49] T.M. Mizuno, C.V. Mobbs, Hypothalamic agouti-related protein

messenger ribonucleic acid is inhibited by leptin and stimulated by

fasting, Endocrinology 140 (1999) 814–817.

[50] T.M. Mizuno, S.P. Kleopoulos, H.T. Bergen, J.L. Roberts, C.A. Priest,

C.V. Mobbs, Hypothalamic proopiomelanocortin mRNA is reduced by

fasting and corrected in ob/ob and db/db mice, but is stimulated by

leptin, Diabetes 47 (1998) 294–297.

[51] H. Munzberg, L. Huo, E.A. Nillni, A.N. Hollenberg, C. Bjorbek, Role

of signal transducer and activator of transcription 3 in regulation of

hypothalamic proopiomelanocortin gene expression by leptin, Endo-

crinology 144 (2003) 2121–2131.

[52] T. Ohkubo, T. Boswell, S. Lumineau, Molecular cloning of chicken

prepro-orexin cDNA and preferential expression in the chicken

hypothalamus, Biochim. Biophys. Acta 1577 (2002) 476–480.

[53] B. Olson, M. Drutarosky, M. Chow, V. Hruby, E. Stricker, J. Verbalis,

Oxytocin and an oxytocin agonist administered centrally decrease

food intake in rats, Peptides 12 (1991) 113–118.

[54] M.A. Pelleymounter, M.J. Cullen, M.B. Baker, R. Hecht, D. Winters,

T. Boone, F. Collins, Effects of the obese gene product on body weight

regulation in ob/ob mice, Science 269 (1995) 540–543.

[55] D. Qu, D.S. Ludwig, S. Gammeltoft, M. Piper, M.A. Pelleymounter,

M.J. Cullen, W.F. Mathes, R. Przypek, R. Kanarek, E. Maratos-Flier,

A role for melanin-concentrating hormone in the central regulation of

feeding behavior, Nature 380 (1996) 243–247.

[56] K. Rahmouni, W.G. Haynes, D.A. Morgan, A.L. Mark, Role of

melanocortin-4 receptors in mediating renal sympathoactivation to

leptin and insulin, J. Neurosci. 23 (2003) 5998–6004.

[57] N. Raver, M. Taouis, S. Dridi, M. Derouet, J. Simon, B. Robinzon, J.

Djiane, A. Gertler, Large-scale preparation of biologically active

recombinant chicken obese protein (Leptin), Protein Expression Purif.

14 (1998) 403–408.

[58] M.P. Richards, M.C. Ashwell, J.P. McMurtry, Analysis of leptin gene

expression in chicken using reverse transcription polymerase chain

reaction and capillary electrophoresis with laser-induced fluorescence

detection, J. Chromatogr., A 853 (1999) 321–335.

[59] F.L. Rock, S.W. Altmann, M. Vanheek, R.A. Kastelein, J.F. Bazon,

The leptin haemopoietic cytokine fold is stabilized by an intrachain

disulfide bond, Horm. Metab. Res. 28 (1996) 649–652.

[60] M. Rossi, M. Kim, D. Morgan, A C-terminal fragment of agouti-

related protein increases feeding and antagonizes the effect of alpha-

melanocyte stimulating hormone in vivo, Endocrinology 139 (1998)

4428–4431.

[61] T. Sakurai, A. Amemiya, M. Ishii, I. Matsuzaki, R. Chemelli, H.

Tanaka, S. Williams, J. Richardson, G. Kozlowski, S. Wilson, J. Arch,

R. Buckingham, A. Haynes, S. Carr, R. Annan, D. McNulty, W. Liu, J.

Terrett, N. Elshourbagy, D. Bergsma, M. Yanagisawa, Orexins and

orexin receptors: a family of hypothalamic neuropeptides and G

protein-coupled receptors that regulate feeding behavior, Cell 92

(1999) 573–585.

[62] M.W. Schwartz, R.J. Seeley, L.A. Campfield, P. Burn, D.G. Baskin,

Identification of targets of leptin action in rat hypothalamus, J. Clin.

Invest. 98 (1996) 1101–1106.

[63] M.W. Schwartz, R.J. Seeley, S.C. Woods, D.S. Weigle, L.A. Camp-

field, P. Burn, D.G. Baskin, Leptin increases hypothalamic proopio-

melanocortin mRNA expression in the rostral arcuate nucleus,

Diabetes 46 (1997) 2119–2123.

[64] M.W. Schwartz, S.C. Woods, J.D. Porte, R.J. Seeley, D.G. Baskin,

Central nervous system control of food intake, Nature 404 (2000)

661–671.

[65] R.J. Seeley, S.C. Woods, Monitoring of stored and available fuel by

the CNS: implications for obesity, Nat. Rev., Neurosci. 4 (2003)

901–909.

[66] M. Shimada, N. Tritos, B.B. Lowell, J.S. Flier, E. Maratos-Flier, Mice

lacking melanin concentrating hormone are hypophagic and lean,

Nature 396 (1998) 670–674.

[67] T. Shimokawa, M.V. Kumar, M.D. Lane, Effect of a fatty acid

synthase inhibitor on food intake and expression of hypothalamic

neuropeptides, Proc. Natl. Acad. Sci. U. S. A. 99 (2002) 66–71.

[68] T. Shimokawa, M.V. Kumar, M.D. Lane, Effect of a fatty acid

synthase inhibitor on food intake and expression of hypothalamic

neuropeptides, Proc. Natl. Acad. Sci. U. S. A. 99 (2002) 66–71.

[69] M.K. Sinha, I. Opentanova, J.P. Ohannesian, J.W. Kolaczynski, M.L.

Heiman, J. Hale, G.W. Becker, R.R. Bowsher, T.W. Stephens, J.F.

Caro, Evidence of free and bound leptin in human circulation, J. Clin.

Invest. 98 (1996) 1277–1282.

[70] M. Spina, E. Merlo-pich, R. Chan, A. Basso, J. Rivier, W. Vale, G.


Koob, Appetite-suppressing effects of urocortin, a CRF-related

neuropeptide, Science 273 (1996) 1561–1564.

[71] B. Stanley, S. Leibowitz, Neuropeptide Y injected in the para-

ventricular hypothalamus: a powerful stimulant of feeding behavior,

Proc. Natl. Acad. Sci. U. S. A. 82 (1985) 3940–3943.

[72] T. Tachibana, K. Sugahara, A. Ohgushi, R. Ando, S. Kawakami, T.

Yoshimatsu, M. Furuse, Intracerebroventricular injection of agouti-

related protein attenuates the anorexigenic effect of alpha-melanocyte

stimulating hormone in neonatal chicks, Neurosci. Lett. 305 (2001)

131–134.

[73] S. Takeuchi, S. Takahashi, Melanocortin receptor genes in the chicken-

tissue distributions, Gen. Comp. Endocrinol. 112 (1998) 220–231.

[74] S. Takeuchi, H. Suzuki, M. Yabuuchi, S. Takahashi, A possible

involvement of melanocortin 1-receptor in regulating feather color

pigmentation in the chicken, Biochim. Biophys. Acta 1308 (1996)

164–168.

[75] S. Takeuchi, H. Suzuki, S. Hirose, M. Yabuuchi, C. Sato, H.

Yamamoto, S. Takahashi, Molecular cloning and sequence analysis

of the chick melanocortin 1-receptor gene, Biochim. Biophys. Acta

1306 (1996) 122–126.

[76] S. Takeuchi, T. Kudo, S. Takahashi, Molecular cloning of the chicken

melanocortin 2 (ACTH)-receptor gene, Biochim. Biophys. Acta 1403

(1998) 102–108.

[77] S. Takeuchi, S. Takahashi, A possible involvement of melanocortin 3

receptor in the regulation of adrenal gland function in the chicken,

Biochim. Biophys. Acta 1448 (1999) 512–518.

[78] M. Taouis, J.W. Chen, C. Daviaud, J. Dupont, M. Derouet, J. Simon,

Cloning the chicken leptin gene, Gene 208 (1998) 239–242.

[79] J.E. Thornton, C.C. Cheung, D.K. Clifton, R.A. Steiner, Regulation of

hypothalamic proopiomelanocortin mRNA by leptin in ob/ob mice,

Endocrinology 138 (1997) 5063–5066.

[80] Y. Uehara, H. Shimizu, K.I. Ohtani, N. Sato, M. Mori, Hypothalamic

corticotrophin-releasing hormone is a mediator of the anorexigenic

effect of leptin, Diabetes 47 (1998) 890–893.

[81] S.C. Woods, R.J. Seeley, J.D. Porte, M.W. Schwartz, Signals that

regulate food intake and energy homeostasis, Science 280 (1998)

1378–1383.

[82] Y. Zhang, R. Proenca, M. Maffei, M. Barone, J.M. Friedman,

Positional cloning of the mouse obese gene and its human homologue,

Nature (London) 372 (1994) 425–432.

Documents

Mode of leptin action in chicken hypothalamus