B R A I N R E S E A R C H 1 2 0 1 ( 2 0 0 8 ) 1 6 7 – 1 7 6

ava i l ab l e a t www.sc i enced i rec t . com

www.e l sev i e r. com/ l oca te /b ra in res

Research Report

Mice lacking α-tocopherol transfer protein gene have severeα-tocopherol deficiency in multiple regions of the centralnervous system

Kishorchandra Gohila,⁎, Saji Oommena, Hung T. Quachb, Vihas T. Vasua,Hnin Hnin Aunga, Bettina Schockc, Carroll E. Crossa, Govind T. Vatasseryb,d

aDepartment of Internal Medicine, Genome and Biomedical Sciences Facility, University of California, Davis, CA 95616, USAbResearch Service, V.A. Medical Center, Minneapolis, Minnesota 55417, USAcRespiratory Research Group, Department of Medicine, Institute of Clinical Science, The Queen's University of Belfast, Belfast, BT12 6BJ, UKdDepartment of Psychiatry And the Graduate Program in Neuroscience, University of Minnesota, Minneapolis, Minnesota 55455, USA

A R T I C L E I N F O

⁎ Corresponding author. Genome and BiomedUSA. Fax: +1 530 752 8632.

E-mail address: kgohil@ucdavis.edu (K. G

0006-8993/$ – see front matter © 2008 Elsevidoi:10.1016/j.brainres.2008.01.044

A B S T R A C T

Article history:Accepted 15 January 2008Available online 9 February 2008

Ataxia with vitamin E deficiency is caused by mutations in α-tocopherol transfer protein(α-TTP) gene and it can be experimentally generated in mice by α-TTP gene inactivation(α-TTP-KO). This study compared α-tocopherol (α-T) concentrations of five brain regions andof four peripheral organs from 5 months old, male and female, wild-type (WT) and α-TTP-KOmice. All brain regions of femaleWTmice contained significantly higher α-T than those fromWT males. α-T concentration in the cerebellum was significantly lower than that in otherbrain regions of WT mice. These sex and regional differences in brain α-T concentrations donot appear to be determined by α-TTP expressionwhichwas undetectable in all brain regions.All the brain regions of α-TTP-KO mice were severely depleted in α-T. The concentration ofanother endogenous antioxidant, total glutathione, was unaffected by gender but wasdecreased slightly but significantly in most brain regions of α-TTP-KO mice. The results showthat both gender and the hepatic α-TTP, but not brain α-TTP gene expression are important indetermining α-T concentrationswithin the brain. Interestingly, functional abnormality (ataxia)develops only very late in α-TTP-KO mice in spite of the severe α-tocopherol deficiency in thebrain starting at an early age.

© 2008 Elsevier B.V. All rights reserved.

Keywords:AtaxiaBrainGenderLiverTransgenic miceTocopherol transfer proteinVitamin E

1. Introduction

Vitamin E family contains eight lipophilic, naturally occurringcompounds that include four tocopherols and four tocotrienolsdesignated as alpha-, beta-, gamma-, and delta-. Vitamin E isessential for a healthy central nervous system (Muller et al.,1983; Nelson, 1980). Histological studies implicated a role for

ical Sciences Facility, Suit

ohil).

er B.V. All rights reserved

dietary α-T in maintaining CNS structure in rats (Carpenter,1965). Investigations of chronic vitamin E deficiency producedby feeding rats α-T deficient diets suggested that the CNS wasmore severely affected than the peripheral nervous system(Towfighi, 1981). Experimental data showing a need for α-T forCNS myelination emerged from studies in rats fed diets thatvaried in α-T concentrations (Dinesen and Clausen, 1976).

e 6510, Internal Medicine, University of California, Davis, CA 95616,

.

Fig. 1 – α-T concentrations in five brain regions of 5months-oldWTmale and female brains. All brain regions from femalemice (n=5) contained significantly higher concentrations ofα-T than that from the brains of male mice (n=3).α-T concentration of the cerebellum was lower than that ofthe other brain regions. COR=cortex, CER=cerebellum,HIP=hippocampus, BS=brainstem, MB=midbrain.

Fig. 2 – Cholesterol concentrations in male and female brainregions. Cholesterol concentrations in five brain regions of5 months-old WT male and female brains. Data show nosignificant effect of sex on the cholesterol concentrations inthe five brain regions. COR=cortex, CER=cerebellum,HIP=hippocampus, BS=brainstem, MB=midbrain. The datashow mean±SEM, n=3 for male mice and n=5 for femalemice.

168 B R A I N R E S E A R C H 1 2 0 1 ( 2 0 0 8 ) 1 6 7 – 1 7 6

Comparative morphometric analysis of cerebellar synapsesof young and old rats indicated a role for α-T in preservingsynaptic morphology (Bertoni-Freddari et al., 1995; Bertoni-Freddari et al., 1984). These early studies in rodents show thatdietary vitamin E is essential for maintaining the integrity ofcellular structures in the CNS.

α-T is also required for the health of human CNS. This isvividly demonstrated inataxiawith vitaminEdeficiency (AVED)patients who present with neurological symptoms of varyingseverity (Cavalier et al., 1998; Gotoda et al., 1995; Schuelke et al.,1999; Tamaru et al., 1997). Neurological deficits similar to thoseof theAVEDsubjects are also observed in transgenicmicewith adeletion of the α-TTP gene (Yokota et al., 2001; Yokota et al.,1987). Furthermore, cerebral cortex of α-TTP-knockout (α-TTP-KO) mice has been reported to display attenuated electrophy-siological activity compared to the activity displayed by WTmice. Genome-wide mRNA expression analysis of the cerebralcortex fromyoung, asymptomaticα-TTP-KOmice suggest a rolefor α-T inmyelination and synaptic functions in the CNS (Gohilet al., 2004;Gohil et al., 2003). Similar observationswere reportedin rats fed α-T deficient diets (Hyland et al., 2006). The data fromthese gene profiling studies appear to provide amolecular basisfor the histological and morphometric observations documen-ted in earlier investigations. The studies in young α-TTP-KOmice indicate that the loss of molecular markers of neuronalfunction precedes the decline in neurological phenotype, sug-gesting the possibility of an important role for brain α-T duringearly development and in the prevention of age-related declinein neurological functions. In view of these and numerous otherobservations therehasbeena lot of interest in theuseofvitaminE in human disorders. In clinical practice many attempts havebeen made to use vitamin E as a therapeutic agent in disordersof the nervous system (Nelson, 1980; Vatassery et al., 1999).

Electro-retinographic measurements have shown attenu-ated activities in α-TTP-KO mice compared with WT mice in-dicating retinal degeneration which was accelerated by feedingα-T deficient diet to α-TTP-KO mice (Tanito et al., 2007). Sincesome AVED patients develop retinal degeneration (Mariottiet al., 2004; Yokota et al., 1996) the α-TTP-KO mice may be re-levant to exploring the potential of dietary α-T in thepreventionof age-related retinal degeneration. α-T deficiency caused bythe deletion of α-TTP gene also accelerated Alzheimer Diseasephenotype in transgenic mice that overexpress human APP695with a doublemutation (Nishida et al., 2006). Collectively, thesestudies suggest that α-TTP-KO mice offer an in vivo model foridentifying molecular and cellular mechanisms relevant tohumanCNSpathological changes that occurwithagingand thatmay be ameliorated by dietary antioxidants like α-T. Themodelmay also have utility in testing neuroprotective effects of othermembers of vitamin E family such as tocotrienols (Sen et al.,2007).

An understanding of the role of α-TTP in brain would beaided by relating α-T levels in the α-TTP-KO mice with bio-chemical parameters. Yokota et al. (2001) have shown that α-Tis very low in two brain regions and that the levels reachedquantifiable levels only after feeding a diet high in vitamin E.To characterize the role of α-TTP gene in the retention, dis-tribution and biological actions of α-T in the CNS, we havedetermined α-T, cholesterol, total glutathione and the expres-sion of α-TTP gene from several brain regions. We have alsoexamined whether gender influences brain concentrations ofthe three compounds.

2. Results

Wholebodyweights of femalemicewere significantly (p<0.0001)lower (by ∼28%) than those of themalemice. However, absenceof α-TTP gene did not affect whole body weights.

Fig. 3 – α-TTP expression by immunoblot analysis. Immunoblot analysis ofα-TTP expression in cerebellum, cortex and, liverhomogenates from WT (n=2, lanes 1 and 2) and α-TTP-KO (n=2, lanes 3 and 4) mice. Forty µg of protein from each tissuehomogenatewere resolved by PAGE and electro transferred tomembranes as described in theMethods. The immunoblotswereprobed with rabbit anti-α-TTP antiserum (a generous gift from Professor Maret G. Traber, Linus Pauling Institute, Oregon StateUniversity, Corvallis, OR, USA). A ~32 kDa protein was detected in livers from WT mice. The protein was absent in livers fromα-TTP-KO mice. The ~32 kDa anti-α-TTP antiserum reactive protein was not detectable in cortex or in the cerebellum ofeither the WT or the α-TTP-KO mice. MW=Molecular weight standards.

169B R A I N R E S E A R C H 1 2 0 1 ( 2 0 0 8 ) 1 6 7 – 1 7 6

2.1. Concentrations of α-T in WT male and female brains

In order to examine the effects of α-TTP gene deficiency, sex anddietaryα-Ton theα-T concentrationsof variousbrain regionswedetermined α-T in brain stem, cerebral cortex, cerebellum, hip-pocampus and mid-brain. Fig. 1 shows that the α-T concentra-tions of all five brain regions fromfemalemicewere significantly(p<0.005) higher (by ∼40%) than those of the male mice. Fur-thermore, α-T concentrations of cerebella were significantly(p<0.001) lower (by ∼30%) than those of the other brain regions.

Cholesterol is a membrane lipid that has several physico-chemical and biological characteristics similar to α-T. There-fore, we determined cholesterol in the different brain regionsand the results are given in Fig. 2. In contrast to α-T, cho-lesterol content did not change with gender.

2.2. Expression of α-TTP protein and mRNA in tissuehomogenates

Data in Fig. 1 showed that cerebellum contained significantly(p<0.001) lower (∼30%) α-T concentrations than that in hip-pocampus and three other brain regions in both, male and

Fig. 4 – α-TTP mRNA expression by qRT-PCR analysis. Theexpression of α-TTP mRNA in cerebellum and cortex isundetectable by qRT-PCR assay. The data were normalizedfor the expression of GAPDH mRNA in the same samples.α-TTP mRNA is abundantly expressed in livers from wildtype (WT) mice and its expression is near the limit ofdetection in the livers from α-TTP-KO mice. Its expressionwas not detectable (ND) in either the cerebellum or the cortexfrom the same mice. Data are mean±SEM, n=5.

femalemice. α-TTP protein is implicated in the retention of α-Tin liver (Meier et al., 2003; Traber and Arai, 1999) and prostatecancer cells (Ni et al., 2007). We, therefore, determined theexpression of α-TTP mRNA and protein in cerebellum, cerebralcortex and liver. Fig. 3 shows that α-TTP protein expressionwasbelow the limit of detection in cerebral cortex and cerebellumofWT mice whereas it was abundantly expressed in livers fromWT mice. As expected, α-TTP expression was below detectionlimits in both brain and liver from theα-TTP-KOmice. Similarly,α-TTP mRNA expression, determined by qRT-PCR was unde-tectable in the two brain regions (Fig. 4), supporting theimmunoblot data (Fig. 3). Collectively these data suggest thatα-TTP mRNA and its encoded protein are expressed at very lowconcentrations in the brain and do not appear to determine theregion specific differences in α-T concentrations.

2.3. Scavenger-receptor B1 (SR-B1) expression in cerebralcortex and cerebellum

SR-B1 regulates tissueα-T concentrations (Mardonesetal., 2002).The expression of SR-B1 was assayed by immunoblot analysis(Fig. 5). The data show abundant expression of the ∼82 kDareceptor in livers and adrenal glands but very low expression incerebral cortex, cerebellum and medulla. A ∼57 kDa product is

Fig. 5 – Scavenger receptor B1 expression is undetectable inbrain regions. The data show abundant expression of thereceptor (~82 kDa) in liver and adrenal glands butundetectable expression in the three brain regions. A~57 kDa immunoreactive protein was also detected in liversand adrenal gland, and it probably is an unglycosylatedSR-B1. Aliquots of homogenates from WT liver (lane 1, 60 µgprotein), α-TTP-KO liver (lane 2, 60 µg protein), WT adrenalglands (lane 3, 60 µg and lane 4, 20 µg), WT cerebellum, WTmedulla and WT cortex (lanes 5, 6 and 7, respectively, 60 µgprotein each,) were processed for immunoblot detection ofSR-B1 expression. The blots were over-exposed to enablevisualization of the immunoreactive protein in the brainregions.

Fig. 6 – Brain regions of male a-TTP-KO mice are severelyα-T depleted IN AT. α-T concentrations in the five regions ofbrains from five months-old male mice. The data show thatα-T concentrations in all brain regions were significantly(p<0.00001) lower than those in the brains of either the WTmice fed the same α-T diet (35 IU/kg diet) or in the brains ofWT mice fed the α-T deficient diet. The data show mean±SEM, n=3. COR=cortex, CER=cerebellum,HIP=hippocampus, BS=brainstem, MB=midbrain.

Fig. 8 – Differential effects of α-TTP gene deletion onnon-CNS tissues. α-T concentrations in peripheral tissues ofmale and female mice of WT and α-TTP-KO mice. α-Tconcentrations in livers (LIV) and hearts (HRT) from WTfemale mice were significantly (*, p<0.001) higher (43%) thanthose in the male mice. α-T in ovaries (OVA) wassignificantly higher than that in testes (TST). Absence of theα-TTP gene resulted in a significant (†, p<0.0001) and a large(~90%) decrease in the α-T concentrations of heart, testesand ovaries. In contrast, the decrease in liver α-T ofα-TTP-KO mice was smaller (~50%) than that of the othertissues. The data are mean±SEM (n=5–7).

170 B R A I N R E S E A R C H 1 2 0 1 ( 2 0 0 8 ) 1 6 7 – 1 7 6

also seen in livers and adrenal glands and is likely to be ungly-cosylated SR-B1 as suggested by the antiserum manufacturer(AbCam Data sheets, Cambridge, MA, USA).

2.4. α-T concentrations in all five brain regions ofα-TTP-KO mice are very low and are much lower than theconcentrations achieved by dietary vitamin E deficiency

Data in Fig. 6 show α-T concentrations in the five brain regionsfrom 5 months-old male mice. α-T concentrations in all thefive brain regions were highly significantly (p<0.00001) lower

Fig. 7 – Cholesterol concentrations are unaffected by the absencanatomical regions of the female and male brains were unaffectCER=cerebellum, HIP=hippocampus, BS=brainstem, MB=midbrfor female mice.

in the α-TTP-KO mice than those in the respective regions oftheir WT-littermates. α-T concentrations in the brains of theα-TTP-KO mice were somewhat close to the limit of quantita-tion of the assay. However, it was measurable. It is importantto note that this severe depletion of brain α-T concentrationsoccurred in spite of the presence of sufficient α-T (35 IU/kgdiet) in the diet of the α-TTP-KO mice. Notably, such low α-Tconcentrations could not be achieved in the brains of age andsex matched WT mice by feeding the mice a semi-syntheticdiet made from vitamin E stripped oil with no added α-T.The five brain regions of female mice showed a very similarpattern of α-T concentrations to that of male mice (data notshown). We have also determined cholesterol concentrations

e of α-TTP. Cholesterol concentrations in the five distincted by the absence of α-TTP gene. COR=cortex,ain. The data show mean±SEM, n=3 for male mice and n=5

Fig. 9 – Glutathione concentrations in tissues of WT andα-TTP-KO mice. Absence of α-TTP gene results in small butstatistically significant decrease in total GSH of selected brainregions and in liver of female mice. The data are mean±SEM,n=3–5. Total GSH was significantly (p<0.001–0.034) lower(~7–18%) in cerebellum (CER), hippocampus (HIP), brainstem(BS), midbrain (MB) and liver (LIV) from α-TTP-KO micecompared to that in the tissues from theWTmice. There wasno significant difference (NS) between theWT andα-TTP-KOmice for the total GSH in cortex (COR), heart (HRT), ovaries(OVA).

171B R A I N R E S E A R C H 1 2 0 1 ( 2 0 0 8 ) 1 6 7 – 1 7 6

in the brains of these mice and the data are given in Fig. 7.These data show that the absence of α-TTP gene did not altercholesterol concentrations in the five brain regions.

2.5. Decreases in tissue α-T concentrations in α-TTP-KOmice in peripheral tissues vary with the anatomic site

Fig. 8 shows α-T concentrations in liver, heart, testes andovaries from5months-oldWTandα-TTP-KOmice. The tissuesfrom female mice have significantly (p<0.03–0.001) higher α-Tthan those from the male mice. Furthermore, the absence ofα-TTP gene significantly (p<0.0001) decreased the α-T concen-trations of all the tissues. But the magnitude of the decrease(∼90%)was greater inheart, testes andovaries compared to that(∼50%) in the liver suggesting that different regulatorymechan-isms may determine α-T concentrations in liver.

2.6. Severe α-T deficiency in the CNS has small butsignificant effect on total glutathione

It has been suggested that vitamin E has strong biological in-teractions with other endogenous antioxidants such as vita-min C and GSH. Therefore, we determined total glutathione(tGSH), a water-soluble endogenous antioxidant, in tissues offive months-old wild type and α-TTP-KO animals. Fig. 9 showstGSH concentrations in tissues of femalemice. Within the fivedistinct anatomical regions of the brain, cortex contained thehighest concentrations of tGSH and brainstem the lowestconcentrations. In contrast to α-T which showed significantlyhigher concentrations in female tissues compared to males(Fig. 1), tGSH concentrations were not different among malesand females (data not shown). The absence of α-TTP gene andthe resulting α-T deficiency resulted in significantly (p<0.034–0.001) lower (7%–18%) tGSH inmost but not all the tissues fromboth male and female mice (Fig. 9).

3. Discussion

3.1. Occurrence of severe α-T deficiency in all brain regionsof α-TTP-KO mice in spite of feeding α-T sufficient diet

In this study we provide comprehensive profiles of α-T con-centrations in five distinct brain regions of fivemonths-oldmaleand female mice that are deficient in the α-TTP gene and, com-pare them with the wild-type “littermates”. Data (Fig. 6) showthat the brains of α-TTP-KOmice are severely deficient in α-T inspite of feeding a basal, rodent chow containing sufficientconcentrations of α-T (35 IU/kg diet). It should also be stressedthat the concentrations of brain α-T in these mice are signifi-cantly (p<0.001) lower than those fed α-T deficient diets (Fig. 6).Thus, theα-TTP-KOmiceoffer anadvantageoverdiet-inducedα-T deficiency because: a), extremely low concentrations of α-T inthe CNS can be obtained, possibly from birth and b), they over-come the frequent criticism about vitamin E deficient diets thatsuch diets contain undesirable oxidation products of dietarylipids generated ex-vivo and that these oxidation products maycontribute significantly to oxidative stress in vivo.

Previous studies have shown that cerebellum and cortexfrom α-TTP-KO mice have very low or undetectable concen-trations of α-T (Gohil et al., 2004; Gohil et al., 2003; Leonardet al., 2002; Yokota et al., 2001). Unlike previous studies wehave determined α-T in several brain regions. The currentstudy further shows that all CNS regions (cortex, hippocam-pus, midbrain, cerebellum and brainstem) examined, fromboth female and male mice, are severely depleted (N95% ofnormal) in α-T. Furthermore, in contrast to the previous studywhich used 15 months-old mice (Leonard et al., 2002) thisstudy used younger (5 months old) mice and showed α-Tdeficiency that is very severe starting at a much younger age(5 months old). Another important observation made here isthat in spite of the extremely low α-T in the CNS, the youngmice do not display ataxia which appears only after 9 monthsof age (Gohil et al., 2004; Yokota et al., 2001). Thus the de-velopment of clinical ataxia in the α-TTP-KO animals hasa long latency, possibly due to the presence of unknownmechanisms that sustain normal cerebellar functions inyoung α-TTP-KO mice whose brains are almost devoid of α-T.

3.2. Liver is spared from severe α-T deficiency inα-TTP-KO mice

Livers of α-TTP-KOmice underwent less severe depletion of α-Tthanother extra-hepatic tissueswhich showed large (N80%) andhighly significant (p<0.0001) α-T deficiency (Fig. 8). Since chy-lomicron remnants are the primary source of α-T for liver (Bjo-rneboeet al., 1986;Kaempf-Rotzoll et al., 2003; Traber et al., 1988)and hepatic α-T is less severely depleted than that of the othertissues, it is inferred that α-TTP deficiency has a modest effecton the uptake of α-T from chylomicron remnants.

3.3. Tissue α-T concentrations are not directly correlatedwith α-TTP expression

In agreement with our previous studies using male mice(Vatassery et al., 1984a; Vatassery et al., 1984b; Vatassery

172 B R A I N R E S E A R C H 1 2 0 1 ( 2 0 0 8 ) 1 6 7 – 1 7 6

et al., 1984c) the current experiments demonstrated thatcerebellum from both female and male mice containedsignificantly (p<0.001) lower (∼30%) α-T than cortex andother brain regions (Fig. 1). If α-TTP is essential for theretention of α-T (Meier et al., 2003; Spector and Johanson,2007) then we would predict higher expression of α-TTP inthe cortex compared to that in the cerebellum. Experimentaldata do not support this prediction. A previous study(Hosomi et al., 1998) indicated higher expression of α-TTPmRNA in the cerebellum compared to that in the cortexsuggesting an inverse relationship between α-TTP mRNAexpression and α-T concentrations. We also note that Yokotaet al., 2001 detected very low levels of α-TTP in brain regionscompared to that in liver (Yokota et al., 2001); however α-Tconcentration in the two organs are very similar, furthersuggesting a lack of causal relationship between α-TTPexpression and whole tissue α-T concentrations. It is alsonoteworthy that α-TTPwas not detected inWT-heart (Yokotaet al., 2001) but α-T concentrations in WT-hearts are similarto those of WT-livers (Fig. 8) which has abundant expressionof α-TTP. Data from liver and lungs (Gohil et al., 2007) of WTmice also suggest a lack of correlation between α-TTP mRNAexpression and tissue α-T concentrations. α-TTP was unde-tectable by immunoblot analysis of whole homogenates fromeither the cerebellum or the cortex from either wild type orTTP-KO mice (Fig. 3).

Our assays cannot exclude the possibility that in manytissues, including the CNS, the expression of α-TTP is spe-cifically localized to a few cells within the tissue. Previousstudies have reported such discrete cellular localization ofα-TTP. For example, the occurrence of α-TTP has been reportedin rat cerebellar Bergman glia (Hosomi et al., 1998) and in Pur-kinje cells of AVED patients, in selected cells of patients withoxidative stress related to neurodegeneration (Copp et al., 1999)and in trophoblast, fetal capillaries, endothelium and amnionepithelium of human term placenta (Muller-Schmehl et al.,2004).However, thepresence of a fewα-TTP expressing cells inatissuemay not account for bulk α-T determined inwhole tissuehomogenates.

3.4. Proteins other than α-TTP that may modify tissue α-Tconcentrations

A number of genes other than that encoding α-TTP are im-plicated in the uptake, retention and secretion of α-T (Kaempf-Rotzoll et al., 2003; Mardones and Rigotti, 2004; Schneider,2005). These include genes encoding scavenger receptor B-1(SR-B1) (Goti et al., 2001; Mardones et al., 2002; Reboul et al.,2006), phosphilipid transfer protein (Desrumaux et al., 1999;Desrumaux et al., 2005; Huuskonen et al., 2001; Jiang et al.,2002), apolipoprotein E (Reich et al., 2001; Vatassery et al., 2006)lipoprotein lipase (Goti et al., 2002) and tocopherol bindingproteins (Kempna et al., 2003; Stocker and Azzi, 2000). In thisstudy we assayed the expression of SR-B1 and found it toundetectable in the three brain regions of WTmice (Fig. 5). SR-B1 was highly expressed in adrenal glands and liver (Fig. 5).Low expression of SR-B1 in brain compared to that in liver andadrenal glands has been previously documented (Srivastava,2003). These data suggest that SR-B1 may not play an im-portant role in the uptake of α-T in brain.

3.4.1. Effect of gender on α-tocopherol concentrations in thebrainOurdata (Fig. 1) show thatα-T concentrations in different brainregions in females are higher than those in the correspondingareas of the male brains. This difference was not altered by α-TTP deficiency and thus seems to be a more fundamentalphenomenon. Literature contains reports of similar differ-ences in α-T contents of tissues frommales and females. It hasbeen shown that α-T content of some tissues in female rats ishigher than that of males (Chen et al., 1992). Others haveconfirmed this finding (Lopez-Torres et al., 1998). Feingoldet al.(1993) have reported that ovariectomy of rats resulted indecreased concentrations of α-T in both adrenals and liver andthat this effect can be prevented by administration of estradiolat the time of surgery. These reports and our data indicate afundamental difference in the handling of α-T by male andfemale brains. Additional investigations are needed to under-stand the significance and mechanism of this phenomenon.

4. Conclusions

Transgenic mice lacking the α-TTP gene offer an experimentalmodel of α-T deficient AVED patients as well as for the pro-duction of severeα-T deficiency in brain that is unattainable bydietary manipulation. Our study shows that the differences intissue α-T concentrations cannot be accounted for by theextent of expression ofα-TTP genewhose expression levels arehigh in the liver and below the limits of detection in all thebrain regions and in someother tissues examined. The presentdata also show a significant effect of sex on the concentrationsof α-T in all brain regions and gonads ofWTmice. The absenceof α-TTP gene dramatically decreases the levels of α-T in allregions of the brain and this effect is much more severe thanthat observed in brains of mice fed vitamin E-deficient diets.It is particularly noteworthy that development of ataxia inthe α-TTP-KO mice takes place only when the animals aremore than9monthsof age in spite of the fact that thedepletionof α-T occurs much earlier (probably at birth).

5. Experimental procedure

5.1. Chemicals

The chemicals used were of reagent grade purity from stan-dard sources. Solvents for chromatography were HPLC gradefrom Fisher Scientific, Itasca, ILL, U.S.A. Standard d-α-T waspurchased from Kodak Laboratory Chemicals, Rochester, NY,USA. Absolute ethanol was obtained from Aaper Alcohol andChemical Company, Shelbyville, Kentucky, USA and was re-distilled prior to use. Most of the reagent grade chemicals werefrom Sigma Chemicals, St. Louis, MO, USA.

Diets were purchased from Purina Test Diets, Richmond, PA,USA. The composition of diets (AIN-93G) used in these experi-ments followed the recommendation for rodent diets by theAmerican InstituteofNutrition (Reevesetal., 1993).Thebasalα-Tdeficient diet (-E) was obtained by substituting the source offats in AIN-93G diet with vitamin E-stripped corn oil andremoving α-T from the vitamin mix. The diet containing 35 IU

173B R A I N R E S E A R C H 1 2 0 1 ( 2 0 0 8 ) 1 6 7 – 1 7 6

ofα-T/kgdiet (E)wasproduced by the additionof the appropriateamounts of dl-α-tocopheryl acetate to the α-T deficient diet. Themice were allowed to feed on the pelleted diets ad libitum.

Micewere bred on C57BL6 genetic background and obtainedfrom the in-house colonyatUCDavis. All the experimentswithmice were approved by UC Davis Animal Use Committee.Heterozygous α-TTP female pairs were housed with a hetero-zygous male. The pregnant mice were separated from themales andwere allowed to give birth. Themicewere allowed tofeed on the basal, 35 IU α-T/kg diet. The pups were weaned forone-month and genotyped using DNA extracted from tail-clippings (<1 cm). The α-TTP-KO mice were then selected forfurther experiments. One month old wild-type C57Bl6 micethat were used in studies of dietary α-T deficiency were ob-tained from Jackson Laboratory (Bar Harbor, Maine, USA) andwere allowed to consume vitamin E deficient diet for 4months.

5.2. Genotyping of mice

DNA was extracted from clipped tails with Qiagen DNA ex-traction kit as described by the manufacturer. Aliquots of ex-tracted DNA were subjected to PCR protocol as previouslydescribed (Terasawa et al., 2000).

5.3. Tissue dissection, storage and processing

After weaning, the mice were fed basal or α-T deficient dietsfor 4 months and then euthanized with an overdose of pento-barbital (N100 mg/kg body wt). Tissues were rapidly dissectedand frozen on dry-ice followed by storage at −70 °C untilfurther analysis.

5.4. Biochemical assays: Determination of α-T andcholesterol

The tissues (brain stem, cerebral cortex, hippocampus, cere-bellum, midbrain, hearts, livers, ovaries, and testes) wereweighed and homogenized in 0.32 M sucrose, 10 mM HEPES,1 mM EDTA at pH 7.4 and stored at −7 °C.

The α-T and cholesterol assays were done within two to fourmonths. Details of the method have been reported (Vatasseryet al., 1997; Vatassery et al., 1993). Briefly, 2 ml of ethanol con-taining0.025%(w/v)butylatedhydroxytoluene (BHT)and0.1mlof30% (w/v) ascorbic acidwerepipetted into tubes containing tissuehomogenates. The mixture was saponified at 60 °C after theaddition of 1 ml 10% (w/v) KOH. Sample tubes were cooled and2 ml of water was added followed by 2 ml of hexane containing0.025%(w/v) BHT. The tocopherols and cholesterolwere extractedinto the hexane phase by vortexing the samples. Part of thehexane extract was evaporated down and the residue wasredissolved in mobile phase and analyzed by liquid chro-matography for tocopherol using the following conditions: col-umn=ultrasphere ODS, 5 μm, 4.6×150 mm from BeckmanInstruments; mobile phase=5.5% water in methanol with final7.5 mM NaH2PO4; flow rate=2.5 ml/min. α-T was detectedelectrochemically utilizing Coulochem 5100; the detecting elec-trodes consisted of the 5011 analytical cell (detector 1 at −0.25 Vanddetector 2 at +0.55V) and5021 conditioning cell set at−0.75V.

One portion of the hexane extract was used for cholesteroldetermination by a gas chromatographic method reported

earlier (Vatassery et al., 1997). After evaporation of the solvent,trimethylsilyl ether derivatives of cholesterol were preparedusing bis(trimethyl silyl) trifluoroacetamide and analyzed by aHewlett Packard (Avondale, PA)model 5880 gas chromatographequipped with a flame ionization detector and a capillary col-umn (DB1column, 30meters×0.324mm, film thickness 0.25μm;temperature programming conditions: oven temperature initial50 °C, initial time 3 min, program rate 30 °C per min, final value290 °C, second program rate 1 °C per min, final temperature300 °C and keep at 300 °C for 5min). Under these conditions theretention times of the internal standard cholestane andcholesterol were 14.82 and 17.26 min, respectively.

5.5. Determination of total glutathione

Themethod of Ubbink et al. (1991) asmodified by Castagna et al.(1995)wasused.Briefly, thebrainhomogenatewas incubatedonice with tri-n-butyl phosphine to reduce GSSG and the solutionwas then mixed with 5.5% trichloroacetic acid containing0.55 mM EDTA. Total GSH in the acid extract was derivatizedwith 7-fluor-2.1.3-benzoxazole-4-sulfonamide (SBDF) and ana-lyzed by reverse phase HPLC with fluorescent detection.

Protein concentrations were determined by the Lowry tech-nique as modified by Markwell et al. (1978).

5.6. Immunoblot analysis for α-TTP and scavengerreceptor B1 expression in tissue homogenates

All materials were from Santa Cruz Biotechnology Inc. (CA) andtheir catalog numbers are given in parenthesis. The procedureswere as described in Western Blotting Protocol, Santa CruzBiotechnology, Inc. Briefly, ∼50 mg frozen tissue was homo-genized in ice-cold 200–500 µL of lysis buffer (sc-24948) contain-ing complete protease inhibitor cocktail (sc-29130) with freshlyadded phenylmethylsulfonyl fluoride (sc-3597). The homoge-nates were centrifuged and protein determined in the super-natants. Aliquots containing 40 µg protein were mixed with anequal aliquot of sample buffer (sc-24945), boiled for 3 min and10–20 µlwere loadedper lane in 4–20%pre-cast Tris–glycine gels(Invitrogen, Carlsbad, CA). Electrophoretically resolved proteinswere transferred to polyvinylidene fluoride membranes,blocked with Blotto A (sc-2323) and incubated with anti-α-TTPrabbit antiserum, (1/5000 dilution in Blotto A) overnight at 4 °C.The α-TTP-antiserumwas a generous gift from Professor MaretTraber, Oregon State University, OR. Scavenger receptor B1 (SR-B1) antibody was a rabbit antiserum and used at 1/500 dilutionas suggested bymanufacturer (AbCam, Cambridge,MA). α-TTP-antiserum or SR-B1 antibody bound proteins were visualizedwith goat-anti-rabbit horseradish peroxidase conjugated anti-serum (1/5000 dilution, room temperature, 1 h) and Chemilu-minescence Luminol Reagent (sc-2048).

5.7. Quantitative RT-PCR (qRT-PCR) of α-TTP mRNAexpression in tissues

Total RNA was extracted from tissues of female mice as pre-viously described (Gohil et al., 2003). Approximately ∼50 mg oftissue from each female mouse was homogenized in 1 ml ofTrizol Reagent (Invitrogen, Carlsbad, CA) and a pellet of totalRNA was obtained using the procedures described by the

174 B R A I N R E S E A R C H 1 2 0 1 ( 2 0 0 8 ) 1 6 7 – 1 7 6

manufacturer. The total RNA pellet from each tissue was dis-solved in RNAase-DNAase free water to obtain a concentrationof 2.5 µg of RNA/µl of solution.

An aliquot equivalent to 5 µg of total RNA extracted fromeach brain region was reverse-transcribed to obtain cDNA in afinal volume of 20 µl solution consisting of buffer, oligo-dTprimer, DTT, dNTPs and Superscript-II reverse transcriptase(Invitrogen, Carlsbad, CA). Real-time polymerase chain reac-tion (RT-PCR) method with SYBR as fluorescent reporter wasused to quantify the expression of α-TTP mRNA. The primersequences were: Glyceraldehyde-3-phosphate dehydrogenaseGCAACAGGGTGGTGGACCT (forward), GGATAGGGCCTC-TCTTGCTCA (reverse);

α-TTP: TCTACAGAGAACACTAATGAGCAATGTG(forward),TGGTGAAGCCATGTGGAAAGT (reverse).

The reaction was carried out in 96 well optical plates con-taining 6.25 ng cDNA ineachwell. The appliedRNAquantitywasnormalized by amplifying cDNA samples simultaneously withglyceraldehyde-3-phosphate dehydrogenase (GAPDH) specificprimers. The transcript concentrations were measured by real-time RT-PCR using the ABI PRISM 7700 Sequence detection sys-tem (PE Applied Biosystems, Foster City, CA). The PCR amplifica-tionparameterswere: initial denaturationstepat 95 °C for 10minfollowed by 40 cycles, each at 95 °C for 15 s (melting) and 60 °C for1min (annealing and extension). The 2−ΔΔCTmethod (Livak andSchmittgen, 2001) was used to calculate relative changes in geneexpression determined from real-time quantitative PCR experi-ments (Applied Biosystems User Bulletin No.2 (P/N4303859). Thethreshold cycle, Ct, which correlates inversely with the targetmRNA concentrations, was measured as the cycle numberat which the SYBR Green emission increases above a presetthreshold concentration. The specific mRNA transcripts wereexpressed as fold difference in the expression of the specificmRNAs in RNA samples from the brain regions of the α-TTP-KOmice compared to those from the brain regions of WT mice.

Statistical data for α-T and cholesterol and total GSH con-centrations and, for changes in gene expression (fold-change)obtained by qRT-PCR were analyzed by GraphPad PRISM(version 4.0; GraphPad Software, San Diego, CA). The data arereported as means±SEMs. An unpaired Student's t test wasused for comparisons between the experimentalmouse groups.All data were considered statistically significant when p valueswere ≤0.05.

Acknowledgments

Research was supported by NIH ES 011985-02, ES 011985, USDA(2003-00915), Clinical Nutrition Research Unit Pilot Researchgrant from the University of California and a grant from Centerfor HumanNutrition Research at University of California, Davis.Parts of the fundswere from aMerit Review grant (to GTV) fromthe department of Veterans Affairs, Washington DC.

R E F E R E N C E S

Bertoni-Freddari, C., Giuli, C., Pieri, C., 1984. Effect of chronicvitamin E deficiency on the synapses of cerebellar glomeruli inyoung rats. Mech. Ageing Dev. 24, 225–232.

Bertoni-Freddari, C., Fattoretti, P., Caselli, U., Paoloni, R.,Meier-Ruge, W., 1995. Vitamin E deficiency as a model ofprecocious brain aging: assessment by X-ray microanalysisand morphometry. Scanning Microsc. 9, 289–301 discussion301–282.

Bjorneboe, A., Bjorneboe, G.E., Bodd, E., Hagen, B.F., Kveseth, N.,Drevon, C.A., 1986. Transport and distribution ofalpha-tocopherol in lymph, serum and liver cells in rats.Biochim. Biophys. Acta 889, 310–315.

Carpenter, S., 1965. A histochemical study of oxidative enzymes inthe nervous system of vitamin E-deficient Rats. Neurology 15,328–332.

Castagna, A., Le Grazie, C., Accordini, A., Giulidori, P., Cavalli, G.,Bottiglieri, T., Lazzarin, A., 1995. Cerebrospinal fluidS-adenosylmethionine (SAMe) and glutathione concentrationsin HIV infection: effect of parenteral treatment with SAMe.Neurology 45, 1678–1683.

Cavalier, L., Ouahchi, K., Kayden, H.J., Di Donato, S., Reutenauer, L.,Mandel, J.L., Koenig, M., 1998. Ataxia with isolated vitamin Edeficiency: heterogeneity of mutations and phenotypicvariability in a large number of families. Am. J. Hum. Genet. 62,301–310.

Chen, H.W., Cook, L.R., Hendrich, S., 1992. Gender and dietary fataffect alpha-tocopherol status in F344/N rats. Lipids 27,844–846.

Copp, R.P., Wisniewski, T., Hentati, F., Larnaout, A.,Ben Hamida, M., Kayden, H.J., 1999. Localization of alpha-tocopherol transfer protein in the brains of patients with ataxiawith vitamin E deficiency and other oxidative stress relatedneurodegenerative disorders. Brain Res. 822, 80–87.

Desrumaux, C., Deckert, V., Athias, A., Masson, D., Lizard, G.,Palleau, V., Gambert, P., Lagrost, L., 1999. Plasma phospholipidtransfer protein prevents vascular endothelium dysfunction bydelivering alpha-tocopherol to endothelial cells. FASEB J. 13,883–892.

Desrumaux, C., Risold, P.Y., Schroeder, H., Deckert, V., Masson, D.,Athias, A., Laplanche, H., Le Guern, N., Blache, D., Jiang, X.C.,Tall, A.R., Desor, D., Lagrost, L., 2005. Phospholipid transferprotein (PLTP) deficiency reduces brain vitamin E content andincreases anxiety in mice. FASEB J. 19, 296–297.

Dinesen, B., Clausen, J., 1976. The influence of vitamin E deficiencyand combined deficiency in vitamin E and polyunsaturatedfatty acids on the biosynthesis and degradation of rat centralnervous system myelin. Nutr. Metab. 20, 95–111.

Feingold, I.B., Longhurst, P.A., Colby, H.D., 1993. Regulation ofadrenal and hepatic alpha-tocopherol content by androgensand estrogens. Biochim. Biophys. Acta 1176, 192–196.

Gohil, K., Schock, B.C., Chakraborty, A.A., Terasawa, Y., Raber, J.,Farese Jr., R.V., Packer, L., Cross, C.E., Traber, M.G., 2003. Geneexpression profile of oxidant stress and neurodegeneration intransgenic mice deficient in alpha-tocopherol transfer protein.Free Radic. Biol. Med. 35, 1343–1354.

Gohil, K., Godzdanker, R., O'Roark, E., Schock, B.C., Kaini, R.R.,Packer, L., Cross, C.E., Traber, M.G., 2004. Alpha-tocopheroltransfer protein deficiency in mice causes multi-organderegulation of gene networks and behavioral deficits withage. Ann. N. Y. Acad. Sci. 1031, 109–126.

Gohil, K., Oommen, S., Vasu, V.T., Aung, H.H., Cross, C.E., 2007.Tocopherol transfer protein deficiency modifies nuclearreceptor transcriptional networks in lungs: modulation bycigarette smoke in vivo. Mol. Aspects Med. 28, 453–480.

Goti, D., Hrzenjak, A., Levak-Frank, S., Frank, S., van derWesthuyzen, D.R., Malle, E., Sattler, W., 2001. Scavengerreceptor class B, type I is expressed in porcine brain capillaryendothelial cells and contributes to selective uptake ofHDL-associated vitamin E. J. Neurochem. 76, 498–508.

Goti, D., Balazs, Z., Panzenboeck, U., Hrzenjak, A., Reicher, H.,Wagner, E., Zechner, R., Malle, E., Sattler, W., 2002. Effects oflipoprotein lipase on uptake and transcytosis of low density

175B R A I N R E S E A R C H 1 2 0 1 ( 2 0 0 8 ) 1 6 7 – 1 7 6

lipoprotein (LDL) and LDL-associated alpha-tocopherol in aporcine in vitro blood–brain barrier model. J. Biol. Chem. 277,28537–28544.

Gotoda, T., Arita, M., Arai, H., Inoue, K., Yokota, T., Fukuo, Y.,Yazaki, Y., Yamada, N., 1995. Adult-onset spinocerebellardysfunction caused by a mutation in the gene for thealpha-tocopherol-transfer protein. N. Engl. J. Med. 333,1313–1318.

Hosomi, A., Goto, K., Kondo, H., Iwatsubo, T., Yokota, T.,Ogawa, M., Arita, M., Aoki, J., Arai, H., Inoue, K., 1998.Localization of alpha-tocopherol transfer protein in rat brain.Neurosci. Lett. 256, 159–162.

Huuskonen, J., Olkkonen, V.M., Jauhiainen, M., Ehnholm, C., 2001.The impact of phospholipid transfer protein (PLTP) on HDLmetabolism. Atherosclerosis 155, 269–281.

Hyland, S., Muller, D., Hayton, S., Stoecklin, E., Barella, L., 2006.Cortical gene expression in the vitamin E-deficient rat: possiblemechanisms for the electrophysiological abnormalities ofvisual and neural function. Ann. Nutr. Metab. 50, 433–441.

Jiang, X.C., Tall, A.R., Qin, S., Lin, M., Schneider, M., Lalanne, F.,Deckert, V., Desrumaux, C., Athias, A., Witztum, J.L., Lagrost, L.,2002. Phospholipid transfer protein deficiency protectscirculating lipoproteins from oxidation due to the enhancedaccumulation of vitamin E. J. Biol. Chem. 277, 31850–31856.

Kaempf-Rotzoll, D.E., Traber, M.G., Arai, H., 2003. Vitamin E andtransfer proteins. Curr. Opin. Lipidol. 14, 249–254.

Kempna, P., Zingg, J.M., Ricciarelli, R., Hierl, M., Saxena, S., Azzi, A.,2003. Cloning of novel human SEC14p-like proteins: ligandbinding and functional properties. Free Radic. Biol. Med. 34,1458–1472.

Leonard, S.W., Terasawa, Y., Farese Jr., R.V., Traber, M.G., 2002.Incorporation of deuterated RRR- or all-rac-alpha-tocopherolin plasma and tissues of alpha-tocopherol transfer protein-nullmice. Am. J. Clin. Nutr. 75, 555–560.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative geneexpression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods 25, 402–408.

Lopez-Torres, M., Thiele, J.J., Shindo, Y., Han, D., Packer, L., 1998.Topical application of alpha-tocopherol modulates theantioxidant network and diminishes ultraviolet-inducedoxidative damage in murine skin. Br. J. Dermatol. 138, 207–215.

Mardones, P., Rigotti, A., 2004. Cellular mechanisms of vitamin Euptake: relevance in alpha-tocopherol metabolism andpotential implications for disease. J. Nutr. Biochem. 15,252–260.

Mardones, P., Strobel, P., Miranda, S., Leighton, F., Quinones, V.,Amigo, L., Rozowski, J., Krieger, M., Rigotti, A., 2002.Alpha-tocopherol metabolism is abnormal in scavengerreceptor class B type I (SR-BI)-deficient mice. J. Nutr. 132,443–449.

Mariotti, C., Gellera, C., Rimoldi, M., Mineri, R., Uziel, G., Zorzi, G.,Pareyson, D., Piccolo, G., Gambi, D., Piacentini, S., Squitieri, F.,Capra, R., Castellotti, B., Di Donato, S., 2004. Ataxia withisolated vitamin E deficiency: neurological phenotype, clinicalfollow-up and novel mutations in TTPA gene in Italianfamilies. Neurol. Sci. 25, 130–137.

Markwell, M.A., Haas, S.M., Bieber, L.L., Tolbert, N.E., 1978. Amodification of the Lowry procedure to simplify proteindetermination in membrane and lipoprotein samples. Anal.Biochem. 87, 206–210.

Meier, R., Tomizaki, T., Schulze-Briese, C., Baumann, U.,Stocker, A., 2003. The molecular basis of vitamin E retention:structure of human alpha-tocopherol transfer protein. J. Mol.Biol. 331, 725–734.

Muller-Schmehl, K., Beninde, J., Finckh, B., Florian, S.,Dudenhausen, J.W., Brigelius-Flohe, R., Schuelke, M., 2004.Localization of alpha-tocopherol transfer protein in trophoblast,fetal capillaries' endothelium and amnion epithelium of humanterm placenta. Free Radic. Res. 38, 413–420.

Muller, D.P., Lloyd, J.K., Wolff, O.H., 1983. Vitamin E andneurological function. Lancet 1, 225–228.

Nelson, 1980. Pathology of vitamin E deficiency. In: Machlin, L.J.(Ed.), Vitamin E. Marcel Dekker, New York.

Ni, J., Pang, S.T., Yeh, S., 2007. Differential retention ofalpha-vitamin E is correlated with its transporter geneexpression and growth inhibition efficacy in prostate cancercells. Prostate 67, 463–471.

Nishida, Y., Yokota, T., Takahashi, T., Uchihara, T., Jishage, K.,Mizusawa, H., 2006. Deletion of vitamin E enhances phenotypeof Alzheimer disease model mouse. Biochem. Biophys. Res.Commun. 350, 530–536.

Reboul, E., Klein, A., Bietrix, F., Gleize, B., Malezet-Desmoulins, C.,Schneider, M., Margotat, A., Lagrost, L., Collet, X., Borel, P., 2006.Scavenger receptor class B type I (SR-BI) is involved invitamin E transport across the enterocyte. J. Biol. Chem. 281,4739–4745.

Reeves, P.G., Rossow, K.L., Lindlauf, J., 1993. Development andtesting of the AIN-93 purified diets for rodents: results ongrowth, kidney calcification and bone mineralization in ratsand mice. J. Nutr. 123, 1923–1931.

Reich, E.E., Montine, K.S., Gross, M.D., Roberts II, L.J., Swift, L.L.,Morrow, J.D., Montine, T.J., 2001. Interactions betweenapolipoprotein E gene and dietary alpha-tocopherol influencecerebral oxidative damage in aged mice. J. Neurosci. 21,5993–5999.

Schneider, C., 2005. Chemistry and biology of vitamin E. Mol. Nutr.Food Res. 49, 7–30.

Schuelke, M., Mayatepek, E., Inter, M., Becker, M., Pfeiffer, E.,Speer, A., Hubner, C., Finckh, B., 1999. Treatment of ataxia inisolated vitamin E deficiency caused by alpha-tocopheroltransfer protein deficiency. J. Pediatr. 134, 240–244.

Sen, C.K., Khanna, S., Roy, S., 2007. Tocotrienols in health anddisease: the other half of the natural vitamin E family. Mol.Aspects Med. 28, 692–728.

Spector, R., Johanson, C.E., 2007. Vitamin transport andhomeostasis inmammalian brain: focus on Vitamins B and E. J.Neurochem. 103, 425–438.

Srivastava, R.A., 2003. Scavenger receptor class B type I expressionin murine brain and regulation by estrogen and dietarycholesterol. J. Neurol. Sci. 210, 11–18.

Stocker, A., Azzi, A., 2000. Tocopherol-binding proteins: theirfunction and physiological significance. Antioxid. RedoxSignal. 2, 397–404.

Tamaru, Y., Hirano, M., Kusaka, H., Ito, H., Imai, T., Ueno, S., 1997.alpha-Tocopherol transfer protein gene: exon skipping of alltranscripts causes ataxia. Neurology 49, 584–588.

Tanito, M., Yoshida, Y., Kaidzu, S., Chen, Z.H., Cynshi, O.,Jishage, K., Niki, E., Ohira, A., 2007. Acceleration of age-relatedchanges in the retina in alpha-tocopherol transfer protein nullmice fed a Vitamin E-deficient diet. Invest. Ophthalmol. Vis.Sci. 48, 396–404.

Terasawa, Y., Ladha, Z., Leonard, S.W., Morrow, J.D., Newland, D.,Sanan, D., Packer, L., Traber, M.G., Farese Jr., R.V., 2000.Increased atherosclerosis in hyperlipidemic mice deficient inalpha -tocopherol transfer protein and vitamin E. Proc. Natl.Acad. Sci. U. S. A. 97, 13830–13834.

Towfighi, J., 1981. Effects of chronic vitamin E deficiency on thenervous system of the rat. Acta Neuropathol. (Berl) 54, 261–267.

Traber, M.G., Arai, H., 1999. Molecular mechanisms of vitamin Etransport. Annu. Rev. Nutr. 19, 343–355.

Traber, M.G., Ingold, K.U., Burton, G.W., Kayden, H.J., 1988.Absorption and transport of deuterium-substituted2R,4′R,8′R-alpha-tocopherol in human lipoproteins. Lipids 23,791–797.

Ubbink, J.B., Hayward Vermaak, W.J., Bissbort, S., 1991. Rapidhigh-performance liquid chromatographic assay for totalhomocysteine levels in human serum. J. Chromatogr. 565,441–446.

176 B R A I N R E S E A R C H 1 2 0 1 ( 2 0 0 8 ) 1 6 7 – 1 7 6

Vatassery, G.T., Angerhofer, C.K., Knox, C.A., 1984a. Effect of ageon vitamin E concentrations in various regions of the brainand a few selected peripheral tissues of the rat, and on theuptake of radioactive vitamin E by various regions of rat brain.J. Neurochem. 43, 409–412.

Vatassery, G.T., Angerhofer, C.K., Knox, C.A., Deshmukh, D.S., 1984b.Concentrations of vitamin E in various neuroanatomical regionsand subcellular fractions, and the uptake of vitamin E by specificareas, of rat brain. Biochim. Biophys. Acta 792, 118–122.

Vatassery, G.T., Angerhofer, C.K., Peterson, F.J., 1984c. Vitamin Econcentrations in the brains and some selected peripheraltissues of selenium-deficient and vitamin E-deficient mice.J. Neurochem. 42, 554–558.

Vatassery, G.T., Smith, W.E., Quach, H.T., 1993. A liquidchromatographicmethod for the simultaneousdeterminationofalpha-tocopherol and tocopherolquinone in human red bloodcells and other biological samples where tocopherol is easilyoxidized during sample treatment. Anal. Biochem. 214, 426–430.

Vatassery, G.T., Quach, H.T., Smith, W.E., Krick, T.P., Ungar, F.,1997. Analysis of hydroxy and keto cholesterols in oxidizedbrain synaptosomes. Lipids 32, 101–107.

Vatassery, G.T., Bauer, T., Dysken, M., 1999. High doses of vitaminE in the treatment of disorders of the central nervous system inthe aged. Am. J. Clin. Nutr. 70, 793–801.

Vatassery, G.T., Lam, C., Smith, W.E., Quach, H.T., 2006.Apolipoprotein E exerts selective and differential control overvitamin E concentrations in different areas of mammalianbrain. J. Neurosci. Res. 84, 1335–1342.

Yokota, T., Igarashi, K., Uchihara, T., Jishage, K., Tomita, H.,Inaba, A., Li, Y., Arita, M., Suzuki, H., Mizusawa, H., Arai, H.,2001. Delayed-onset ataxia in mice lacking alpha-tocopheroltransfer protein: model for neuronal degeneration caused bychronic oxidative stress. Proc. Natl. Acad. Sci. U. S. A. 98,15185–15190.

Yokota, T., Wada, Y., Furukawa, T., Tsukagoshi, H., Uchihara, T.,Watabiki, S., 1987. Adult-onset spinocerebellar syndromewith idiopathic vitamin E deficiency. Ann. Neurol. 22,84–87.

Yokota, T., Shiojiri, T., Gotoda, T., Arai, H., 1996. Retinitispigmentosa and ataxia caused by a mutation in the gene forthe alpha-tocopherol-transfer protein. N. Engl. J. Med. 335,1770–1771.